The Environmental Obesogen Bisphenol a Promotes Adipogenesis by Increasing the Amount of 11B-Hydroxysteroid Dehydrogenase Type 1 in the Adipose Tissue of Children

Home , Obesogen

ORIGINAL ARTICLE The environmental obesogen bisphenol A promotes adipogenesis by increasing the amount of 11b-hydroxysteroid dehydrogenase type 1 in the adipose tissue of children

J Wang1, B Sun2, M Hou1,XPan3 and X Li1,3

BACKGROUND: Bisphenol A (BPA) is considered as an environmental obesogen. The enzyme 11b-hydroxysteroid dehydrogenase type 1 (11b-HSD1) converts the inactive hormone cortisone to the active hormone cortisol in adipose tissues and promotes adipogenesis. OBJECTIVE: To examine whether environmentally relevant concentrations of BPA could increase the expression of 11b-HSD1, as well as that of the adipogenesis-related genes peroxisome proliferator-activated receptor-g (PPAR-g) and lipoprotein lipase (LPL), in the adipose tissue of children. METHODS: Omental fat biopsies were obtained from 17 children (7 boys and 10 girls between 3 and 13 years of age) undergoing abdominal surgery. The effects of BPA (10 nM,1mM, and 80 mM)on11b-HSD1, PPAR-g and LPL mRNA expression, and 11b-HSD1 enzymatic activity in adipose tissue and adipocytes were assessed in vitro. Moreover, the effects of carbenoxolone (CBX), an 11b-HSD1 inhibitor, or RU486, a glucocorticoid (GC) receptor antagonist, on 11b-HSD1, PPAR-g and LPL mRNA expression were assessed in human visceral preadipocytes and adipocytes. RESULTS: BPA, even at the lowest concentration tested (10 nM), increased the mRNA expression and enzymatic activity of 11b-HSD1 in the omental adipose tissue samples and the visceral adipocytes. Similar effects on PPAR-g and LPL mRNA expression and lipid accumulation were observed in the adipocytes. CBX treatment inhibited the stimulatory effects of BPA (at 10 nM)on PPAR-g and LPL mRNA expression, whereas RU486 inhibited 11b-HSD1 mRNA expression in the adipocytes. CONCLUSION: BPA, at environmentally relevant levels, increased the mRNA expression and enzymatic activity of 11b-HSD1 by acting upon a GC receptor, which may lead to the acceleration of adipogenesis.

International Journal of Obesity (2013) 37, 999–1005; doi:10.1038/ijo.2012.173; published online 23 October 2012 Keywords: 11b-HSD1; adipose tissue; adipogenesis; bisphenol A; children

INTRODUCTION the impact of BPA have investigated links between BPA and earlier The incidence of obesity has risen dramatically over the past onset of puberty and altered reproductive function.8 These studies decade. Despite a concerted effort to understand the underlying have also raised concerns about the impact of BPA on mechanisms, the causes of this epidemic remain unclear. adiposity.9,10 BPA has been reported to enhance preadipocyte Although most attention has been focused on high-calorie diets differentiation and lipid accumulation in mature adipocytes. BPA and sedentary lifestyles as the root causes, there is increasing has also been reported to alter several metabolic functions interest in the role of environmental factors. The increase in rates through the expression of transcription factors and adipocyte- of obesity was preceded by an exponential increase in synthetic speciﬁc genes, such as adiponectin in adipose tissue explants and chemical production.1 This association has led to the ‘the CAAT enhancer-binding protein-a, peroxisome proliferator- environmental obesogen hypothesis’. activated receptor-g (PPAR-g), and lipoprotein lipase (LPL) in Bisphenol A (BPA) is an environmental endocrine-disrupting 3T3-L1 cells.11–13 These studies provide evidence that supports a chemical that is used commercially in products containing role for BPA as an obesogen. However, whether BPA at polycarbonate plastics, such as toys and food and beverage environmentally relevant concentrations (the low nanomolar containers, and as an additive in other plastics.2 Children are more range) also has this activity has not been examined. susceptible to this environmental pollutant than are adults. For Glucocorticoids (GCs) have an important role in the regulation example, BPA is leached from baby bottles during dishwashing, of adipocyte differentiation, lipid synthesis and metabolism.14,15 boiling and brushing.3 Accumulating evidence indicates The GC enzyme 11b-hydroxysteroid dehydrogenase type 1 (11b- widespread human exposure to BPA, which has been detected HSD1) converts inactive GCs to active corticosterone or cortisol, in human plasma, urine, and breast milk.4–7 Notably, the prenatal which combines with the GC receptor (GR) to amplify local GC and neonatal periods represent a more vulnerable window of action.16 The potential importance of pre-receptor GC metabolism exposure than adolescence and adulthood.6 Previous studies on in metabolic syndromes is supported by studies using transgenic

