DOCSLIB.ORG

Molecular Identification of a New Isolate of Nitrogen Fixing Bacteria an Its Evaluation in Sweet Potato

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Identification of a New Isolate of Nitrogen Fixing Bacteria an Its Evaluation in Sweet Potato Greetings to All on Behalf of My Mother Land India Agronomic Investigation of New Microbial Isolates as Biofertilizers in Sweet Potato (Ipomoea batatas L. Lam) Grown in an Ultisol of India K. Susan John, Neetha Soma John and I.P. Anjana Devi Central Tuber Crops Research Institute (CTCRI) (Indian Council of Agricultural Research), Thiruvananthapuram, Kerala, India, email: [email protected] ALL INDIA NET WORK ON TUBER CROPS Started during 1968 14 10 6 7 11 1. TNAU, Coimbatore 13 2. ANGRAU, Hyderabad 4 8 3. KKV, Dapoli 9 4. NAU, Navasari 5. IGKV, Jagadalpur 5 17 6. NDUA&T, Faizabad 7. RAU, Dholi 3 2 8. BAU, Ranchi 9. BCKV, Kalyani 15 10. AAU, Jorhat 11. ICAR RC NEH, Shillong 12. CARI, Port Blair 1 13. CAU, Imphal 14. MPUAT, Udaipur 16 12 15. UAS, Dharwad 16. CTCRI, HQ 17. CTCRI, RC The sole institute in the world exclusively dedicated to research on Tropical Tuber Crops Head quarters Thiruvananthapuram, Regional centre Bhubaneswar, Kerala Orissa Research carried out under 5 Divisions Division of Crop Improvement Division of Crop Production Division of Crop Protection Division of Crop Utilization Section of Social Sciences Sweet potato( Ipomoea batatas Lam L.) Cassava( Manihot esculenta Crantz) Elephant foot yam(Amorphophallus paeonifolius) Yams(Dioscorea sp.) (Coleus rotundifolius) Taro(Colocasia sp.) Arrowroot(Maranta arundinaceae) Tannia (Xanthosoma sagittifolium) MANDATE ¾ To undertake basic, strategic and applied research for generating technologies to enhance productivity and utilisation potential of tuber crops viz., cassava, sweet potato, yams, aroids (EFY, taro, tannia), coleus and yam bean (other than potato) ¾ To act as a national repository of scientific information on tuber crops ¾ To coordinate network research with State Agricultural Universities for generating location specific technologies ¾ To act as a centre of human resources development for various clientele systems involved in tuber crops research and development ¾ To undertake transfer of tuber crops technologies through consultancy, outreach programmes and linkage with developmental agencies "Greater emphasis on tuberous crops such as potato, tapioca and sweet potato to make them available at cheaper rates" Dr. A P J Abdul Kalam (Former president of India) ALL INDIA NET WORK ON TUBER CROPS Started during 1968 14 10 6 7 11 1. TNAU, Coimbatore 13 2. ANGRAU, Hyderabad 4 8 3. KKV, Dapoli 9 4. NAU, Navasari 5. IGKV, Jagadalpur 5 17 6. NDUA&T, Faizabad 7. RAU, Dholi 3 2 8. BAU, Ranchi 9. BCKV, Kalyani 15 10. AAU, Jorhat 11. ICAR RC NEH, Shillong 12. CARI, Port Blair 1 13. CAU, Imphal 14. MPUAT, Udaipur 16 12 15. UAS, Dharwad 16. CTCRI, HQ 17. CTCRI, RC Introduction Sweet potato is grown in the tropics and warm temperate regions of the world Globally, grown in developing countries in an area of 9 mha having a production of 124 mt with a productivity of 13.7 t ha-1 (FAOSTAT, 2006) China ranks first in area (4.7 m ha) and production (70 m t) with a productivity of 14 t ha-1 (FAOSTAT, 2001) Third most important tuber crop in India after potato and cassava India occupies 12th, 8th and 5th rank globally in terms of area, production and productivity with an area of 0.14 mha, production 1.21 mt and productivity 8.87 t ha-1(CMIE,2006) In India, grown in Orissa, West Bengal, Uttar Pradesh, Bihar and Jharkand accounting 77% of area and 82% of production In Kerala, it is grown in an area of 505 ha with a production of 6405 t and productivity is 12.68 t ha-1 ( Farm guide,2009) SWEET POTATO GROWING BELT OF INDIA Facts about sweet potato No. of varieties released from CTCRI-27 Propagation through vine cuttings Method