Effective Control of Antibiotic Resistance in Cheese and Characterization of a Dairy

Enterococcus faecium Isolate Carrying a Persistent, TA-independent Tetracycline

Resistance-encoding Plasmid

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Xinhui Li, B.Eng, M.S.

Graduate Program in Food Science and Nutrition

The Ohio State University

2011

Dissertation Committee:

Hua Wang, Co-Advisor

Valente Alvarez, Co-Advisor

John Gunn

Zhongtang Yu

Xinhui Li

2011

iii

Abstract

The prevalence of antibiotic resistant (ART) bacteria in ready-to-eat foods including cheese products has been a major public health concern. The objectives of this study were to determine critical control points (CCP) in cheese fermentation for effective mitigation, and to characterize an ART isolate from the dairy environment to reveal potential mechanism(s) involved in the development, maintenance and dissemination of antibiotic resistance (AR).

Pilot plant studies indicated that pasteurization effectively reduced ART bacteria in milk and AR can be effectively minimized and controlled with proper sanitation and processing controls. ART bacteria were not significantly amplified during ripening.

However, antibiotic facilitated the proliferation of ART bacteria by inhibiting the growth of starter cultures, suggesting rapid and sufficient growth of starter cultures for acid production was important to control AR during chess making process. Results of assessing samples from commercial cheese manufacturing facilities indicated that approximately 104 CFU/ml of Tetr bacteria were found in a manufacturer-maintained starter/adjunct culture vat and representative isolates were identified to be Streptococcus thermophilus (tet(S)). Additional identified AR gene (tet(S), tet(M) and tet(L)) carriers included Streptococcus spp., Leuconostoc sp., Staphylococcus sp., Lactococcus sp., and

Lactobacillus sp., from cheese samples collected during the manufacturing process.

ii Results from a small scale survey indicated that the overall quantities of AR genes by real-time PCR in retail cheese products purchased in 2010 reduced compared to those from 2006, suggesting the effectiveness of targeted AR mitigation in related products.

A dairy Enterococcus faecium isolate M7M2 carrying both tet(M) and tet(L) genes was further characterized and both tet(M) and tet(L) genes were found to be located on a 19.6 kb plasmid, which was stable (99% retaining rate) in the absence of antibiotic selective pressure after consecutive transfer for more than 500 generations. The tet(M)-tet(L) gene cluster was successfully transferred to and lead to acquired resistance in Enterococcus faecalis OG1RF by electroporation and Streptococcus mutans UA159 by natural transformation. DNA sequence analysis revealed that the 19.6kb plasmid contained 21 ORFs, which included a 10.6 kb backbone, which was highly homologous

(99.9%) to the reported plasmid pRE25, but without the identified toxin-antitoxin (TA) plasmid stabilization mechanism. The derived backbone plasmid without the tetracycline resistance determinants exhibited 100% retention rate in the presence of acridine orange, suggesting the presence of a TA-independent, plasmid stabilization mechanism, with its impact on the persistence of a broad spectrum of resistance-encoding traits to be elucidated. Quantitative real-time RT-PCR indicated induced transcription of both tet(M) and tet(L) genes by tetracycline in pM7M2. E. faecium M7M2 also formed biofilms on stainless steel coupons as assessed by scanning electron microscopy, suggesting potential persistence of the strain in the environment.

The CCP identified in this study included pasteruzation, rapid growth of starter culture and proper maintenance of manufacturer-maintained cultures, which provided important information for controlling AR in dairy industry and reducing AR exposure

iii from fermented dairy foods. Characteristics of E. faecium M7M2 provided essential information for the development of counter strategies for AR mitigation.

Acknowledgements

I want to thank my adviser, Dr. Hua Wang, for her advice and support throughout the four years when I study in OSU and do research in her lab.

I would like to thank advisor Dr. Valente Alvarez for his advice and his help for my dissertaion porject. I also really enjoyed working with him in the fermentation class.

I would like to thank Dr. Zhongtang Yu for providing support when we have difficulties.

I would also like to thank Dr. John Gunn, from whom I have really learned a lot.

I want to thank Gary Wenneker, who has helped me a lot to accomplish the project.

I want to thank all my labmates in these four years: Yingli Li, Hanna Cortado, Dan

Kinkelaar, Lu Zhang, Monchaya Rattanaprasert, Linlin Xiao, Xiaojing Li, Andrew

Wassinger and Ying Huang for their support and encouragement.

The study was supported by OARDC seed grant #OHOA1084 and Dairy Management

Inc. grant OSURF project #60010225. We sincerely thank industry participants for their collaboration.

Vita

January 1982 ...... Born, Wuhan, Hubei, China

2004...... B.Eng, Pharmaceutical Engineering,

South China University of Technology

2007...... M.S., Biochemistry and Molecular Biology,

South China University of Technology

2007 to present ...... Graduate Teaching Associate and

Graduate Research Associate,

The Ohio State University

Publications

Peer-reviewed articles:

Li, X., L. Shi, W. Yang, L. Li, and S. Yamasaki. 2006. New array of aacA4-catB3-dfrA1 gene cassettes and a noncoding cassette from a class-1-integron positive clinical strain of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 50:2278–2279.

He, Y., L. Shi, S. Yamasaki, X. Li, Y. Cao, L. Li, L. Yang, and S. Miyoshi. 2007. A plasmidic class 1 Integron from five Pseudomonas aeruginosa clinical strains harbored aacA4 and Nonsense-mutated cmlA1 Gene Cassettes. J. Health Sci. 53:750-755.

Su, J., L. Shi, L. Yang, Z. Xiao, X. Li, and S. Yamasaki. 2006. Analysis of integrons in clinical isolates of Escherichia coli in China during the last six years. FEMS Microbiol Lett. 254:75–80.

vi Presentations at national conferences:

Li, X., V. Alvarez, H.H. Wang. 2010. Characterization of an antibiotic resistant Enterococcus faecium strain from a fermented dairy product. IFT annual meeting abstarct book, Chicago, IL. Page 84, No. 037-41.

Li, X., Y. Li, V. Alvarez, W.J. Harper, H.H. Wang. 2009. Critical control points to minimize antibiotic resistance contamination in cheese products. IFT annual meeting abstract book. Anaheim, CA. Page 104, No. 200-12.

Li, X., Y. Li, V. Alvarez, W.J. Harper, H.H. Wang. 2008. Stability of antibiotic resistant Enterococcus sp. in the dairy fermentation environment. International association for food protection (IAFP) annual meeting abstract book, Columbus OH. Page 82, No. P2-18.

Li, X., H.H. Wang. 2008. Prevalence of antibiotic resistance in selected seafood and fermented dairy products. ASM general meeting abstract book, Boston, MA. Page 190, P-136. .

Fields of Study

Major Field: Food Science and Nutrition

vii

Table of Contents

Abstract ...... ii

Acknowledgements ...... v

Vita ...... vi

List of Tables ...... x

List of Figures ...... xi

Chapter

1. Introduction ...... 1

2. Literature Review ...... 7

2.1 History of antibiotics ...... 7 2.2 Applications of antibiotics ...... 9 2.3 Mode of action ...... 10 2.4 Antibiotic resistance (AR) and its mechanisms ...... 12 2.5 Origins of AR ...... 15 2.6 AR dissemination ...... 17 2.7 Persistence of AR ...... 22 2.8 Tetracycline and tetracycline resistance ...... 23 2.9 AR in the food chain ...... 25 2.10 AR in cheese products ...... 28 2.11 Cheese fermentation and microbial dynamics ...... 29 2.12 Enterococci and ART enterococci in food ...... 34

3. Dissertation Objectives ...... 49

4. Determination of Critical Control Points to Control Antibiotic Resistance in Cheese Making Process in Pilot Plant Settings ...... 51

4.1 Abstract ...... 51 4.2 Introduction ...... 52 4.3 Materials and methods ...... 54 4.4 Results ...... 59 viii 4.5 Discussion ...... 65 4.6 References ...... 66

5. Determination of Critical Control Points for Antibiotic Resistant Bacteria Mitigation in Commercial Cheese Manufacturing Facilities ...... 69

5.1 Abstract ...... 69 5.2 Introduction ...... 70 5.3 Materials and methods ...... 71 5.4 Results ...... 75 5.5 Discussion ...... 79 5.6 References ...... 81

6. Characterization of a Dairy Enterococcus faecium Isolate Carrying a Persistent, TA-independent Tetracycline Resistance-encoding Plasmid ...... 84

6.1 Abstract ...... 84 6.2 Introduction ...... 85 6.3 Materials and methods ...... 88 6.4 Results ...... 94 6.6 Acknowledgement ...... 117 6.7 References ...... 117

7. Summary and Conclusions ...... 123

Bibliography ...... 126

Appendix A. Neclutide sequence of pM7M2 ...... 141

List of Tables

Table Page

5.1 Primers and probes used in this study ...... 73

5.2 Identified AR genes and AR gene carriers from cheese plant samples ...... 76

6.1 Amino acid and nucleotide identities of putative proteins encoded by pM7M2

...... 100

List of Figures

Figure Page

2.1 Simplified outline of cheese making process ...... 30

4.1 Dynamics of total bacterial counts and ART bacteria counts during Cheddar type cheese making ...... 60

4.2 Dynamics of ART bacterial counts during ripening of cheese, made with thermophilic starter spiked with Tetr E. faeciums and tetracycline...... 62

4.3 Total bacterial counts (A) and increasing of Tetr bacterial counts (B, ratio of

Tetr bacterial count to original inoculum) of different tubes after different incubation periods ...... 64

5.1 Correlation between bacterial counts of E. faecium M7M2 and tet(M) gene copy no. assessed by real-time quantitative PCR of spiked cheese samples...... 77

5.2 Assessment of antibiotic resistance in commercial cheese samples by conventional plate counting and real-time PCR ...... 79

6.1 Restriction enzyme digestion of E. faecium M7M2 plasmid extract ...... 95

6.2 Electrophoresis and Southern hybridization of M7M2 plasmid and its

transformants of E. faecalis OG1RF and S. mutans UA159...... 96

6.3 Circular map of plasmid pM7M2 ...... 99

xi 6.4 RT-PCR products of tet(M), tet(L) and ddl ...... 110

6.5 Relative quantification of tet(M) and tet(L) transcripts under 8, 16 and 32 compared to 0 μg/ml tetracycline ...... 111

6.6 SEM assessment of biofilm structure development by E. faecium M7M2...113

xii

CHAPTER 1

Introduction

Since the discovery of antibiotics, they have been universally used in the treatment of bacterial infections. However, the misuse of antibiotics, like prescribing antibiotics for non-bacterial infection, is also a common occurrence. In addition, antibiotics are widely used in animals both in veterinary medicine and agricultural livestock (Teuber, 2001; United States General Accounting Office, 2004). In food animal production, antibiotics are not only used to treat diseases, but also to control the spread of disease, prevent disease, and promote animal growth (United States General Accounting

Office, 2004). When antibiotics are used as growth promoters, they are provided at low doses for an extended period of time in large groups of animals (United States General

Accounting Office, 2004). The rapid emergence of antibiotic resistance (AR) is a consequence of the ubiquity of antibiotic use and misuse. AR poses a major public health threat because of the difficulties it creates in the treatment of bacterial infections, especially nosocomial infections in immunocompromised patients. We are facing the big problem that no available antibiotic can be used to effectively control nosocomial infections caused by multi-drug resistant bacteria, such as enterococci, Pseudomonas aeruginosa and Acinetobacter spp. (Arias & Murray, 2009). The emergence of

1 methicillin-resistant Staphylococcus aureus (MRSA) is another example of the concerns.

To date, 30-50% of invasive hospital isolates of S. aureus are MRSA (French, 2010). The

World Health Organization (WHO) also estimates that about 440,000 new cases of multidrug-resistant tuberculosis (MDR-TB) emerge annually, causing at least 150,000 deaths (http://www.who.int/mediacentre/factsheets/fs194/en/). The estimated cost due to

AR is US $150 million to $30 billion a year in US, which is a huge economic burden

(Levy & Marshall, 2004). Therefore, controlling the spread of AR is a priority for numerous organizations such as the WHO, Centers for Disease Control and Prevention

(CDC), Food and Drug Administration (FDA) and National Institutes of Health (WHO,

2001; Interagency Task Force on Antimicrobial Resistance, 2011). The irrational and inappropriate use of antibiotics has been indicted as one cause of AR because of the selective pressure it created in the whole ecosystem. To stem further AR spread, the

Europian Union banned the use of antibiotics as growth promoters in agriculture (Ferber,

2003; Larson, 2007). In Australia, the National Prescribing Service has gone a step further and introduced a media campaign to curtail antibiotic prescriptions for viral infections (Wutzke et al., 2007). More stringent regulations of antibiotics use in animals have been proposed in the Unites States (Ferber, 2003). AR in opportunistic pathogens that cause nosocomial infections has been extensively studied due to its dramatic impact on patient health and health care costs. However, recent studies have identified AR beyond the confines of hospitals and documented AR in both the food chain and the environment, suggesting that AR dissemination and persistence in the entire ecosystem

(Wang et al., 2006; Allen et al., 2010; Devirgiliis et al., 2010; Li & Wang, 2010;

O'Connor et al., 2010). The food chain has become essential to AR dissemination

2 because of its multifaceted connections to the whole ecosystem. Among all foodborne bacteria, foodborne pathogens have gained the most attention and their physiology, pathogenesis and resistance to antibiotic have been extensively studied. The National

Antimicrobial Resistance Monitoring System (NARMS) established by the FDA, CDC and United States Department of Agriculture (USDA) has been monitoring AR in foodborne pathogens from human, animal and retail sources, including Salmonella,

Campylobacter, and E. coli 0157 isolated from food chains since 1996.

Even though ART foodborne pathogens are a threat to public health, they are a small percentage of the total bacteria ingested with our food. On the other hand, commensal bacteria are the major foodborne microbes in the food system and data have shown that the AR gene pool is common in foodborne commensal bacteria (Wang et al.,

2006; Li & Wang, 2010). Up to 107 CFU ART bacteria per gram of food have been detected in various retail products including many ready-to-consume seafood, dairy, meat and produce products (Wang et al., 2006; Li & Wang, 2010). More importantly, the AR genes from representative food isolates were transmissible and functional in human residential and pathogenic bacteria by horizontal gene transfer (HGT) (Wang et al., 2006;

Li & Wang, 2010). Since there is no genetic barrier between commensal and pathogenic bacteria in the food, host systems and natural environment, the transmission of AR between these bacteria via HGT is a major concern that could lead to accelerated AR dissemination in the whole ecosystem. Fermented dairy products, especially cheeses, are popular food items that are consumed regularly in many countries (Fox et al., 2000;

Davis et al., 2010). Cheese is usually regarded as a healthy product due to its nutrient density. However, cheeses have been found to carry high concentrations of ART bacteria

3 (Wang et al., 2006) and AR gene pools (Manuzon et al., 2007). In recent years, many studies about AR in cheeses, especially local specialty cheeses in different countries, have been documented, and most ART isolates are lactic acid bacteria (LAB), including

Enteorcoccus spp , Streptococcus thermophilus , Lactococcus lactis, Lactobacillus spp., and Leuconostoc spp. (Florez et al., 2005; Rizzotti et al., 2009; Ozmen Togay et al.,

2010). Some other commensal bacteria including Staphylococcus aureus and

Enterobacteriacea have also been detected (Hammad et al., 2009; Rosengren et al., 2010;

Spanu et al., 2010). Even though AR in cheese does not cause immediate health problems in humans, the potential impact on the public health due to HGT is a concern.

Cheese making is a complicated process. Numerous ingredients and steps in the process can potentially contribute to AR development in the final cheese products, including the milk, starter culture, pasteurization, pressing, salting and ripening.

Therefore, it is important to identify critical control points (CCP) for AR mitigation in cheese fermentation, in order to reduce the general public‟s AR exposure from conventional food intake. Since low level sporadic ART bacterial contamination may still happen, it is also necessary to understand the molecular mechanisms in ART bacteria that contribute to AR dissemination and persistence. A clear understanding of the molecular mechanisms involved would enable the development of targeted counter strategies which would minimize AR contamination, dissemination and persistence in cheese and the food chain.

4 References

Allen, H. K., J. Donato, H. H. Wang, K. A. Cloud-Hansen, J. Davies, and J. Handelsman. 2010. Call of the wild: antibiotic resistance genes in natural environments. Nat. Rev. Microbiol. 8:251-259.

Arias, C. A., and B. E. Murray. 2009. Antibiotic-resistant bugs in the 21st century-a clinical super-challenge. N. Engl. J. Med. 360:439-443.

Davis, C., D. P. Blayney, D. Dong, S. Stefanova, and A. Johnson. 2010. Long-term growth in US cheese consumption may slow. http://www.ers.usda.gov/Publications/ldp/2010/07jul/ldpm19301/.

Devirgiliis, C., S. Barile, A. Caravelli, D. Coppola, and G. Perozzi. 2010. Identification of tetracycline- and erythromycin-resistant Gram-positive cocci within the fermenting microflora of an Italian dairy food product. J. Appl. Microbiol. 109: 313-323.

Ferber, D. 2003. Antibiotic resistance. WHO advises kicking the livestock antibiotic habit. Science. 301:1027.

Florez, A. B., S. Delgado, and B. Mayo. 2005. Antimicrobial susceptibility of lactic acid bacteria isolated from a cheese environment. Can. J. Microbiol. 51:51-58.

Fox, P. F., T. M. Cogan, and T. P. Guinee. 2000. Fundamentals of cheese science. Aspen publishers. Gaitherburg, MD.

French, G. L. 2010. The continuing crisis in antibiotic resistance. Int. J. Antimicrob. Agents. 36 Suppl 3:S3-S7.

Hammad, A. M., Y. Ishida, and T. Shimamoto. 2009. Prevalence and molecular characterization of ampicillin-resistant Enterobacteriaceae isolated from traditional Egyptian Domiati cheese. J. Food Prot. 72:624-630.

Interagency Task Force on Antimicrobial Resistance. 2011. A public health action plan to combat antimicrobial resistance. http://www.cdc.gov/drugresistance/pdf/2010/Interagency-Action-Plan-PreClearance-03- 2011.pdf.

Larson, E. 2007. Community factors in the development of antibiotic resistance. Annu. Rev. Public Health. 28:435-447.

Levy, S. B. 2002. The 2000 Garrod lecture. Factors impacting on the problem of antibiotic resistance. J. Antimicrob. Chemother. 49:25-30.

5 Li, X., and H. H. Wang. 2010. Tetracycline resistance associated with commensal bacteria from representative ready-to-consume deli and restaurant foods. J. Food Prot. 73:1841-1848.

Manuzon, M. Y., S. E. Hanna, H. Luo, Z. Yu, W. J. Harper, and H. H. Wang. 2007. Quantitative assessment of the tetracycline resistance gene pool in cheese samples by real-time TaqMan PCR. Appl. Environ. Microbiol. 73:1676-1677.

Ozmen Togay, S., A. Celebi Keskin, L. Acik, and A. Temiz. 2010. Virulence genes, antibiotic resistance and plasmid profiles of Enterococcus faecalis and Enterococcus faecium from naturally fermented Turkish foods. J. Appl. Microbiol. 109:1084-1092.

Rizzotti, L., F. La Gioia, F. Dellaglio, and S. Torriani. 2009. Characterization of tetracycline-resistant Streptococcus thermophilus isolates from Italian soft cheeses. Appl. Environ. Microbiol. 75:4224-4229.

Rosengren, A., A. Fabricius, B. Guss, S. Sylven, and R. Lindqvist. 2010. Occurrence of foodborne pathogens and characterization of Staphylococcus aureus in cheese produced on farm-dairies. Int. J. Food Microbiol. 144:263-269.

Spanu, V., S. Virdis, C. Scarano, F. Cossu, E. P. De Santis, and A. M. Cosseddu. 2010. Antibiotic resistance assessment in S. aureus strains isolated from raw sheep's milk cheese. Vet. Res. Commun. 34 Suppl 1:S87-S90.

Teuber, M. 2001. Veterinary use and antibiotic resistance. Curr. Opin. Microbiol. 4:493- 499.

United States General Accounting Office. 2004. Federal agencies need to better focus efforts to address risk to humans from antibiotic use in animals. Report to Congressional Requesters. http://www.gao.gov/new.items/d04490.pdf.

Wang, H. H., M. Manuzon, M. Lehman, K. Wan, H. Luo, T. E. Wittum, A. Yousef, and L. O. Bakaletz. 2006. Food commensal microbes as a potentially important avenue in transmitting antibiotic resistance genes. FEMS Microbiol. Lett. 254:226-231.

World Health Organization. 2001. Monitoring antimicrobial usage in food animals for the protection of human health, WHO consultation. Oslo, Norway, Sep 10-13, 2001.

Wutzke, S. E., M. A. Artist, L. A. Kehoe, M. Fletcher, J. M. Mackson, and L. M. Weekes. 2007. Evaluation of a national programme to reduce inappropriate use of antibiotics for upper respiratory tract infections: effects on consumer awareness, beliefs, attitudes and behaviour in Australia. Health. Promot. Int. 22:53-64. 6

CHAPTER 2

Literature Review

Antibiotics have been used since the 1930‟s to remedy bacterial infections (Lesch,

2007). In recent decades, high antibiotic use and overuse in humans, agriculture and animals has led to the spread of antibiotic resistance (AR) (Levy, 2002; Sanders, 2005;

Teuber, 2001). AR has become ubiquitous in our environment and been documented in our food chain thereby introducing AR into host systems (Wang et al., 2006; Allen et al.,

2010; Devirgiliis et al., 2010; Li & Wang, 2010; O'Connor et al., 2010). AR has huge public health consequences because of the difficulty it creates in treating many infectious diseases, leading to tens of thousands of deaths and millions to billons of economic costs each year (Levy & Marshall, 2004). Controlling AR in the food chain would dramatically reduce human exposure to harmful foodborne bacterial drug resistance.

2.1 History of antibiotics

Antibiotics are chemical substances having the capacity, in dilute solution, to kill or inhibit growthof microorganisms (Dorland, 2007). Antibiotics were originally produced by microorganisms, but the definition has been extended to synthetic and semisynthetic compounds with similar properties (Dorland, 2007). Antibiotics selectively

7 block certain crucial metabolic processes in microbial cells which inhibit or kill the microbes. Even though some antibiotics are anti-fungal compounds, the majority have antibacterial function. Thus, „antibiotic‟ has become synonymous with „antibacterial‟.

Depending on the mode of actions, antibiotics can be bacteriostatic (inhibit the growth of bacteria) or bactericidal (decrease the number of bacteria) (Walsh, 2003). The observations of Alexandra Fleming that Staphylococcus aureus was inhibited by the mold

Penicillum notatum in 1928 is usually considered the beginning of the era of antibiotics, however, the antibacterial function of Penicillum spp. was initially described in England by John Tyndall in 1875 (Walsh, 2003; Kingston, 2008). In 1877, Louis Pasteur and Jules

Francois Joubert also found that anthrax bacilli growth was inhibited by the airborne organisms (Heng et al., 2007). Pasteur and Joubert suggested this might be important in therapeutics. In 1932, Prontosil, a synthetic antibiotic that had broad effects against

Gram-positive cocci, became the first commercial antibiotic (Lesch, 2007). The active compound in Prontosil was later identified as sulfanilamide and was widely used in

World War II for the Allied armies. Many antibiotics followed the discovery of sulfanilamide, including streptomycin and chloramphenicol. To date, numerous different types of antibiotics have been developed and improved to combat bacterial infections.

The current focus in antibiotic development is creating novel, synthetic antimicrobials with more specificity and fewer side effects. However, the development of new antibiotics for antibiotic resistant (ART) bacteria have been increasingly difficult and slowed down in recent years (Boucher et al., 2009).

8 2.2 Applications of antibiotics

Antibiotics are the most commonly prescribed treatment for infections, especially bacterial infections. Data from the Surveillance and Control of Pathogens of

Epidemiologic Importance (SCOPE) MediMedia Information Technology (MMIT)

Antimicrobial Surveillance Network (SCOPE-MMIT) showed that among 688,166 patients admitted to the 37 hospitals participating in this surveillance study, over half of them (55%) received at least one does of antibiotic during their hospitalization (Pakyz &

Polk, 2007), suggesting the overuse of antibiotics in hospitals. Other studies have documented the misuse of antibiotics in the treatment of non-bacterial infection and in the case of self-prescriptions (Levy, 2002). The rapid rise in AR establishes the seriousness and pervasiveness of the problem. Antibiotics are now categorized as prescription drugs in many countries to better control the use of antibiotics in medical treatments.

Antibiotics are also widely used in animals and are among the most common drugs used in veterinary medicine (Sanders, 2005; Teuber, 2001). In animals, antibiotics are used not only to treat disease but also to limit the spread of disease, prevent disease and promote growth in food animals (United States General Accounting Office, 2004).

When antibiotics are used as growth promoters in agriculture, they are used long-term at low doses in large groups of animals (United States General Accounting Office, 2004).

The use of antibiotics sub-therapeutically and as growth promoters is contentious because of their association with the more serious issue of antibiotic resistance. In 2006, the

European Union banned the use of antibiotics in agriculture as growth promoters (Ferber,

2003; Larson, 2007; Soulsby, 2007), leading to a dramatic fall in the sales of

9 antimicrobial growth-promoting products in the UK (Soulsby, 2007). Similar regulations have been proposed in the Unites States (Ferber, 2003).

2.3 Mode of action

Different types of antibiotics may have different mechanisms to inhibit or kill the target bacteria. Typically, antibiotics target cell wall synthesis, protein synthesis, DNA synthesis, RNA synthesis or folate synthesis (Walsh, 2003). The major commonality between antibiotics is that they selectively kill or inhibit pathogenic bacteria with no significant impact on host cell homeostasis. Some antibiotics do this by targeting bacterial enzymes that don‟t exist in animals, such as the enzymes for cell wall biosynthesis and folic acid biosynthesis. Some antibiotic bacterial targets, such as protein synthesis and DNA synthesis, have counterparts in animals, but they are sufficiently distinct from the animal version.