1Department of Children’s Health Care, Nanjing Children’s Hospital Nanjing Medical University, Nanjing, China; 2Department of General Surgery, Nanjing Children’s Hospital Nanjing Medical University, Nanjing, China and 3Institute of Pediatric Research, Nanjing Children’s Hospital, Nanjing Medical University, Nanjing, China. Correspondence: Professor X Li, Institute of Pediatric Research, Nanjing Children’s Hospital, Nanjing Medical University, 72 Guangzhou Road, Nanjing 210008, China. E-mail: [email protected] Received 25 April 2012; revised 11 September 2012; accepted 14 September 2012; published online 23 October 2012 BPA increases 11b-HSD1 in children adipose tissue J Wang et al 1000 mice that overexpress 11b-HSD1 in adipose tissue.14 The from the collected biopsies. The adipose tissue was washed with sterile overexpression of 11b-HSD1 in adipose tissue is also associated 0.9% NaCl and cut into small pieces (3–4 mm3) using sharp scissors. The with obesity and related metabolic disorders in human adults and tissue fragments were placed in six-well dishes (100–150 mg adipose tissue 17–19 per well) that contained 3 ml of M199 supplemented with 1% fetal bovine children. Moreover, the activity of 11b-HSD1 is regulated by À 1 À 1 many obesity-related factors, such as inflammatory cytokines, serum, 1 nM insulin, 100 U ml penicillin, 100 mgml streptomycin and 25 mM IBMX. Medium containing a low level of IBMX is more suitable for insulin-sensitising thiazolidinediones (PPAR-g agonists) and sex adipose tissue growth and gene expression.21,25 After preincubation in a steroids.20,21 Additionally, GC levels are important regulators of humidified incubator at 37 1C under an atmosphere of 95 O2 and 5% CO2 PPAR-g, CAAT enhancer-binding protein, leptin, 11b-HSD1, for 24 h, the medium was removed, and 3 ml of fresh medium without 22,23 adiponectin and LPL expression. Taken together, these IBMX was dispensed into each well. To evaluate the possible effect of BPA observations strongly suggest that the overexpression of 11b- on 11b-HSD1 mRNA expression and enzymatic activity ex vivo, adipose HSD1 in adipose tissue has a causal role in visceral obesity and tissue pieces were incubated with BPA at different doses (10 nM,1mM,or that local GC production is tightly associated with obesity-related 80 mM) with respect to control samples for 24 h. At the end of the biofactors. incubation, the adipose tissue was immediately transferred to tubes and 1 The aim of this study was to examine whether exposure to BPA stored at À 70 C until further analysis. could increase the expression of 11b-HSD1 in adipose tissue and thus accelerate the potential for childhood obesity. Therefore, we HPA-v cells culture and differentiation assessed the effects of BPA at micromolar to nanomolar levels on HPA-v cells were grown to confluence in a six-well plate containing the gene expression, and enzymatic activity of 11b-HSD1 in standard medium supplemented with 5% fetal bovine serum, 1% omental adipose tissue samples from children. In addition, we preadipocyte growth supplement and 1% penicillin/streptomycin solution examined the capacity of BPA to promote lipid accumulation and in PAM. One day after reaching confluence, the cells were treated for 2 days with preadipocyte differentiation medium, which contained 1 mM to increase the mRNA levels of PPAR-g and LPL in human visceral À 1 DEX, 100 nM insulin, 100 U ml penicillin and streptomycin, and 0.5 mM adipocytes as a molecular indicator of adipogenesis progression. IBMX in PAM. Subsequently, the medium was removed, and the cells were cultured for 2 additional days in preadipocyte differentiation medium containing 1 mM rosiglitazone. This medium was replaced every MATERIALS AND METHODS other day with PAM supplemented with 100 nM insulin. The effect of BPA Materials on the expression of 11b-HSD1 mRNA was determined by the addition of 10 nM,1mM, and 80 mM BPA into the medium at different stages: (1) Preadipocyte medium (PAM) and human visceral preadipocytes (HPA-v) proliferation (day 0) for 24 h, and (2) differentiation (days 4–18) for 14 days that were