of planting-Mounds, ridges, furrows and flat beds Nutrient management-NPK@50:25:50 kg ha-1+ FYM @5 t ha-1 Major pest- Sweet potato weevil- Mass trapping of adult weevils using sex pheromone Post harvest utilization- Roots and leaves as human food and roots and vines as animal feed Processed into industrial starch, alcohol, noodles and other products viz., jam, jelly, pickles, squashes etc., Has an average protein content comparable to that of rice (1.3-10.0% on DWB) (Purcell et al., 1972) It is also a good source of Ca, ascorbic acid, and ß- carotene. Some sweet potato varieties released from CTCRI Sree Arun Orange- fleshed sweet potato Orange fleshed sweet potato contains β carotene and anthocyanin which are cheap source of vitamin A and antioxidants Orange fleshed sweet potato can combat vitamin A deficiency in developing countries ( Harvest plus Programme) Sree Kanaka ST-14 β carotene 10.50 mg/100g β carotene 8 mg/100g Significance of the present study N fixers, P solubilizers and K mobilizers are the most beneficial soil microorganisms for use as biofertilizers in agriculture The main objective of using biofertilizers is to reduce fertilizer quantity there by reduce the cost of production and an eco-friendly practice Exploitation of agro-biodiversity for identifying useful microorganisms for nutrient management as well as biocontrol is a thrust area in the present day agriculture to substitute for chemical fertilizers and pesticides and to maintain soil health Objective To screen, isolate, identify and characterize potent N fixers and P solubilizers from the biodiversity hot spots of Western ghats of Kerala and to agronomically evaluate their efficacy as a substitute to chemical fertilizers in sweet potato to enhance growth and yield Methodology a. Microbiological work Survey and collection of soil samples - High biodiversity hot spot areas of South India Microbial ( bacteria, fungi & actinomycetes) enumeration - Serial dilution and plate counting From the bacterial population, screening for P solubilizers - Pikovskaya’s agar media N fixers - Jensen’s nitrogen free solid medium P solubilizing capacity- Vanado molybdo phosphoric yellow colour method N fixing capacity - Kjeldhal method b. Preparation of biofertilizer Mass multiplication of potent isolates 100 ml of the broth containing the isolates mixed with sand and charred rice husk (1:4) aseptically Sampling locations –AGASTHYAMALAI RANGES Kulathupuzha RF Thenmala RF Palode RF Peppara RF Kalakkad RF Lower Kothayar RF Aryan Kau RF Kothayar RF Kollam Pechiparai RF Kottur RF Neyyar RF Kottur Extension Nagarcoil Ponmudi RF Trivandrum c. Molecular characterization of the biofertilizer microbes Isolation of the genomic DNA (Sambrook et al. 1989) Amplification of 16s rDNA - Forward 8F primer 5'AGAGTTTGATCCTGGCTCAG3' and reverse 1492R primer 5'CGGCTACCTTGTTACGACTT3’ (Babu et al. 2004) Agarose Gel Electrophoresis (AGE) with 100 bp marker (NE Biolabs) The band cut, eluted and purified using the QIA quick gel extraction kit, QIAGEN Sequencing of the eluted product - Genei, Bangalore Sequence analysis - National Centre of Biotechnology Information (NCBI) database -Basic Local Alignment Search Tool (BLAST) d. Agronomic investigation of the bio fertilizer efficacy 1. P solubilizer a. Controlled condition experiment in pots No. of treatments - 9 Replication - 3 Design – CRD Initial status Organic carbon-1.36%, Available P-184 kg ha-1, Exchangeable K-159 kg ha-1 Quantity of N- 78%, Available P-0, Exchangeable K-83% of POP rate (Aiyer,Nair,1985) Treatment details of the pot experiment Treat Treatments T1 Soil test based fertilizer (STBF) recommendation (NPK@ 39:0:41.5 kg ha‐1) T2 Package of Practice (POP) recommendation for sweet potato (NPK @ 50:25:50 kg ha‐1) T3 Phosphate solubilizing bacteria alone T4 STBF + biofertilizer (PSB) (NPK@ 39:0:41.5 kg ha‐1) T5 NK + ¼P + biofertilizer (NK @ 50:50 kgha‐1 + P@ ¼of 25 kgha‐1) T6 NK + ½P + biofertilizer (NK @ 50:50 kgha‐1+P@ ½of 25 kgha‐1) T7 NK + ¾P +biofertilizers (NK@ 50:50 kgha‐1+ P@ ¾of 25 kgha‐1) T8 NK @ 50:50 kgha‐1 + biofertilizer T9 Absolute control A View of the Pot Experiment b. Field experiment Design-RBD Treatments -12 Replication- 2 No. of seasons- 2 Treatment details T1-STBF T2 - POP T3 - PSB -1 T4 - PSB-2 T5 - POP+PSB-1 T6 - POP+PSB-2 T7- 25 %P+ PSB-1 T8- 25 %P+ PSB-2 T9 - 50 % P + PSB-1 T10 - 50% P + PSB-2 T11 - 75% P+PSB-1 T12 - 75% P+PSB-2 N & K @50:50 kg ha-1 A View of the Field Experiment d. Agronomic investigation of the biofertilizer efficacy 1. N fixer a. Controlled condition experiments in pots No. of treatments - 8 Replication - 3 Design - CRD Initial status Organic carbon- 0.26%, Av. P- 216.16 kg ha-1, Exch. K- 303.52 kg ha-1 Quantity of N-117%, P- 0, K- 48% of POP rate ( Aiyer and Nair,1985) Treat. No. Treatments T1 Soil test based ferlilizer (STBF) recommendation (NPK @ 58.5:0:24 kg ha-1) T2 POP recommendation for sweet potato (NPK@ 50:25:50 kg ha-1) T3 N fixer alone T4 N fixer + STBF ([email protected]:0:24 kg ha-1) T5 N fixer + N(3/4 of STBF), P, K (STBF) i.e. (NPK @44:0:24 kg ha-1) T6 N fixer + N(1/2 of STBF), P, K(STBF) i.e. (NPK @29.25:0:24 kg ha-1) T7 N fixer + N(1/4 of STBF), P, K(STBF) i.e. (NPK @14.6:0:24 kg ha-1) T8 Absolute control Results No. of microbes isolated- 505 No. of bacteria - 341 No. of P solubilizers - 169 No. of N fixers - 194 P solubilization efficacy of the 2 potent isolates PSB-1- 150 µg g-1 - Enterobacter sp. PSB-2- 112.5 µg g-1 - Pantoea agglomerans N fixing capacity of the N fixer bacteria – 4% - Alcaligenes feacalis Influence of P solubilizers on tuber yield of sweet potato (pot trial) Zonation of P solubilizers in Pikovskayas agar medium 16s rDNA amplified product A View of the Crop Harvest ( P solubilizer field experiment) Effect of P solubilizers on growth and yield of sweet potato ( Field experiment) (Mean of 2 seasons) Tuber Vine Root: Soil P Tuber Vine P Harvest
Load more

Recommended publications
  • 398-IJBCS-Article
    Available online at http://ajol.info/index.php/ijbcs Int. J. Biol. Chem. Sci. 3(5): 1100-1113, October 2009 ISSN 1991-8631 Original Paper http://indexmedicus.afro.who.int Morphoagronomical characterization of Solenostemon rotundifolius (Poir. J. K. Morton) (Lamiaceae) germplasm from Burkina Faso Romaric Kiswendsida NANEMA *, Ernest Renan TRAORE, Pauline BATIONO/KANDO and Jean-Didier ZONGO Laboratoire de Génétique et de Biotechnologie Végétales, Unité de Formation et de Recherche en Sciences de la Vie et de la Terre, Université de Ouagadougou, 03 BP 7021 Ouagadougou 03, Burkina Faso. * Corresponding author, E-mail: [email protected], Telephone: 00226 78 84 67 65 ABSTRACT Solenostemon rotundifolius or country potato is a tropical multipurpose tuber crop species. It has been one of the staple crops in West Africa but currently, its genetic resources are in a process of disappearing. Characterization of S. rotundifolius genetic variability is recognized as a prior intervention to support a sustainable conservation and use of its genetic resources. For identifying suitable descriptors for S. rotundifolius , a morphoagronomical characterization was carried out on 155 cultivars from Burkina Faso. A total of 50 morphological traits (16 qualitative and 34 quantitative) related to the foliage, the cycle and the tubers were scored. The results showed variability within cultivars for the foliage, the cycle and the potential yield (number and weight of tubers). However, no significant variability was found for tubers size. Cultivars from different geographical origin discriminated for the cycle and the potential yield. Significant correlations were found between the cycle, the foliage and the potential yield. Most of the qualitative morphological traits were shown to be varietal criteria.