A big distinction between bacterial and animal cells is that bacterial cells have a cell wall. Gram-positive and Gram-negative bacteria have different cell wall structures but they both contain a peptidoglycan (PG) layer. Gram-negative bacteria have a much thinner PG layer between two membranes. Gram-positive bacteria have a relatively thick

PG layer. The PG strands contain glycans and peptides that are enzymatically cross- linked by a transglycosylase and transpeptidase enzymes (Walsh, 2003). The cross- linkage of one strand of peptide chain to the other strand forms the mesh-like structure in the bacterial cell wall (Walsh, 2003). PG assembly includes cytoplasmic, membrane- associated steps and extracytoplasmic steps. Some antibiotics, such as β-lactams and glycopeptides, inhibit cell wall synthesis by interfering with the steps in PG synthesis.

10 For example, glycopeptides bind to the pentapeptidyl tails in D-Ala4-D-Ala5 to block transpeptidation (Walsh, 2003). Since Gram-negative bacteria have a layer of outer membrane, some antibiotics, such as the glycopeptide antibiotic vancomycin, work poorly against these bacteria because the entry of the antibiotic is usually blocked by the porins of the outer membrane (Walsh, 2003). Because of this, vancomycin is not usually used for infections caused by Gram-negative bacteria.

Ribosomes are a common antibiotic target because of the structural differences existing between eukaryotic ribosomes and prokaryotic ribosomes. Bacterial ribosome is composed of 50S and 30S subunits, while the eukaryotic ribosome contains 60S and 40S subunits. Ribosomes are critical for protein synthesis. Some antibiotics can specifically bind bacterial ribosomes, blocking bacterial protein synthesis, and thereby inhibiting bacterial growth without affecting the eukaryotic host. The 50S ribosomal unit contains

34 ribosomal proteins and a 23S rRNA as well as a 5S rRNA while the 30S subunit contains 21 proteins and a 16S rRNA. Some antibiotics, such as macrolides, lincosamides, streptogramines, everninomycins, oxazolidinones and licosamides, bind to the 50S ribosomal subunit and block polypeptide formation; while other antibiotics, such as tetracycline and aminoglycosides, bind to the 30S subunit and block the attachment of charged aminoacyl-tRNAs (Walsh, 2003).

Several enzymes are involved in DNA and RNA synthesis, such as topoisomerases and RNA polymerase. Topoisomerase II, also called DNA gyrase, introduces negative supercoils into DNA and relaxes positive supercoils. Topoisomoerase is the target for several antibiotics, including quinolones. Other antibiotics target RNA synthesis, such as rifampin which inhibits RNA polymerase. Rifampin specifically binds

11 to the β subunit of the RNA polymerase at the allosteric site and blocks RNA elongation, which inhibits RNA synthesis (Walsh, 2003).

Sulfamethoxazole-trimethoprim is an antiobiotic combination that inhibits DNA synthesis by altering folate metabolism in bacteria. Folic acid is essential for bacterial de novo synthesis of the DNA nucleosides, thymidine and uridine. In this case, sulfamethoxazole is a competitive inhibitor of dihydropteroate synthase, a key enzyme in the biosynthesis of the intermediate dihydropteroic acid for folate. The trimethoprim component of the drug targets dihydrofolate reductase (DHFR), another enzyme involved in the downstream conversion of dihydrofolic acid to tetrahydrofolic acid (Walsh, 2003).

The two drugs work synergistically to inhibit bacterial propagation (Bushby & Hitchings,

1968; Walsh, 2003).

2.4 Antibiotic resistance (AR) and its mechanisms

Antibiotics are considered the “magic bullet” in the treatment of bacterial infections. However, the emergence of AR has become a serious issue and has critically undermined the effectiveness of antibiotics. From the 1930s, when the first antibiotic sulfonamides went to market, through the 1960s, when cephalosporins were introduced,

AR has been observed 10-30 years after each antibiotic was deployed (Walsh, 2003). As mentioned, antibiotics are bacteriocidal or bacteriostatic, by interfering with different key metabolic functions in the bacterium. Bacteria have combated antibiotics by developing various methods of resistance, including enzymatic inactivation, efflux pumps, replacement or modification of antibiotic targets, which render the drugs ineffective.

12 Enzymatic inactivation of antibiotics is a major mechanism of AR. For example, cephalosporins are β-lactam antibiotics, including 4 generations of derivatives (Shahid et al., 2009). The production of β-lactamase in bacteria has made cephalosporins ineffectual in fighting bacterial infections. β-lactamase hydrolyzes the four-membrane β-lactam ring in many β-lactam antibiotics, removing the antibiotics original functions. The third generation of cephalosporins is more active against Enterobacteriacea, while the fourth generation of cephalosporins has an extended-spectrum compared to the third generation

(Shahid et al., 2009). The continued enhancement of antibiotics has been paralleled by continued developments in bacterial resistance. Extended-spectrum β-lactamases (ESBLs) have been detected in Enterobacteriacea (Falagas & Karageorgopoulos, 2009). ESBLs nullify later generations of cephalosporins, mostly third generation versions of cephalosporins (Munday, et al., 2004).. ESBLS have been widely reported in

Enterobacteriaceae, including E. coli, K. pneumoniae, Salmonella, et al., and most common ESBLs groups include bla-TEM, bla-SHV and bla-CTX-M (Munday, et al.,

2004; Falagas & Karageorgopoulos, 2009). Other examples of enzymatic inactivation include aminoglycoside-modifying enzymes, including adenyltransferase (AADA), acetyltransferase (AACA) and phosphotransferases (APH). These enzymes produced by

Gram-negative and Gram-positive bacteria modify aminoglycosides by acetylation, adenylation or phosphorylation. Another common example is chloramphenicol- modifying enzyme chloramphenicol acetyltransferases (CATs), which inactivate chloramphenicol, as well as thiamphenicol and azidamfenicol (Walsh, 2003; Schwarz et al., 2004).

13 Another route of antibiotic resistance is exporting the antibiotic outside the cell by efflux pumps, which reduces the intracellular antibiotic concentration and minimizes the toxic impact of the antibiotics. Several efflux pumps have been characterized for various types of antibiotics, including β-lactam antibiotics, macrolides, flouroquinolones, and tetracyclines (Poole, 2004). Efflux pumps can be proton-dependent or require ATPase to produce energy for cytoplasmic exportation. Proton-dependent efflux pumps can be categorized into three types: major facilitator superfamly (MFS), e.g. PmrA found in S. pneumoniae, small multidrug regulator (SMR) family, e.g. Smr found in S. aureus, or resistance/nodulation/cell division superfamily (RND), e.g. AcrAB-TolC found in E. coli

(Poole, 2007). ATPase dependent pumps, are catergorized into the ATP-binding cassette superfamily (ABC), e.g. Msr(C) found in E. faecium and Msr(D) found in S. pneumoniae

(Poole, 2004; Poole, 2007). Some efflux pumps are chromosomally encoded and therefore supply intrinsic resistance for some bacteria. For example, wild-type P. aeruginosa has the MexAB-OprM system, which constantly expresses and confers resistance to many antibiotics, such as β-lactams, quinolones and chloramphenicol (Aires et al., 1999; Alekshun & Levy, 2007). Efflux pumps can also be carried on plasmids or transposons and transferred to other strains through horizontal gene transfer (HGT). For example, it has been reported that the macrolide efflux pump gene, mef (E), can be transferred from different streptococci to Streptococcus pyogenes by conjugation

(Jonsson & Swedberg, 2006).

Some bacteria become resistant by modifying antibiotic targets. Bacteria can either mutate at one or multiple target-gene sites, or incorporate new replacement enzymes, which decrease the sensitivity to the antibiotics. For example, some MRSA

14 acquired a mecA gene, encoding a new penicillin-binding protein (PBP) that nullifies the effect of methicillin (Walsh, 2003). As mentioned above, vancomycin inhibits the synthesis of PG in Gram-positive bacteria. However, vancomycin-resistant enterococci reconstitute the PG termini from D-Ala-D-Ala to D-Ala-D-Lac, making it unrecognizable to the antibiotic (Walsh, 2003; Depardieu et al., 2007). Another example is quinolone antibiotics. Even though the main mechanism for the resistance is the mutation of targeted enzymes, DNA gyrase and topoisomerase IV, the plasmid-encoded Qnr protein by qnr, is able to protect the DNA gyrase from quinolones and plays an increasingly significant role in quinolone resistance (Strahilevitz et al., 2009).

Bacteria can carry multiple resistance mechanisms for one specific antibiotic and can carry one resistance mechanism that affects multiple antibiotics, such as efflux pumps as mentioned above. Multi-resistance induced by one mechanism or several different mechanisms have been characterized in many bacteria, especially clinical isolates, due to the highly selective pressure from antibiotics. All these contribute to the increased bacterial resistance to broad spectrum antibiotics currently plaguing patients today.

2.5 Origins of AR

Mutation is a random event which happens during DNA replication in bacteria.

Mutation is also an origin of AR. AR caused by mutation is usually not able to be transferred to other strains. The absolute frequency of mutation is very low (around 10-7), but due to the large size of the genome and high populations of some bacteria in culture, under some conditions, mutated bacterium that is resistant to antibiotics can occur (Walsh,

15 2003). Under constant antibiotic pressure, resistant bacterium has the adaptive advantage to survive and proliferate. Therefore, even though mutation events are rare, extensive and long-term antibiotic use would lead to resistant isolates which could thrive in the continued presence of antibiotics.

Antibiotics are natural products of bacteria and fungi. Logically, those antibiotic- producers should carry “immunity” mechanisms to prevent the antibiotics they produce from destroying themselves. Bacteria that can produce antibiotics do indeed have mechanisms, which are similar to AR mechanisms, for self-protection. These mechanisms include temporary intracellular inactivation of the antibiotic, efflux of the produced antibiotic and modification of the antibiotic target in the producer (Walsh,

2003). As an example, some aminoglycoside-inactivating enzymes were found in aminoglycoside-produing Streptomyces and were similar to aminoglycoside-resistance genes from aminoglycoside-resistant Gram-negative bacteria (Benveniste & Davies, 1973;

Amábile-Cuevas, 1993). These data suggest that some AR potentially originated from antibiotic producers.

Some antibiotic resistance genes existed even before the use of that antibiotic and

AR bacteria have been document in places without antibiotic application (Allen et al.,

2010). For example, serine β-lactamases is believed to originate from over 2 billion years ago and many have been plasmid encoded for millions of years (Allen et al., 2010). This is logical since some AR mechanisms are not only used to combat antibiotics but also serve other essential metabolic functions in bacteria (Allen et al., 2010). Many efflux pumps not only pump antibiotics out of the bacterial cell but are also essential for removing cellular toxic waste materials (Allen et al., 2010). Therefore, it is difficult to

16 show causation between antibiotic use and the origins of AR genes. However, it is certain that the selective pressure of antibiotic use, and misuse, is a major concern regarding the dissemination of AR genes resulting in generations of ART bacteria.

2.6 AR dissemination

The rapid emergence of AR is not only due to the extensive use of antibiotics, but also compounded by the extensive gene transfer that occurs in bacteria. Since some AR traits are encoded by AR genes, the dissemination of AR genes in the whole ecosystem also plays an important role in the AR issue. There are two main mechanisms that contribute to the spread of AR, vertical gene transfer and horizontal gene transfer (HGT).

2.6.1 Vertical gene transfer

Vertical gene transfer involves passing resistance from parental cells to daughter cells. Some point mutations, deletions or other modifications in the DNA may lead to blocking antibiotic targets. Under antibiotic selective pressure, ART bacteria would selectively proliferate and overtake the other wild type population. Therefore, vertical gene transfer is important in AR dissemination when the environment is constantly under antibiotic selective pressure. The hospital setting is ripe with these events, including the documented outbreak of vancomycin resistant enterococci (VRE) in a large Polish hospital (Kawalec et al., 2007).

17 2.6.2 Horizontal gene transfer (HGT)

Some bacteria are insensitive to several antibiotics, because of innate resistance mechanisms. For example, P. aeruginosa is resistant to many antibiotics because of its inherent efflux pumps (Pole, 2005). Alternatively, some resistances develop from mutations passed down to progenies through vertical gene transfer; or AR genes can exist on transferrable elements, such as plasmid and transposon, and can be transferred between bacteria through HGT. HGT can occur between species, genus or even from

Gram-positive to Gram-negative bacteria. HGT results from three machanisms natural transformations, conjugations and, to a lesser extent, transductions (Davison, 1999).

Conjugative plasmids and transposons carrying AR genes can be transferred by conjugation. An intimate association between the cell surfaces of the interacting donor and the recipient is necessary for conjugative transfer (Llosa et al., 2002). In Gram- negative bacteria, conjugation is usually mediated by the pilus (Lawley, et al., 2004). The mechanisms of conjugation in Gram-positive bacteria have not been totally elucidated but sex pili are not involved (Clewell & Francia, 2004). However, cell-to-cell contact promoted by aggregation has been detected in some Gram-positive bacteria (Gasson &

Shearman, 2004). For example, enterococci secrete pheromones that initiate conjugation

(Clewell & Dunny, 2002). In the pheromone conjugation system, the conjugative plasmid contains genes for recognition of recipient-produced peptide pheromone, which initiates the mating process (Dunny, 2007). The pheromone-inducing plasmids (pheromone plasmids) are conjugatively transferred efficiently after a clumping reaction takes place between donor and recipient cells (Clewell & Francia, 2004; Phillips & Funnell, 2004).

Besides plasmids, some conjugative transposons have also been identified, such as the

18 Tn916-family (Clewell & Francia, 2004). The conjugative transposons are thought to form a plasmid-like intermediate during the conjugative process (Clewell & Francia,

2004).

Conjugation frequencies vary depending on both donor and recipient strains as well as conditions. Pheromone-responding transfers are typically very efficient (up to 10–

1 transconjugants/donor) (Hirt et al., 2005). Studies also showed that biofilm may also facilitate the conjugation in laboratory setting (Luo et al., 2005). Because of the complex conditions exisiting in food fermentation and processing impacts conjugation frequency, conjugation rates in food systems can be higher or lower compared to lab settings. For example, a pheromone plasmid carrying both tetracycline and vancomycin resistance genes can be transferred at a higher frequency (10-3/ recipient) during sausage making and a lower frequency (10-6/recipient) during cheese making as compared to a plate mating assay at the lab bench (10-4/ recipient) (Cocconcelli et al., 2003).

Natural transformation is another mechanism of HGT. In natural transformations, free DNA in the environment enters the recipient organisms and incorporates into the genome or plasmid. So far, only a few bacteria have been classed as naturally competent, capable of being transformed, during certain life cycle stages. Bacillus subtilis is competent and natural transformation occurs at a detectable and relatively high frequency

(Johnsborg et al., 2007). Streptococcus mutans, another oral pathogenic organism is also capable of natural transformation (Li et al., 2001). A specific set of genes are involved in natural gene transformation (Johnsborg et al., 2007). Data from recent genomic studies illustrate that genes related to natural transformation are widely distributed amongst bacteria (Blomqvist et al., 2006; Johnsborg et al., 2007). Theoretically, it is possible that

19 more bacteria are capable of natural gene transformation; but in the confines of the laboratory settings, such events have not yet been detected.

The last mechanism of natural HGT is transduction, which is mediated by bacteriophages. Bacteriophages play significant role in the evolution of the bacterial genome (Brabban et al., 2005). It can transfer determinants important to the physiology and pathogenicity of bacteria (Brabban et al., 2005). Compared to conjugation and natural transformation, transduction‟s relationship to AR dissemination has not had a lot of scholarly studies. However, recent reports propose the role of transduction in the HGT of AR genes may be underestimated (Brabban et al., 2005). Transduction of AR determinants has also been described in several different bacteria like P. aeruginosa,

Salmonella Typhimurium DT104 and Streptococcus pyogenes (Ubukata et al., 1975;

Blahova et al., 1999; Schmieger & Schicklmaier, 1999). A recent report also found AR genes carried by bacteriophages in environmental samples and some of the AR genes were furthered transferred to bacteria in laboratory settings, suggesting that bacteriopages may be environmental reservoirs for AR genes (Colomer-Lluch et al., 2011).

One important group of mobile genetic elements which is worth pointing out is integrons, which were firstly defined in 1989 (Stokes & Hall, 1989). The significance of integrons related to antibiotic resistance is that they are able to acquire, exchange and express different resistance gene cassettes, which confer different resistance (Davies,

2007). So far, four classes of integrons including one class of super integron have been found (Fluit & Schmitz, 2004). Among them, class 1 and class 2 integron are the most common (Davies, 2007). All intergons contain an integrase gene, a tyrosine recombinase, which catalyzes the excision and integration of gene cassettes (Cambray et al., 2010). So

20 far, more than 130 different cassettes harboring AR genes have been identified (Cambray et al., 2010). One integron can carry multiple gene cassettes, which significantly contributes to the multi-drug resistance in many bacteria. Integrons have been found to be ubiquitous in ART clinical Gram-negative isolates and have been identified in Gram- positive bacteria (Fluit & Schmitz, 2004; Davies, 2007). Even though integrons themselves are not transmissible, many of them are associated with mobile genetic elements (transposons) and can be carried by conjugative plasmid (Cambray et al., 2010).

Therefore, the resistance genes carried by integrons can be transferred by HGT through different mechanisms as mentioned above.

Lactic acid bacteria (LAB), commonly found in fermented foods, are susceptible to HGT. HGT in LAB, such as Enterococcus spp., Lactococcus spp., Lactobacillus spp., have been reported (Teuber et al., 1999; Hummel et al., 2007; Jacobsen et al., 2007;

Boguslawska et al., 2009; Sabia et al., 2009). Conjugation is one of the HGT mechanisms which has been extensively studied in some LAB, including Enterococcus spp (Clewell & Dunny, 2002; Dunny, 2007) and L. lactis (Anderson & McKay, 1984;

Wang et al., 1994) and cell-clumping associated high frequency conjugation has been reported in Enterococcus facaelis (Dunny, 2007), Lactococcus lactis (Walsh & McKay,

1981), Lactobacillus plantarum (Reniero et al., 1992) and Bacillus thuringiensis (Andrup et al., 1993). Luo et al. (Luo et al., 2005) further illustrated that the high frequency conjugation system in L. lactis can facilitate the transmission of the broad-host-range drug resistance-encoding plasmid up to 10,000 times higher than the strains without the intrinsic mechanism. A probiotic Lactobacillus strain has also been reported to be able to acquire vancomycin resistance gene in vitro, and at a higher frequency in vivo (Mater et

21 al., 2008). The identification of the prevalence of AR genes in various LAB strains and the presence of HGT facilitating mechanisms in these bacteria suggest that despite of their beneficial applications, starter cultures and probiotics, like other bacteria, can readily be involved in AR dissemination. LAB are utilized at high concentrations in the food industry, potentially compounding the damage they could do, if the safety features of the strains are not fully understood.

2.7 Persistence of AR

The wide and extensive use of antibiotics in therapy, agriculture, aquaculture and other parts of the ecosystem selectively enriches and maintains ART bacteria in the environment. However, recent studies found that limit the use of antibiotic did not eliminate AR in some bacteria (Johnsen et al., 2005; Sorum et al., 2006), suggesting additional mechanisms involved in the persistence of AR. One strategy is to incorporate

AR genes to the chromosome in order to better maintain the resistance. Beside this, recent studies also found many stable plasmids existing without corresponding antibiotic pressure. Some stable plasmids result from active partition systems (Williams & Thomas,

1992), resolution system for plasmid multimers (Summers & Sherratt, 1984; Williams &

Thomas, 1992), and toxin-antitoxin (TA) systems (Hayes, 2003). In TA systems, daughter cells that lost plasmid are not able to produce labile anti-toxins and consequently killed by the stable and potent toxins, so that the plasmid-free cells are eliminated and cells with resistance carried by plasmids are retained and persisted (Hayes,

2003). The toxin gene in the TA system encodes a stable protein, while the antitoxin is either an untranslated antisense RNA or a labile protein (Hayes, 2003; Bukowski et al.,

22 2011). TA systems are categorized based on the antitoxin they generate, type I generates

RNA antitoxin and type II produces an antitoxin protein (Bukowski et al., 2011). TA systems can reside on either a plasmid or chromosome and those located on a plasmid contribute to the plasmid‟s stability. Most TA systems located on plasmids are type II

(Hayes, 2003). Under normal conditions, the toxin produced is sequestered by the antitoxin, encoded by a gene co-located on the plasmid. When the cell loses the plasmid, since antitoxin is more susceptible to degradation, the toxin is able to induce the cell death of the plasmid-free cell (Bukowski et al., 2011). So far, many plasmid-residing type II TA systems have been identified, such as ccdAB and parED in E. coli, axe-txe in

E. faecium, and ω-ε-ζ in E. faecium and S. pyogenes (Hayes, 2003; Van Melderen &

Saavedra De Bast, 2009). Studies have found that TA are widely distributed in many types of ART bacteria, suggesting TA‟s roles in maintaining AR plasmids, leading to the persistence of AR genes (Moritz & Hergenrother, 2007; Rosvoll et al., 2010).

2.8 Tetracycline and tetracycline resistance (tetr)

Tetracyclines are broad-spectrum antibiotics used in the treatment of both Gram- negative and Gram-positive bacteria. The first tetracycline was discovered in the 1940s.

Due to their antimicrobial properties and limited side effects, they have been widely used both for the treatment of infections and at the sub-therapeutic level as growth promoters in livestock feed (Chopra & Roberts, 2001). Tetracycline binds to the 16S ribosomal

RNA of bacteria near the ribosomal accepter A site and prevents aminoacyl-tRNA binding, thereby inhibiting protein synthesis (Chopra & Roberts, 2001; Sapunaric et al.,

2007).

23 Tetracycline resistance emerged after a decade of tetracycline employment

(Chopra & Roberts, 2001). Many tetracycline resistant (Tetr) bacteria have been reported, possibly because many of those resistance determinants are located on transferrable elements (Roberts, 2005a). The four characterized mechanisms for bacteria to combat tetracycline include efflux pumps, ribosomal protection, inactivation of tetracycline molecules and rRNA mutations (Sapunaric, et al., 2007). Most tetracycline resistance genes or oxytetracycline resistance genes encode for efflux pumps, which pump the antibiotics out of the cytoplasm. The genes in this group include tet(K), tet(L), tet(A), tet(B) and other tetr genes (Roberts, 2005a). The mechanisms for ribosomal protection are still not clear. One hypothesis is that the Tetr bacteria produced proteins allosterically disrupt tetracycline binding site(s) (Chopra & Roberts, 2001). There are 11 classes of tetr genes in this group the common ones include tet(M), tet(O) and tet(W) (Roberts, 2005 a&b). Inactivation of tetracycline and rRNA mutations are the less common mechanisms employed for tetracycline resistance. So far, three genes encoding enzymes capable of tetracycline inactivation have been identified, including genes for NADP-requiring oxidoreductases and xanthine–guanine phosphoribosyl transferase (Roberts, 2005a).

To date, at least 1,189 tetr genes have been reported. They are distributed among

84 genera and 354 species of Gram-positive and Gram-negative bacteria (Thaker et al.,

2010). The wide distribution of Tetr bacteria is not only due to the selective pressure created by the extensive use of tetracycline (Thaker et al., 2010) but also a result of their residence on highly mobile, transferrable genetic elements such as plasmids and transposons (Thaker et al., 2010).

24 2.9 AR in the food chain

Antibiotics are employed in human clinical applications but also widely used in food production, including livestock, poultry as growth promoters and plant agriculture

(Castanon, 2007, McManus, 2002). It has been reported that the amount of antibiotics used in livestock accounts for 78% of total antibiotic use (Dibner & Richards, 2005).

Recent studies identified AR in both the food chain, including ready-to-consume foods and food animals, as well as the environments, including soil and aquatic environments , suggesting that the whole ecosystem is involved in AR dissemination and persistence

(Wang et al., 2006; Allen et al., 2010; Devirgiliis et al., 2010; Li & Wang, 2010;

O'Connor et al., 2010). Food chain plays a keystone role because it connects many different aspects of the whole ecosystem together. AR can be introduced into the food chain during food production with ART contamination occurring in the original materials, processing, packing and/or handling of food.

2.9.1 Foodborne bacteria

Among foodborne bacteria, including both foodborne pathogens and foodborne commensal bacteria, foodborne pathogens are the more notorious and extensively studied of the two, since they are the major cause of foodborne illnesses and result in large economic losses. Numerous studies have analyzed their physiology, pathogenesis and resistance to antibiotics. However, pathogens only account for a small proportion of the total bacteria in foods. They can not be detected without enrichment. The concentration of commensal bacteria in food is much greater. Our previous studies showed that some ready-to-consume foods contained up to 108 CFU/g bacteria, most of which were

25 commensals (Wang et al., 2006). Since commensals do not directly cause diseases, their impact on food safety and public health has not been fully elucidated.

Fermented foods utilize commensal bacteria as starter cultures or probiotics. For instance, yogurt and cheese usually contains 109 CFU/g bacteria, mostly starter cultures, including probiotics for some products. Starter cultures produce organic acids and other end products that help ripen, flavor, texture and/or preserve the food product. Probiotics are used because of their potential health benefits to the hosts (Lee & O'Sullivan, 2010).

Therefore, starter cultures and probiotics are usually considered as beneficial microbes in the food system.

2.9.2 AR in foodborne bacteria

Foodborne bacteria, both pathogenic and commensal bacteria, are AR carriers.