isolated from human visceral fat tissue were both obtained from following the hormonal induction of differentiation. The cells were ScienCell Research Laboratories (San Diego, CA, USA). Medium 199 (M199) harvested in 1 ml of TRIzol to measure mRNA expression and stored at was obtained from Life Technologies (Invitrogen, Carlsbad, CA, USA). Insulin, À 70 1C until further analysis. penicillin, streptomycin, 3-isobutyl-1-methylxanthine (IBMX), rosiglitazone, To evaluate the mechanism of BPA action, CBX, the 11b-HSD1 inhibitor, BPA, carbenoxolone (CBX), mifepristone (RU486) and dexamethasone (DEX) and mifepristone (RU486), the GR antagonist, were used. At the were obtained from Sigma (Sigma-Aldrich, Saint Louis, MO, USA). Oil-red proliferation stage, 100 nM RU486 alone or combination with 10 nM BPA O powder and TRIzol were obtained from Invitrogen. was added in the medium for 24 h, and the cells were harvested. DEX (100 nM) was included as a positive control in the experiment. On day 6, Subjects after initiation of differentiation, the medium was replaced with medium The study protocol was approved by the Ethical Committee of Nanjing containing 2 mM CBX, and the cells were incubated for 1 h. Subsequently, Medical University in China (NO. 2006-1201). Informed consent was the plates were replenished with 2 ml of the medium containing 2 mM CBX provided by the parents of all of the children involved. None of the or containing a combination of 2 mM CBX with 10 nM BPA for 14 days, and children had any type of endocrine disorder, malignancy or severe the cells were harvested as described above. systemic illness. Furthermore, none of the children were taking any medication or had a family history of diabetes. Omental fat biopsies were Assessment of lipid accumulation in differentiated adipocytes obtained from 7 boys (with an age range from 3 to 10 years) and 10 girls The lipid accumulation of differentiated adipocytes was determined using (with an age range from 3 to 13 years) undergoing surgery for abdominal Oil-red O staining. The cells were washed with phosphate-buffered saline disorders. These disorders included four cases of appendicitis, five cases of (PBS) and fixed with 3.7% (w/v) paraformaldehyde in PBS for 2 min as teratoma, two cases of choledochocyst, two cases of intestinal malrotation previously described.26 The cells were incubated for 30 min with 0.5% (w/v) and four cases of an abdominal mass. Anthropometrical measurements Oil-red O in an isopropyl alcohol/water (60/40, v/v) solution and washed were carried out before surgery. The BMI values, which are calculated by twice with PBS. The percentage of lipid-positive cells was determined dividing the weight (kg) by the height squared (m2), were transformed to 24 using a Nikon Instruments TS300 inverted microscope (JEOL, Tokyo, Japan) BMI standard deviation scores (SDSs). The use of a BMI SDS corrects for as previously described.12 Three different microscopic fields ( Â 400 variation in age and gender among the children, and the BMI SDS values of magnification) per culture were photographed. The percentage of lipid- the subjects ranged from À 0.80 to 1.02, which does not indicate issues positive cells, which was calculated by dividing the number of lipid- with being overweight or obese. positive cells by the total number of cells (at least 150 cells), in each photograph was determined by two investigators. The results were Adipose tissue preparation and incubation expressed as the average value of the duplicate cultures. The biopsies (omental adipose tissue) were obtained from the children within 30 min after the start of surgery and were placed in 10 ml of serum- RNA preparation and quantification free sterile M199 media before being immediately transported to the Total RNA was isolated from cultured tissue using TRIzol according to the laboratory. All subsequent procedures were conducted under a laminar manufacturer’s protocol. The purity and the quantity of the RNA were airflow hood. Visible blood vessels and connective tissue were removed spectrophotometrically determined according to optical densities at