    [Show full text]
  • Status of Paliga Auratalis (Lepidoptera: Crambidae) As Black
    ORIGINAL RESEARCH ARTICLE Current Research on Biosciences and Biotechnology 2 (2) 2021 121-125 Current Research on Biosciences and Biotechnology www.crbb-journal.com Status of Paliga auratalis (Lepidoptera: Crambidae) as black potato pest and its control strategy using natural enemies Erniwatia*, Tiara Sayustib, Woro Anggraitoningsih Noerdjitoa aZoology Division, Research Center for Biology, Indonesian Institute of Science, bAnimal Bioscience Program, Department of Biology, IPB University ABSTRACT Plectranthus rotundifolius (Lamiales: Lamiaceae) is an edible tuber that is widely distributed in Article history: Asia, covering India, Sri Lanka, Malaysia, and Indonesia. P. rotundifolius, which is commonly Received 23 Jul 2020 called black potato in Indonesia, has the potential to be developed for national food Revised 19 Dec 2020 diversification due to its high carbohydrates. However, one of the challenges in black potato Accepted 13 Jan 2021 cultivation is the existence of leaf-eating caterpillar. This study aimed to evaluate the status of Available online 28 Feb 2021 Paliga auratalis (Lepidoptera: Crambidae) larva as an insect pest in black potato plant and to develop the control strategy by using parasitoid as the natural enemies. Observation and Keywords: collection of P. auratalis and other potential insect pests were conducted in 12 black potato plantations located in five provinces of Java island. The life cycle of P. auratalis was observed Paliga auratalis in the laboratory of Zoology Division, Research Centre for Biology, Indonesian Institute of Plectranthus rotundifolius Cryptopimpla Science. Rearing of unhealthy P. auratalis larvae was also conducted to observe the parasitoid. insect pest We identified five moth larvae species that infested black potato plants: Argyrograma sp., parasitoid Pycnarmon cribata, Pleuroptya punctimarginalis, Rehimena diemenalis, and Paliga auratalis.
    [Show full text]
  • Pharmacognostical Study of Coleus Rotundifolius L
    European Journal of Biotechnology and Bioscience European Journal of Biotechnology and Bioscience ISSN: 2321-9122; Impact Factor: RJIF 5.44 Received: 23-04-2019; Accepted: 26-05-2019 www.biosciencejournals.com Volume 7; Issue 4; July 2019; Page No. 48-49 Pharmacognostical study of Coleus rotundifolius L Pratima Patel1, M Salim2, Jay Singh Patel3 1, 3 Research Scholar, Department of Botany, S.G.S. Govt. P.G. College, Sidhi, A.P.S. Univ, Rewa, Madhya Pradesh, India 2 Professor, Department of Botany, S.G.S. Govt. P.G. College, Sidhi, Madhya Pradesh, India Abstract Coleus rotundifolius L. belonging to the family Lamiaceae commonly known as Patharchur in Hindi, It is a large succulent aromatic perennial herb. The leaves of this plant have been used in malarial fever, hepatopathy, renal and vesicle calculi, cough, chronic asthma, hiccough, bronchitis, anthelmintic, colic and convulsions. This paper deals with the pharmacognostical evaluation of leaves, stems and roots of Coleus rotundifolius by using different parameters. Keywords: Coleus rotundifolius, Phytoconsituents, carbohydrates, leaf extract, traditional Introduction Preliminary phytochemical screening It is a large succulent aromatic perennial herb. Much Preliminary phytochemical screening was carried out by branched, fleshy highly aromatic pubescent herb with using standard procedure described by Kokate et al. (1986) distinctive smelling leaves. The plant is distributed through [11]. Total phenol content of the extracts was determined by out India, cultivated in the gardens. It is a folkloric using the Folin-Ciocalteu method (Sadasivam snd Manikam, medicinal plant used to treat malarial fever, hepatopathy, 1992) [12]. Total flavonoid content was determined as (Kirtikar and Basu, 1971) [1] renal and vesical calculi, described by Singleton & Rossi (1965) [13].