The population of foodborne pathogens that are ART has increased significantly since the

1990s (White et al., 2002). ART foodborne pathogens, such as Listeria monocytogenes,

Salmonella spp., Vibro spp., Campylobacter spp. have been widely reported and studied

(Conter et al., 2009; Harakeh et al., 2009; Luangtongkum et al., 2009; Miranda et al.,

2009; O'Connor et al., 2010; Kitaoka et al., 2011). The National Antimicrobial

Resistance Monitoring System (NARMS) also monitors several human and animal isolated food-borne pathogens, including Salmonella, Shigela, Campylobacter and E. coli.

As documented, plasmid-mediated resistance to expanded-spectrum cephalosporins is widely spread among Salmonella (Miriagou et al., 2004). Integrons, which can carry multiple AR gene cassettes, have also been frequently detected in ART bacteria (Carattoli,

2001; Partridge et al., 2009). For example, the global spread of multiresistant S.

26 Typhimurium DT104 has been problematic (Davis et al., 2002). ART L. monocytogenes were isolated from different samples with resistances against different antibiotics, such as chloramphenicol, kanamycin, tetracycline, and erythromycin (White et al., 2002). A main

AR resistance issue for Campylobacter spp. is fluoroquinolone-resistance, due to the mutation of targeted genes and increasing cases of gyrase protection proteins encoded on plasmids (Strahilevitz, et al., 2009). As mentioned, even though the emerging ART foodborne pathogens are a threat to public health, foodborne pathogens, especially ART foodborne pathogens are only a small percentage of the total bacteria in many foods.

They do not represent the whole picture of AR transmission in food chain. It is also important to note that there are no genetic boundaries between pathogens and other commensal bacteria. In addition, antibiotics are not recommended for treating certain diseases initiated by foodborne pathogens, such as by E. coli O157:H7. Therefore, the practical impact of AR caused by foodborne pathogens on public health is limited.

Even though commensal bacteria are the majority of microbes in the food system, they cause spoilage of food products and therefore not the major cause of disease. AR in foodborne commensal bacteria has not been studied until recent years. Data beginning in

2006 have shown large AR gene pools in foodborne commensal bacteria (Wang et al.,

2006; Manuzon et al., 2007; Li & Wang, 2010). Up to 107 CFU ART bacteria per gram of food were found in various retail products including seafood, dairy, meat and produce products (Wang et al., 2006; Li & Wang, 2010). Identified ART bacteria and AR gene carriers include Enterococcus spp., Carnobacterium spp., Staphylococcus spp,

Pseudomonas spp., and Lactococcus lactics (Wang et al., 2006; Li & Wang, 2010). The

AR genes from representative food isolates were transmissible and functional in human

27 residential and pathogenic bacteria (Wang et al., 2006; Li & Wang, 2010). Since many of the food items are consumed directly, they serve as a significant avenue introducing AR to humans, independent from clinical exposure. AR dissemination is enhanced in these bacteria. Foodborne bacteria are known to be susceptible to HGT mechanisms, and the frequency of HGT is correlated with the size of the AR gene pool. The prevalence and high magnitude of AR in foodborne commensal bacteria, partnered with occasional colonization in human digestive tract, inevitably represent a significant risk of AR dissemination in both the food environment and the hosts. Therefore, control of AR genes in foods system becomes an emerging issue in controlling AR issue (Wang et al., 2006).

2.10 AR in cheese products

Fermented dairy products, especially cheeses, are the primary dairy products and largely consumed in many countries (Fox et al., 2000; Davis et al., 2010). However, most retail cheese samples examined in 2004-2005 from retail chain stores in Columbus OH area contained very high number of ART bacteria (Wang et al., 2006). Identified AR gene carriers include Staphylococcus sp., Streptococcus spp., as well as organisms commonly used as fermentation starter cultures, such as S. thermophilus and L. lactis

(Wang et al., 2006). A quantification study of an AR gene pool in retail cheese samples revealed that 7 out of 11 samples contained up to 107 copies of the tetS gene per gram of cheese (Manuzon et al., 2007). Milk itself is rich in nutrients and susceptible to microbial contamination. The inoculation and rapid growth of fermentation starter cultures in milk is essential in cheese making to successfully control the outgrowth of spoilage and pathogenic bacteria for the preservation of the perishable raw material. A large variety of

28 cheese products result from a combination of various starter and adjunct cultures, making procedures and processing conditions. It is disconcerting that many recent studies about

AR in cheeses, especially specialty cheeses in Europe have been documented and most

ART isolates belonged to LAB, such as Enteorcoccus spp. (Ozmen Togay et al., 2010), S. thermophilus (Rizzotti et al., 2009), Lactococcus spp. (Florez et al., 2005). Other commensal bacteria, such as S. aureus (Rosengren et al., 2010; Spanu et al., 2010) and

Enterobacteriacea (Hammad et al., 2009) have also been reported. These studies demonstrate AR contamination in cheese products is a serious issue. Controlling and minimizing AR in cheese making has the potential therefore to reduce AR exposure throughout the food chain.

2.11 Cheese fermentation and microbial dynamics

Dairy fermentation, especially in cheese making, is a complicated process involving advanced changes in microbiology and chemistry. Cheese making requires numerous stages, such as pasteurization, milk fermentation, coagulation, draining, pressing, salting, and ripening. A schematic outline of the process is shown in Figure 2.1.

Multiple factors contribute to the dynamic microbial changes engaged in cheese making process. These factors include the ingredients, such as milk, starter and adjunct cultures, as well as the processing procedures, such as pasteurization, brining, fermentation and ripening. Raw milk, secreted by healthy cows, is free of microorganisms before it is milked. However, it is often contaminated with different contaminants throughout the process before receiving. Soil, bedding, manure, feed and milking equipment during milking, transferring and handling process can all be the

29 sources of contamination. Since milk is very nutritious, microbes can grow rapidly, especially above refrigeration temperature.

Figure 2.1. Simplified outline of cheese making process

30 Raw milk can contain high numbers of bacteria, including both commensals and pathogens before pasteurization. Our lab has detected 102-106 CFU/ml bacteria in raw milk samples, depending on holding time, sources and handling methods (Li and Wang, unpublished data). Pasteurization destroys heat sensitive spoilage and pathogenic bacteria in raw milk. Pasteurization conditions are 15 s at 71.7°C or 30 min at 62.7°C, which effectively reduces the bacterial load in milk; but thermoduric bacteria that survive pasteurization and post-pasteurization contamination, from equipment, can still cause spoilage. Some injured bacteria may also recover after pasteurization. Therefore, flora surviving the heat treatment can be a potential ART source found in the final products.

Most cheeses are innoculated with starter cultures for acid production and flavor development. Sometimes the cheese recipe includes secondary and adjunct cultures, as well. Primary starter cultures used in dairy fermentation are mostly lactic acid bacteria

(LAB) and the common species involved include L. lactis, Lactobacillus helveticus, S. thermophilus and Lactobacillus delbreckii but not all of them are used in every cheese variety. LAB are Gram-positive bacteria, that utilize lactose and generate lactic acid during fermentation. In addition, proteolytic and lypolytic ezymes in LAB generate flavor compounds in this process. Besides primary starter cultures, some LAB are also used as adjunct cultures in cheese fermentation. Adjunct cultures further enhance flavor compound production. The LAB used as adjunct cultures are termed non-starter lactic acid bacteria (NSLAB). Probiotics, including some LAB, such as species of

Lactobacillus, Streptococcus and Enterococcus, Bifidobacterium, Bacillus and

Escherichia coli, which are beneficial to human health (Lee & O'Sullivan, 2010; Sanders et al., 2010), are also used as starter cultures or adjunct cultures in dairy fermentation.

31 During cheese manufacturing, starter cultures produce lactic acid which drops the pH, and inhibits spoilage and pathogenic microorganisms. This contributes to the microbial safety of cheese. Besides primary starter cultures, secondary starter cultures are also used in some cheeses. Secondary starter cultures are utilized in the ripening process and their initial inoculua are much lower in concentration than primary starter cultures. For example, molds are the secondary starters in blue and Camembert cheese. During the high temperature ripening process in Swiss cheese, propionic bacteria

(Propionicbacterium) are introduced as a secondary starter. The propionic bacteria proliferate and produce carbon dioxide, which forms “eyes” in Swiss cheese.

Nowadays, many starter cultures are commercialized and packed in condensed forms (109 CFU/g). These can be directly used for cheese making, minimizing potential contamination. However, some cheese manufacturers also use plant-maintained starter cultures or adjunct cultures for the flavor development. It is important to properly maintain the starter cultures. Improper handling can lead to bacteriophage contamination, diminished starter culture activity, and increased pathogen contamination, leading to foodborne diseases. In addition, AR contamination and enhanced ART bacterial propogation can also be caused by inappropriate maintenance of starter cultures and adjunct culture. Contaminated starter culture would be a robust reservoir of AR if contaminated by ART bacteria. Before 2006, lactic acid bacteria and probiotics were always considered beneficial bacteria and assumed to be free of AR genes. Therefore, screening of AR genes had never been a routine practice, even in starter culture companies. However, some ART LAB strains, including probiotics from fermented dairy products, have been found to be resistant to different antibiotics (Franz et al., 1999;

32 Kastner et al., 2006). In addition, bacteria commonely used as starters can be carriers for resistance encoding genes (Wang, et al., 2006). These results suggest that proper environmental conditions, stringent aseptic techniques, and particularly screening of the presence of AR genes and the potential involvement in HGT events are essential for proper maintenance of starter cultures. The food industry, especially the cheese industry, must provide sufficient education, regulation and guidelines regarding culture maintenance.

The first goal of cheese making is to convert liquid milk into cheese curds. This is achieved by adding the enzyme rennet, which includes the active enzyme chymosin, with the main function of coagulating the milk. Rennet has higher activity under acidic conditions; hence it is usually added after starter cultures have fermented the milk for a period of time (Kosikowski, 1982). Even after rennet is added, starter cultures proliferate and the pH continues to drop. After coagulation, whey is expulsed and cheese curds remain. The main principle of cheese making is to eliminate the water in milk. Reducing water content reduces the risk of spoilage and unwanted microorganisms. Cheese curds have a pH ranging from 4.5 to 5.3 so that acid-sensitive bacteria are dispatched (Fox et al., 2000). How cheese curds are further processed depends on what types of cheese is being made. Salt will be added, either by directly mixing it into the cheese curds, as in cheddar cheese, or by brining the curds in a saturated saline, as in Swiss cheese. Final cheese products may contain 0.7-6.0% (w/w) salt (Gulnee, 2004), which provides flavoring, controls microbial growth, limits enzymatic activity, further reduces water content and influences the cheese‟s texture (Fox et al., 2000).

Ripening is the last step in most cheese making, except for fresh cheeses. It is also called aging or curing. During ripening, primary starter cultures slow down generating

33 acids but still provide flavor development. Secondary starter cultures, which are secondary during the initial steps of cheese manufacturing, predominate during the ripening step. NSLAB contribute to the flavor and texture development in cheeses during this stage. In some cases, NSLAB are not defined strains that are introduced from uncontrolled sources, such as the milk or adjunct cultures. Since they were not selected regarding AR and little background is known, they can be a source of ART bacteria in cheese. Microbial enzymes, such as proteases and lipases, are the key to developing flavor compounds in cheese. Ripening is usually a low temperature process, slowing the chemical and microbiological changes during this stage. Ripening can last several months or several years, in order to produce different kinds of cheese. Ripening also contributes to the safety of cheese products. In the United States, it is legal to use raw milk to make cheese and categorize it as unpasteurized cheese. However, unpasteurized cheeses need to be ripened for at least 60 days before going to market. The idea being that is during the ripening process, the cheese becomes more acidic limiting potential pathogens. However, the impact of ripening on ART non-pathogenic microbes has not been taken into consideration.

2.12 Enterococci and ART enterococci in food

2.12.1 Enterococci

Enterococci are gram-positive LAB bacteria. Enterococcus faecalis and

Enterococcus faecium are the two most common species, while other 25 species have been included in the genus Enterococcus (Facklam, et al. 2002; Mohamed & Huang,

2007). Enterococci are important in environmental, clinical and food microbiology.

34 Enterococci can survive a wide range of environmental conditions, such as high sodium chloride concentrations (up to 6.5%), extreme temperatures (10 to 45ºC), and a spectrum of pH (4.5- 9.6) (Franz et al., 1999). These bacteria are widely used as starter cultures and probiotics in the production of fermented foods in Europe, especially in

Mediterranean countries. Enterococci are also normal inhabitants of the gut flora and are indicators of fecal contamination. Enterococci are generally not pathogenic but are opportunistic pathogens that cause disease in the nosocomial setting in immunocompromised patients. Enterococci are a predominant Gram-positive bacterial genus found in hospital infections (Jones, 2001; Hidron et al., 2008).

2.12.2 AR in Enterococci

An important characteristic of enterococci, which causes increased interest in these organisms, is their expanding resistance to most antimicrobial agents currently approved. They are intrinsically resistant to many antibiotics, such as semisynthetic penicillins (e.g., oxacillin), aminoglycosides (low level), vancomycin (low level resistant in E. gallinarum, E. casseliflavus/E. flavescens), lincosamides (mostly), polymyxines and streptogramins (E. faecalis) (Klare et al., 2003). In addition to the many intrinsic resistances, enterococci have now acquired resistance to many other antibiotics. Mobile elements such as plasmids (Murray & Mederski-Samaroj, 1983; Schwarz et al., 2001;

Simjee et al., 2006; Sletvold et al., 2010), transposons (Handwerger & Skoble, 1995;

Rice & Carias, 1998; Simjee et al., 2000; Roberts et al., 2006; Rice et al., 2010) and integrons (Clark et al., 1999) carrying various resistant traits (glycopeptides, aminoglycosides, quinopristin-dalfopristin, tetracycline, chloramphenicol, erythromycin,

35 and β-lactams) have been identified in enterococci. This suggests the importance of HGT in the dissemination of AR among enterococci. Particularly devastating to public health is the emergence of vancomycin-resistant enterococci (VRE), especially in the hospitals

(Willems & Bonten, 2007). In the early 1990s, infections with VRE had a substantial effect on hospitals in the Northeastern and Midwestern regions of the United States

(Murray, 2000). VRE continues to be associated with outbreaks in patients around the world and a report in 2004 showed that the prevalance of VRE was around 28% in the intensive care units of the US hospitals (McDonald, 2006; Werner et al., 2008). VRE can also transfer resistance-encoding traits to other unrelated pathogens, such as S. aureus, including MRSA (McDonald, 2006; de Niederhausern et al., 2011). In addition, representative TA systems, such as ω-ε-ζ, and axe-txe, are ubiquitous in Vanr-ecoding plasmids (Moritz & Hergenrother, 2007; Rosvoll et al., 2010), as well as other plasmids conferring multi-drug resistance (Schwarz et al., 2001). VRE are an ever increasing public health threat.

Same as many other bacteria, enterococci can also form biofilms, which brings difficulties to the treatment of enterococcal infections. One significant reason is that biofilms are more resistant to antibiotics than planktonic cells (Mohamed & Huang, 2007).

In addition, the biofilm formation factor contributes to the pathogenesis of enterococcal infection (Mohamed & Huang, 2007). One concern for food industry is that the biofilms formed by many bacteria can be a persistent source of contamination (Van Houdt &

Michiels, 2010). Even though not many studies related to the impact of enterococcal biofilm on the food industry have been documented, due to the physiological characteristics of enterococci, contamination of biofilm formed by ART enterococci in

36 food production environments is highly possible and can be a important source of ART contamination in dairy industry.

2.12.3 AR in foodborne Enterococci

Enterococci are starter cultures or probiotics in fermented food productions in some countries. Despite that most strains have not been screened for their AR properties,

ART enterococci have been reported recently in different foods (Çitak et al., 2004;

McGowan-Spicer et al., 2008; Devirgiliis et al., 2010; Li & Wang, 2010; Ozmen Togay et al., 2010). A few studies further characterized food ART enterococcal isolates. One study isolated, sequenced and analyzed a multi resistance plasmid, pRE25. This plasmid carrying resistance to aminoglycosides, erythromycin, and chloramphenicol was found in sausage E. faecium isolate RE25 (Schwarz et al., 2001). A later study showed pRE25- related replicons were widely distributed in plasmids with TA systems carried by glycopeptide resistant E. faecium, demonstrating the quick dissemination of AR traits into an entire ecosystem (Rosvoll et al., 2010). In another study, Cocconcelli, et al. exposed the transfer of tetracycline and vancomycin resistance among enterococcal strains involved in the cheese and sausage fermentation (Cocconcelli et al., 2003).

Studying and elucidating the mechanisms involved in the development, maintenance and dissemination of ART enterococci is essential for developing targeted counter strategies that minimize AR transmission in food and further control the AR transmission in enterococci.

37 2.13 References

Aires, J. R., T. Kohler, H. Nikaido, and P. Plesiat. 1999. Involvement of an active efflux system in the natural resistance of Pseudomonas aeruginosa to aminoglycosides. Antimicrob. Agents. Chemother. 43:2624-2628.

Alekshun, M. N., and S. B. Levy. 2007. Molecular mechanisms of antibacterial multidrug resistance. Cell. 128:1037-1050.

Allen, H. K., J. Donato, H. H. Wang, K. A. Cloud-Hansen, J. Davies, and J. Handelsman. 2010. Call of the wild: antibiotic resistance genes in natural environments. Nat. Rev. Microbiol. 8:251-259.

Amábile-Cuevas, C. F. 1993. Origin, evolution and spread of antibiotic resistance genes. R.G. Landes Co., Austin TX.

Anderson, D. G., and L. L. McKay. 1984. Genetic and physical characterization of recombinant plasmids associated with cell aggregation and high-frequency conjugal transfer in Streptococcus lactis ML3. J. Bacteriol. 158:954-962.

Andrup, L., J. Damgaard, and K. Wassermann. 1993. Mobilization of small plasmids in Bacillus thuringiensis subsp. israelensis is accompanied by specific aggregation. J. Bacteriol. 175:6530-6536.

Benveniste, R., and J. Davies. 1973. Aminoglycoside antibiotic-inactivating enzymes in actinomycetes similar to those present in clinical isolates of antibiotic-resistant bacteria. Proc. Natl. Acad. Sci. USA. 70:2276-2280.

Blahova, J., K. Kralikova, K. V. Sr, and N. Bartonikova. 1999. High-frequency transduction of antibiotic resistance in Pseudomonas aeruginosa by a wild-type bacteriophage with restricted specificity for recipient strains. Eur. J. Clin. Microbiol. Infect. Dis. 18:152-4.

Blomqvist, T., H. Steinmoen, and L. S. Havarstein. 2006. Natural genetic transformation: A novel tool for efficient genetic engineering of the dairy bacterium Streptococcus thermophilus. Appl. Environ. Microbiol. 72:6751-6756.

Boguslawska, J., J. Zycka-Krzesinska, A. Wilcks, and J. Bardowski. 2009. Intra- and interspecies conjugal transfer of Tn916-like elements from Lactococcus lactis in vitro and in vivo. Appl. Environ. Microbiol. 75:6352-60.

Boucher, H. W., G. H. Talbot, J. S. Bradley, J. E. Edwards, D. Gilbert, L. B. Rice, M. Scheld, B. Spellberg, and J. Bartlett. 2009. Bad bugs, no drugs: no ESKAPE! An update from the Infectious Diseases Society of America. Clin. Infect. Dis. 48:1-12.

38 Brabban, A. D., E. Hite, and T. R. Callaway. 2005. Evolution of foodborne pathogens via temperate bacteriophage-mediated gene transfer. Foodborne Pathog. Dis. 2:287-303.

Bukowski, M., A. Rojowska, and B. Wladyka. 2011. Prokaryotic toxin-antitoxin systems -the role in bacterial physiology and application in molecular biology. Acta. Biochim. Pol. 58:1-9.

Bushby, S. R., and G. H. Hitchings. 1968. Trimethoprim, a sulphonamide potentiator. Br. J. Pharmacol. Chemother. 33:72-90.

Cambray, G., A. M. Guerout, and D. Mazel. 2010. Integrons. Annu. Rev. Genet. 44:141- 166.

Carattoli, A. 2001. Importance of integrons in the diffusion of resistance. Vet. Res. 32:243-259.

Castanon, J. I. 2007. History of the use of antibiotic as growth promoters in European poultry feeds. Poult. Sci. 86:2466-2471.

Chopra, I., and M. Roberts. 2001. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 65:232-260.

Çitak, S., N. Yucel, and S. Orhan. 2004. Antibiotic resistance and incidence of Enterococcus species in Turkish white cheese. Int. J. Dairy Technol. 57:27-31.

Clark, N. C., O. Olsvik, J. M. Swenson, C. A. Spiegel, and F. C. Tenover. 1999. Detection of a streptomycin/spectinomycin adenylyltransferase gene (aadA) in Enterococcus faecalis. Antimicrob. Agents. Chemother. 43:157-160.

Clewell, D. B., and G. M. Dunny. 2002. Conjugation and genetic exchange in enterococci, p.265-300. In M.S. Gilmore, D. B. Clewell, P. Courvalin, G. M. Dunny, B. E. Murray, L. B. Rice (ed.), The enterococci: pathogenesis, molecular biology and antibiotic resistance. ASM Press, Washington, DC.

Clewell, D. B., and M. V. Francia. 2004. Conjugation in Gram-Positive bacteria, p. 227- 256. In G. Phillips, and B. E. Funnell (ed.), Plasmid biology. ASM Press, Washington, D.C.

Cocconcelli, P. S., D. Cattivelli, and S. Gazzola. 2003. Gene transfer of vancomycin and tetracycline resistances among Enterococcus faecalis during cheese and sausage fermentations. Int. J. Food Microbiol. 88:315-23.

Colomer-Lluch, M., J. Jofre, and M. Muniesa. 2011. Antibiotic resistance genes in the bacteriophage DNA fraction of environmental samples. PLoS One. 6:e17549. doi: 10.1371/journal.pone.0017549. 39 Conter, M., D. Paludi, E. Zanardi, S. Ghidini, A. Vergara, and A. Ianieri. 2009. Characterization of antimicrobial resistance of foodborne Listeria monocytogenes. Int. J. Food Microbiol. 128:497-500.

Davies, J. 2007. Microbes have the last word. A drastic re-evaluation of antimicrobial treatment is needed to overcome the threat of antibiotic-resistant bacteria. EMBO Rep. 8:616-621.

Davis, C., D. P. Blayney, D. Dong, S. Stefanova, and A. Johnson. 2010. Long-Term Growth in US Cheese Consumption May Slow. http://www.ers.usda.gov/Publications/ldp/2010/07jul/ldpm19301/.

Davis, M. A., D. D. Hancock, and T. E. Besser. 2002. Multiresistant clones of Salmonella enterica: The importance of dissemination. J. Lab. Clin. Med. 140:135-141.

Davison, J. 1999. Genetic exchange between bacteria in the environment. Plasmid. 42:73- 91. de Niederhausern, S., M. Bondi, P. Messi, R. Iseppi, C. Sabia, G. Manicardi, and I. Anacarso. 2011. Vancomycin-resistance Transferability from VanA Enterococci to Staphylococcus aureus. Curr. Microbiol. 62:1363-1367.

Depardieu, F., I. Podglajen, R. Leclercq, E. Collatz, and P. Courvalin. 2007. Modes and modulations of antibiotic resistance gene expression. Clin. Microbiol. Rev. 20:79-114.

Dibner, J. J., and J. D. Richards. 2005. Antibiotic growth promoters in agriculture: history and mode of action. Poult. Sci. 84:634-643.

Dorland, W. A. N. 2007. Dorland's Illustrated Medical Dictionary, 31st ed. Saunders Press, Philadelphia, Pa.

Dunny, G. M. 2007. The peptide pheromone-inducible conjugation system of Enterococcus faecalis plasmid pCF10: cell-cell signalling, gene transfer, complexity and evolution. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 362:1185-1193.

Facklam, R. R., M. D. G. S. Carvalbo and L. M. Teixeria. 2002. History, taxonomy, biochemical characteristics and antibiotic susceptibility testing of enterococci, p. 1-54. In M.S. Gilmore, D. B. Clewell, P. Courvalin, G. M. Dunny, B. E. Murray, L. B. Rice (ed.), The enterococci: pathogenesis, molecular biology and antibiotic resistance. ASM Press, Washington, DC.

40 Falagas, M. E., and D. E. Karageorgopoulos. 2009. Extended-spectrum beta-lactamase- producing organisms. J. Hosp. Infect. 73:345-354.

Ferber, D. 2003. Antibiotic resistance. WHO advises kicking the livestock antibiotic habit. Science. 301:1027.

Florez, A. B., S. Delgado, and B. Mayo. 2005. Antimicrobial susceptibility of lactic acid bacteria isolated from a cheese environment. Can. J. Microbiol. 51:51-58.

Fluit, A. C., and F. J. Schmitz. 2004. Resistance integrons and super-integrons. Clin. Microbiol. Infect. 10:272-288.

Fox, P. F., T. M. Cogan, and T. P. Guinee. 2000. Fundamentals of cheese science. Aspen publishers. Gaitherburg, MD.

Franz, C. M. A. P., W. H. Holzapfel, and M. E. Stiles. 1999. Enterococci at the crossroads of food safety? Int. J. Food Microbiol. 47:1-24.

Gasson, M. J., and C. A. Shearman. 2005. Plasmid biology, conjugation, and transposition, p. 25-44. In B. J. B Wood, and P. J. Warner (Ed.), Genetics of lactic acid bacteria. Kluwer Academic/Plenum Publishers, New York, NY.

Gulnee, T. P., and P. F. Fox. 2004. Salt in cheese: physical, chemical and biological aspects, p. 207-223. In P. F. Fox, P. L. H. McSweeney, , T. M. Cogan, and, T. P. Guinee. (ed.), Cheese: physical, chemical and biological aspects, 3rd ed. Elsevier Academic press, San Diego, CA.