Table 1. The primer sequences used in the real-time PCR analysis

Gene name Forward primer (50-30) Reverse primer (50-30)

GAPDH CGGGTCGGGAGTGGGTAAT AGTCGCCGTGCCTACCAT 11b-HSD1 TCCAGGGTCAATGTATCAATCACT GACTATCCCAGAAACTGCCTTCA PPAR-g ATGTCTCATAATGCCATCAGGTT TCTCCGCCAACAGCTTCT LPL GTGGCCAAATAGCACATCCT CCGAAAGATCCAGAATTCCA

International Journal of Obesity (2013) 999 – 1005 & 2013 Macmillan Publishers Limited BPA increases 11b-HSD1 in children adipose tissue J Wang et al 1001 260 nM and 280 nm. The integrity of the RNA was verified through the ethidium bromide staining of the rRNA bands, which were separated on a 1% agarose gel. The RNA was stored at À 70 1C until further use. Quantitative real-time PCR was used to determine the relative mRNA levels of 11b-HSD1, PPAR-g and LPL. The complementary DNA was synthesised using M-MLV reverse transcriptase (Promega, Southampton, UK) with 1.0 mg of the RNA sample as described by the manufacturer. The PCR amplification on a subset of the complementary DNA samples using glyceraldehyde-3-phosphate dehydrogenase primers confirmed successful reverse transcription. The sequences of the primers are listed in Table 1. Real-time PCR was performed using the SYBR GREEN ABI Prism 7500 (Foster City, CA, USA) sequence detector with the following cycling parameters: 50 1C for 2 min, 95 1C for 10 min, 40 cycles of 95 1C for 15 s, and 60 1C for 1 min. The mRNA levels were normalised to the corresponding glyceraldehyde-3-phosphate dehydrogenase mRNA levels. The data were analysed Figure 1. The effects of BPA on 11b-HSD1, PPAR-g, and LPL mRNA using the 2 À DD Ct method.27 expression in adipose tissue. The results are expressed as the fold increase relative to the control value (without BPA treatment), and the bars represent the mean±s.e. (n ¼ 17 independent experiments 11b-HSD1 enzymatic activity measurements in triplicate). *P 0.05 compared with the control; #P 0.05 o w o The enzymatic activity of 11b-HSD1 in the homogenised samples was compared with BPA at 10 nM; Po0.05 compared with BPA at 1 mM. measured in the dehydrogenase direction, which is more stable than the reductase direction.28 The enzymatic activity was measured as described previously.21,29 Briefly, adipose tissue (40–50 mg) was homogenised in homogenisation buffer (10% glycerol, 300 mM NaCl, 1 mM EDTA, 50 mM Tris (pH 7.4)) that contained dithiothreitol (1 mM), and samples were centrifuged at 4 1C. Protein concentration was determined using a Pierce bicinchoninic acid protein assay kit with BSA as a standard (Pierce Biotechnology, Thermo Fisher Scientific, Rockford, IL, USA). The assay tubes contained supernatant of the homogenised samples (0.987 mg ml À 1 3 protein), NADP (2 mM) and ( H)cortisol (50 nM). After incubation in a shaking water bath at 37 1C for 12 h, the reaction was interrupted. The steroids were extracted with ethylacetate, dried, dissolved in ethanol, separated by thin-layer chromatography (mobile-phase chloroform to ethanol, 92:8) and exposed to a Phosphorimager tritium screen (GE Healthcare, Europe GmbH, Freiburg, Germany). The thin-layer chromatography plates were then scanned and quantified using a Typhoon scanner (GE Healthcare, Europe). The results are expressed as the percentage of the substrate (cortisol) converted into the product (cortisone). Figure 2. The effect of BPA on 11b-HSD1 enzymatic activity in adipose tissue. 11b-HSD1 dehydrogenase activity was measured. Statistical analysis The results are expressed as the of the conversion of the substrate The Statistical Package for Social Sciences software (version 13.0; SPSS Inc., (cortisol, F) converted into the product (cortisone, E). The bars Chicago, IL, USA) was used. All values are presented as the mean±s.e. represent the mean±s.e. (n ¼ 6 independent experiment). *Po0.05 # Significant differences among different treatments were analysed using a compared with the control; Po0.05 compared with BPA at 1 mM. one-way analysis of variance followed by a post-hoc Fisher’s least significance difference test. The differences in expression of 11b-HSD1 between pre- and mature adipocytes were assessed using Student’s t-test for the same treatments. A value of Po0.05 was considered to be significant.

RESULTS There were no signiﬁcant differences in the expression level of 11b-HSD1 after BPA stimulation between samples collected from children of differing BMI SDSs or gender. Therefore, the BMI SDSs and gender were not considered in the subsequent analyses.

Effects of BPA on 11b-HSD1, PPAR-g and LPL mRNA expression, and 11b-HSD1 dehydrogenase activity in the adipose tissue of children The omental biopsies from children were incubated with BPA at concentrations of 10 nM,1mM and 80 mM. The expression of 11b- HSD1 increased to a similar level in the biopsies treated with all BPA concentrations examined (Figure 1). The expression of PPAR-g Figure 3. The effects of BPA on 11b-HSD1 mRNA expression in HPA-v and LPL mRNA increased with BPA stimulation, and the highest preadipocytes and adipocytes. The results are expressed as the fold expression was observed at 80 mM BPA (Figure 1). The enzymatic increase relative to the control (without BPA in preadipocytes), and ± activity of 11b-HSD1 in the omental adipose tissue exhibited a the bars represent the mean s.e. (n ¼ 3 independent experiments in triplicate). *Po0.05 compared with the control; #Po0.05 U-shaped curve in response to BPA; higher activity was observed w compared with BPA at 10 nM; P 0.05 compared with BPA at 1 mM; y o at 10 nM and 80 mM, and no change was observed at 1 mM when Po0.05 compared with preadipocytes at the same BPA dose. compared with the control without BPA treatment (Figure 2).

Effects of BPA on 11b-HSD1, PPAR-g and LPL mRNA expression 1 mM in both HPA-v preadipocytes and adipocytes. Moreover, and lipid accumulation in HPA-v cells 11b-HSD1 mRNA expression was higher in adipocytes than in 11b-HSD1 mRNA expression also exhibited a similar response to preadipocytes, when exposed to BPA at the same concentration BPA; higher expression was observed at 10 nM and 80 mM than at (Figure 3).

& 2013 Macmillan Publishers Limited International Journal of Obesity (2013) 999 – 1005 BPA increases 11b-HSD1 in children adipose tissue J Wang et al 1002 At terminal differentiation, the cells displayed a rounded shape, 11b-HSD1 in adipocytes, BPA at 10 nM and 80 mM also increased which is characteristic of mature adipocytes, and most of the cells PPAR-g and LPL mRNA expression (Figure 4b). in the treatment wells contained several cytoplasmic lipid droplets (Figure 4a). Oil-red O staining revealed lipid droplets in B45% of cells in the untreated cultures. Lipid droplets were found in 67, 49 Effects of CBX and BPA treatment on 11b-HSD1, PPAR-g and and 89% of cells treated with BPA at concentrations of 10 nM,1mM LPL mRNA expression in HPA-v adipocytes and 80 mM , respectively. BPA at the low and high concentrations CBX (inhibitor of 11b-HSD1) was added on day 6, and the effect caused a signiﬁcant increase in the percentage of lipid-positive was examined on day 18. Oil-red O staining showed that the cells compared with the control. Similar to the expression of percentage of lipid-positive cells was lower in cultures stimulated