    [Show full text]
  • Phytochemical Screening of Coleus Rotundifolius L. Leaf Extract
    International Journal of Advanced Science and Research International Journal of Advanced Science and Research ISSN: 2455-4227; Impact Factor: RJIF 5.12 Received: 21-04-2019; Accepted: 23-05-2019 www.allsciencejournal.com Volume 4; Issue 4; July 2019; Page No. 48-49 Phytochemical screening of Coleus rotundifolius L. leaf extract Pratima Patel1, M Salim2, Jay Singh Patel3 1, 3 Research Scholar (Botany), S.G.S. Govt. P.G. College, Sidhi, A.P.S. Univ. Rewa Madhya Pradesh, India 2 Professor of Botany, S.G.S. Govt. P.G. College, Sidhi Madhya Pradesh, India Abstract Coleus rotundifolius L. is highly medicinal plant of family Lamiaceae. It is used in various traditional diseases. In the present study a chemical test performed against the, all the phytochemical constituents for their preliminary screening of each solvent extract of leaf like water, methanol, chloroform, ethyl acetate, and acetone. From the phytochemical investigation of the leaf extracts; the result is revealed the presence of carbohydrates, glycosides, tannins, flavonoids, triterpenoids, and lipids in all the solvent extracts. But phenols are more retain in methanolic leaf extract remain all the phytochemical constituents. Keywords: Coleus rotundifolius, phytoconsituents, carbohydrates, leaf extract, traditional Introduction Preliminary phytochemical screening Since long the tribal peoples and research scholars have Preparation of the leaf extract been exploring the nature particularly plants and plant The healthy and disease-free mature leaves of plant of compounds searching of new medicines. This has resulted in Coleus rotundifolius L. material were collected and two the use of huge number of medicinal plants and times washed thoroughly under running pump water, shade phytochemical with curative properties to treat different dried leaves in open air separately.
    [Show full text]
  • Nomenclatural Changes in Coleus and Plectranthus (Lamiaceae): a Tale of More Than Two Genera
    Nomenclatural changes in Coleus and Plectranthus (Lamiaceae): a tale of more than two genera Article Published Version Creative Commons: Attribution 4.0 (CC-BY) Open access Paton, A., Mwyanyambo, M., Govaerts, R. H.A., Smitha, K., Suddee, S., Phillipson, P. B., Wilson, T. C., Forster, P. I. and Culham, A. (2019) Nomenclatural changes in Coleus and Plectranthus (Lamiaceae): a tale of more than two genera. PhytoKeys, 129. pp. 1-158. ISSN 1314–2003 doi: https://doi.org/10.3897/phytokeys.129.34988 Available at http://centaur.reading.ac.uk/86484/ It is advisable to refer to the publisher’s version if you intend to cite from the work. See Guidance on citing . To link to this article DOI: http://dx.doi.org/10.3897/phytokeys.129.34988 Publisher: Pensoft All outputs in CentAUR are protected by Intellectual Property Rights law, including copyright law. Copyright and IPR is retained by the creators or other copyright holders. Terms and conditions for use of this material are defined in the End User Agreement . www.reading.ac.uk/centaur CentAUR Central Archive at the University of Reading Reading’s research outputs online A peer-reviewed open-access journal PhytoKeys 129:Nomenclatural 1–158 (2019) changes in Coleus and Plectranthus: a tale of more than two genera 1 doi: 10.3897/phytokeys.129.34988 RESEARCH ARTICLE http://phytokeys.pensoft.net Launched to accelerate biodiversity research Nomenclatural changes in Coleus and Plectranthus (Lamiaceae): a tale of more than two genera Alan J. Paton1, Montfort Mwanyambo2, Rafaël H.A. Govaerts1, Kokkaraniyil Smitha3, Somran Suddee4, Peter B. Phillipson5, Trevor C.