Handwerger, S., and J. Skoble. 1995. Identification of chromosomal mobile element conferring high-level vancomycin resistance in Enterococcus faecium. Antimicrob. Agents Chemother. 39:2446-2453.

Harakeh, S., I. Saleh, O. Zouhairi, E. Baydoun, E. Barbour, and N. Alwan. 2009. Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products. Sci Total Environ. 407:4022-4027.

Hayes, F. 2003. Toxins-antitoxins: plasmid maintenance, programmed cell death, and cell cycle arrest. Science. 301:1496-1499.

Heng, N. C. K., P. A. Wescombe, J. P. Burton, R. W. Jack, and J. R. Tagg. 2007. p.45-92. In M. A. Riley, and M. A. Chavan (ed.), Bacteriocins: ecology and evolution. Springer- Verlag, Berlin, Germany.

41 Hidron, A. I., J. R. Edwards, J. Patel, T. C. Horan, D. M. Sievert, D. A. Pollock, S. K. Fridkin, National Healthcare Safety Network Team, and Participating National Healthcare Safety Network Facilities. 2008. NHSN annual update: antimicrobial-resistant pathogens associated with healthcare-associated infections: annual summary of data reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2006-2007. Infect. Control Hosp. Epidemiol. 29:996-1011.

Hirt, H., D. A. Manias, E. M. Bryan, J. R. Klein, J. K. Marklund, J. H. Staddon, M. L. Paustian, V. Kapur, and G. M. Dunny. 2005. Characterization of the pheromone response of the Enterococcus faecalis conjugative plasmid pCF10: complete sequence and comparative analysis of the transcriptional and phenotypic responses of pCF10- containing cells to pheromone induction. J. Bacteriol. 187:1044-1054.

Hummel, A., W. H. Holzapfel, and C. M. Franz. 2007. Characterisation and transfer of antibiotic resistance genes from enterococci isolated from food. Syst. Appl. Microbiol. 30:1-7.

Jacobsen, L., A. Wilcks, K. Hammer, G. Huys, D. Gevers, and S. R. Andersen. 2007. Horizontal transfer of tet(M) and erm(B) resistance plasmids from food strains of Lactobacillus plantarum to Enterococcus faecalis JH2-2 in the gastrointestinal tract of gnotobiotic rats. FEMS Microbiol. Lett. 59:158-166.

Johnsborg, O., V. Eldholm, and L. S. Havarstein. 2007. Natural genetic transformation: prevalence, mechanisms and function. Res. Microbiol. 158:767-778.

Johnsen, P. J., J. I. Osterhus, H. Sletvold, M. Sorum, H. Kruse, K. Nielsen, G. S. Simonsen, and A. Sundsfjord. 2005. Persistence of animal and human glycopeptide- resistant enterococci on two Norwegian poultry farms formerly exposed to avoparcin is associated with a widespread plasmid-mediated vanA element within a polyclonal enterococcus faecium population. Appl. Environ. Microbiol. 71:159-168.

Jones, R. N. 2001. Resistance patterns among nosocomial pathogens: trends over the past few years. Chest. 119:397S-404S.

Jonsson, M., and G. Swedberg. 2006. Macrolide resistance can be transferred by conjugation from viridans streptococci to Streptococcus pyogenes. Int. J. Antimicrob. Agents. 28:101-103.

Kastner, S., V. Perreten, H. Bleuler, G. Hugenschmidt, C. Lacroix, and L. Meile. 2006. Antibiotic susceptibility patterns and resistance genes of starter cultures and probiotic bacteria used in food. Syst. Appl. Microbiol. 29:145-155.

Kawalec, M., J. Kedzierska, A. Gajda, E. Sadowy, J. Wegrzyn, S. Naser, A. B. Skotnicki, M. Gniadkowski, and W. Hryniewicz. 2007. Hospital outbreak of vancomycin-resistant enterococci caused by a single clone of Enterococcus raffinosus and several clones of Enterococcus faecium. Clin. Microbiol. Infect. 13:893-901. 42 Kingston, W. 2008. Irish contributions to the origins of antibiotics. Ir. J. Med. Sci. 177:87-92.

Kitaoka, M., S. T. Miyata, D. Unterweger, and S. Pukatzki. 2011. Antibiotic resistance mechanisms of Vibrio cholerae. J. Med. Microbiol. 60:397-407.

Klare, I., C. Konstabel, D. Badstubner, G. Werner, and W. Witte. 2003. Occurrence and spread of antibiotic resistances in Enterococcus faecium. Int. J. Food Microbiol. 88:269- 290.

Kosikowski, F. V. 1982. Cheese and fermented milk foods, 2nd ed. F. V. Kosikowski and Associates, Brookdontale, N.Y.

Larson, E. 2007. Community factors in the development of antibiotic resistance. Annu. Rev. Public Health. 28:435-447.

Lawley, T., B. M. Wilkins, and L. S. Frost. 2004. Conjugation in Gram-Negative bacteria, p. 203-226. In G. Phillips, and B. E. Funnell (ed.), Plasmid biology. ASM Press, Washington, D.C.

Lee, J. H., and D. J. O'Sullivan. 2010. Genomic insights into bifidobacteria. Microbiol. Mol. Biol. Rev. 74:378-416.

Lesch, J. E. 2007. The first miracle drugs: how the sulfa drugs transformed medicine. Oxford University Press, New York, NY.

Levy, S. B. 2002. The 2000 Garrod lecture. Factors impacting on the problem of antibiotic resistance. J. Antimicrob. Chemother. 49:25-30.

Li, X., and H. H. Wang. 2010. Tetracycline resistance associated with commensal bacteria from representative ready-to-consume deli and restaurant foods. J. Food Prot. 73:1841-1848.

Li, Y. H., P. C. Lau, J. H. Lee, R. P. Ellen, and D. G. Cvitkovitch. 2001. Natural genetic transformation of Streptococcus mutans growing in biofilms. J. Bacteriol. 183:897-908.

Llosa, M., F. X. Gomis-Ruth, M. Coll, and F. de la Cruz Fd. 2002. Bacterial conjugation: a two-step mechanism for DNA transport. Mol. Microbiol. 45:1-8.

Luangtongkum, T., B. Jeon, J. Han, P. Plummer, C. M. Logue, and Q. Zhang. 2009. Antibiotic resistance in Campylobacter: emergence, transmission and persistence. Future Microbiol. 4:189-200.

Luo, H., K. Wan, and H. H. Wang. 2005. High-frequency conjugation system facilitates biofilm formation and pAMbeta1 transmission by Lactococcus lactis. Appl. Environ. Microbiol. 71:2970-2978. 43 Manuzon, M. Y., S. E. Hanna, H. Luo, Z. Yu, W. J. Harper, and H. H. Wang. 2007. Quantitative assessment of the tetracycline resistance gene pool in cheese samples by real-time TaqMan PCR. Appl. Environ. Microbiol. 73:1676-1677.

Mater, D. D., P. Langella, G. Corthier, and M. J. Flores. 2008. A probiotic Lactobacillus strain can acquire vancomycin resistance during digestive transit in mice. J. Mol. Microbiol. Biotechnol. 14:123-127.

McDonald, L. C. 2006. Trends in antimicrobial resistance in health care-associated pathogens and effect on treatment. Clin. Infect. Dis. 42 Suppl 2:S65-S71.

McGowan-Spicer, L. L., P. J. Fedorka-Cray, J. G. Frye, R. J. Meinersmann, J. B. Barrett, and C. R. Jackson. 2008. Antimicrobial resistance and virulence of Enterococcus faecalis isolated from retail food. J. Food Prot. 71:760-769.

McManus, P. S., V. O. Stockwell, G. W. Sundin, and A. L. Jones. 2002. Antibiotic use in plant agriculture. Annu. Rev. Phytopathol. 40:443-465.

Miranda, J. M., A. C. Mondragon, B. Martinez, M. Guarddon, and J. A. Rodriguez. 2009. Prevalence and antimicrobial resistance patterns of Salmonella from different raw foods in Mexico. J. Food Prot. 72:966-971.

Miriagou, V., P. T. Tassios, N. J. Legakis, and L. S. Tzouvelekis. 2004. Expanded- spectrum cephalosporin resistance in non-typhoid Salmonella. Int. J. Antimicrob. Agents. 23:547-555.

Mohamed, J. A., and D. B. Huang. 2007. Biofilm formation by enterococci. J. Med. Microbiol. 56:1581-1588.

Moritz, E. M., and P. J. Hergenrother. 2007. Toxin-antitoxin systems are ubiquitous and plasmid-encoded in vancomycin-resistant enterococci. Proc. Natl. Acad. Sci. USA 104:311-316.

Munday, C. J., G. M. Whitehead, N. J. Todd, M. Campbell, and P. M. Hawkey. 2004. Predominance and genetic diversity of community-and hospital-acquired CTX-M extended-spectrum beta-lactamases in York, UK. J. Antimicrob. Chemother. 54:628-633.

Murray, B. E. 2000. Vancomycin-resistant enterococcal infections. N. Engl. J. Med. 342:710-721.

Murray, B. E., and B. Mederski-Samaroj. 1983. Transferable beta-lactamase. A new mechanism for in vitro penicillin resistance in Streptococcus faecalis. J. Clin. Invest. 72:1168-1171.

44 O'Connor, L., M. O'Leary, N. Leonard, M. Godinho, C. O'Reilly, L. Coffey, J. Egan, and R. O'Mahony. 2010. The characterization of Listeria spp. isolated from food products and the food-processing environment. Lett. Appl. Microbiol. 51:490-498.

Pakyz, A., and R. Polk. 2007. Antibiotic use in hospitals in the United States SCOPE- MMIT antimicrobial surveillance network, p, 83-91. In I. M. Gould, and J. W. M. van der Meer (ed.), Antibiotic policies: fighting resistance. Springer, New York, NY.

Partridge, S. R., G. Tsafnat, E. Coiera, and J. R. Iredell. 2009. Gene cassettes and cassette arrays in mobile resistance integrons. FEMS Microbiol. Rev. 33:757-784.

Pole, K. 2005. Pseudomonas aeruginosa, p. 355-366. In D. G. White, M. N. Alekshun, and P. F. McDermott (ed.), Frontiers in antimicrobial resistance :a tribute to Stuart B. Levy. ASM press, Washington, DC.

Reniero, R., P. Cocconcelli, V. Bottazzi, and L. Morelli. 1992. High frequency of conjugation in Lactobacillus mediated by an aggregation-promoting factor. J. Gen. Microbiol. 138:763-768.

Rice, L. B., and L. L. Carias. 1998. Transfer of Tn5385, a composite, multiresistance chromosomal element from Enterococcus faecalis. J. Bacteriol. 180:714-721.

Roberts, A. P., I. J. Davis, L. Seville, A. Villedieu, and P. Mullany. 2006. Characterization of the ends and target site of a novel tetracycline resistance-encoding conjugative transposon from Enterococcus faecium 664.1H1. J. Bacteriol. 188:4356-4361.

Roberts, M. C. 2005(a). Update on acquired tetracycline resistance genes. FEMS Microbiol. Lett. 245:195-203.

Roberts, M. 2005(b). Tetracycline resistance due to ribosomal protection proteins, p. 19- 28. In D. G., White, M., N. Alekshun, and P. F. McDermott (ed.), Frontiers in antimicrobial resistance :a tribute to Stuart B. Levy. ASM Press, Washington, DC.

45 Roberts, A. P., I. J. Davis, L. Seville, A. Villedieu, and P. Mullany. 2006. Characterization of the ends and target site of a novel tetracycline resistance-encoding conjugative transposon from Enterococcus faecium 664.1H1. J. Bacteriol. 188:4356-4361.

Rosvoll, T. C., T. Pedersen, H. Sletvold, P. J. Johnsen, J. E. Sollid, G. S. Simonsen, L. B. Jensen, K. M. Nielsen, and A. Sundsfjord. 2010. PCR-based plasmid typing in Enterococcus faecium strains reveals widely distributed pRE25-, pRUM-, pIP501- and pHTbeta-related replicons associated with glycopeptide resistance and stabilizing toxin- antitoxin systems. FEMS Immunol. Med. Microbiol. 58:254-268.

Sabia, C., S. de Niederhausern, E. Guerrieri, M. Bondi, I. Anacarso, R. Iseppi, and P. Messi. 2009. Interference of Lactobacillus plantarum strains in the in vitro conjugative transfer of R-plasmids. Curr. Microbiol. 58:101-105.

Sanders, M. E., L. M. Akkermans, D. Haller, C. Hammerman, J. Heimbach, G. Hormannsperger, G. Huys, D. D. Levy, F. Lutgendorff, D. Mack, P. Phothirath, G. Solano- Aguilar, and E. Vaughan. 2010. Safety assessment of probiotics for human use. Gut Microbes. 1:164-185.

Sanders, P. 2005. Antibiotic use in animals-policies and control measures around Europe, p. 649-671. In I. M. Gould, and J. W. M. van der Meer (ed.), Antibiotic policies: theory and practice. Kluwer Academic/Plenum Publishers, New York, NY.

Sapunaric, F. M., M. Aldemea-Ramos, and L. M. Mcmurry. 2005. Tetracycline resistance: efflux, mutation, and other mechanisms, p. 3-18. In D. G., White, M., N. Alekshun, and P. F. McDermott (ed.), Frontiers in antimicrobial resistance: a tribute to Stuart B. Levy. ASM Press, Washington, DC.

Schmieger, H., and P. Schicklmaier. 1999. Transduction of multiple drug resistance of Salmonella enterica serovar typhimurium DT104. FEMS Microbiol. Lett. 170:251-256.

Schwarz, F. V., V. Perreten, and M. Teuber. 2001. Sequence of the 50-kb conjugative multiresistance plasmid pRE25 from Enterococcus faecalis RE25. Plasmid. 46:170-187.

Schwarz, S., C. Kehrenberg, B. Doublet, and A. Cloeckaert. 2004. Molecular basis of bacterial resistance to chloramphenicol and florfenicol. FEMS Microbiol. Rev. 28:519- 542.

Shahid, M., F. Sobia, A. Singh, A. Malik, H. M. Khan, D. Jonas, and P. M. Hawkey. 2009. Beta-lactams and beta-lactamase-inhibitors in current- or potential-clinical practice: a comprehensive update. Crit. Rev. Microbiol. 35:81-108.

46 Simjee, S., S. E. Manzoor, A. P. Fraise, and M. J. Gill. 2000. Nature of transposon- mediated high-level gentamicin resistance in Enterococcus faecalis isolated in the United Kingdom. J. Antimicrob. Chemother. 45:565-575.

Simjee, S., Y. Zhang, P. F. McDermott, S. M. Donabedian, M. J. Zervos, and J. Meng. 2006. Heterogeneity of vat(E)-carrying plasmids in Enterococcus faecium recovered from human and animal sources. Int. J. Antimicrob. Agents. 28:200-205.

Sletvold, H., P. J. Johnsen, O. G. Wikmark, G. S. Simonsen, A. Sundsfjord, and K. M. Nielsen. 2010. Tn1546 is part of a larger plasmid-encoded genetic unit horizontally disseminated among clonal Enterococcus faecium lineages. J. Antimicrob. Chemother.

Sorum, M., P. J. Johnsen, B. Aasnes, T. Rosvoll, H. Kruse, A. Sundsfjord, and G. S. Simonsen. 2006. Prevalence, persistence, and molecular characterization of glycopeptide- resistant enterococci in Norwegian poultry and poultry farmers 3 to 8 years after the ban on avoparcin. Appl. Environ. Microbiol. 72:516-521.

Soulsby, L. 2007. Antimicrobials and animal health: a fascinating nexus. J. Antimicrob. Chemother. 60 Suppl 1:i77-i78.

Stokes, H. W., and R. M. Hall. 1989. A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: integrons. Mol. Microbiol. 3:1669- 1683.

Strahilevitz, J., G. A. Jacoby, D. C. Hooper, and A. Robicsek. 2009. Plasmid-mediated quinolone resistance: a multifaceted threat. Clin. Microbiol. Rev. 22:664-689.

Teuber, M. 2001. Veterinary use and antibiotic resistance. Curr. Opin. Microbiol. 4:493- 499.

Teuber, M., L. Meile, and F. Schwarz. 1999. Acquired antibiotic resistance in lactic acid bacteria from food. Antonie Van Leeuwenhoek. 76:115-137.

Thaker, M., P. Spanogiannopoulos, and G. D. Wright. 2010. The tetracycline resistome. Cell Mol. Life Sci. 67:419-431.

47 Ubukata, K., M. Konno, and R. Fujii. 1975. Transduction of drug resistance to tetracycline, chloramphenicol, macrolides, lincomycin and clindamycin with phages induced from Streptococcus pyogenes. J. Antibiot. (Tokyo). 28:681-688.

Van Houdt, R., and C. W. Michiels. 2010. Biofilm formation and the food industry, a focus on the bacterial outer surface. J. Appl. Microbiol. 109:1117-1131.

Van Melderen, L., and M. Saavedra De Bast. 2009. Bacterial toxin-antitoxin systems: more than selfish entities? PLoS Genet. 5:e1000437. doi:10.1371/journal.pgen.1000437

Walsh, C. 2003. Antibiotics :actions, origins, resistance. ASM Press, Washington, D.C.

Walsh, P. M., and L. L. McKay. 1981. Recombinant plasmid associated cell aggregation and high-frequency conjugation of Streptococcus lactis ML3. J. Bacteriol. 146:937-944.

Wang, H., J. Broadbent, and J. Kondo. 1994. Analysis of the physical and functional characteristics of cell clumping in lactose-positive transconjugants of Lactococcus lactis spp. lactis ML3. J. Dairy Sci. 77:375-384.

Werner, G., T. M. Coque, A. M. Hammerum, R. Hope, W. Hryniewicz, A. Johnson, I. Klare, K. G. Kristinsson, R. Leclercq, C. H. Lester, M. Lillie, C. Novais, B. Olsson- Liljequist, L. V. Peixe, E. Sadowy, G. S. Simonsen, J. Top, J. Vuopio-Varkila, R. J. Willems, W. Witte, and N. Woodford. 2008. Emergence and spread of vancomycin resistance among enterococci in Europe. Euro. Surveill. 13:19046.

White, D. G., S. Zhao, S. Simjee, D. D. Wagner, and P. F. McDermott. 2002. Antimicrobial resistance of foodborne pathogens. Microbes Infect. 4:405-412.

Willems, R. J., and M. J. Bonten. 2007. Glycopeptide-resistant enterococci: deciphering virulence, resistance and epidemicity. Curr. Opin. Infect. Dis. 20:384-390.

Williams, D. R., and C. M. Thomas. 1992. Active partitioning of bacterial plasmids. J. Gen. Microbiol. 138:1-16.

CHAPTER 3

Dissertation Objectives

Multiple factors can contribute to antibiotic resistance (AR) in the cheese making process. The goal of this study was to determine the Critical Control Points (CCP) for reducing antibiotic resistant (ART) bacteria in the cheese fermentation environment, and to identify molecular mechanisms potentially contributing to the AR dissemination and persistence. Our first objective was to determine critical control points (CCP) during which ART bacteria were introduced or significantly amplified throughout the dairy fermentation process and analyze the effectiveness of targeted control strategies. We assessed ART bacterial profiles, AR determinants and their carriers throughout the dairy fermentation process from raw milk to ripened products in pilot plant and commercial manufacturing facilities. Potential factors contributing to AR contamination examined included commercial starter cultures, plant-maintained starter cultures, pasteurization, ripening process, and antibiotic. We further evaluated the effectiveness of the control strategies by assessing the microbial profiles of retail cheese samples.

Cheese making is a complicated process with different steps involved. In cheese manufacturing facilities, even if proper CCP and better regulation are applied, sporadic contamination of ART bacteria can still happen. From the microbiological aspect, to

49 better understand the characteristics regarding AR dissemination and persistence of cheese isolates is important for developing counter strategies to control AR. An antibiotic resistant Enterococcus faecium strain M7M2 was previously isolated from a pilot plant cheese sample, which was highly contaminated with ART bacteria. The second objective of this study was to analyze detailed molecular characteristics of E. faecium M7M2 to reveal its potentials of AR dissemination and persistence. Since the AR genes were identified to be located on a plasmid, the transferability, functionality and persistence of the resistant plasmid were analyzed. The biofilm formation potential of M7M2 was also assessed.

CHAPTER 4

Determination of Critical Control Points to Control Antibiotic Resistance in Cheese

Making Process in Pilot Plant Settings

4.1 Abstract

The prevalence of antibiotic resistant (ART) bacteria in retail cheese products demands for practical intervention approaches to control antibiotic resistance (AR) in cheese. The study identified potential critical control points (CCP) to control AR during cheese making process in pilot plant and laboratory settings. Samples were taken during cheese-making processes in the pilot plant. Raw milk samples were found contaminated with tetracycline resistant (Tetr) bacteria but pasteurized milk and commercial starter cultures were not. Results indicated that AR can be minimized and controlled under proper sanitation and processing controls. Ripening was not likely to support the proliferation of ART bacteria. However, co-inoculation of starter cultures and ART bacteria showed that antibiotic facilitated proliferation of ART bacteria by inhibiting the growth of starter cultures.

51 4.2 Introduction

The rapid emergence of antibiotic resistant (ART) pathogens has been a major public health concern (Levy & Marshall, 2004). Recent findings have shown the prevalence of antibiotic resistance (AR) gene-containing ART commensal bacteria in a broad-spectrum of ready-to-consume items (Duran & Marshall, 2005; Wang et al., 2006;

Zhang et al., 2009; Li & Wang, 2010), suggesting that the food chain likely has served as an important avenue disseminating ART bacteria to the general public. Between 2005-

2006, small-scale surveillance studies using retail samples purchased from national chain grocery stores in the Columbus, Ohio area revealed the presence of high levels of ART bacteria and a representative AR gene pool in most cheese samples (multiple types and brands) examined (Wang et al., 2006; Manuzon et al., 2007). Various commensal bacteria, such as Streptococcus thermophilus, Pseudomonas sp., Staphylococcus sp.,

Lactococcus lactis and Lactococcus sp. were identified to be AR-gene carriers (Wang et al., 2006). The AR genes from certain foodborne isolates were further transmitted to human pathogenic and residential bacteria in laboratory settings by horizontal gene transfer (HGT) mechanisms leading to acquired resistance in the recipient cells, suggesting the functionality and mobility of the foodborne AR genes (Wang et al., 2006;

Feld et al., 2009; Li & Wang, 2010). The high prevalence of ART bacteria and AR gene pool in cheese products and the identification of certain AR gene carriers being lactic acid bacteria (LAB) raised a concern of the potential impact of the dairy fermentation process on ART bacteria emergence and amplification.

Cheese making is a process with complicated changes in microorganisms and chemicals. Different cheese products depend on the ingredients, cultures, process and

52 process conditions for distinct flavors and textures. From the microbiological aspect, multiple factors contribute to the dynamic shift of bacterial populations during the cheese making process. These factors include the ingredients such as milk, starter and adjunct cultures, as well as processing procedures, including pasteurization, brining, fermentation, and ripening. Therefore, control AR in cheese is a complicated issue because many steps, parameters and factors are involved. Recent studies related to AR in cheese were still mainly focused on isolating and analyzing specific ART bacteria, including food-borne pathogens (Harakeh et al., 2009; Rosengren et al., 2010; Spanu et al., 2010),

Enterococcus spp. (Çitak et al., 2004), S. thermophilus (Rizzotti et al., 2009) and

Lactobacillus spp. (Belletti et al., 2009; Comunian et al., 2010) from final cheese products. One study analyzed selective ART LAB isolates during cheese manufacturing and ripening (Florez et al., 2005). Another study analyzed raw milk, natural whey starter culture, rennet and Mozzarella cheese from different cheese manufacturers (Devirgiliis et al., 2010). However, a systemic and comprehensive assessment of contributing factors and practical suggestions for controlling AR during cheesing making process are still limited. Therefore, the objective of this study was to determine potential critical control points (CCP) to control AR in cheese making process by making cheeses in pilot plant settings. The information is essential for further investigation of CCP to control AR in cheese industry and developing counter strategies to reduce AR exposure from fermented dairy foods.

53 4.3 Materials and methods

4.3.1 Bacterial strains and growth conditions

Enterococcus faecium M7M2 was isolated from a cheese sample made in a class in the OSU pilot plant and grown at 37°C in the brain heart infusion (BHI, Becton,

Dickinson and Company, Spark, MD) supplemented with 16 µg/ml tetracycline (Sigma-

Aldrich, St Louis, MO). Frozen stock was stored in BHI broth supplemented with 20% glycerol and kept at -80°C.

Frozen direct set vat (DVS) starter cultures were obtained from Chr. Hansen

Company (Milwaukee, WI). Two types of starter cultures were used in the study:

A: mesophilic culture (F-DVS R-604), containing a mix of L. lactis subsp. lactis and L. lactis subsp. cremoris;

B: thermophlic culture (F-DVS RSF-621), containing a mix of L. lactis, Lactobacillus helveticus and S. thermophilus.

Starter cultures were activated by inoculating 2-3 grams of frozen direct set vat (DVS) starter pellets into 940 ml commercial shelf-stable UHT milk (Parmalt® 2% reduced fat milk, Farmland Dairies, Wallington, NJ), and incubated 18 h at 33ºC or 38ºC, for mesophilic and thermophilic starter cultures, respectively.

4.3.2 Pilot plant scale cheese making and sampling

Raw milk was obtained from OSU dairy farm, stored at 4ºC and pasteurized at

71.7ºC for 30 seconds using a plate heat exchanger (APV Corporation, Buffalo, NY) at the OSU dairy pilot plant. Pasteurized milk was stored at 4ºC and used for cheese making at the OSU dairy pilot plant within 24 hours.

