Greetings to All on Behalf of My Mother Land India
Agronomic Investigation of New Microbial Isolates as Biofertilizers in Sweet Potato (Ipomoea batatas L. Lam) Grown in an Ultisol of India K. Susan John, Neetha Soma John and I.P. Anjana Devi Central Tuber Crops Research Institute (CTCRI) (Indian Council of Agricultural Research), Thiruvananthapuram, Kerala, India, email: [email protected] ALL INDIA NET WORK ON TUBER CROPS Started during 1968
14 10 6 7 11 1. TNAU, Coimbatore 13 2. ANGRAU, Hyderabad 4 8 3. KKV, Dapoli 9 4. NAU, Navasari 5. IGKV, Jagadalpur 5 17 6. NDUA&T, Faizabad 7. RAU, Dholi 3 2 8. BAU, Ranchi 9. BCKV, Kalyani 15 10. AAU, Jorhat 11. ICAR RC NEH, Shillong 12. CARI, Port Blair 1 13. CAU, Imphal 14. MPUAT, Udaipur 16 12 15. UAS, Dharwad 16. CTCRI, HQ 17. CTCRI, RC The sole institute in the world exclusively dedicated to research on Tropical Tuber Crops
Head quarters Thiruvananthapuram, Regional centre Bhubaneswar, Kerala Orissa
Research carried out under 5 Divisions Division of Crop Improvement Division of Crop Production Division of Crop Protection Division of Crop Utilization Section of Social Sciences Sweet potato( Ipomoea batatas Lam L.) Cassava( Manihot esculenta Crantz)
Elephant foot yam(Amorphophallus paeonifolius)
Yams(Dioscorea sp.) (Coleus rotundifolius) Taro(Colocasia sp.)
Arrowroot(Maranta arundinaceae) Tannia (Xanthosoma sagittifolium) MANDATE
¾ To undertake basic, strategic and applied research for generating technologies to enhance productivity and utilisation potential of tuber crops viz., cassava, sweet potato, yams, aroids (EFY, taro, tannia), coleus and yam bean (other than potato)
¾ To act as a national repository of scientific information on tuber crops
¾ To coordinate network research with State Agricultural Universities for generating location specific technologies
¾ To act as a centre of human resources development for various clientele systems involved in tuber crops research and development
¾ To undertake transfer of tuber crops technologies through consultancy, outreach programmes and linkage with developmental agencies "Greater emphasis on tuberous crops such as potato, tapioca and sweet potato to make them available at cheaper rates"
Dr. A P J Abdul Kalam (Former president of India) ALL INDIA NET WORK ON TUBER CROPS Started during 1968
14 10 6 7 11 1. TNAU, Coimbatore 13 2. ANGRAU, Hyderabad 4 8 3. KKV, Dapoli 9 4. NAU, Navasari 5. IGKV, Jagadalpur 5 17 6. NDUA&T, Faizabad 7. RAU, Dholi 3 2 8. BAU, Ranchi 9. BCKV, Kalyani 15 10. AAU, Jorhat 11. ICAR RC NEH, Shillong 12. CARI, Port Blair 1 13. CAU, Imphal 14. MPUAT, Udaipur 16 12 15. UAS, Dharwad 16. CTCRI, HQ 17. CTCRI, RC Introduction Sweet potato is grown in the tropics and warm temperate regions of the world
Globally, grown in developing countries in an area of 9 mha having a production of 124 mt with a productivity of 13.7 t ha-1 (FAOSTAT, 2006)
China ranks first in area (4.7 m ha) and production (70 m t) with a productivity of 14 t ha-1 (FAOSTAT, 2001)
Third most important tuber crop in India after potato and cassava
India occupies 12th, 8th and 5th rank globally in terms of area, production and productivity with an area of 0.14 mha, production 1.21 mt and productivity 8.87 t ha-1(CMIE,2006)
In India, grown in Orissa, West Bengal, Uttar Pradesh, Bihar and Jharkand accounting 77% of area and 82% of production
In Kerala, it is grown in an area of 505 ha with a production of 6405 t and productivity is 12.68 t ha-1 ( Farm guide,2009) SWEET POTATO GROWING BELT OF INDIA Facts about sweet potato No. of varieties released from CTCRI-27
Propagation through vine cuttings
Method of planting-Mounds, ridges, furrows and flat beds
Nutrient management-NPK@50:25:50 kg ha-1+ FYM @5 t ha-1
Major pest- Sweet potato weevil- Mass trapping of adult weevils using sex pheromone
Post harvest utilization- Roots and leaves as human food and roots and vines as animal feed
Processed into industrial starch, alcohol, noodles and other products viz., jam, jelly, pickles, squashes etc.,
Has an average protein content comparable to that of rice (1.3-10.0% on DWB) (Purcell et al., 1972)
It is also a good source of Ca, ascorbic acid, and ß- carotene. Some sweet potato varieties released from CTCRI Sree Arun
Orange- fleshed sweet potato Orange fleshed sweet potato contains β carotene and anthocyanin which are cheap source of vitamin A and antioxidants Orange fleshed sweet potato can combat vitamin A deficiency in developing countries ( Harvest plus Programme) Sree Kanaka ST-14