    [Show full text]
  • The Acquisition of Medicinal Plant Knowledge: a Cross-Cultural Survey
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Masters Theses Graduate School 5-1990 The Acquisition of Medicinal Plant Knowledge: A Cross-Cultural Survey Anna Ruth Dixon University of Tennessee, Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_gradthes Part of the Anthropology Commons Recommended Citation Dixon, Anna Ruth, "The Acquisition of Medicinal Plant Knowledge: A Cross-Cultural Survey. " Master's Thesis, University of Tennessee, 1990. https://trace.tennessee.edu/utk_gradthes/4163 This Thesis is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Masters Theses by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a thesis written by Anna Ruth Dixon entitled "The Acquisition of Medicinal Plant Knowledge: A Cross-Cultural Survey." I have examined the final electronic copy of this thesis for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Master of Arts, with a major in Anthropology. Michael H. Logan, Major Professor We have read this thesis and recommend its acceptance: Benita Howell, Jefferson Chapman Accepted for the Council: Carolyn R. Hodges Vice Provost and Dean of the Graduate School (Original signatures are on file with official studentecor r ds.) To the Graduate Council: I am submitting herewith a thesis written by Anna Ruth Dixon entitled "The Acquisition of Medicinal Plant Knowledge: a Cross-Cultural Survey." I have examined the final copy of this thesis for form and content and recommend tht it be accepted in partial fulfillment of the requirements for the degree of Master of Arts, with a major in Anthropology.
    [Show full text]
  • Intoduction to Ethnobotany
    Intoduction to Ethnobotany The diversity of plants and plant uses Draft, version November 22, 2018 Shipunov, Alexey (compiler). Introduction to Ethnobotany. The diversity of plant uses. November 22, 2018 version (draft). 358 pp. At the moment, this is based largely on P. Zhukovskij’s “Cultivated plants and their wild relatives” (1950, 1961), and A.C.Zeven & J.M.J. de Wet “Dictionary of cultivated plants and their regions of diversity” (1982). Title page image: Mandragora officinarum (Solanaceae), “female” mandrake, from “Hortus sanitatis” (1491). This work is dedicated to public domain. Contents Cultivated plants and their wild relatives 4 Dictionary of cultivated plants and their regions of diversity 92 Cultivated plants and their wild relatives 4 5 CEREALS AND OTHER STARCH PLANTS Wheat It is pointed out that the wild species of Triticum and rela­ted genera are found in arid areas; the greatest concentration of them is in the Soviet republics of Georgia and Armenia and these are regarded as their centre of origin. A table is given show- ing the geographical distribution of 20 species of Triticum, 3 diploid, 10 tetraploid and 7 hexaploid, six of the species are endemic in Georgia and Armenia: the diploid T. urarthu, the tetraploids T. timopheevi, T. palaeo-colchicum, T. chaldicum and T. carthlicum and the hexaploid T. macha, Transcaucasia is also considered to be the place of origin of T. vulgare. The 20 species are described in turn; they comprise 4 wild species, T. aegilopoides, T. urarthu (2n = 14), T. dicoccoides and T. chaldicum (2n = 28) and 16 cultivated species. A number of synonyms are indicated for most of the species.