54 Each batch of cheese making included three vats. In the first round (Batch #1 &

#2), three vats of cheese were made with:

1) mesophilic culture A;

2) thermophilic culture B; and

3) thermophilic culture B + sub-lethal concentration of tetracycline (0.25µg/ml).

The second round (Batch #3 & #4) of cheese making used

1) thermophilic culture B + low dose (1 CFU/ml) of M7M2;

2) thermophilic culture B + low dose of M7M2 + 0.25 µg/ml of tetracycline; and

3) thermophilic culture B (control).

Cheddar cheese making were adapted from standard procedures (Kosikowski, 1982):

1. Cleaning the equipment

All equipment and utensils were thoroughly cleaned using sanitizers or chlorinated cleaner. Cheese vats and milk tanks were also steamed for at least 2 minutes before used. Utensils were also steamed or disinfected by 70% ethanol before used to prevent cross contamination.

2. Milk treatment

Raw milk was obtained from OSU dairy farm, stored at 4ºC and pasteurized at

71.7ºC for 30 seconds using high temperature-short time (HTST) pasteurizer in the OSU dairy pilot plant within 10 hours after harvesting. Pasteurized milk was stored at 4ºC and used for cheese making at the OSU dairy pilot plant within 24 hours.

3. Making the curd

Five gallons milk was used for each cheese vat. The vat was steamed heated and was monitored to a temperature of approximately of 34°C to 37°C. Preliminary

55 experiments showed thermophilic starter cultures grew faster than mesophilic starter cultures, possible due to the synergistic effect of the strains of thermophilic starter cultures. When the milk reached the temperature of 34°C, it was inoculated with 2%

(w/w) activated mesophilic starter culture A or 1% (w/w) activated thermophilic starter culture B. Inoculated milk was held at 34ºC (for mesophilic culture A) or 37ºC (for thermophilic culture B) in the cheese vat and waited the pH dropped below 6.50, before

15ml 10 times diluted commercial chymosin, Chy-MAX® Extra, Chr Hansen) was added and left undisturbed for 30 min-1 hr.

4. Cutting the curd and cooking

Milk was kept undisturbed for 30-60 min for coagulation and curd forming.

Quarter inch knives, vertical knife first then horizontal knife, were used to cut the curd to small pieces. Curd was cut in smooth and continuous motions and then cooked in whey at

34ºC for 20 minutes with gentle stirring.

5. Draining the whey, cheddaring the curd, and cutting

Whey was drained off after cooking. Curds were put together and were further dived to 6-8 blocks, 3-4 on each side inside the cheese vat. Blocks were flipped every 20 minutes and repeat 4-5 times. Then blocks were weighted and cut to small pieces of curds again.

6. Salting the curds, pressing/molding and packing

Added 2% of salt and mixed it well into the curds. The curds were transferred in to cheese molds and pressed at room temperature. Molded curds was turned once after 2-

3 hours and turned 1-2 times before left at room temperature overnight. Cheese was then subject to vacuum packing and stored at 7ºC for ripening.

56 4.3.3 Sampling from pilot plant cheese making process

Samples including raw milk, pasteurized milk, starter culture, whey, cheese curds before salting, cheese curds before ripening, and ripened cheese samples were collected.

4.3.4 Laboratory assessment of the impact of antibiotic on dairy microbes

Four grams of activated thermophilic starter culture B was inoculated into 36 grams of UHT milk containing 0, 0.25, 0.5 and 1 µg/ml of tetracycline. All milk culture tubes were further spiked with a same dose of tetracycline resistant (Tetr) E. faecium

M7M2 (4-10 CFU/ml). In order to imitate the cheese making conditions, all tubes were first incubated at 37ºC for 6 hrs. Then 30% (w/v) NaCl solution was added to each tube to a final concentration of 2% (w/w) and all tubes were further incubated at room temperature for 18 hrs. At 3, 6 and 24 hrs, 1 ml of samples was aseptically removed from the tubes and subject to microbial assessments. Final pH values at 24 h were recorded.

The experiment was repeated three times. Comparisons of cell counts of different tubes and pH values were analyzed using one-way ANOVA following Tukey‟s post hoc comparisons by PASW Statistics 18 software (SPSS Inc, Chicago, IL).

Tetr isolates from cheese made in the pilot plant and this experiment were randomly selected and screened by PCR using E. faecium specific primers to confirm the possible identification of Tetr isolates. Firstly, a single colony was dissolved in 150-200

µl extraction buffer (20 mM Tris, 2 mM EDTA and 1.2% Triton X-100, pH 8.0)

(Iwamoto et al., 2003). The mixture was boiled for 20 min and put on ice immediately.

After 2 min centrifuge at 10000 rpm, supernatant was used as template for the PCR reaction. Specific primers (Fea1 5'-CCAAGGCTTCTTAGAGA-3' and Fea2 5'- 57 CATCGTGTAAGCTAACTTC-3') modified from Dutka-Malen (Dutka-Malen et al.,

1995) targeting ddl gene of E. faecium were used for the screening. PCR reaction mixtures were prepared in a 25 µl volume containing 2.5 U Taq polymerase (NEB,

Ipswich, MA), 2.5 ul 10×standard buffer, 31.25 nm MgCl2 (NEB), 10 nmol of dNTP (GE

Healthcare, Piscataway, NJ), 0.015 nmol of each primer, and 2 µl prepared template.

PCR conditions were: one cycle at 95°C for 3 min, followed by 35 cycles at 95°C for 30 s,

52°C for 30 s and 68°C for 30 s, with a final extension at 68°C for 5 min using a thermal cycler (MyCycler Bio-Rad, Hercules, CA, USA).

4.3.5 Microbial assessments

All samples were subject to assessments for total bacterial counts and Tetr counts following procedures as described previously (Wang et al., 2006) with slight modifications. For cheese curd and cheese block samples, five grams of each sample were placed in stomach bags containing 10 ml of sterile 0.1% peptone water and homogenized in stomacher bags by Stomacher 80 biomaster (Seward Laboratory Systems

Inc, Bohemia, NY) twice at high speed for 2 minutes each time. Homogenized samples or rinse liquid were serially diluted and plated on Difco Lactobacilli MRS agar (Becton,

Dickinson and Company) and BHI agar for total microbial counts, and on plates with 16

µg/ml tetracycline for Tetr counts. All plates were supplemented with 100 µg/ml cyclohexamide (Sigma-Aldrich, St Louis, MO) to inhibit eukaryotic cells. Plates were incubated aerobically at 30ºC or 37ºC for up to 48 h. The cell numbers reported were means from at least two replicates.

58 4.4 Results

4.4.1 Critical control points assessment for antibiotic resistance mitigation in pilot

scale cheese making.

The total bacterial counts and Tetr bacterial counts of samples collected at key steps of the first round of the cheese making using both mesophilc and thermophilc starter cultures at OSU dairy pilot plant was illustrated in Figure 4.1. While the numbers for both the total and Tetr bacterial counts were high in raw milk samples, pasteurization effectively reduced both and no Tetr nacteria were detected in pasteuried milk (Figure

4.1). No Tetr bacteria were detected from both commercial mesophilic and thermophilic starter cultures. Tetr bacteria were also not detected in samples collected throughout the cheese making process (Figure 4.1), as well as the 6-month ripening period (data not shown. The results indicated that with proper sanitation controls, producing ART bacteria-free cheeses was achievable. In a contained system, the presence of sub-lethal level antibiotic did not lead to the development of corresponding ART bacteria

59 12

10 Inoculation 8

6 log CFU/ml log (g) 4

ND0 Raw milk Psateurized Milk before Whey Curds before Curds before milk rennet added salting ripening

Figure 4.1. Dynamics of total bacterial counts and Tetr bacteria counts during Cheddar type cheese making. Results represent samples collected from cheese made with mesophilic starter culture. Similar results were found by thermophilic culture (data not shown). All plates were aerobically incubated at 30°C for up to 48 hrs. ND: not detected.

Arrow indicates inoculation point. ■: Batch #1, total plate counts; ▲: Batch #2, total plate counts; □: Batch #1, Tetr counts; Δ: Batch #2, Tetr counts.

4.4.2 The impact of low levels of ART bacteria and antibiotic contamination on

ART bacteria proliferation in cheese fermentation.

Occasional contamination with low number of ART bacteria in dairy processing could happen either due to insufficient pasteurization or equipment sanitation. Thus the dynamic changes of ART bacteria in the fermentation process was monitored in cheese

60 making using pasteurized milk spiked with Tetr E. faecium M7M2. Thermophilic culture

B was used in the study because of its increased popularity in commercial cheese making, due to the facilitated acid production and therefore cheese-making process. Figure 4.2 illustrated that the overall change of Tetr bacteria remained within 1 log value during the

6 months ripening period, indicating that ripening did not significantly affect the dynamics of ART bacteria in cheese, even from milk with antibiotic. However, cheese samples made from milk with Tetr E. faecium and tetracycline had slightly higher Tetr bacterial counts than those spiked only with Tetr E. faecium. All 144 randomly selected

ART isolates from ripened cheese samples of Batch #3 and #4 were confirmed to be E. faecium by PCR screening, indicating final ART bacteria were from the proliferation of original inoculated ART bacteria but not through HGT.

61 4

3.5

3 CFU/g

r 2.5

log Tet log 2

1.5

1 0 1 2 3 4 5 6 Month

Figure 4.2. Dynamics of Tetr bacterial counts during ripening of cheese, made with thermophilic starter spiked with Tetr E. faeciums and tetracycline. ■: Batch #3 spiked with Tetr E. faecium; ▲: Batch #4 spiked with Tetr E. faecium; □: Batch #3 spiked with

Tetr E. faecium and tetracycline; Δ: Batch #4 spiked with Tetr E. faecium and tetracycline.

4.4.3 Laboratory assessment of the impact of antibiotic on dairy microbes

To further elucidate the impact of antibiotic on the dynamics of starter culture and

ART bacteria in the dairy environment, the thermophilic starter culture mix B and low dose of Tetr E. faecium M7M2 were co-inoculated under different antibiotic concentration in vitro, and the dynamics of total and Tetr bacteria, as well as acid production were analyzed. After 24 h of incubation, the final pH values of tubes with 0,

0.25, 0.5, 1 µg/ml of tetracycline were 4.15±0.05, 4.26±0.03, 4.52±0.07 and 5.18±0.02

62 (mean±SD, SD: standard deviation, n=3) respectively. The final pH values showed that when tetracycline concentration was or higher than 0.5 µg/ml, the acid production was significantly slower than the control and with 0.25 µg/ml tetracycline (p<0.05).

Accordingly, The final total bacterial and Tetr counts, as illustrated in Figure 4.3, indicated that total bacteria (mostly starter cultures) proliferated significantly more slowly when tetracycline concentration was or higher than 0.5 µg/ml (p<0.05, Figure

4.3A), while the numbers of ART bacteria significantly increased (p<0.05, Figure 4.3B).

Furthermore, 100% out of 182 ART isolates recovered from the end products were also confirmed to be E. faecium by PCR.

63 9.3 9.1 8.9 8.7 tet: 0µg/ml 8.5 tet: 0.25µg/ml

log CFU/ml log 8.3 tet: 0.5µg/ml 8.1 tet: 1µg/ml 7.9 7.7 0h 3h 6h 24h Time A

4 3.5

CFU/ml)] CFU/ml)] 3 ori r 2.5 2 tet: 0µg/ml tet: 0.25µg/ml 1.5 tet: 0.5µg/ml

CFU/ml) /(Tet CFU/ml) 1 r tet: 1µg/ml 0.5

0 log [(Tet log 0h 3h 6h 24h Time B

Figure 4.3. Total bacterial counts (A) and increasing of Tetr bacterial counts (B, ratio of

Tetr bacterial count to original inoculum) of different tubes after different incubation periods. Total plate counts were on MRS plates without tetracycline and Tetr plate counts

64 were on BHI plates with 16μg/ml tetracycline. All plates were aerobically incubated at

37°C for up to 48 hours. Bars represent mean±SEM from three replicates.

4.5 Discussion

Cheese accounts for a larger portion of foods consumption in public than before, demanding a better control of AR issue in cheese. Milk is the main ingredient for cheese.

As expected, pasteurization, which was initially used to kill potential pathogens in raw milk, also eliminated ART bacteria. Cheese made in the pilot plant successfully demonstrated that ART bacteria could also be eliminated with proper sanitation and operation controls. Results of cheese spiked with Tetr bacteria and/or tetracycline indicated that ripening had no significant impact on the dynamics of ART bacteria in cheese. Possibly because pH value already dropped to a low level and salt was added before ripening, the growth of most microbes in cheese were inhibited during ripening.

Therefore, steps before ripening would be the key stage to control AR. A successful dairy fermentation process involves the effective amplification of starter cultures and the inhibition of the growth of spoilage and pathogenic bacteria. Results from this study also indicated that in the dairy fermentation environment, the proliferation of Tetr bacteria was also inhibited by the effective acid production and the dominant growth of the starter cultures. However, when the proper growth of the starter culture was inhibited, in this case by low dose of tetracycline, Tetr bacteria gained survival advantage resulting in increased population density. The increased AR in samples was mainly due to proliferation of the E. faecium M7M2 strain. Results from the study also revealed that

65 with thorough safety screening, commercial starter cultures from major companies were free of detected ART bacteria. Further, there was no indication of detectable HGT events during fermentation and ripening, even at the presence of the corresponding antibiotic, under the specified experimental conditions. However, our result does not exclude the potential involvement of the dairy ART isolates in disseminating AR genes in other environmental conditions, including HGT event in vivo (Feld et al., 2008).

Results from this study indicate that in order to minimize AR in cheese products, proper sanitation and operations are still important. Pasteurization and rapid growth of starter cultures are among the CCP for AR mitigation in cheese fermentation.

4.6 References

Belletti, N., M. Gatti, B. Bottari, E. Neviani, G. Tabanelli, and F. Gardini. 2009. Antibiotic resistance of lactobacilli isolated from two italian hard cheeses. J. Food Prot. 72:2162-2169.

Çitak, S., N. Yucel, and S. Orhan. 2004. Antibiotic resistance and incidence of Enterococcus species in Turkish white cheese. Int. J. Dairy Technol. 57:27-31.

Comunian, R., E. Daga, I. Dupre, A. Paba, C. Devirgiliis, V. Piccioni, G. Perozzi, D. Zonenschain, A. Rebecchi, L. Morelli, A. De Lorentiis, and G. Giraffa. 2010. Susceptibility to tetracycline and erythromycin of Lactobacillus paracasei strains isolated from traditional Italian fermented foods. Int. J. Food Microbiol. 138:151-156.

Duran, G. M., and D. L. Marshall. 2005. Ready-to-eat shrimp as an international vehicle of antibiotic-resistant bacteria. J. Food Prot. 68:2395-2401.

Dutka-Malen, S., S. Evers, and P. Courvalin. 1995. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J. Clin. Microbiol. 33:24-27.

66 Feld, L., E. Bielak, K. Hammer, and A. Wilcks. 2009. Characterization of a small erythromycin resistance plasmid pLFE1 from the food-isolate Lactobacillus plantarum M345. Plasmid. 61:159-170.

Feld, L., S. Schjorring, K. Hammer, T. R. Licht, M. Danielsen, K. Krogfelt, and A. Wilcks. 2008. Selective pressure affects transfer and establishment of a Lactobacillus plantarum resistance plasmid in the gastrointestinal environment. J. Antimicrob. Chemother. 61:845-852.

Florez, A. B., S. Delgado, and B. Mayo. 2005. Antimicrobial susceptibility of lactic acid bacteria isolated from a cheese environment. Can. J. Microbiol. 51:51-58.

Iwamoto, T., T. Sonobe, and K. Hayashi. 2003. Loop-mediated isothermal amplification for direct detection of Mycobacterium tuberculosis complex, M. avium, and M. intracellulare in sputum samples. J. Clin. Microbiol. 41:2616-2622.

Kosikowski, F. V. 1982. Cheese and fermented milk foods, 2nd ed. F. V. Kosikowski and Associates, Brookdontale, N.Y.

Levy, S. B., and B. Marshall. 2004. Antibacterial resistance worldwide: causes, challenges and responses. Nat. Med. 10:S122-S129.

Li, X., and H. H. Wang. 2010. Tetracycline resistance associated with commensal bacteria from representative ready-to-consume deli and restaurant foods. J. Food Prot. 73:1841-1848.

67 Wang, H. H., M. Manuzon, M. Lehman, K. Wan, H. Luo, T. E. Wittum, A. Yousef, and L. O. Bakaletz. 2006. Food commensal microbes as a potentially important avenue in transmitting antibiotic resistance genes. FEMS Microbiol. Lett. 254:226-231.

Zhang, X. X., T. Zhang, and H. H. Fang. 2009. Antibiotic resistance genes in water environment. Appl. Microbiol. Biotechnol. 82:397-414.

CHAPTER 5

Determination of Critical Control Points for Antibiotic Resistant Bacteria

Mitigation in Commercial Cheese Manufacturing Facilities

5.1 Abstract

Critical control points (CCP) assessments for the prevalence of antibiotic resistant

(ART) bacteria and representative antibiotic resistance (AR) genes in cheese fermentation were conducted at commercial facilities, for targeted mitigation. Approximately 104

CFU/ml of Tetr bacteria were found in the manufacturer-maintained starter/adjunct culture vat and representative isolates were identified to be Streptococcus thermophilus

(tet(S)). Streptococcus thermophilus (tet(S)), Streptococcus sp. (tet(S)), Leuconostoc sp.

(tet(S)), Lactococcus sp. (tet(S)), Staphylococcus sp. (tet(L)) and Lactobacillus spp.

(tet(M)) were isolated from cheese curds or cheese blocks during cheese making process in manufacturing facilities. Assessed by real-time PCR, overall quantities of AR genes in retail cheese products purchased in 2010 were lower than those from 2006, suggesting improvements in cheese industry. Pasteurization, in-house maintained cultures and other traditional flavor-enhancing practices are among the CCP for minimizing AR in cheese fermentation.

69 5.2 Introduction

The rapid emergence of antibiotic resistant (ART) pathogens has been a major public health concern due to the financial burden in disease treatment and the risk of running out of therapeutic options for bacterial infections (Levy & Marshall, 2004). Even though the application of antibiotics in clinical treatments is a major factor contributing to the selective enrichment of ART pathogens (Lipsitch & Samore, 2002; Levy &

Marshall, 2004), the prevalence of antibiotic resistance (AR) gene-containing ART commensal bacteria in a broad-spectrum of ready-to-consume items reported recently

(Duran & Marshall, 2005; Wang et al., 2006; Zhang et al., 2009; Li & Wang, 2010), suggested that the food chain likely have served as an important avenue disseminating

ART bacteria to the general public. Multiple types and brands of retail cheese samples purchased and analyzed between 2005-2006 from national chain grocery stores in the

Columbus, Ohio area showed the presence of high levels of ART bacteria and a representative AR gene pool examined (Wang et al., 2006; Manuzon et al., 2007). In recent years, ART bacteria from different cheese products have also been found and reported in other countries (Çitak et al., 2004; Belletti et al., 2009; Hammad et al., 2009;

Rizzotti et al., 2009; Ozmen Togay et al., 2010; Spanu et al., 2010). The high prevalence of ART bacteria and AR gene pool and the identification of certain AR gene carriers being lactic acid bacteria raised a concern of the potential impact of the dairy fermentation process on ART bacteria emergence and amplification.

Potential CCP for controlling AR in cheese have been identified in pilot plant settings in Chapter 4. However, cheese making process in commercial cheese manufacturing facilities is more complicated than pilot plant settings, because more

70 equipment, operators, environmental factors, sources of ingredients are involved. In addition, the large scale production line may induce more factors contributing to the dynamics of the microbes during cheese making process. Thus, identified CCP in pilot plant were not sufficient to cover all possible factors contributing to AR in cheese making process. Therefore, the objective of this study was to determine critical factors on controlling AR in cheese making process by analyzing cheese samples collected during cheese making process in cheese manufacturing plants and further evaluated the CCP identified by analyzing AR level in retail cheese products. The information is essential for controlling AR in cheese industry and developing counter strategies to reduce AR exposure from fermented dairy foods.

5.3 Materials and methods

5.3.1 Sampling from commercial cheese manufacturing facilities

To assess CCP for ART bacteria under commercial manufacturing conditions, samples including raw milk, pasteurized milk, starter culture, cheese curds, whey, and cheese samples during ripening were collected throughout the Swiss cheese making process from two commercial manufacturing facilities in Ohio, designated as Plant #I and

Plant #II. Samples were placed in 4ºC cooler during shipment and assessed at OSU food microbial lab within 12 hrs of collection.

5.3.2 Microbial assessment

All samples were subject to assessments for total bacterial counts and tetracycline resistant (Tetr) bacterial counts following the procedures described in 4.3.5. Additional

71 BHI plates with 64 µg/ml tetracycline were also used for the recovery of tetracycline resistant bacteria and were incubated anaerobically at 30ºC or 37ºC for up to 48 h. All plates were supplemented with 100 µg/ml cyclohexamide (Sigma-Aldrich, St Louis, MO) to inhibit eukaryotic cells.

5.3.3 AR gene detection and identification of AR-gene carriers

Conventional PCR was used to detect the presence of selective tetracycline resistance (tetr) genes (tet(M), tet(S), tet(L) and tet(K)) in ART isolates following procedures described previously (Li & Wang, 2010) with slight modification (Table 5.1).

Templates for PCR were prepared by the bead-beating method described previously

(Wang et al., 2006) or an alternative boiling method mentioned in 4.3.4. Briefly, a single colony was dissolved in 150-200 µl extraction buffer (20 mM Tris, 2 mM EDTA and 1.2%

Triton X-100, pH 8.0) (Iwamoto et al., 2003). The mixture was boiled for 20 min and put on ice immediately. After 2 min centrifuge at 9300 × g, supernatant was used as template for the PCR reaction. PCR conditions were: one cycle at 94°C for 3 min, followed by 35 cycles at 94°C for 30 s, 50°C for 30 s and 68°C for 50 s, with a final extension at 68°C for 5 min using a thermal cycler (MyCycler, Bio-Rad, Hercules, CA, USA). The AR gene carriers were identified by PCR amplification of the partial 16S rRNA gene fragment and sequence analysis following procedures as described previously (Connor et al., 2005).

Amplicon Gene Sequence (5' to 3') Reference and note size (bp) a GAACGCCAGAGAGGTATTAC (F ) (Li & Wang, 2010), with tet(S) 1050 TACCTCCATTTGGACCTCAC (Rb) modification

GAACTCGAACAAGAGGAAA (Fa) (Li & Wang, 2010), with tet(M) b 979 CCAATACAATAGGAGCAAGC (R ) modification TTGGATCGATAGTAGCCATG (Fa) tet(L) 908 (Li & Wang, 2010) GTAACCAGCCAACTAATGAC (Rb) AGGATAGCCATGGCTACAAG (Fa) tet(K) b 981 (Li & Wang, 2010)

7 ACAAGGAGTAGGATCTGCTG (R )

3 16S AGAGTTTGATCCTGGCTCAG (Fa) (Weisburg et al., 1991; Li 1498 rRNA TACCTTGTTACGACTT (Rb) & Wang, 2010) GTATGTTCATCTTTCTAAG (Fa) (Manuzon et al., 2007), tet(S) 190 GCAATAACATCTTTTCAAC (Rb) primers for real-time PCR GAACATCGTAGACACTCAATTG (Fa) (Kinkelaar, 2008), primers tet(M) 168 CAAACAGGTTCACCGG (Rb) for real-time PCR tet(S) FAM-CCATGTGTCCAGGAGTATCTAC-BHQ (Pc) - (Manuzon et al., 2007) tet(M) FAM-CGGTGTATTCAAGAATATCGTAGTG-BHQ (Pc) - (Kinkelaar, 2008)

Table 5.1. Primers and probes used in this study.

a F: Forward primer

b R: Reverse primer

c P: Probe for real-time PCR

73 5.3.4 Quantitative assessment of AR genes in commercial cheese samples by real-

time PCR

Twelve cheese samples involving 8 brands purchased in 2010 from 2 grocery chain stores in the Columbus (OH) area and analyzed for tetracycline resistant (Tetr) counts as well as tet(S) and tet(M) gene pools using conventional plate counting and a real-time PCR assay following procedures described previously with slight modification

(Manuzon et al., 2007). MRS agar plates with 16 g/ml tetracycline were used to recovery

Tetr bacteria and were incubated aerobically at 37ºC for 48 hr. PCR conditions were: one cycle at 95°C for 3 min, followed by 40 cycles at 95°C for 30 s, 55°C for 30 s and 68°C for 20 s, with a final extension at 68°C for 5 min using a using a iCycler iQTM real-time

PCR detection system (Bio-Rad Laboratories). Primers and probes used were listed in

Table 5.1. The 1262-bp tet(M) gene fragment obtained by PCR using forward primer for screening of tet(M) gene and reverse primer for tet(M) real-time PCR, and the 1050-bp tet(S) gene fragment obtained by PCR using primers for screening of tet(S) gene were confirmed by sequencing before serially diluted and used as standards respectively.

Tetr E. faecium M7M2 carrying both tet(M) and tet(L) was grown in BHI containing 16 ug/ml tetracycline. Overnight culture was serially diluted and spiked to reference cheese samples made in OSU pilot plant with no Tetr bacteria detected as validation for the method.

74 5.4 Results

5.4.1 Critical Control Points for ART bacteria mitigation in commercial cheese

manufacturing facilities.