Figure 4. The effects of BPA on the lipid accumulation (a) and mRNA expression of PPAR-g and LPL (b) in HPA-v adipocytes. At terminal differentiation, the lipid accumulation in the adipocytes was determined using Oil-red O staining under a Nikon Instruments TS300 inverted microscope ( Â 400 magniﬁcation, the scale bar represents 50 mm). The mRNA levels are expressed as the fold increase relative to the control, and the bars represent the mean±s.e. (n ¼ 3 independent experiments in triplicate). *P 0.05 compared with the control; #P 0.05 compared w o o with BPA at 10 nM; Po0.05 compared with BPA at 1 mM.

International Journal of Obesity (2013) 999 – 1005 & 2013 Macmillan Publishers Limited BPA increases 11b-HSD1 in children adipose tissue J Wang et al 1003

Figure 5. The effects of BPA and CBX treatment on lipid accumulation (a) and mRNA expression of 11b-HSD1, PPAR-g and LPL mRNA expression (b) in HPA-v adipocytes. The lipid accumulation in the adipocytes was determined using Oil-red O staining under a Nikon Instruments TS300 inverted microscope ( Â 400 magniﬁcation, the scale bar represents 50 mm). The mRNA levels are expressed as the fold increase relative to the control, and the bars represent the mean±s.e. (n ¼ 3 independent experiments in triplicate). *Po0.05 compared with the control; #Po0.05, compared with BPA treatment alone.

with BPA and CBX than in those stimulated with BPA alone (46 vs DISCUSSION 72%; Figure 5a). The BPA-induced mRNA expression of 11b-HSD1 This study showed that BPA, even at environmentally relevant was inhibited by adding CBX (Figure 5b). The BPA-induced mRNA (very low) concentrations, could increase 11b-HSD1 mRNA expression of PPAR-g and LPL was also completely blocked with expression and enzymatic activity in adipose tissue samples CBX treatment. isolated from children and in HPA-v cells (preadipocytes and adipocytes). Similar effects were found on PPAR-g and LPL mRNA expression. These data support the hypothesis that BPA-mediated Effect of BPA and GR agonist treatment on 11b-HSD1 mRNA regulation of 11b-HSD1 could promote preadipocyte differentia- expression in HPA-v preadipocytes tion and adipogenesis, accelerating obesity during childhood. The GR has an important role in local GC action, and it can Previously, the effects of BPA were examined at high 30 be targeted by BPA. The effect of the GR agonist RU486 on concentrations (micromolar doses). For instance, BPA at 100 mM 11b-HSD1 mRNA expression was examined during the culture of stimulated insulin-dependent glucose uptake and increased the HPA-v preadipocytes. RU486 alone did not have any effect on expression of the glucose transporter 4 in 3T3-F442A murine 31 11b-HSD1 mRNA expression. DEX alone and BPA alone increased adipocytes. BPA at 80 mM accelerated the terminal differentiation 11b-HSD1 mRNA expression, and this increase was completely of 3T3-L1 adipocytes and increased LPL activity.12 However, BPA is inhibited by the addition of RU486 (Figure 6). found at much lower concentrations in the environment. BPA has