β carotene 10.50 mg/100g β carotene 8 mg/100g Significance of the present study N fixers, P solubilizers and K mobilizers are the most beneficial soil microorganisms for use as biofertilizers in agriculture
The main objective of using biofertilizers is to reduce fertilizer quantity there by reduce the cost of production and an eco-friendly practice
Exploitation of agro-biodiversity for identifying useful microorganisms for nutrient management as well as biocontrol is a thrust area in the present day agriculture to substitute for chemical fertilizers and pesticides and to maintain soil health Objective To screen, isolate, identify and characterize potent N fixers and P solubilizers from the biodiversity hot spots of Western ghats of Kerala and to agronomically evaluate their efficacy as a substitute to chemical fertilizers in sweet potato to enhance growth and yield Methodology a. Microbiological work
Survey and collection of soil samples - High biodiversity hot spot areas of South India Microbial ( bacteria, fungi & actinomycetes) enumeration - Serial dilution and plate counting From the bacterial population, screening for P solubilizers - Pikovskaya’s agar media N fixers - Jensen’s nitrogen free solid medium P solubilizing capacity- Vanado molybdo phosphoric yellow colour method N fixing capacity - Kjeldhal method b. Preparation of biofertilizer
Mass multiplication of potent isolates 100 ml of the broth containing the isolates mixed with sand and charred rice husk (1:4) aseptically Sampling locations –AGASTHYAMALAI RANGES
Kulathupuzha RF
Thenmala RF Palode RF
Peppara RF Kalakkad RF Lower Kothayar RF Aryan Kau RF Kothayar RF Kollam Pechiparai RF Kottur RF Neyyar RF Kottur Extension Nagarcoil Ponmudi RF Trivandrum c. Molecular characterization of the biofertilizer microbes
Isolation of the genomic DNA (Sambrook et al. 1989)
Amplification of 16s rDNA - Forward 8F primer 5'AGAGTTTGATCCTGGCTCAG3' and reverse 1492R primer 5'CGGCTACCTTGTTACGACTT3’ (Babu et al. 2004)
Agarose Gel Electrophoresis (AGE) with 100 bp marker (NE Biolabs)
The band cut, eluted and purified using the QIA quick gel extraction kit, QIAGEN
Sequencing of the eluted product - Genei, Bangalore
Sequence analysis - National Centre of Biotechnology Information (NCBI) database -Basic Local Alignment Search Tool (BLAST) d. Agronomic investigation of the bio fertilizer efficacy
1. P solubilizer a. Controlled condition experiment in pots
No. of treatments - 9 Replication - 3 Design – CRD Initial status Organic carbon-1.36%, Available P-184 kg ha-1, Exchangeable K-159 kg ha-1 Quantity of N- 78%, Available P-0, Exchangeable K-83% of POP rate (Aiyer,Nair,1985) Treatment details of the pot experiment Treat Treatments
T1 Soil test based fertilizer (STBF) recommendation (NPK@ 39:0:41.5 kg ha‐1) T2 Package of Practice (POP) recommendation for sweet potato (NPK @ 50:25:50 kg ha‐1) T3 Phosphate solubilizing bacteria alone T4 STBF + biofertilizer (PSB) (NPK@ 39:0:41.5 kg ha‐1) T5 NK + ¼P + biofertilizer (NK @ 50:50 kgha‐1 + P@ ¼of 25 kgha‐1) T6 NK + ½P + biofertilizer (NK @ 50:50 kgha‐1+P@ ½of 25 kgha‐1) T7 NK + ¾P +biofertilizers (NK@ 50:50 kgha‐1+ P@ ¾of 25 kgha‐1) T8 NK @ 50:50 kgha‐1 + biofertilizer T9 Absolute control A View of the Pot Experiment b. Field experiment Design-RBD Treatments -12 Replication- 2 No. of seasons- 2
Treatment details
T1-STBF T2 - POP T3 - PSB -1 T4 - PSB-2
T5 - POP+PSB-1 T6 - POP+PSB-2 T7- 25 %P+ PSB-1
T8- 25 %P+ PSB-2 T9 - 50 % P + PSB-1 T10 - 50% P + PSB-2
T11 - 75% P+PSB-1 T12 - 75% P+PSB-2
N & K @50:50 kg ha-1 A View of the Field Experiment d. Agronomic investigation of the biofertilizer efficacy 1. N fixer a. Controlled condition experiments in pots No. of treatments - 8 Replication - 3 Design - CRD
Initial status Organic carbon- 0.26%, Av. P- 216.16 kg ha-1, Exch. K- 303.52 kg ha-1
Quantity of N-117%, P- 0, K- 48% of POP rate ( Aiyer and Nair,1985)
Treat. No. Treatments
T1 Soil test based ferlilizer (STBF) recommendation (NPK @ 58.5:0:24 kg ha-1) T2 POP recommendation for sweet potato (NPK@ 50:25:50 kg ha-1) T3 N fixer alone T4 N fixer + STBF ([email protected]:0:24 kg ha-1) T5 N fixer + N(3/4 of STBF), P, K (STBF) i.e. (NPK @44:0:24 kg ha-1) T6 N fixer + N(1/2 of STBF), P, K(STBF) i.e. (NPK @29.25:0:24 kg ha-1) T7 N fixer + N(1/4 of STBF), P, K(STBF) i.e. (NPK @14.6:0:24 kg ha-1) T8 Absolute control Results No. of microbes isolated- 505
No. of bacteria - 341
No. of P solubilizers - 169
No. of N fixers - 194
P solubilization efficacy of the 2 potent isolates
PSB-1- 150 µg g-1 - Enterobacter sp.