As in the case of the pilot plant Cheddar type cheese study, no Tetr bacteria were detected in pasteurized milk. Tetr bacteria were at 102 CFU/ml (g) level or less in most samples collected during the Swiss cheese making process. The commercial starter cultures were free of Tetr bacteria. However, high number of Tetr bacteria (9.2×103

CFU/ml) were found in the adjunct starter culture maintained by the cheese Plant #I and selected isolates were identified to be S. thermophilus (tet(S)), suggesting that the in- house maintained cultures is a CCP for AR mitigation in cheese fermentation. Plant #II did not carry in-house maintained starters in the plant. The presence of AR genes and identified AR gene carriers were summarized in Table 5.2. Representative AR gene carriers included S. thermophilus (tet(S)), Streptococcus sp. (tet(S)), and Lactobacillu sp.

(tet(M)). Leuconostoc sp. (tet(S)), Lactococcus sp. (tet(S)) and Staphylococcus sp. (tet(L)) were also detected.

Resistance gene (no. of Cheese AR gene carrier (no. of carriers/no. Sample carriers/no. of isolates plant # of isolates identified) screened) Adjunct culture I maintained by cheese tet(S) (40/40) Streptococcus thermophilus (4/4) plant Cheese curds after I tet(S)(20/20) Streptococcus thermophilus (6/6) pressing Streptococcus sp. (3/4), Lactococcus I Cheese before brining tet(S) (24/24) sp. (1/4) Leuconostoc sp. (2/3, tet(S)) I Cheese after bring tet(S) (2/3), tet(L)(1/3) Staphylococcus sp. (1/3, tet(L)) II Whey tet(S) (4/4) Streptococcus thermophilus (1/1)

6 Cheese curds before II tet(S) (3/3) Streptococcus thermophilus (2/2) pressing Cheese curds after II tet(S) (53/53) Streptococcus thermophilus (14/14) pressing Streptococcus thermophilus (2/ 3, II Cheese before brining tet(S) (33/36) tet(M) (3/36) tet(S)), Streptococcus sp. (1/ 3, tet(M)) II Cheese after brining tet(S) (19/19) Streptococcus thermophilus (6/6)

Lactobacillus sp. (12/13, tet(M)) Cheese after warm II tet(S) (6/35) tet(M) (29/35) Streptococcus thermophilus (1/13, room ripening tet(S)) Cheese after cold II tet(M) (25/25) Lactobacillus sp. (2/2) room ripening

Table 5.2. Identified AR genes and AR gene carriers from cheese plant samples.

76 5.4.2 Validation of real-time quantitative PCR

In order to validate the real-time quantitative PCR assay, reference cheese samples made in OSU pilot plant with no Tetr bacteria detected were spiked with 104-109

CFU Tetr E. faecium M7M2. Figure 5.1 showed a linear relationship between the copy numbers of the tet(M) gene as measured by real-time PCR and the bacterial counts of E. faecium M7M2 spiked to reference cheese samples. In addition, no tet(M) gene was detected from reference samples without spiked Tetr E. Faecium M7M2, suggesting no tet(M) background from reference cheese samples. The results suggested that real-time quantitative PCR could be used to accurately assess the gene pool in cheese samples.

10 y = 0.9708x + 0.2406 9 R² = 0.9907

5 (M)gene no.copy gram per

tet 4 log 3 3 4 5 6 7 8 9 10 log Tetr CFU/g

Figure 5.1. Correlation between bacterial counts of E. faecium M7M2 and tet(M) gene copy no. assessed by real-time quantitative PCR of spiked cheese samples.

77 5.4.3 Quantitative assessment of AR genes in retail cheese samples.

Tetr bacteria were only detected in 3 out of 12 samples (Figure 5.2), including one with a total of 20 colonies detected on two plates from the least diluted sample, and other two contained 103 CFU/g and 104 CFU/g of cheese, respectively, while 6 out of 11 samples in the 2006 study contained 104-106 CFU/g of cheese. The detection limit for real-time PCR was roughly 100 copies per reaction for reliable and consistent results.

Therefore, the deletection limit for real-time PCR in cheese matrix was approximately

104 copies per g. Accordingly, the tet(S) and tet(M) gene pools in most of the 2010 cheese samples (except the tet(S) gene pool in one sample) were around 104 to 105 copies per g of sample, which is around or slightly above the detection limit using the real-time

PCR method (104 copies per g), while 7 out of 11 cheese samples in the 2006 study contained 107 or above copies of tet(S) gene per g of food (Manuzon et al., 2007).

Because most brands and cheese types examined were the same as those tested in the

2006 study, the data from this small scale study illustrated a reduction of the prevalence of both the ART bacteria and AR gene pool in retail cheese samples in the past 4 years.

78 12

copy no.)copy 8 (S) (S)

tet 6

copy no.) perno.) g copy Approx. detection

(M) (M) 4 limit of real-

tet time PCR in CFU),( log r 2 cheese

matrix

Tet or log(or

log ( log 0 A B C D E F G H I J K L Cheese samples

Figure 5.2. Assessment of antibiotic resistance in commercial cheese samples by conventional plate counting and real-time PCR. MRS agar plats containing 16 µg/ml tetracycline were incubated aerobically at 30°C for 48 h for Tetr bacterial counts. Cheese samples: A: sharp Cheddar; B: mild Cheddar #1; C: mild Cheddar #2; D: mild Cheddar #3;

E: mild Cheddar #4; F: sharp white Cheddar; G: mild Cheddar #5; H: Swiss #1; I: aged

Swiss; J: baby Swiss #1; K: Swiss #2; L: baby Swiss #2. Data represent means of at least two replicates and coefficient variations of log copy no. of resistance gene were less than

0.1. Open bar: log Tetr CFU/g; hatched bar: log tet(S) copy no. per g; solid bar: log tet(M) copy no. per g.

5.5 Discussion

The frequency of HGT is correlated to the size of the AR gene pool and the genetic features including compatibility of the donor and recipient strains. A successful dairy fermentation process involves the effective amplification of starter cultures and the

79 inhibition of the growth of spoilage and pathogenic bacteria. The prevalence of ART bacteria in the final products could be due to the amplification of AR-gene containing starter cultures or ART contaminants throughout the fermentation process, or resulting from HGT events during fermentation and ripening. Even though no specific HGT events were detected in this study, because lactic acid bacteria (LAB) are prone to HGT events in vitro as well as in vivo (Morelli et al., 1988; Luo et al., 2005; Jacobsen et al., 2007;

Feld et al., 2008), the second scenario would still be a concern.

While the AR-gene encoding plasmids from Lactococcus sp. and Enterococcus sp. were transmitted to Streptococcus mutans or Enterococcus faecalis by natural transformation and electroporation (Li & Wang, 2010), we were unsuccessful in illustrating transmission of the AR gene from Tetr S. thermophilus to Tets S. thermophilus under the same laboratory conditions (data not shown). It is expected that the involvement of HGT events likely vary among AR gene carriers, thus proper risk assessment should be based on not only the size of the AR gene pool but also the genetic characteristics of the AR gene carriers. Cultures with potential fermentation or probioitc applications should be characterized at the strain (isolate) level for not only the presence of AR genes but the potential for both acquisition and dissemination such genes via HGT mechanisms.

In agreement with the Cheddar cheese made in pilot plant, commercial starter cultures from major companies were free of Tetr bacteria. However, same as the pilot plant study, our result does not exclude the potential involvement of the dairy ART isolates in disseminating AR genes in other environmental conditions, including HGT event in vivo (Feld et al., 2008).

80 The reduction of the AR prevalence in retail cheese products indicated the effectiveness of targeted mitigation strategies by the dairy and starter culture industry in the past several years. However, the lack of safety screening in locally maintained starters and adjunct cultures, as well as the occasional ART bacterial contamination from the environment and facility during cheese making likely contributed to the sporadic cases of contaminated cheeses. This observation is also in agreement with the recent reports on dairy ART bacteria, but mostly isolated from specialty cheeses and from areas probably with less access to the cutting-edge literature and knowledge (Çitak et al., 2004; Rizzotti et al., 2009; Ozmen Togay et al., 2010; Comunian et al., 2010). However, there is no geographic boundary for the rapid dissemination of problematic organisms nowadays.

LAB are also commonly used in large quantity as fermentation starters and probiotic supplements for human, food and aquaculture animal consumption in developing countries. Thus it is particularly important to properly communicate the scientific knowledge, including the risk factors involved and the mitigation strategies, to the broad audience. Uncovering the tendency, mechanisms and conditions of HGT events and enhancing the safety screening of cultures for beneficial applications are critical for targeted AR mitigation.

5.6 References

Belletti, N., M. Gatti, B. Bottari, E. Neviani, G. Tabanelli, and F. Gardini. 2009. Antibiotic resistance of lactobacilli isolated from two italian hard cheeses. J. Food Prot. 72:2162-2169.

Çitak, S., N. Yucel, and S. Orhan. 2004. Antibiotic resistance and incidence of Enterococcus species in Turkish white cheese. Int. J. Food Microbiol. 57:27-31.

81 Comunian, R., E. Daga, I. Dupre, A. Paba, C. Devirgiliis, V. Piccioni, G. Perozzi, D. Zonenschain, A. Rebecchi, L. Morelli, A. De Lorentiis, and G. Giraffa. 2010. Susceptibility to tetracycline and erythromycin of Lactobacillus paracasei strains isolated from traditional Italian fermented foods. Int. J. Food Microbiol. 138:151-156.

Connor, C. J., H. Luo, B. B. Gardener, and H. H. Wang. 2005. Development of a real- time PCR-based system targeting the 16S rRNA gene sequence for rapid detection of Alicyclobacillus spp. in juice products. Int. J. Food Microbiol. 99:229-235.

Duran, G. M., and D. L. Marshall. 2005. Ready-to-eat shrimp as an international vehicle of antibiotic-resistant bacteria. J. Food Prot. 68:2395-2401.

Kinkelaar, D. F. 2008. M.S. thesis. Profiles of tetracycline resistant bacteria in the human infant digestive system. The Ohio State University, Columbus OH.

Levy, S. B., and B. Marshall. 2004. Antibacterial resistance worldwide: causes, challenges and responses. Nat. Med. 10:S122-S129.

Li, X., and H. H. Wang. 2010. Tetracycline resistance associated with commensal bacteria from representative ready-to-consume deli and restaurant foods. J. Food Prot. 73:1841-1848.

Lipsitch, M., and M. H. Samore. 2002. Antimicrobial use and antimicrobial resistance: a population perspective. Emerg. Infect. Dis. 8:347-354.

Luo, H., K. Wan, and H. H. Wang. 2005. High-frequency conjugation system facilitates biofilm formation and pAMbeta1 transmission by Lactococcus lactis. Appl. Environ. Microbiol. 71:2970-2978. 82 Manuzon, M. Y., S. E. Hanna, H. Luo, Z. Yu, W. J. Harper, and H. H. Wang. 2007. Quantitative assessment of the tetracycline resistance gene pool in cheese samples by real-time TaqMan PCR. Appl. Environ. Microbiol. 73:1676-1677.

Morelli, L., P. G. Sarra, and V. Bottazzi. 1988. In vivo transfer of pAM beta 1 from Lactobacillus reuteri to Enterococcus faecalis. J. Appl. Bacteriol. 65:371-375.

Weisburg, W. G., S. M. Barns, D. A. Pelletier, and D. J. Lane. 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173:697-703.

Zhang, X. X., T. Zhang, and H. H. Fang. 2009. Antibiotic resistance genes in water environment. Appl. Microbiol. Biotechnol. 82:397-414.

CHAPTER 6

Characterization of a Dairy Enterococcus faecium Isolate Carrying a Persistent, TA-

independent Tetracycline Resistance-encoding Plasmid

6.1 Abstract

A tetracycline resistant (Tetr) dairy Enterococcus faecium isolate designated

M7M2 was found to carry both tet(M) and tet(L) genes on a 19.6 kb plasmid. After consecutive transfer in the absence of tetracycline, the resistance-encoding plasmid persisted in 99% of the progenies. DNA sequence analysis revealed that the 19.6 kb plasmid contained 21 ORFs, including a tet(M)-tet(L)-mob gene cluster, as well as a 10.6 kb backbone highly homologous (99.9%) to the reported plasmid pRE25, but withoutidentified toxin-antitoxin (TA) plasmid stabilization system. The derived backbone plasmid without the Tetr-determinants exhibited 100% retention rate in the presence of acridine orange, suggesting the presence of a TA-independent, plasmid stabilization mechanism, with its impact on the persistence of a broad spectrum of resistance-encoding traits to be elucidated. The tet(M)-tet(L) gene cluster from M7M2 was functional and transmissible that led to acquired resistance in Enterococcus faecalis

OG1RF by electroporation and Streptococcus mutans UA159 by natural transformation.

Southern hybridization showed that both the tet(M) and tet(L) genes were integrated into

84 the genome of S. mutans UA159, while the whole plasmid was transferred to and retained in E. faecalis OG1RF. Quantitative real-time RT-PCR indicated induced transcription of both tet(M) and tet(L) genes by tetracycline in pM7M2. E. faecium M7M2 also formed biofilm on stainless steel coupons, suggesting its potential to be persistent in the environment. The results indicated that multiple mechanisms might have contributed to the persistence of the strain and the antibiotic resistance encoding genes, and that the plasmids pM7M2, pIP816, and pRE25 likely are evolutionary correlated.

6.2 Introduction

Enterococci are opportunistic pathogens able to survive in a wide range of environmental conditions (Franz et al., 1999). They are commonly associated with mammalian gastrointestinal (GI) tracts, and are considered as indicators of fecal contamination from humans and animals. Enterococci are prone to horizontal gene transfer (HGT) mechanisms, a feature that empowers this group of bacteria to evolve quickly by rapid acquisition and dissemination of beneficial trait-encoding elements, including antibiotic resistance (AR) genes, from the surroundings and flourish in both the host and natural environment (Fisher & Phillips, 2009). In fact, Enterococcus faecalis and Enterococcus faecium are among the leading causes of nosocomial infections by gram-positive bacteria (Hidron et al., 2008) Particularly, the emergence of vancomycin- resistant enterococci (VRE) and its potential involvement in the dissemination of resistance-encoding traits to other pathogens such as Staphylococcus sp. have become a major public health concern (Willems & Bonten, 2007; de Niederhausern et al., 2011).

To date, various resistance traits (glycopeptides, aminoglycosides, quinopristin-

85 dalfopristin, tetracycline, chloramphenicol, erythromycin, β-lactams, et al.) have been identified in enterococci, many are encoded by mobile elements such as plasmids

(Murray & Mederski-Samaroj, 1983; Schwarz et al., 2001; Simjee et al., 2006; Sletvold et al., 2010), transposons (Handwerger & Skoble, 1995; Rice & Carias, 1998; Simjee et al., 2000; Roberts et al., 2006; Rice et al., 2010) and integrons (Clark et al., 1999).

However, many mobile genetic elements in enterococci, especially large plasmids with multiple IS elements, remain to be cryptic (Hegstad et al., 2010).

Enterococci have also been associated with various food products, especially meat, dairy and produce items (Franz et al., 2001; Schwarz et al., 2001; Li & Wang, 2010). In addition to fecal or environmental contaminants on raw food materials, historically certain enterococcal strains have also been used as fermentation starter cultures and probiotics (Franz et al., 1999). However, foodborne enterococci can also acquire resistance through HGT events. For example, Eaton and Gasson (Eaton & Gasson, 2001) demonstrated that foodborne enterococcal strains were able to acquire virulence factors from clinical isolates through conjugation. Cocconcelli, et al. (Cocconcelli et al., 2003) further illustrated that AR can be transferred in food matrices during processing, with the highest frequency observed in sausage fermentation, among the conditions examined. In the past few years, various antibiotic resistant (ART) commensal enterococcal strains have been isolated from food products (Schwarz et al., 2001; Johnston & Jaykus, 2004;

Wang et al., 2006; Devirgiliis et al., 2010; Li & Wang, 2010; Ozmen Togay et al., 2010), suggesting that daily food intake might be an important avenue for the influx of ART enterococci and AR-encoding genes impacting the human gut microflora.

86 It is well documented that the applications of antibiotics in clinical therapy, as well as in food animal, agriculture and aquaculture productions played an important role in the selection and maintaining of the ART bacterial population (Levy & Marshall,

2004). However, recent data from food animal studies have shown that limiting the use of antibiotics in food animal production resulted in modest reduction in the prevalence instead of elimination of resistance in certain bacteria (Johnsen et al., 2005; Sorum et al.,

2006). Furthermore, results from human infant studies revealed that ART bacteria established, amplified and persisted in human GI track even in the absence of the corresponding antibiotic exposure (Lancaster et al., 2003; Ready et al., 2003, L. Zhang,

D. F. Kinkelaar, Y. Huang, Y. Li, X. Li, H. H. Wang, unpublished data). In addition to incorporation into the chromosome DNA, plasmid-encoded genes can be retained in the bacterial hosts by a number of stabilization mechanisms, such as active partition systems

(Williams & Thomas, 1992), resolution system for plasmid multimers (Summers &

Sherratt, 1984; Williams & Thomas, 1992), and the toxin-antitoxin (TA) systems (Wang,

2009). In TA systems, the host cell produces a toxin protein and an antitoxin component both encoded by the plasmid. The daughter cells that lost the plasmid are not able to produce labile anti-toxins and consequently killed by the stable and potent toxins (Hayes,

2003). To date, various TA systems, such as ω-ε-ζ, axe-txe, and tasA-tasB have been reported in bacteria (Hayes, 2003; Fico & Mahillon, 2006; Moritz & Hergenrother, 2007), including the multidrug encoding plasmid pRE25, originally isolated from an E. faecium isolate from fermented sausage (Schwarz et al., 2001). A recent report further found that pRE25-, pRUM-, pIP501- and pHTbeta-related replicons associated with glycopeptide resistance and the stabilizing TA systems are widely distributed in E. feacium (Rosvoll et

87 al., 2010). The persistence of AR genes in microbial ecosystems even without the antibiotic selective pressure presented a serious challenge for effective mitigation, and revealing the molecular mechanisms involved is essential for the development of targeted counter strategies.

During our study of the ART bacteria from food products, we have isolated a tetracycline resistant (Tetr) isolate, designated M7M2, from a cheese sample made at the

OSU pilot plant. The tetracycline resistance trait was found quite stable after consecutive transfer of the strain in bacterial culture medium without the corresponding antibiotic.

Therefore the purpose of this study was to reveal the genetic characteristics of the tetracycline resistance encoding element to understand the potential persistence mechanism.

6.3 Materials and methods

6.3.1 Strain cultivation

The isolated Tetr strain M7M2 was cultured using brain heart infusion (BHI,

Becton, Dickinson and Company, Spark, MD) broth or agar plate with 16 μg/ml tetracycline (Sigma-Aldrich, St Louis, MO) and incubated at 37ºC for 18 h.

Streptococcus mutans UA159 was cultured in BHI, and Enterococcus faecalis OG1RF was cultured using BHI broth or plate with 25µg/ml rifampicin and incubated at 37ºC for

18 h. Lactococcus lactis 2301 was cultured using M17 (Becton, Dickinson and Company) supplemented with 0.5% glucose (Fisher Scientific, Pittsburg, PA). All cultures were incubated in aerobic condition except for S. mutans UA159 on BHI agar plates, which was incubated anaerobically. SR plates (10 g trytone, 5 g yeast extract, 200g sucrose, 10

88 g glucose, 25 g gelatin and 15 g agar per liter and 2.5 mM MgCl2, 2.5 mM CaCl2, pH 6.8)

(Holo & Nes, 1989) supplemented with 8 μg/ml tetracycline and 25 µg/ml rifampicin were used to select Tetr transformants E. faecalis OG1RF from electroporation.

6.3.2 DNA extraction, AR gene screening and strain identification

Plasmid DNA or total DNA was isolated following the method of Anderson and

Mckay (Anderson & McKay, 1983) or Yu and Morrison (Yu & Morrison, 2004). DNA extract from 5 ml culture was treated with 20 µg RNase (USB, Santa Clara, CA). Plasmid

DNA was digested with BamHI, HindIII or XbaI (NEB, Ipswich, MA), to determine plasmid number. Plasmid DNA from 25 ml culture was further purified using the Plasmid mini-kit (Qiagen) with slight modification. Instead of using culture, 300 μl of each buffer of P1, P2 and P3, , was mixed in a 1.5 ml eppendorf tube and centrifuged at 16100×g for

10 min, then the supernatant was mixed with the crude plasmid DNA extract before loading to the column for further purification following procedures by the manufacturer.

Conventional PCR was used to detect the presence of tetracycline resistance genes as reported previously (Li & Wang, 2010) with modification. Primers TetMFP595

(5‟-GAACTCGAACAAGAGGAAA-3‟) was used instead of TetMFP600 and the sequence for TetSFP160 was changed to TetSFP160(2): 5‟-

GAACGCCAGAGAGGTATTAC-3‟. Bacterial isolates were identified by 16S rRNA partial DNA sequence analysis following published procedures (Wang et al., 2006). E. faecium species-specific primers Fea1 5'-CCAAGGCTTCTTAGAGA-3' and Fea2 5'-

CATCGTGTAAGCTAACTAACTTC-3', modified from Dutka-Malen (Dutka-Malen et al., 1995), targeting the ddl gene of E. faecium were used to confirm E. faecium isolates.

89 6.3.3 Southern blotting analysis

The purified PCR amplicons of tet(L) and tet(M) genes were labeled using the

DIG DNA labeling and detection kit (Roche, Indianapolis, IN) as the hybridization probe.

Hybridization and color detection were conducted following procedures by the manufacturer. Plasmid DNA digested with ATP-dependent DNase (Epicentre

Biotechnologies, Madison, WI), which eliminated linear DNA, including chromosomal

DNA, was also hybridized.

6.3.4 AR stability assessment

An overnight culture of the ART strain was obtained by inoculating 5 ml of BHI broth using a single colony from an overnight culture plate and incubated at 37ºC for 18 h.

Culture was then consecutively inoculated 1:1000 or 1:100000 to fresh BHI with 10

µg/ml or without acridine orange (Sigma-Aldrich), in the absence of tetracycline, for more than 500 generations (>30 days). Serially diluted cultures were spread-plated on

BHI agar plates and incubated at 37ºC for 24h. The resistance retention rate was determined by randomly picking at least 100 colonies from the BHI plates, spotting onto new BHI plates with and without tetracycline (16 μg/ml), and calculating the ratio of resistant to total colonies. Both the resistant and the susceptible colonies were further assessed for the presence of AR genes, the plasmid backbone and species identity by

PCR, and subject to confirmation by plasmid extraction and electrophoresis following standard procedures.

90 6.3.5 AR gene functionality and mobility assessments

Purified DNA of pM7M2 was transferred to S. mutans UA159 by natural transformation following procedures as described previously (Wang et al., 2006). Briefly,

18 h culture of recipient strain was diluted 1:20 to 1:80 to fresh medium and grew to exponential phase (OD600=0.1-0.4), then plasmid extract was added directly to the culture and the culture was further incubated for 1 h before it was spread on agar plates with antibiotic for the selection of transformant. The Tetr transformants were screened on BHI plates supplemented with 16 μg/ml tetracycline. Plates were incubated anaerobically at

37ºC for 48 h. Purified pM7M2 was also electroporated to E. faecalis OG1RF, as described by Gruz-Rodz and Gilmore (Cruz-Rodz & Gilmore, 1990). The Tetr transformants were screened on SR plates supplemented with 8 μg/ml tetracycline and 25

µg/ml rifampicin and incubated aerobically at 37ºC for 24 h. The locations of the resistance genes in transformants were examined by southern hybridization.

6.3.6 Minimum inhibitory concentration (MIC)

MIC values of the strains and derivatives were determined using 96-well microtiter plates, with wells containing 0.25–512 μg/ml tetracycline in BHI broth as described previously (Wang et al., 2006).

6.3.7 Cloning and sequencing of plasmid pM7M2

Purified plasmid DNA was digested with ATP-dependent DNase (Epicentre

Biotechnologies) to eliminate residues of chromosomal DNA. To determine the sequence of pM7M2, the purified plasmid was digested with HindIII and XbaI (Invitrogen,

91 Carlsbad, CA), and ligated to pBluescript II KS (+) digested by the same set of enzymes with T4-ligase (Invitrogen). Ligation product was transformed to competent E. coli Dh5α prepared by CaCl2 treatment following standard protocol (Ausubel et al., 1989; Sambrook et al., 1989). Transformants carrying recombinant plasmids with different pM7M2 fragments were subject to DNA sequence analysis at the Plant Genomic Analysis Facility at the Ohio State University using a DNA analyzer ABI PRISMs 3700 (Applied

Biosystems). To close the gaps, primers were designed according to identified sequences within the fragments and used to PCR the franking products containing the gaps. Both the

PCR products and the purified pM7M2 were further used as templates for direct sequencing. The whole plasmid sequence was covered by the combination of the above methods at least twice. The DNA sequences were compared with those deposited in the

NCBI database by BLASTN. Whole plasmid sequence was compiled using the

DNASTAR software (DNASTAR Inc., Madison, WI).

6.3.8 Tetracycline induced transcription of AR genes

For RNA preparation, 1% 18 h culture of strain M7M2 was cultured in BHI medium containing 0, 8, 16 and 32 μg/ml tetracycline, respectively. Total RNA was extracted from approximately 3-5×108 CFU exponentially growing cells using RNeasy

Mini Kit (Qiagen), and further treated with 2U DNase I (Invitrogen) at 37°C for 30 min.