& 2013 Macmillan Publishers Limited International Journal of Obesity (2013) 999 – 1005 BPA increases 11b-HSD1 in children adipose tissue J Wang et al 1004 receptors,2 although the binding energy of BPA might be different for each receptor. The relative binding affinity of BPA for both oestrogen receptors is at least 10 000-fold lower than that of oestradiol,37 but BPA and other endocrine-disrupting chemicals are similar to DEX in terms of their affinity for the GR and their effects on GR activation.30,38,39 In this study, increasing 11b-HSD1 expression following exposure to 100 nM DEX or 10 nM BPA was blocked by RU486, the antagonist of the GR. This result confirmed that the BPA-stimulated expression of 11b-HSD1 in adipocytes involves the GR pathways. It should be noted that the mass of adipose tissue is limited in young children, and this study primarily focused on the mRNA levels and enzymatic activity of 11b-HSD1 in the adipose tissue of children. Future studies of obese children and infants are necessary to fully understand the impact of BPA on the development of Figure 6. The effect of BPA and RU486 treatment on the mRNA obesity and/or obesity-related metabolic complications during expression of 11b-HSD1 in HPA-v preadipocytes. The results are childhood. In particular, these studies should consider testing the expressed as the fold increase relative to the control, and the bars effects of BPA at even lower doses, such as 0.1 nM or 1 nM. represent the mean±s.e. (n ¼ 3 independent experiments in In addition, the dual activity of 11-bHSD1 (as a reductase and triplicate). *P 0.05 compared with the control; #P 0.05, compared o w o dehydrogenase) is apparent in humans. In intact cells, 11-bHSD1 with BPA at 10 nM treatment alone; Po0.05 compared with DEX at appears to prefer the reduction reaction (that is, cortisone to 100 nM treatment alone. cortisol, E to F).40 In homogenised tissue, however, 11b-oxidation is more stable than the reductase reaction.28,41 This striking been detected at concentrations between 0.2 to 20.6 ng ml À 1 in change in directionality between intact cells and the homo- humans, and the geometric mean was 2.6 ng ml À 1,7 which is genised samples has yet to be satisfactorily explained. The equivalent to B10 nM. Recently, BPA has been found to increase published enzyme kinetics data for 11b-HSD1 in homogenised 9,10 body weight and early adipogenesis in rats, and BPA (at 1 nM) adipose tissue have been measured in terms of the dehydro- was found to reduce adiponectin release from human adipose genase activity (that is, cortisol to cortisone, F to E) rather than 13 tissue. In the present work, two doses of BPA, 80 mM and 1 mM, reductase activity. This activity is proportional to total 11b-HSD1 were selected as ‘positive controls’ based on previous studies.12,30 protein present in the incubation, and there is no evidence of the These two doses most likely exceed the in vivo levels of BPA. conversion of cortisol to other metabolites. Moreover, differences Therefore, an additional dose of 10 nM was included in the present in 11b-HSD1 enzymatic activity that may arise in measuring F to E study as an environmentally relevant concentration. Our results vs E to F also remain to be studied. showed that BPA at both low and high concentrations (10 nM and 80 mM) increased 11b-HSD1 enzymatic activity in adipose tissue samples isolated from children and mRNA expression in HPA-v CONCLUSIONS preadipocytes and adipocytes. It has been estimated that In this study, we provide evidence that BPA at nanomolar increased 11b-HSD1 activity is associated with visceral adipose concentrations could upregulate 11b-HSD1 mRNA expression 32 tissue accumulation in humans. Therefore, we suggest that and accelerate adipocyte differentiation and adipogenesis in BPA exposure at environmentally relevant concentrations has humans. Given the persistence of BPA in the environment, as well the capacity to stimulate the expression and enzymatic activity of as its presence in the human body, and the increase in GC activity 11b-HSD1 in the adipose tissue of children, which may be a in adipose tissue at environmentally relevant BPA concentrations, contributing factor to childhood obesity. we suggest that the daily BPA exposure of children may be an Excessive GC regeneration could result in the accumulation of important risk factor for obesity and metabolic homoeostasis. abdominal fat due to acceleration of preadipocyte differentiation and adipogenesis,33 and 11b-HSD1 enzymatic activity amplifies local GC action by converting inactive GCs to active cortisol. We CONFLICT OF INTEREST therefore examined PPAR-g, which is a terminal differentiation The authors declare no conflict of interest. factor that is involved in preadipocyte differentiation and the modulation of several other transcription factors related to 34,35 adipogenesis. We also examined the expression of LPL and ACKNOWLEDGEMENTS the percentage of lipid-positive cells in differentiated adipocytes, This work was supported through funding from 973 Program of China 11 which are hallmarks of adipogenesis in mature adipocytes. (2013CB530604), the National Natural Science Foundation of China (81273064), the Under the same experimental conditions, BPA, even at a low Blue Project of the Jiangsu Education Department of China (JX10410533), the concentration, increased the mRNA expression of PPAR-g and LPL Scientific Research Foundation for Returned Overseas Scholars of the Ministry of and increased lipid accumulation, which is consistent with previ- Education of China (DG216G15013), and the Project Funder by the Priority Academic ous reports that DEX-induced 3T3-L1 preadipocyte differentiation Program Development of Jiangsu Higher Education Institutions. We thank the transiently increases PPAR-g expression36 and LPL activity.11 Thus, doctors in the Department of Surgery at Nanjing Children’s Hospital for collecting we suggest that exposure to BPA at environmentally relevant samples, Associate Professor Baoqing Mo (Department of Public Health, Nanjing Medical University) for help with statistical analysis, and Professor Duan Chen concentrations accelerates the terminal differentiation of adipo- (Department of Cancer Research and Molecular Medicine, Norwegian University of cytes and adipogenesis. This action was inhibited by CBX, an Science and Technology) for valuable discussions. inhibitor of 11b-HSD1 activity, suggesting that the BPA promotes preadipocyte differentiation and adipogenesis by increasing the expression of 11b-HSD1. REFERENCES The GR is an important regulator of GC-induced gene 22 15 1 Baillie-Hamilton PF. Chemical toxins: a hypothesis to explain the global obesity expression and adipogenesis in adipocytes. BPA can affect epidemic. J Altern Complement Med 2002; 8: 185–192. the endocrine pathway through binding to the GR, oestrogen 2 Rubin BS. Bisphenol A: an endocrine disruptor with widespread exposure and receptors (a and b), the androgen receptor, or endocrine-related multiple effects. J Steroid Biochem Mol Biol 2011; 127: 27–34.