    [Show full text]
  • Characterisation of Three Morphotypes of Solenostemon Rotundifolius [(Poir.) JK Morton]
    Vol. 11(2), pp. 6-15, July-December 2019 DOI: 10.5897/IJGMB2019.0171 Article Number: 126BFC061420 ISSN 2006-9863 Copyright © 2019 International Journal of Genetics and Molecular Author(s) retain the copyright of this article http://www.academicjournals.org/IJGMB Biology Full Length Research Paper Characterisation of three morphotypes of Solenostemon rotundifolius [(Poir.) J. K. Morton] cultivated in Burkina Faso using quantitative traits Romaric Kiswendsida NANEMA1*, Zakaria KIEBRE1, Renan Ernest TRAORE1, Aminata Hamidou BA1 and Francis KUSI2 1Department of Plant Biology and Plant Physiology, Faculty of Earth and Life Sciences, University Ouaga I Pr Joseph Ki-Zerbo, P. O. Box 7021 Ouagadougou, Burkina Faso. 2CSIR-Savanna Agricultural Research Institute, Manga Agriculture Station, P. O. Box 46 Bawku, UER, Ghana. Received 29 October, 2018; Accepted 25 June, 2019 Evaluation of intra specific variability is a key step toward conservation and sustainable use of species. This study was carried out to describe the morphotypes of Solenostemon rotundifolius (Lamiaceae) based on quantitative traits. Three accessions (E02, E35 and E20), representing the morphotypes “A”, “B” and “C” were characterised in Randomised Complete Block Design with three replications. Twenty- four (24) traits related to the cycle, the canopy size, the production and the tuber size were measured. Analysis of variance (ANOVA) revealed significant difference of the morphotypes (at level P = 0.05 or 0.01) in the traits related to the canopy and leaf size, the crop cycle, the production and the tuber size. The morphotype “A” was identified to be the most promising one. It was early maturing (107 to 113 days) and the most productive (134.98 g per plant).
    [Show full text]
  • Potentials of Hausa Potato (Solenostemon Rotundifolius (Poir.) J
    ISSN: 2354-2306 Potentials of Hausa Potato (Solenostemon rotundifolius (Poir.) J. K. Morton and Management of its Tuber Rot in Nigeria By Enyiukwu D. N . Awurum A. N. Nwaneri J. A. Greener Journal of Agronomy, Forestry and Horticulture ISSN: 2354-2306 Vol. 2 (2), pp. 027-037, April 2014. Review Article Potentials of Hausa Potato (Solenostemon rotundifolius (Poir.) J. K. Morton and Management of its Tuber Rot in Nigeria *1Enyiukwu D. N., 1Awurum A. N. and 2Nwaneri J. A. 1Department of Plant Health Management, Michael Okpara University of Agriculture, Umudike, P.M.B 7269 Umuahia, Abia State Nigeria. 2Lesser and Minor Root Crops Unit, National Root Crop Research Institute Umudike, PMB 7006 Umuahia, Abia State, Nigeria. *Corresponding Author’s Email: [email protected], Tel: +234 803 744 6891 ABSTRACT Solenostemon rotundifolius (Poir) J. K. Morton commonly called Hausa potato in Nigeria, is a herbaceous, annual crop, with distinctive fragrance and peculiar tuber taste. Ethnomedicinally, leaves of the crop are used to treat dysentery, blood in urine and eye disorders. The tubers are eaten as a main starchy staple or part of it in combination with legumes, vegetables or cereals. The crop which is popular in the middle belt and Northeastern Nigeria, is constrained by edaphic factors, extremes of climatic variables and biotic pressures resulting in tiny tuber formations, tuber branching, low yields and poor tuber storability due to rots and poor storage methods. Amongst these, rots have been identified as the greatest constraint; followed by dearth of documented information on proper methods of its storage. Synthetic fungicides are veritable agents of fungal rot control; however their use is being de- emphasized due to ecological and human health concerns occasioned by residues in crops as well as development of resistance to chemical control agents in pathogens.