The chromosomal encoded D-alanine: D-alanine ligase (ddl) gene was used as internal standard for data normalization. In addition to specific primer pair and probe for tet(M) as described previously (Kinkelaar, 2008), specific primer pairs (tet(L)-RT-FP:

5‟CGTCTCATTACCTGATATTGC3‟, tet(L)-RT-RP:

92 5‟AGGAGTAACCTTTTGATGCC3‟; ddl-RT-FP: 5‟CTTTAGCAACAGCCTATCAG3‟, ddl-RT-RP: 5‟ACGTCTTTTACGACTTCACC3), and fluorescence-labeled probes

(5‟FAM-AACCACCTGCGAGTACAAACTGG-BHQ3‟ for tet(L), and 5‟FAM-

TCGTTGAACAAGGAATTGAAGC-BHQ3‟ for ddl) were used for the quantitative real- time reverse transcriptase-PCR (real-time RT-PCR) assessment of the transcription of tet(M), tet(L) genes and the internal control (ddl), respectively. Reaction mixtures in a 25

µl volume contained 12.5 μl of the real-time RT-PCR reacion mix (iScript™ One-Step

PCR Kit for Probes, Bio-Rad Laboratories), 0.012 nmol of each primer, 0.006 nmol probe, 0.5 μl iScript™ MMLV reverse transcriptase from iScript™ One-Step PCR Kit, 1

μl DNase I-treated RNA extract and H2O. A sample without reverse-transcriptase was always included for each sample as control for genomic DNA contamination. Real-time

RT-PCR was performed with the iCycler iQTM real-time PCR detection system (Bio-Rad

Laboratories). The PCR mixture was held at 10 min for 50 °C for reverse transcription,

95 °C for 5 min for inactivation of the reverse transcriptase, followed with PCR cycles:

95°C for 30 s, and 35 cycles of 95°C for 30 s, 55°C for 30 s and 68°C for 20 s, and 68°C for 5 min. The transcription ratios under 8, 16 and 32 μg/ml tetracycline compared to 0

μg/ml tetracycline were calculated by using the threshold cycle (ΔΔCt) method (Livak &

Schmittgen, 2001). Data reported represent the means of three RNA preparations at different days and at least three technical replicates were performed for each RNA sample. Comparisons of transcription levels under different tetracycline treatments were analyzed using one-way ANOVA following Tukey‟s post hoc comparisons using PASW

Statistics 18 software (SPSS Inc, Chicago, IL).

93 6.3.9 Biofilm assessment

Biofilm formation by enterococcal strain was examined by scanning electron microscopy (SEM) following published procedures with slight modification (Luo et al.,

2005). For each sample, 1% fresh culture was inoculated to TSBYE (trypticase soy broth containg 0.25% glucose, plus 0.6% yeast extract, Becton, Dickinson and Company) plus

0.75% glucose, and incubated aerobically at 37˚C for 24 hr. Interval time during dehydration was 30 min instead of 15 min.

6.4 Results

6.4.1 Strain identification and Tetr determinants

The strain M7M2 was identified to be E. faecium by 16S-rRNA partial DNA sequence analysis and species specific PCR. The strain was found containing both the tet(M) and tet(L) genes by PCR. Plasmid gel electrophoresis revealed that M7M2 contained several bands besides chromosomal band. In order to identity the number of plasmid carried by M7M2. Plasmid extract was digested by restriction enzymes BamHI,

XbaI and HindIII and yield 1 (>12 kb), 2 (12 kb and 8 kb), and 4 (1.8 kb, 3 kb, 6 kb and 9 kb) bands respectively (Figure 6.1), indicating M7M2 carried one plasmid, which is about 19-20 kb and different bands from electrophoresis were different plasmid conformations. As shown in Figure 6.2, plasmid DNA with linear DNA digested and the

BamHI-digested plasmid DNA showed positive signals of both tet(M) and tet(L) for hybridization, suggesting that both tet(M) and tet(L) were located on the plasmid.

1 L 2 3 L

12 kb 8 kb 6kb

3 kb

2 kb 1650 bp

Figure 6.1. Restriction enzyme digestion of E. faecium M7M2 plasmid extract. Lane L:

1kb plus DNA ladder; lane 1: digestion product of BamHI; lane 2: digestion product of

HindIII; lane 3: digestion product of XbaI.

S M1M2M3M4 S M5M6M7 S M1M2 M3M4 S M5 M6 M7

S L1 L2 L3 L4 S L5 L6 L7 S L1 L2 L3 L4 S L5 L6 L7

Figure 6.2. Electrophoresis and Southern hybridization of M7M2 plasmid and its transformants of E. faecalis OG1RF and S. mutans UA159. M1-M7: Southern hybridization with tet(M) probe; L1-L7: Southern hybridization with tet(L) probe. lane S:

Supercoiled DNA ladder; lane M1, M5, L1, and L5: plasmid extract of M7M2; lane M2 and L2: plasmid extract of E. faecalis OG1RF transformant; lane M3 and L3: total DNA extract of S. mutans transformant; lane M4 and L4: total DNA extract of L. lactis 2301 as

96 negative control; lane M6 and L6: plasmid extract of M7M2 digested with ATP- dependent DNase; lane M7 and L7: plasmid extract of M7M2 digested with BamHI.

6.4.2 Nucleotide sequence of the 19.6-kb plasmid pM7M2

The 19557 bp plasmid pM7M2 (GenBank accession no. JF800907) contained 21 open reading frames (ORFs), initiated by 19 ATG, 1 TTG and 1 GTG start codons, with a total of G+C content of 35.1%. As illustrated in Fig 6.3 and Table 6.1, pM7M2 contained an 8.6-kb fragment flanked by two IS1216 elements harboring both the tet(M) and tet(L) genes, as well as the plasmid mobilization gene mob. Within the 8.6-kb region, the resistance gene tet(M) and tet(M) leader peptide, as well as a 982bp fragment upstream of the tet(M) leading peptide shared 95.4% and 98.7% nucleotide sequence identity, respectively, with the corresponding sequences of the conjugative transposon Tn916

(GenBank accession no.: U09422.1), while shared 100% and 99.9% nucleotide sequence identity, respectively, with the corresponding sequences of the genome of S. gallolyticus

UCN34 (GenBank accession no.: FN597254.1). The tet(L) gene was found downstream of the tet(M) gene, with a 193 bp spacer between the stop codon of the tet(M) and the start codon of tet(L). The first 90 bp of the spacer was identical to the tet(M) downstream sequence from Tn916, and the rest of the spacer, which included a 63 bp fragment encoding a tet(L) leader peptide with 20 amino acids, and the tet(L) coding region shared

99.9% nucleotide sequence identity with the tet(L) upstream as well as the coding sequences from Bacillus cereus (GenBank accession no.: X51366.1). However, a mutation from T to A changed the coding sequence of the third amino acid of the tet(L)

97 leader peptide in pM7M2 from Cys to a stop codon. The rest of pM7M2 included a 10.6 kb fragment, containing ORF7 to ORF21. ORF5 to ORF7 had 99.9% sequence identity with a fragment of pIP816 (Sletvold et al., 2010). Starting from partial of ORF7 till

ORF21, pM7M2 had 99.9% sequence identity with fragment sequence in pRE25

(Schwarz et al., 1992) and E. faecium plasmid p5753cB (GenBank accession no.:

GQ900487.1). ORF9 to ORF13, partial ORF18 to ORF20 and ORF21 had at least 99.9% nucleotide sequence identity with the corresponding fragments of pIP816. Other plasmids which partially shared high homology at certain regions to pM7M2 include E. faecium plasmid pVEF3, pVEF2, pVEF1, and pEF1.

Figure 6.3. Circular map of plasmid pM7M2 (compare to Table 6.1 for further details).

The putative open reading frames are numbered in frames. The coding regions are represented by arrows indicating the direction of transcription and putative proteins encoded correspond to the proteins from the database with the highest amino acid homology. Solid black ring: 99.5% nt identity (position: 1-7097) of Streptococcus gallolyticus UCN34 (accession no.: FN597254.1) genome, which has 32 additional bp behind nt postion 693 of pM7M2, as indicated by the black solid triangle; solid grey ring:

99.9%-100% nt identity (positions: 7092-9438, 10500-14353, 17014-18706; 18749-

19557) with plasmid E. faecium plasmid pIP816 (AM932524.1); open ring: 99.9% nt identity (position: 8744-19557) with E. faecalis plasmid pRE25 (X92945.2) and E. faecium plasmid p5753cB (GQ900487.1).

Locus %aa %nt ORF Length Identification (highest homology) Position identity identity

tet(M) leader peptide; S. gallolyticus UCN34

(FN597254.1), Streptococcus suis BM407

ORF1 983-1069 87 (FM252032.1), E. faecalis ( CP002491.1), 100 100

Lactobacillus sakei (EF605269.1), E. coli

100

( DQ534550.1)

Tetracycline resistance protein TetM; S. gallolyticus

UCN34 (FN597254.1), E. faecium plasmid pYA409- ORF2 1085-3004 1920 100 100 1 (DQ223244.1), 99.5% nt identity of S. suis BM407

(FM252032.1)

Continued Table 6.1 Amino acid and nucleotide identities of putative proteins encoded by pM7M2 (GenBank accession no. JF800907).

CDS of pIP816 referred to: (Sletvold et al., 2010)

100 Table 6.1 continued

Tetracycline resistance protein TetL; S. gallolyticus

UCN34 (FN597254.1), Staphylococcus aureus

plasmid pKKS627 (FN390948.1), E. faecalis ORF3 3198-4574 1377 100 100 (AF503772.1), B. cereus plasmid pJHI

(AY129652.1), 99.9% nt identity of S. suis BM407

(FM252032.1)

101 Putative plasmid recombination/mobilization protein

(Mob); S. gallolyticus (FN597254.1), S. suis BM407

ORF4 5138-6400 1263 (FM252032.1), S. aureus plasmid pKKS627 100 100

(FN390948.1), E. faecalis plasmid pAMalpha1

(AF503772.1)

Continued

101 Table 6.1 continued

IS1216-1; E.faecalis (AB247327.1), E. faecium

plasmid pIP816 (CDS*21; AM932524.1) E. faecium ORF5 7152-7838 687 100 100 plasmid pVEF3 (AM931300), Lactococcus lactis

plasmid 1 (CP000426.1)

Hypothetical protein; E. faecium DO

(NZ_ACIY01000546), E. faecium plasmid pIP816 ORF6 8265-8477 213 100 100 (position: 31841-31629; AM932524.1), E. faecium

102 plasmid pVEF3 (AM931300)

Continued

102 Table 6.1 continued

Hypothetical protein; E. faecium plasmid pIP816

(CDS*32, AM932524.1), E. faecium plasmid pVEF3

(AM931300, partial (position: 8744-9349) nt

ORF7 8498-9349 852 identical (100%) to E. faecalis plasmid pRE25 100 100

(position: 3727-3122, X92945.2), E. faecalis

plasmid p5753cB (position: 10002-10607

GQ900487.1)

Integrase, catalytic region; E. faecium plasmid

103

p5753cB (GQ900487.1), E. faecium MV5 ORF8 9532-10491 960 100 100 (HM921050.1). 99.9% nt identity to E. faecalis

plasmid pRE25 (ORF3, X92945.2)

Continued

103 Table 6.1 continued

Putative PrgN protein; E. faecalis plasmid pRE25

(ORF2, X92945.2), E. faecalis plasmid p5753cB

(hypothetical protein, GQ900487.1), E. faecium ORF9 10515-10811 297 100 100 plasmid pIP816 (CDS*31, AM932524.1), E. faecium

plasmid pVEF3 (AM931300), E. faecium MV5

(HM921050.1)

Putative RepR protein, E. faecalis plasmid pRE25 104

(ORF1, X92945.2), E. faecium plasmid p5753cB

ORF10 10946-12439 1494 (plasmid replication protein, GQ900487.1), RepE of 100 100

E. faecium plasmid pIP816 (CDS*30, AM932524.1),

E. faecium plasmid pVEF3 (AM931300)

Continued

104 Table 6.1 continued

Hypothetical protein; E. faecalis (NZ_GG692852.1),

E. faecalis plasmid pRE25 (position: 50027-50161,

X92945.2), E. faecium plasmid p5753cB

ORF11 12547-12681 135 (position:13805-13939, GQ900487.1), E. faecium 100 100

plasmid pVEF3 (AM931300), 99.3% nt identity to

E. faecium plasmid pIP816 (position: 28624-28490,

105 AM932524.1)

Putative PrgP protein; E. faecalis plasmid pRE25

(ORF58, X92945.2), E. faecium plasmid p5753cB

ORF12 13051-14004 954 (chromosome partitioning ATPase, GQ900487.1), E. 100 100

* faecium plasmid pIP816 (CDS 29 , AM932524.1),

E. faecium plasmid pVEF3 (AM931300)

Continued

105 Table 6.1 continued

Putative PrgO protein; E. faecalis plasmid pRE25

(ORF57, X92945.2), E. faecalis plasmid p5753cB

(PrgO-like protein for plasmid replication ORF13 13976-14251 276 100 100

GQ900487.1), E. faecium plasmid pIP816 (CDS*28,

AM932524.1), E. faecium plasmid pVEF3

(AM931300)

106

Transposase; 99.6% nt identity to E. faecium plasmid

p5753cB (transposase, GQ900487.1), 99.6% nt ORF14 14444-14698 255 98.8 99.6

identity to E. faecalis plasmid pRE25 (position:

48264-48010, X92945.2)

Continued

106 Table 6.1 continued

Transposase; E. faecium plasmid p5753cB

ORF15 14749-15063 315 (transposase, GQ900487.1), E. faecalis plasmid 100 100

pRE25 (position: 47959-47645, X92945.2)

IS1485, E. faecalis plasmid pRE25 (ORF55,

X92945.2), E. faecium plasmid p5753cB (position: ORF16 15104-16266 1163 100 100 107 16362-17524, including transpoase and integrase,

GQ900487.1)

Transposase; E. faecium plasmid p5753cB

ORF17 16517-16939 423 (transposase, GQ900487.1), E. faecalis plasmid 100 100

pRE25 (position: 46191-45772, X92945.2)

Continued

107 Table 6.1 continued

Hypothetical protein; E. faecalis (NZ_GG692631), E.

faecalis plasmid pRE25 (position: 45719-45548,

X92945.2), E. faecium plasmid p5753cB (position: ORF18 16999-17160 162 100 100 18257-18418, GQ900487.1), partial (position: 17014-

17160) nt identity to E. faecium plasmid pIP816

(position: 22413-22559, AM932524.1)

Resolvase; E. faecalis plasmid pRE25 (ORF53,

108 * X92945.2), E. faecium plasmid pIP816 (CDS 23, ORF19 17412-17984 573 100 100 AM932524.1), E. faecium plasmid p5753cB (site-

specific recombinase, GQ900487.1)

Continued

108 Table 6.1 continued

Cell filamentation protein, E. faecalis plasmid pRE25

(ORF52, X92945.2), of E. faecium plasmid pIP816

ORF20 18000-18605 606 (CDS*24, AM932524.1), 99.8% nt identity of E. 100 100

faecium plasmid p5753cB (position: 19258-19862,

GQ900487.1)

IS1216-2, E. faecalis plasmid pRE25 (ORF51,

X92945.2), E. faecium plasmid p5753cB (position:

109

20060-20746, including transposase, GQ900487.1), ORF21 18803-19489 687 100 100 E. faecium plasmid pIP816 (CDS*27; AM932524.1),

L. lactis plasmid 1 (CP000426.1), L innocua plasmid

pLI100 (AL592102.1)

Continued

109

6.4.3 Tetracycline induced transcription of tet(M) and tet(L)

Figure 6.4 showed specific RT-PCR products amplified from E. faecium M7M2 using primer sets for tet(M), tet(L) and ddl. As shown in Figure 6.5, quantitative real-time

RT-PCR indicated that both tet(M) and tet(L) genes were significantly induced in the presence of 8 to 32 μg/ml tetracycline (P<0.05). However, there was no significant difference (p>0.05) in the induced transcription levels of both genes within the range of tetracycline concentrations (from 8 to 32 μg/ml) tested in this study.

L 1 2 3

200 bp 100 bp

Figure 6.4. RT-PCR products of tet(M), tet(L) and ddl. Lane L:1kb plus DNA ladder; lane 1: tet(M); lane 2: tet(L); lane 3: ddl.

110 35.0

) ) tet(M)

Ct 30.0 ΔΔ - 25.0 tet(L) 20.0 15.0 10.0 5.0 0.0

relative amount of mRNA (2 mRNA of amount relative 0 8 16 32 tetracycline conc. (μg/ml)

Figure 6.5. Relative quantification of tet(M) and tet(L) transcripts under 8, 16 and 32 compared to 0 μg/ml tetracycline. Bars represent mean±SEM from three independent biological replicates.

6.4.4 Stability of AR.

Persistence of AR genes in E. faecium M7M2 was assessed by the stability test.

Resistance genes were highly stable in the absence of plasmid curing agent acridine orange and the corresponding antibiotic tetracycline, with a retention rate of 99.04±0.79%

(mean±SD, N=4). At the presence of acridine orange, the retention rate was lowered to

85.10±15.51% (mean±SD, N=4). However, plasmid isolation of selective progenies after consecutive transferwhich lost resistance showed that they still carried an 11.7 kb plasmid designated pM7M2D compared to the original pM7M2. PCR mapping, restriction enzyme digestion and partial DNA sequencing analysis showed that likely a

111 recombination event led to the elimination of the fragment flanked between the two identical insertion sequences of IS1216 including the tetracycline resistance genes.

Two E. faecium derivatives M7M2D1 and M7M2D2 containing the small backbone plasmid pM7M2D were further subject to consecutive transfer in BHI broth with acridine orange. After more than 600 generations, 100% (52/52) of the progenies assessed retained the plasmid.

6.4.5 Functionality and mobility of the AR genes

Natural transformation and electroporation were used to examine the potential involvement of pM7M2 in HGT events. Tetr transformants were obtained by natural transformation of the pM7M2 into S. mutans UA159, and electroporation of the plasmid into E. faecalis OG1RF. Southern hybridization assessment of the transformants with tet(M) and tet(L) probes, respectively, revealed that both genes were integrated in the chromosome of the S. mutans UA159 transformants, but the 19.6 kb plasmid retained in the E. faecalis OG1RF progenies (Figure 6.2). The MIC test showed that transformants of

S. mutans UA 159 and E. faecalis OG1RF both had significantly increased resistance to tetracycline (>64 µg/ml), as compared to the recipient strains S. mutans UA 159 (1 µg/ml) and E. faecalis OG1RF (0.5 µg/ml), and the resistance level was close to that of the donor strain E. faecium M7M2 (>128 µg/ml). Both the MIC and Southern hybridization data suggested that the Tetr-determinants were functional and transmissible, and led to acquired resistance in the human residential and pathogenic bacteria in laboratory settings.

112 6.4.6 Biofilm formation

As shown in Figure 6.6, E. faecium M7M2 can form biofilm on the stainless steel coupon. Under 5000× total magnification, multi-layer enterococcal biofilm structure on the stainless steel surface was clearly observed.

Figure 6.6. SEM assessment of biofilm structure development by E. faecium M7M2. A:

Overview of colonization and attachment under 500× total magnification. B: Details of structure under 5000× total magnification.

113 6.5 Discussion

Undoubtedly, prudent use of antibiotics is essential to reduce the prevalence and slow down the emergence of ART bacteria, including ART pathogens. However, emerging data on the origin of certain AR-encoding genes including the immunity genes from the antibiotic producing organisms (Allen et al., 2010), the prevalence of ART bacteria in ready-to-consume foods (Duran & Marshall, 2005; Wang et al., 2006; Li &

Wang, 2010), the colonization, persistence and amplification of ART bacteria in host GI tracts in the absence of antibiotic exposure (Lancaster et al., 2003; Ready et al., 2003; L.

Zhang, D. F. Kinkelaar, Y. Huang, Y. Li, X. Li, H. H. Wang, unpublished data), and various AR gene stabilization, co-selection and niche fitness mechanisms (Wang, 2009) illustrated the complication of the AR issue. A comprehensive understanding of the major pathways and mechanisms involved in AR emergence, amplification, persistence and dissemination is greatly needed to achieve effective mitigation.

This study examined the genetic characteristics of a persistent, AR-gene carrier isolated from a dairy product. DNA sequence analysis data of pM7M2 showed that it carried a tet(M)-tet(L)-mob gene cluster. Not only the tet(M), tet(L) and mob genes had high homology with previously identified ones associated with various mobile elements across a broad spectrum of bacteria, the tandem tet(M)-tet(L)-mob gene cluster organization represented the first of its kind on a plasmid. The only other cases were found in the recently sequenced genome of S. gallolyticus UCN34 (100% nt identity) isolated from a colon cancer patient in France (Rusniok et al., 2010) and zoonotic pathogen Streptococcus suis BM407 (99.8% nt identity) isolated from meningitis patient in Vietnam (Holden et al., 2009), where the tet(L) and mob gene were inserted behind the

114 tet(M) gene in a Tn916. It is worth noting that a mutation in the tet(L) leader peptide changed the 3rd amino acid from Cys to a stop codon in pM7M2. The same exact mutation was observed in the gene cluster in S. gallolyticus UCN34 and S. suis BM407.

Schwarz et al. (Schwarz et al., 1992) reported that the tet(L) leader peptide is involved in modulating the expression of tetL at the translational level. However, Kehrenberg et al.

(Kehrenberg et al., 2005) reported that the tet(L) gene missing the entire leader peptide in the plasmid pCCK3259 form Mannheimia still conferred resistance to tetracycline. In this study, the real-time RT-PCR results illustrated induced transcription of both tet(M) and tet(L) in pM7M2, however, the exact impact of this point mutation leading to a truncated tet(L) leader peptide on the translational expression of tet(L), and therefore the overall resistance to tetracycline is yet to be determined. The evolutionary significance of the tet(M)-tet(L) gene cluster also remains to be elucidated. In this study, we have also illustrated the functionality and mobility of pM7M2 within and across genus, and the AR genes from pM7M2 were incorporated into the genome of the human oral pathogen S. mutans UA159 by natural gene transformation in laboratory settings. Although we are unable to establish the physical connection among E. faecium M7M2, S. endocarditis

UCN34 and S. suis BM407 from distant geographic locations, the high homology of the

Tetr determinants found in the two strains (>99% nucleotide sequence identity of the tet(M)-tet(L)-mob gene cluster including the single mutation at the tet(L) leader peptide region, as well as >98% identity of the 982 bp fragment right upstream of the tet(M) leader peptide), suggested the possibility of HGT event(s), although both strains could have also gone through independent evolution events. The foodborne nature of M7M2 suggested that microflora associated with animal and human GI tracts, animal food

115 products and wastes could all possibly be involved in the evolution, dissemination and circulation of such AR-encoding genetic elements. Control intervention thus is essential to interrupt this amplified circulation and evolution of AR-encoding elements in the microbial ecosystems.

Data from recent studies showed that many AR-encoding plasmids were very stable in the absence of corresponding antibiotic pressure, due to specific maintenance mechanisms, such as the toxin-antitoxin (TA) systems. Representative TA systems such as ω-ε-ζ, and axe-txe were found to be ubiquitous in Vanr-ecoding plasmids (Moritz &

Hergenrother, 2007; Rosvoll et al., 2010), as well as other plasmids confer multi-drug resistance (Schwarz et al., 2001; Fico & Mahillon, 2006). The persistent pM7M2 has the backbone structure highly homologous to pIP816 and pRE25, but without the previously illustrated ω-ε-ζ plasmid-stabilizing TA system. However, all three plasmids carried a common fragment including prgO, prgP and prgN genes. After consecutive transfer of the E. faecium in the absence of tetracycline but in the presence of the plasmid curing agent, the Tetr trait was lost in a small population of the progenies, likely due to recombination event(s) eliminated the IS1216 franking fragment including the tet(M)- tet(L)-mob gene cluster. The persistence of the prgO-P-N gene cluster containing backbone, plasmid derivative pM7M2D in the subsequent stability assessment suggested the presence of a second plasmid stabilization system. In agreement, Derome et al.

(Derome et al., 2008) examined the roles of prgP and prgO in plasmid segregation from pGENT, a Vanr plasmid from an enterococcal clinical isolate, and found that mutation of either prgP or prgO significantly decreased the retention rate of the associated plasmid.

Therefore, likely the prgO-P-N gene cluster also served as the TA-independent

116 stabilization mechanism, although much less recognized, contributed to the persistence and subsequently distribution of various AR-encoding plasmids such as pM7M2 for tet(M) and tet(L), pRE25 for erm(B), aadE, cat, sat4 and aph3, and pIP816 as well as pVEF4 for vanA in the microbial populations in the absence of the corresponding antibiotic selective pressure. The ability of M7M2 to form biofilms further enabled the organism to survive advertise environmental factors and flourish in the ecosystem. The prevalence of the AR persistent mechanisms found in isolates such as M7M2 illustrated the need for additional strategies to achieve effective AR mitigation.

6.6 Acknowledgement

E. faecalis strain OG1RF was kindly provided by Dr. Gary Dunny (Univ.

Minnesota), and S. mutans UA 159 by Dr. Robert Burne (University of Florida). We thank Cameron Begg from the Campus Electron Optics Facility (CEOF) at The Ohio

State University for assisting with the microscopy study. The study was supported by

OARDC seed grant #OHOA1084 and Dairy Management Inc. grant OSURF project

#60010225.

6.7 References

Allen, H. K., J. Donato, H. H. Wang, K. A. Cloud-Hansen, J. Davies, and J. Handelsman. 2010. Call of the wild: antibiotic resistance genes in natural environments. Nat. Rev. Microbiol. 8:251-259.

Anderson, D. G., and L. L. McKay. 1983. Simple and rapid method for isolating large plasmid DNA from lactic streptococci. Appl. Environ. Microbiol. 46:549-552.

Ausubel, F. M., R. Brent, R. Kingston, D. Moore, J. Seidman, J. Smith, and K. Struhl. 1989. Current protocols in molecular biology, vol. 1. Wiley Press, New York, NY.

117 Clark, N. C., O. Olsvik, J. M. Swenson, C. A. Spiegel, and F. C. Tenover. 1999. Detection of a streptomycin/spectinomycin adenylyltransferase gene (aadA) in Enterococcus faecalis. Antimicrob. Agents Chemother. 43:157-160.