International Journal of Obesity (2013) 999 – 1005 & 2013 Macmillan Publishers Limited BPA increases 11b-HSD1 in children adipose tissue J Wang et al 1005 3 Nam SH, Seo YM, Kim MG. Bisphenol A migration from polycarbonate baby bottle glucocorticoid-target genes in subcutaneous and omental human preadipocytes. with repeated use. Chemosphere 2010; 79: 949–952. J Mol Endocrinol 2006; 37: 327–340. 4 Vandenberg LN, Chahoud I, Heindel JJ, Padmanabhan V, Paumgartten FJ, 23 Spencer SJ, Tilbrook A. The glucocorticoid contribution to obesity. Stress 2011; 14: Schoenfelder G. Urinary, circulating, and tissue biomonitoring studies indicate 233–246. widespread exposure to bisphenol A. Environ Health Perspect 2010; 118: 24 Fredriks AM, van Buuren S, Wit JM, Verloove-Vanhorick SP. Body index 1055–1070. measurements in 1996-7 compared with 1980. Arch Dis Child 2000; 82: 5 Vandenberg LN, Hauser R, Marcus M, Olea N, Welshons WV. Human exposure to 107–112. bisphenol A (BPA). Reprod Toxicol 2007; 24: 139–177. 25 Gesta S, Lolmede K, Daviaud D, Berlan M, Bouloumie A, Lafontan M et al. Culture 6 Welshons WV, Nagel SC, Vom SF. Large effects from small exposures. III. Endocrine of human adipose tissue explants leads to profound alteration of adipocyte gene mechanisms mediating effects of bisphenol A at levels of human exposure. expression. Horm Metab Res 2003; 35: 158–163. Endocrinology 2006; 147: S56–S69. 26 Vankoningsloo S, Piens M, Lecocq C, Gilson A, De Pauw A, Renard P et al. Mito- 7 Calafat AM, Ye X, Wong LY, Reidy JA, Needham LL. Exposure of the U.S. population chondrial dysfunction induces triglyceride accumulation in 3T3-L1 cells: role of to bisphenol A and 4-tertiary-octylphenol: 2003-2004. Environ Health Perspect fatty acid beta-oxidation and glucose. J Lipid Res 2005; 46: 1133–1149. 2008; 116: 39–44. 27 Pfaffl MW. A new mathematical model for relative quantification in real-time RT- 8 Howdeshell KL, Hotchkiss AK, Thayer KA, Vandenbergh JG, Vom SF. Exposure to PCR. Nucleic Acids Res 2001; 29: e45. bisphenol A advances puberty. Nature 1999; 401: 763–764. 28 Monder C, Lakshmi V, Miroff Y. Kinetic studies on rat liver 11 beta-hydroxysteroid 9 Rubin BS, Murray MK, Damassa DA, King JC, Soto AM. Perinatal exposure to low dehydrogenase. Biochim Biophys Acta 1991; 1115: 23–29. doses of bisphenol A affects body weight, patterns of estrous cyclicity, and 29 Walker EA, Clark AM, Hewison M, Ride JP, Stewart PM. Functional expression, plasma LH levels. Environ Health Perspect 2001; 109: 675–680. characterization, and purification of the catalytic domain of human 11-beta - 10 Somm E, Schwitzgebel VM, Toulotte A, Cederroth CR, Combescure C, Nef S et al. hydroxysteroid dehydrogenase type 1. J Biol Chem 2001; 276: 21343–21350. Perinatal exposure to bisphenol a alters early adipogenesis in the rat. Environ 30 Sargis RM, Johnson DN, Choudhury RA, Brady MJ. Environmental endocrine dis- Health Perspect 2009; 117: 1549–1555. ruptors promote adipogenesis in the 3T3-L1 cell line through glucocorticoid 11 Masuno H, Kidani T, Sekiya K, Sakayama K, Shiosaka T, Yamamoto H et al. receptor activation. Obesity (Silver Spring) 2010; 18: 1283–1288. Bisphenol A in combination with insulin can accelerate the conversion of 3T3-L1 31 Sakurai K, Kawazuma M, Adachi T, Harigaya T, Saito Y, Hashimoto N et al. fibroblasts to adipocytes. J Lipid Res 2002; 43: 676–684. Bisphenol A affects glucose transport in mouse 3T3-F442A adipocytes. Br J 12 Masuno H, Iwanami J, Kidani T, Sakayama K, Honda K. Bisphenol a accelerates Pharmacol 2004; 141: 209–214. terminal differentiation of 3T3-L1 cells into adipocytes through the phosphati- 32 Epel ES, McEwen B, Seeman T, Matthews K, Castellazzo G, Brownell KD et al. Stress dylinositol 3-kinase pathway. Toxicol Sci 2005; 84: 319–327. and body shape: stress-induced cortisol secretion is consistently greater among 13 Hugo ER, Brandebourg TD, Woo JG, Loftus J, Alexander JW, Ben-Jonathan N. women with central fat. Psychosom Med 2000; 62: 623–632. Bisphenol A at environmentally relevant doses inhibits adiponectin release from 33 Tomlinson JW, Walker EA, Bujalska IJ, Draper N, Lavery GG, Cooper MS et al. human adipose tissue explants and adipocytes. Environ Health Perspect 2008; 116: 11Beta-hydroxysteroid dehydrogenase type 1: a tissue-specific regulator of glu- 1642–1647. cocorticoid response. Endocr Rev 2004; 25: 831–866. 