PSB-2- 112.5 µg g-1 - Pantoea agglomerans
N fixing capacity of the N fixer bacteria – 4%
- Alcaligenes feacalis Influence of P solubilizers on tuber yield of sweet potato (pot trial) Zonation of P solubilizers in Pikovskayas agar medium 16s rDNA amplified product A View of the Crop Harvest ( P solubilizer field experiment) Effect of P solubilizers on growth and yield of sweet potato ( Field experiment) (Mean of 2 seasons)
Tuber Vine Root: Soil P Tuber Vine P Harvest Treatment yield yield shoot (kg ha-1) P (%) P solublize index ( t ha-1) (t ha-1) ratio (%) rs ( x 103 cfu g-1 soil) STBF 14.34 15.42 1.57 0.610 32.09 0.234 0.547 256 POP 17.59 17.13 2.01 0.665 17.67 0.264 0.553 251 PSB -1 10.71 7.50 1.96 0.630 12.15 0.262 0.484 220 PSB-2 12.30 16.00 1.47 0.595 14.21 0.278 0.382 210 POP+PSB-1 24.92 26.25 1.48 0.595 18.22 0.428 0.551 231 POP+PSB-2 9.46 14.67 1.77 0.635 9.76 0.234 0.605 175 25 %P+ PSB-1 19.88 28.08 0.95 0.480 20.09 0.219 0.484 119 25 %P+ PSB-2 16.46 7.52 3.47 0.775 8.68 0.334 0.531 194 50 % P + PSB-1 16.42 20.38 1.42 0.585 15.72 0.253 0.568 215 50% P + PSB-2 16.00 20.54 1.60 0.610 30.57 0.352 0.711 164 75% P+PSB-1 14.29 14.38 1.49 0.595 27.11 0.184 0.395 155 75% P+PSB-2 9.75 11.17 1.01 0.495 11.82 0.267 0.309 188 CD 7.097 3.339 1.016 NS 13.06 NS NS NS Molecular characterization of N fixer Influence of N fixer on sweet potato growth
Figure 1 Influence of N fixing bacteria on growth characters of sweet potato
200 180 160 140 120 100 80
Growth characters 60 40 20 0 T1 T2 T3 T4 T5 T6 T7 T8 Treatments
Vine length(cm) Leaf number Leaf length(cm) Leaf breadth(cm) Effect of N fixers on tuber yield of sweet potato Conclusions For sweet potato, among the two P solubilizers, Enterobacter sp. was more effective
By applying the P solubilizers, P dose can be reduced to 75% of POP
By applying N fixer, N dose can be reduced to 25% of POP
Explored the beneficial effect of new microbial isolates of N fixers and P solubilizers as a substitute to chemical fertilizers
Reducing cost of production, improving P status of the soil Future Thrust areas Formulation of microbial consortium containing bio fertilizer cum bio control agents
Agronomic investigation of the bio consortium for nutrient as well as disease management for tropical tuber crops
Popularization and large scale production of the bio consortium as a component of INM strategy for major crops Acknowledgements This paper forms a part of ICAR net work project on ‘ AMAAS ( Application of Microorganisms in Agriculture and Allied Sectos’)
Funding from Indian Council of Agricultural Research
NBAIM ( National Beurea of Agriculturally Important Microorganisms) for the national level coordination of the project
Director, CTCRI, DG & DDG, ICAR for granting permission
ESA for providing an opportunity for oral presentation and for free registration and accommodation for attending the congress
Department of Biotechnology, Govt. of India for international travel grant support ThankThank youyou andand WelcomeWelcome toto GodGod’’ss OwnOwn CountryCountry