Cruz-Rodz, A. L., and M. S. Gilmore. 1990. High efficiency introduction of plasmid DNA into glycine treated Enterococcus faecalis by electroporation. Mol. Gen. Genet. 224:152-154. de Niederhausern, S., M. Bondi, P. Messi, R. Iseppi, C. Sabia, G. Manicardi, and I. Anacarso. 2011. Vancomycin-resistance transferability from VanA Enterococci to Staphylococcus aureus. Curr. Microbiol. 62:1363-1367.

Derome, A., C. Hoischen, M. Bussiek, R. Grady, M. Adamczyk, B. Kedzierska, S. Diekmann, D. Barilla, and F. Hayes. 2008. Centromere anatomy in the multidrug- resistant pathogen Enterococcus faecium. Proc. Natl. Acad. Sci. USA 105:2151-2156.

Duran, G. M., and D. L. Marshall. 2005. Ready-to-eat shrimp as an international vehicle of antibiotic-resistant bacteria. J. Food Prot. 68:2395-2401.

Eaton, T. J., and M. J. Gasson. 2001. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl. Environ. Microbiol. 67:1628-1635.

Fico, S., and J. Mahillon. 2006. TasA-tasB, a new putative toxin-antitoxin (TA) system from Bacillus thuringiensis pGI1 plasmid is a widely distributed composite mazE-doc TA system. BMC Genomics. 7:259. doi: 10.1186/1471-2164-7-259.

Fisher, K., and C. Phillips. 2009. The ecology, epidemiology and virulence of Enterococcus. Microbiology. 155:1749-1757.

Franz, C. M. A. P., W. H. Holzapfel, and M. E. Stiles. 1999. Enterococci at the crossroads of food safety? Int. J. Food Microbiol. 47:1-24.

118 Franz, C. M. A. P., A. B. Muscholl-Silberhorn, N. M. K. Yousif, M. Vancanneyt, J. Swings, and W. H. Holzapfel. 2001. Incidence of virulence factors and antibiotic resistance among enterococci isolated from food. Appl. Environ. Microbiol. 67:4385- 4389.

Handwerger, S., and J. Skoble. 1995. Identification of chromosomal mobile element conferring high-level vancomycin resistance in Enterococcus faecium. Antimicrob. Agents Chemother. 39:2446-2453.

Hayes, F. 2003. Toxins-antitoxins: plasmid maintenance, programmed cell death, and cell cycle arrest. Science. 301:1496-1499.

Hegstad, K., T. Mikalsen, T. Coque, G. Werner, and A. Sundsfjord. 2010. Mobile genetic elements and their contribution to the emergence of antimicrobial resistant Enterococcus faecalis and Enterococcus faecium. Clin. Microbiol. Infect. 16:541-554.

Hidron, A. I., J. R. Edwards, J. Patel, T. C. Horan, D. M. Sievert, D. A. Pollock, S. K. Fridkin, National Healthcare Safety Network Team, and Participating National Healthcare Safety Network Facilities. 2008. NHSN annual update: antimicrobial-resistant pathogens associated with healthcare-associated infections: annual summary of data reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2006-2007. Infect. Control Hosp. Epidemiol. 29:996-1011.

Holden, M. T., H. Hauser, M. Sanders, T. H. Ngo, I. Cherevach, A. Cronin, I. Goodhead, K. Mungall, M. A. Quail, C. Price, E. Rabbinowitsch, S. Sharp, N. J. Croucher, T. B. Chieu, N. T. Mai, T. S. Diep, N. T. Chinh, M. Kehoe, J. A. Leigh, P. N. Ward, C. G. Dowson, A. M. Whatmore, N. Chanter, P. Iversen, M. Gottschalk, J. D. Slater, H. E. Smith, B. G. Spratt, J. Xu, C. Ye, S. Bentley, B. G. Barrell, C. Schultsz, D. J. Maskell, and J. Parkhill. 2009. Rapid evolution of virulence and drug resistance in the emerging zoonotic pathogen Streptococcus suis. PLoS One. 4:e6072. doi: 10.1371/journal.pone.0006072.

Holo, H., and I. F. Nes. 1989. High-frequency transformation, by electroporation, of Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl. Environ. Microbiol. 55:3119-3123.

Johnsen, P. J., J. I. Osterhus, H. Sletvold, M. Sorum, H. Kruse, K. Nielsen, G. S. Simonsen, and A. Sundsfjord. 2005. Persistence of animal and human glycopeptide- resistant enterococci on two Norwegian poultry farms formerly exposed to avoparcin is associated with a widespread plasmid-mediated vanA element within a polyclonal Enterococcus faecium population. Appl. Environ. Microbiol. 71:159-168.

Johnston, L. M., and L. A. Jaykus. 2004. Antimicrobial resistance of Enterococcus species isolated from produce. Appl. Environ. Microbiol. 70:3133-3137.

119 Kehrenberg, C., B. Catry, F. Haesebrouck, A. de Kruif, and S. Schwarz. 2005. tet(L)- mediated tetracycline resistance in bovine Mannheimia and Pasteurella isolates. J. Antimicrob. Chemother. 56:403-406.

Kinkelaar, D. F. 2008. M.S. thesis. The Ohio State University.

Lancaster, H., D. Ready, P. Mullany, D. Spratt, R. Bedi, and M. Wilson. 2003. Prevalence and identification of tetracycline-resistant oral bacteria in children not receiving antibiotic therapy. FEMS Microbiol. Lett. 228:99-104.

Levy, S. B., and B. Marshall. 2004. Antibacterial resistance worldwide: causes, challenges and responses. Nat. Med. 10:S122-S129.

Li, X., and H. H. Wang. 2010. Tetracycline resistance associated with commensal bacteria from representative ready-to-consume deli and restaurant foods. J. Food Prot. 73:1841-1848.

Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402-408.

Luo, H., K. Wan, and H. H. Wang. 2005. High-frequency conjugation system facilitates biofilm formation and pAMbeta1 transmission by Lactococcus lactis. Appl. Environ. Microbiol. 71:2970-2978.

Moritz, E. M., and P. J. Hergenrother. 2007. Toxin-antitoxin systems are ubiquitous and plasmid-encoded in vancomycin-resistant enterococci. Proc. Natl. Acad. Sci. USA. 104:311-316.

Murray, B. E., and B. Mederski-Samaroj. 1983. Transferable beta-lactamase. A new mechanism for in vitro penicillin resistance in Streptococcus faecalis. J. Clin. Invest. 72:1168-1171.

Ready, D., R. Bedi, D. A. Spratt, P. Mullany, and M. Wilson. 2003. Prevalence, proportions, and identities of antibiotic-resistant bacteria in the oral microflora of healthy children. Microb. Drug Resist. 9:367-372.

Rice, L. B., and L. L. Carias. 1998. Transfer of Tn5385, a composite, multiresistance chromosomal element from Enterococcus faecalis. J. Bacteriol. 180:714-721.

Rice, L. B., L. L. Carias, S. Rudin, R. A. Hutton, and S. Marshall. 2010. Multiple copies of functional, Tet(M)-encoding Tn916-like elements in a clinical Enterococcus faecium isolate. Plasmid. 64:150-155. 120 Roberts, A. P., I. J. Davis, L. Seville, A. Villedieu, and P. Mullany. 2006. Characterization of the ends and target site of a novel tetracycline resistance-encoding conjugative transposon from Enterococcus faecium 664.1H1. J. Bacteriol. 188:4356-4361.

Rusniok, C., E. Couve, V. Da Cunha, R. El Gana, N. Zidane, C. Bouchier, C. Poyart, R. Leclercq, P. Trieu-Cuot, and P. Glaser. 2010. Genome sequence of Streptococcus gallolyticus: insights into its adaptation to the bovine rumen and its ability to cause endocarditis. J. Bacteriol. 192:2266-2276.

Sambrook, J., D. W. Russell. Preparation and transformation of competent E. coli using calcium chloride. Cold Spring Harb. Protoc. doi: 10.1101/pdb.prot3932.

Schwarz, F. V., V. Perreten, and M. Teuber. 2001. Sequence of the 50-kb conjugative multiresistance plasmid pRE25 from Enterococcus faecalis RE25. Plasmid. 46:170-187.

Schwarz, S., M. Cardoso, and H. C. Wegener. 1992. Nucleotide sequence and phylogeny of the tet(L) tetracycline resistance determinant encoded by plasmid pSTE1 from Staphylococcus hyicus. Antimicrob. Agents Chemother. 36:580-588.

Simjee, S., S. E. Manzoor, A. P. Fraise, and M. J. Gill. 2000. Nature of transposon- mediated high-level gentamicin resistance in Enterococcus faecalis isolated in the United Kingdom. J. Antimicrob. Chemother. 45:565-575.

Summers, D. K., and D. J. Sherratt. 1984. Multimerization of high copy number plasmids causes instability: CoIE1 encodes a determinant essential for plasmid monomerization and stability. Cell. 36:1097-1103. 121 Wang, H. H. 2009. Commensal bacteria, microbial ecosystems and horizontal gene transmission: adjusting our focus for strategic breakthroughs against antibiotic resistance, p. 267-281. In L. Jaykus, H. H. Wang, and L. S. Schlesinger (eds.), Foodborne Microbes: Shaping the Host Ecosystems. ASM Press, Washington, DC.

Willems, R. J., and M. J. Bonten. 2007. Glycopeptide-resistant enterococci: deciphering virulence, resistance and epidemicity. Curr. Opin. Infect. Dis. 20:384-390. 50.

Williams, D. R., and C. M. Thomas. 1992. Active partitioning of bacterial plasmids. J. Gen. Microbiol. 138:1-16.

Yu, Z., and M. Morrison. 2004. Improved extraction of PCR-quality community DNA from digesta and fecal samples. BioTechniques. 36:808-812.

122

CHAPTER 7

Summary and Conclusions

Food chain plays an important role in the dissemination of antibiotic resistance

(AR) in the ecosystem. Therefore, controlling AR in cheese products is not only essential for the dairy industry but also public health. In this study, a full-scale critical control points (CCP) assessment was conducted to evaluate different potential factors contributing to AR in cheese products. As expected, pasteurization successfully reduced antibiotic resistant (ART) bacteria from the raw milk. AR can be effectively minimized and controlled with proper sanitation and processing controls. Ripening did not support significant amplification of ART bacteria. While commercial starters were not a source of

AR, plant-maintained culture was still a potential source for ART bacterial contamination, suggesting that better culture maintenance practices were essential and necessary in cheese industry. Rapid and sufficient acid production from the growth of starter cultures played an important role in inhibiting the proliferation of ART bacteria. A small scale surveillance study from 2010 found the prevalence of AR in retail cheese samples dropped compared to the data from 2006, suggesting the effectiveness of targeted AR mitigation in related products. Therefore, the CCP identified in this study can be practically applied in cheese industry to minimize AR contamination. In addition, this

123 study also suggests that AR in other dairy dermentation process can be controlled with proper CCP identification and application.

Cheese making is a complicated process with different equipments, steps and other environment factors involved. Sporadic AR contamination can still happen during cheese making. It is also important to understand characteristics related to the AR dissemination and persistence of ART isolates from cheese environment. In this study, a tetracycline resistant (Tetr) pilot plant cheese isolate Enterococcus faeium M7M2 carrying both tet(M) and tet(L) on a 19.6 kb plasmid pM7M2 was further characterized.

The plasmid sequence revealed evolutionary correlation of pM7M2 with other enterococcal plasmids carrying different AR genes. The transferability of functionality of the plasmid in other host indicated the potential of dissemination of its AR genes through horizontal gene transfer. The natural transformation event that transferred AR genes from

M7M2 to oral pathogenic bacteria S. mutans UA159 examlified the dissemination of AR gene between commensals and pathogens through HGT. Even though no toxin-antitoxin plasmid stability system was identified, the plasmid was highly stable, suggesting other unidentified mechanism(s) were contributing to the stability. E. faecium M7M2 also formed biofilm on stainless steel coupons, suggesting its potential to be persistent in the environment. The results indicated that multiple mechanisms might have contributed to the persistence of the strain and the antibiotic resistance encoding genes. Information related to the characteristics of Tetr E. faecium M7M2 analyzed in this study can be applied for the development of counter strategies for AR development, dissemination and persistence.

124 Some future studies following this project can still be conducted. In this study, we vistied 2 Swiss cheese manufacturing facilities. Due to the variations of cheese products and cheese making process, CCP assessment in other cheese manufacturers would provide more information for AR mitigation in the industry environment. One isolate was furthur characterized in this study. Characterization of other ART isolates, especially those belonging to lactic acid bacterua from different cheese samples would let us have a better understanding of AR dissemination and persistence in the dairy environment. Since conditions play an essential role in horizontal gene transfer (HGT), it is also useful to analyze the HGT potentials at different conditions for control of AR dissemination. In addition, identifying and elucidating the unidentified mechanism(s) contributiong to plasmid stability would undoubtly help us understand and furthur control AR persistence.

Combatting with AR is essential but a long term battle. However, as long as enough effort is applied, AR in food chain can still be minimized.

125

Bibliography

Alekshun, M. N., and S. B. Levy. 2007. Molecular mechanisms of antibacterial multidrug resistance. Cell. 128:1037-1050.

Allen, H. K., J. Donato, H. H. Wang, K. A. Cloud-Hansen, J. Davies, and J. Handelsman. 2010. Call of the wild: antibiotic resistance genes in natural environments. Nat. Rev. Microbiol. 8:251-259.

Amábile-Cuevas, C. F. 1993. Origin, evolution and spread of antibiotic resistance genes. R.G. Landes Co., Austin TX.

Anderson, D. G., and L. L. McKay. 1983. Simple and rapid method for isolating large plasmid DNA from lactic streptococci. Appl. Environ. Microbiol. 46:549-552.

Andrup, L., J. Damgaard, and K. Wassermann. 1993. Mobilization of small plasmids in Bacillus thuringiensis subsp. israelensis is accompanied by specific aggregation. J. Bacteriol. 175:6530-6536.

Arias, C. A., and B. E. Murray. 2009. Antibiotic-resistant bugs in the 21st century-a clinical super-challenge. N. Engl. J. Med. 360:439-443.

Ausubel, F. M., R. Brent, R. Kingston, D. Moore, J. Seidman, J. Smith, and K. Struhl. 1989. Current protocols in molecular biology, vol. 1. Wiley Press, New York, NY.

Barrangou, R., and P. Horvath. 2009. The CRISPR system protects microbes against phages, plasmids. Microbe. 4:224-230.

126 Belletti, N., M. Gatti, B. Bottari, E. Neviani, G. Tabanelli, and F. Gardini. 2009. Antibiotic resistance of lactobacilli isolated from two italian hard cheeses. J. Food Prot. 72:2162-2169.

Brabban, A. D., E. Hite, and T. R. Callaway. 2005. Evolution of foodborne pathogens via temperate bacteriophage-mediated gene transfer. Foodborne Pathog. Dis. 2:287-303.

Bukowski, M., A. Rojowska, and B. Wladyka. 2011. Prokaryotic toxin-antitoxin systems - the role in bacterial physiology and application in molecular biology. Acta. Biochim. Pol. 58:1-9.

Bushby, S. R., and G. H. Hitchings. 1968. Trimethoprim, a sulphonamide potentiator. Br. J. Pharmacol. Chemother. 33:72-90.

Cambray, G., A. M. Guerout, and D. Mazel. 2010. Integrons. Annu. Rev. Genet. 44:141- 166.

Carattoli, A. 2001. Importance of integrons in the diffusion of resistance. Vet. Res. 32:243-259.

Castanon, J. I. 2007. History of the use of antibiotic as growth promoters in European poultry feeds. Poult. Sci. 86:2466-2471.

127 Chopra, I., and M. Roberts. 2001. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 65:232-260.

Çitak, S., N. Yucel, and S. Orhan. 2004. Antibiotic resistance and incidence of Enterococcus species in Turkish white cheese. Int. J. Dairy Technol. 57:27-31.

Clewell, D. B., and M. V. Francia. 2004. Conjugation in Gram-Positive bacteria, p. 227- 256. In G. Phillips, and B. E. Funnell (ed.), Plasmid biology. ASM Press, Washington, D.C.

Colomer-Lluch, M., J. Jofre, and M. Muniesa. 2011. Antibiotic resistance genes in the bacteriophage DNA fraction of environmental samples. PLoS One. 6:e17549. doi: 10.1371/journal.pone.0017549.

Conter, M., D. Paludi, E. Zanardi, S. Ghidini, A. Vergara, and A. Ianieri. 2009. Characterization of antimicrobial resistance of foodborne Listeria monocytogenes. Int. J. Food Microbiol. 128:497-500.

Cruz-Rodz, A. L., and M. S. Gilmore. 1990. High efficiency introduction of plasmid DNA into glycine treated Enterococcus faecalis by electroporation. Mol. Gen. Genet. 224:152-154.

128 Davies, J. 2007. Microbes have the last word. A drastic re-evaluation of antimicrobial treatment is needed to overcome the threat of antibiotic-resistant bacteria. EMBO Rep. 8:616-621.

Davis, C., D. P. Blayney, D. Dong, S. Stefanova, and A. Johnson. 2010. Long-term growth in US cheese consumption may slow. http://www.ers.usda.gov/Publications/ldp/2010/07jul/ldpm19301/.

Davis, M. A., D. D. Hancock, and T. E. Besser. 2002. Multiresistant clones of Salmonella enterica: The importance of dissemination. J. Lab. Clin. Med. 140:135-141.

Depardieu, F., I. Podglajen, R. Leclercq, E. Collatz, and P. Courvalin. 2007. Modes and modulations of antibiotic resistance gene expression. Clin. Microbiol. Rev. 20:79-114.

Dibner, J. J., and J. D. Richards. 2005. Antibiotic growth promoters in agriculture: history and mode of action. Poult. Sci. 84:634-643.

Dorland, W. A. N. 2007. Dorland's Illustrated Medical Dictionary, 31st ed. Saunders Press, Philadelphia, Pa.

Duran, G. M., and D. L. Marshall. 2005. Ready-to-eat shrimp as an international vehicle of antibiotic-resistant bacteria. J. Food Prot. 68:2395-2401.

129 Eaton, T. J., and M. J. Gasson. 2001. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl. Environ. Microbiol. 67:1628-1635.

Falagas, M. E., and D. E. Karageorgopoulos. 2009. Extended-spectrum beta-lactamase- producing organisms. J. Hosp. Infect. 73:345-354.

Feld, L., E. Bielak, K. Hammer, and A. Wilcks. 2009. Characterization of a small erythromycin resistance plasmid pLFE1 from the food-isolate Lactobacillus plantarum M345. Plasmid. 61:159-170.

Ferber, D. 2003. Antibiotic resistance. WHO advises kicking the livestock antibiotic habit. Science. 301:1027.

Fisher, K., and C. Phillips. 2009. The ecology, epidemiology and virulence of Enterococcus. Microbiology. 155:1749-1757.

Florez, A. B., S. Delgado, and B. Mayo. 2005. Antimicrobial susceptibility of lactic acid bacteria isolated from a cheese environment. Can. J. Microbiol. 51:51-58.

Fluit, A. C., and F. J. Schmitz. 2004. Resistance integrons and super-integrons. Clin. Microbiol. Infect. 10:272-288.

Fox, P. F., T. M. Cogan, and T. P. Guinee. 2000. Fundamentals of cheese science. Aspen publishers. Gaitherburg, MD.

Franz, C. M. A. P., W. H. Holzapfel, and M. E. Stiles. 1999. Enterococci at the crossroads of food safety? Int. J. Food Microbiol. 47:1-24.

Franz, C. M. A. P., A. B. Muscholl-Silberhorn, N. M. K. Yousif, M. Vancanneyt, J. Swings, and W. H. Holzapfel. 2001. Incidence of virulence factors and antibiotic 130 resistance among enterococci isolated from food. Appl. Environ. Microbiol. 67:4385- 4389.

French, G. L. 2010. The continuing crisis in antibiotic resistance. Int. J. Antimicrob. Agents. 36 Suppl 3:S3-S7.

Gulnee, T. P., and P. F. Fox. 2004. Salt in cheese: physical, chemical and biological aspects, p. 207-223. In P. F. Fox, P. L. H. McSweeney, T. M. Cogan, and, T. P. Guinee. (ed.), Cheese: physical, chemical and biological aspects, 3rd ed. Elsevier Academic press, San Diego, CA.

Handwerger, S., and J. Skoble. 1995. Identification of chromosomal mobile element conferring high-level vancomycin resistance in Enterococcus faecium. Antimicrob. Agents Chemother. 39:2446-2453.

Harakeh, S., I. Saleh, O. Zouhairi, E. Baydoun, E. Barbour, and N. Alwan. 2009. Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products. The Science of the Total Environment. 407:4022-4027.

Hayes, F. 2003. Toxins-antitoxins: plasmid maintenance, programmed cell death, and cell cycle arrest. Science. 301:1496-1499.

131 Hirt, H., D. A. Manias, E. M. Bryan, J. R. Klein, J. K. Marklund, J. H. Staddon, M. L. Paustian, V. Kapur, and G. M. Dunny. 2005. Characterization of the pheromone response of the Enterococcus faecalis conjugative plasmid pCF10: complete sequence and comparative analysis of the transcriptional and phenotypic responses of pCF10- containing cells to pheromone induction. J. Bacteriol. 187:1044-1054.

Hummel, A., W. H. Holzapfel, and C. M. Franz. 2007. Characterisation and transfer of antibiotic resistance genes from enterococci isolated from food. Syst. Appl. Microbiol. 30:1-7.

Johnsborg, O., V. Eldholm, and L. S. Havarstein. 2007. Natural genetic transformation: prevalence, mechanisms and function. Res. Microbiol. 158:767-778.

132 Jones, R. N. 2001. Resistance patterns among nosocomial pathogens: trends over the past few years. Chest. 119:397S-404S.

Jonsson, M., and G. Swedberg. 2006. Macrolide resistance can be transferred by conjugation from viridans streptococci to Streptococcus pyogenes. Int. J. Antimicrob. Agents. 28:101-103.

Johnston, L. M., and L. A. Jaykus. 2004. Antimicrobial resistance of Enterococcus species isolated from produce. Appl. Environ. Microbiol. 70:3133-3137.

Kehrenberg, C., B. Catry, F. Haesebrouck, A. de Kruif, and S. Schwarz. 2005. tet(L)- mediated tetracycline resistance in bovine Mannheimia and Pasteurella isolates. J. Antimicrob. Chemother. 56:403-406.

Kingston, W. 2008. Irish contributions to the origins of antibiotics. Ir. J. Med. Sci. 177:87-92.

Kinkelaar, D. F. 2008. M.S. thesis. Profiles of tetracycline resistant bacteria in the human infant digestive system. The Ohio State University, Columbus OH.

Kitaoka, M., S. T. Miyata, D. Unterweger, and S. Pukatzki. 2011. Antibiotic resistance mechanisms of Vibrio cholerae. J. Med. Microbiol. 60:397-407.

Klare, I., C. Konstabel, D. Badstubner, G. Werner, and W. Witte. 2003. Occurrence and spread of antibiotic resistances in Enterococcus faecium. Int. J. Food Microbiol. 88:269- 290.

Kosikowski, F. V. 1982. Cheese and fermented milk foods, 2nd ed. F. V. Kosikowski and Associates, Brookdontale, N.Y. .

Larson, E. 2007. Community factors in the development of antibiotic resistance. Annu. Rev. Public Health. 28:435-447.

133 Lawley, T., B. M. Wilkins, and L. S. Frost. 2004. Conjugation in Gram-Negative bacteria, p. 203-226. In G. Phillips, and B. E. Funnell (ed.), Plasmid biology. ASM Press, Washington, D.C.

Lee, J. H., and D. J. O'Sullivan. 2010. Genomic insights into bifidobacteria. Microbiol. Mol. Biol. Rev. 74:378-416.

Lesch, J. E. 2007. The first miracle drugs: how the sulfa drugs transformed medicine. Oxford University Press, New York, NY.

Levy, S. B. 2002. The 2000 Garrod lecture. Factors impacting on the problem of antibiotic resistance. J. Antimicrob. Chemother. 49:25-30.

Levy, S. B., and B. Marshall. 2004. Antibacterial resistance worldwide: causes, challenges and responses. Nat. Med. 10:S122-S129.

Li, X., and H. H. Wang. 2010. Tetracycline resistance associated with commensal bacteria from representative ready-to-consume deli and restaurant foods. J. Food Prot. 73:1841-1848.

Li, Y. H., P. C. Lau, J. H. Lee, R. P. Ellen, and D. G. Cvitkovitch. 2001. Natural genetic transformation of Streptococcus mutans growing in biofilms. J Bacteriol. 183:897-908.

Lipsitch, M., and M. H. Samore. 2002. Antimicrobial use and antimicrobial resistance: a population perspective. Emerg. Infect. Dis. 8:347-354.

Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402-408.

Llosa, M., F. X. Gomis-Ruth, M. Coll, and F. de la Cruz Fd. 2002. Bacterial conjugation: a two-step mechanism for DNA transport. Mol. Microbiol. 45:1-8.

Luangtongkum, T., B. Jeon, J. Han, P. Plummer, C. M. Logue, and Q. Zhang. 2009. Antibiotic resistance in Campylobacter: emergence, transmission and persistence. Future Microbiol. 4:189-200.

Luo, H., K. Wan, and H. H. Wang. 2005. High-frequency conjugation system facilitates biofilm formation and pAMbeta1 transmission by Lactococcus lactis. Appl. Environ. Microbiol. 71:2970-2978.

134 Mater, D. D., P. Langella, G. Corthier, and M. J. Flores. 2008. A probiotic Lactobacillus strain can acquire vancomycin resistance during digestive transit in mice. J. Mol. Microbiol. Biotechnol. 14:123-127.