14 Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, Seckl JR et al. A 34 Hutley LJ, Newell FM, Joyner JM, Suchting SJ, Herington AC, Cameron DP et al. transgenic model of visceral obesity and the metabolic syndrome. Science 2001; Effects of rosiglitazone and linoleic acid on human preadipocyte differentiation. 294: 2166–2170. Eur J Clin Invest 2003; 33: 574–581. 15 Tomlinson JW, Sherlock M, Hughes B, Hughes SV, Kilvington F, Bartlett W et al. 35 Laplante M, Sell H, MacNaul KL, Richard D, Berger JP, Deshaies Y. PPAR-gamma Inhibition of 11Beta-hydroxysteroid dehydrogenase type 1 activity in vivo limits activation mediates adipose depot-specific effects on gene expression and lipo- glucocorticoid exposure to human adipose tissue and decreases lipolysis. J Clin protein lipase activity: mechanisms for modulation of postprandial lipemia and Endocrinol Metab 2007; 92: 857–864. differential adipose accretion. Diabetes 2003; 52: 291–299. 16 Morton NM, Seckl JR. 11Beta-hydroxysteroid dehydrogenase type 1 and obesity. 36 Pantoja C, Huff JT, Yamamoto KR. Glucocorticoid signaling defines a novel Front Horm Res 2008; 36: 146–164. commitment state during adipogenesis in vitro. Mol Biol Cell 2008; 19: 17 Rask E, Walker BR, Soderberg S, Livingstone DE, Eliasson M, Johnson O et al. 4032–4041. Tissue-specific changes in peripheral cortisol metabolism in obese women: 37 Kuiper GG, Lemmen JG, Carlsson B, Corton JC, Safe SH, van der Saag PT et al. increased adipose 11beta-hydroxysteroid dehydrogenase type 1 activity. J Clin Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor Endocrinol Metab 2002; 87: 3330–3336. beta. Endocrinology 1998; 139: 4252–4263. 18 Munoz R, Carvajal C, Escalona A, Boza C, Perez G, Ibanez L et al. 11Beta- 38 Gumy C, Chandsawangbhuwana C, Dzyakanchuk AA, Kratschmar DV, Baker ME, hydroxysteroid dehydrogenase type 1 is overexpressed in subcutaneous adipose Odermatt A. Dibutyltin disrupts glucocorticoid receptor function and impairs tissue of morbidly obese patients. Obes Surg 2009; 19: 764–770. glucocorticoid-induced suppression of cytokine production. PLoS One 2008; 3: 19 Li X, Lindquist S, Chen R, Myrnas T, Angsten G, Olsson T et al. Depot-specific e3545. messenger RNA expression of 11 beta-hydroxysteroid dehydrogenase type 1 and 39 Johansson M, Johansson N, Lund BO. Xenobiotics and the glucocorticoid recep- leptin in adipose tissue of children and adults. Int J Obes (Lond) 2007; 31: 820–828. tor: additive antagonistic effects on tyrosine aminotransferase activity in rat 20 Wake DJ, Walker BR. Inhibition of 11beta-hydroxysteroid dehydrogenase type 1 in hepatoma cells. Basic Clin Pharmacol Toxicol 2005; 96: 309–315. obesity. Endocrine 2006; 29: 101–108. 40 Diederich S, Grossmann C, Hanke B, Quinkler M, Herrmann M, Bahr V et al. In the 21 Zhu L, Hou M, Sun B, Buren J, Zhang L, Yi J et al. Testosterone stimulates adipose search for specific inhibitors of human 11beta-hydroxysteroid-dehydrogenases tissue 11beta-hydroxysteroid dehydrogenase type 1 expression in a depot- (11beta-HSDs): chenodeoxycholic acid selectively inhibits 11beta-HSD-I. specific manner in children. J Clin Endocrinol Metab 2010; 95: 3300–3308. Eur J Endocrinol 2000; 142: 200–207. 22 Bujalska IJ, Quinkler M, Tomlinson JW, Montague CT, Smith DM, Stewart PM. 41 Stewart PM. 11 Beta-hydroxysteroid dehydrogenase: implications for clinical Expression profiling of 11beta-hydroxysteroid dehydrogenase type-1 and medicine. Clin Endocrinol (Oxf) 1996; 44: 493–499.

& 2013 Macmillan Publishers Limited International Journal of Obesity (2013) 999 – 1005