    [Show full text]
  • ISTA List of Stabilized Plant Names 6Th Edition
    ISTA List of Stabilized Plant Names 6th Edition ISTA Nomenclature Committee Chair: Dr. J. H. Wiersema Published by All rights reserved. No part of this publication may The International Seed Testing Association (ISTA) be reproduced, stored in any retrieval system or Zürichstr. 50, CH-8303 Bassersdorf, Switzerland transmitted in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, ©2014 International Seed Testing Association (ISTA) without prior permission in writing from ISTA. ISBN 978-3-906549-77-4 ISTA List of Stabilized Plant Names 1st Edition 1966 ISTA Nomenclature Committee Chair: Prof. P. A. Linehan 2nd Edition 1983 ISTA Nomenclature Committee Chair: Dr. H. Pirson 3rd Edition 1988 ISTA Nomenclature Committee Chair: Dr. W. A. Brandenburg 4th Edition 2001 ISTA Nomenclature Committee Chair: Dr. J. H. Wiersema 5th Edition 2007 ISTA Nomenclature Committee Chair: Dr. J. H. Wiersema 6th Edition 2013 ISTA Nomenclature Committee Chair: Dr. J. H. Wiersema ii 6th Edition 2013 ISTA List of Stabilized Plant Names Contents Contents Preface ...................................................... iv L ................................................................41 Acknowledgements .................................... v M ...............................................................46 Symbols and abbreviations ....................... vi N ...............................................................50 ISTA List of Stabilized Plant Names ........... 1 O ...............................................................51
    [Show full text]
  • Dictionary of Medicinal Plants - Scientific Names, Family and Selected Vernacular (English, Sinhala, Sanskrit and Tamil) Names
    Dictionary of Medicinal Plants - Scientific Names, Family and Selected Vernacular (English, Sinhala, Sanskrit and Tamil) Names Dictionary of Medicinal Plants - Scientific Names, Family and Selected Vernacular (English, Sinhala, Sanskrit and Tamil) Names India . United Kingdom Author(s) Sri Ranjani Sivapalan1 and Vinotha Sanmugarajah1* 1University of Jaffna, Sri Lanka. *Corresponding author: E-mail: [email protected]; FIRST EDITION 2019 ISBN 978-93-89246-90-2 (Print) ISBN 978-93-89246-91-9 (eBook) DOI: 10.9734/bpi/mono/978-93-89246-90-2 _________________________________________________________________________________ © Copyright 2019 The Author(s), Licensee Book Publisher International, This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Contents Dedication i Preface ii INTRODUCTION 1 Botanical Names Ab – Az 2-13 Ba – Bu 13-16 Ca – Cy 16-34 Da – Du 34-37 Ec – Ex 37-41 Fa – Fr 41-43 Ga – Gy 43-45 Ha – Hy 45-49 Ic – Ix 49-52 Ja – Ju 52-53 Ka – Ky 53 La – Ly 53-56 Ma – My 56-61 Ne – Ny 61-62 Oc – Os 62-63 Pa – Pu 63-67 Ra – Ru 67-68 Sa – Sy 68-73 Ta – Tr 73-74 Ur – Ut 75 Va – Vi 75-76 Wa – Wr 76-77 Xa – Xy 77-78 Za – Zo 78 REFERENCES 79-82 DEDICATION This book is dedicated to our beloved Bhagawan Sri Sathiya Sai Baba's divine lotus feet. i ii Preface Any plants which provide health promoting characteristics, temporary relief or curative properties are known as Medicinal plants.
    [Show full text]
  • Dictionary of Cultivated Plants and Their Centres of Diversity A.C. Zeven
    Dictionary of cultivated plants and their centres of diversity Excluding ornamentals, forest trees and lower plants A.C. Zeven and P.M. Zhukovsky ,$ Centre for Agricultural Publishing and Documentation Wageningen -1975 ISBN 90 220 0549 6 O Centre for Agricultural Publishing and Documentation, Wageningen, 1975 No part of this book may be reproduced and published in any form, by print, photoprint, microfilm or any other means without written permission from the publishers Cover design: Pudoc, Wageningen Printed in the Netherlands by Krips Repro, Meppel Contents Preface 7 History of the work 8 Origins of agriculture and plant domestication 9 Cradles of agriculture and centres of diversity 18 1. Chinese-Japanese Centre 27 2. Indochinese-Indonesian Centre 42 3. Australian Centre 57 4. Hindustani Centre 62 5. Central Asian Centre 71 6. Near Eastern Centre 77 7. Mediterranean Centre 91 8. African Centre 107 9. European-Siberian Centre 129 10. South American Centre 144 11. Central American and Mexican Centre 162 12. North American Centre 173 Species with a not identified centre 180 References 182 Index of botanical names Preface The aim of the work is to give the reader quick reference to the Centre of diversity of a cultivated plant species. For some important crops, the Centre of diversity of related wild species is also presented. These wild species are important sources of genes useful to man when incorporated in cultivated crops. Hence such wild species have to be included in genitor collections for breeding. For some cultivated species, the region of diversity could not be identified. Future research may show where they have come from.
    [Show full text]