The Effects of Methyl Tert-Butyl Ether (MTBE) on the Male Rat Reproductive System

Food and Chemical Toxicology 46 (2008) 2402–2408

Contents lists available at ScienceDirect

Food and Chemical Toxicology

journal homepage: www.elsevier.com/locate/foodchemtox

The effects of methyl tert-butyl ether (MTBE) on the male rat reproductive system

Dongmei Li a,b, Chuntao Yuan a,b, Yi Gong a,b, Yufeng Huang c, Xiaodong Han a,b,* a Immunology and Reproduction Biology Laboratory, Medical School, Nanjing University, Nanjing, Jiangsu 210093, China b Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093, China c Department of Biochemistry, Jinling Hospital, Clinical School of Medicine, Nanjing University, Nanjing, Jiangsu 210002, China article info abstract

Article history: Methyl tert-butyl ether (MTBE) is an oxygenated compound, which has been widely used in Asia, Europe Received 15 October 2007 and North America. Although numerous in vitro and in vivo studies have demonstrated the carcinogenic- Accepted 23 March 2008 ity and the toxicity of MTBE, there is still a lack of data on reproductive system exposure of MTBE in male rodent animals. We studied subacute exposure of MTBE on the reproductive systems of male Sprague– Dawley rats. MTBE was administered to rats at dose levels of 0, 400, 800 and 1600 mg/kg/day. After 2 Keywords: or 4 weeks of treatments, the rats were euthanized, and their serum, epididymis and testes were col- Methyl tert-butyl ether (MTBE) lected. Significant adverse effects in their reproductive system were observed including: a significant Reproductive system increase in the percentage of abnormal sperm; an irregular and disordered arrangement of the seminif- Toxicity Oxidative stress erous epithelium indicated by a histopathological examination; changed serum levels of testosterone (T), luteinizing hormone (LH) and follicle stimulating hormone (FSH); and decreased levels of mRNA and of androgen binding protein (ABP). In the oxidative stress study, results indicated an increased maleic dialdehyde (MDA) content, implying a raised peroxide level, and that the total antioxidant ability in serum was significantly increased. This finding was especially strong at 1600 mg/kg/day MTBE. In the 2-week treatment, at 1600 mg/kg/day, the mRNA level of 8-oxoguanine DNA glycosidase (OGG1) was signifi-

cantly decreased, and the mRNA level of the extra-cellular form of superoxide dismutase (SODEX) was sig- niﬁcantly increased. Our experiments suggest that relatively high doses of MTBE can exert reproductive system toxicity of male rats and disturb the secretions of T, LH and FSH, possibly due to oxidative stress induced by MTBE. Ó 2008 Elsevier Ltd. All rights reserved.

1. Introduction (Mehlman, 2000; Faulk and Gray, 2001). In view of this, a thorough understanding the characteristics of MTBE remains a priority. Methyl tert-butyl ether (MTBE) is commonly used as an octane Existing studies focused on the carcinogenicity of MTBE (Bel- booster and oxygenate additive in reformulated gasoline. MTBE in- poggi et al., 1997; Borghoff and Williams, 2000; Swenberg and Leh- creases the oxygen content of fuel, decreases carbon monoxide and man-McKeeman, 1999; Zhou et al., 2000). These studies have other hydrocarbon emissions, and reduces air pollution (USEPA, shown that the incidence of renal tubular adenomas and carcino- 1988). In the US, over 200,000 barrels (8 106 l) of MTBE are pro- mas increased in MTBE-exposed male rats. The US environmental duced everyday and more than 1/3 of them are used (Energy Infor- protection agency (EPA), therefore, has listed MTBE as a potential mation Administration (EIA), 2003). In China, more than 1 billion human carcinogen (USEPA, 1998). Few research studies have been kilograms of MTBE are produced annually. However, a report made conducted to figure out the influence of MTBE on the reproductive by US Geological Survey stated that MTBE is the second most fre- systems of rodents. In both inhalation studies and gavage dosages, quently detected chemical in shallow urban monitoring wells it was found that MTBE induces interstitial cell tumors of the testes due to the physicochemical properties of MTBE (Simmons, 1996). in rats. (Belpoggi et al., 1995; Bird et al., 1997; Clegg et al., 1997). For this reason some states in US have either restricted or banned There were other studies on changes in testosterone (T), luteinizing using MTBE, though it is still widely used in Europe and Asia hormone (LH) levels in MTBE-exposed rats (Williams et al., 2000). Our previous studies indicated that a relatively high dose MTBE is directly toxic to spermatogenic cells of mice or rats (Li et al., * Corresponding author. Address: Immunology and Reproduction Biology Labo- 2006, 2007). However, there is still little knowledge on the mech- ratory, Medical School, Nanjing University, Nanjing, Jiangsu 210093, China. Tel./fax: +86 25 83686497. anism through which MTBE influences the male reproductive E-mail address: [email protected] (X. Han). system.

Recently, Krayl et al. (2003) revealed that the energy conserva- Medicine, Nanjing University, according to the manufacturer’s instructions. The ser- tion system involving oxidative stress was very sensitive in the um from group A was first collected and stocked at 80 °C at the Two week mark. Two weeks later, the serum from group B was collected and measured together presence of MTBE by using the model organism Pseudomonas Put- with that from group A. Because commercially available kits are designed for hu- ida KT2440. In mammals, seminiferous epithelium is composed of man serum, the absolute levels of testosterone, FSH and LH could not be qualified two basic cell types: spermatogenic cells and Sertoli cells. It was but the comparative levels of these hormones could be ascertained. found that spermatogenesis, per se, required extensive tissue restructuring in the seminiferous epithelium, resulting in the pro- 2.3. Serum antioxidant and peroxide level determination duction of reactive oxygen species (ROS) and reactive nitrogen spe- The serum antioxidant ability and peroxide level determination including total cies (RNS). An extra-cellular form of superoxide dismutase (SODEX) antioxidant ability and Maleic Dialdehyde (MDA) content were analyzed with the synthesized and secreted by both spermatogenic cells and Sertoli assay kit. Many antioxidants can deoxidize Fe3+ to Fe2+, and the total antioxidant cells acts as an important member of antioxidant defense systems ability of serum was determined by colorimetry at 520 nm. Lipid peroxidation Thio- in rat testes to protect themselves from cellular damage and death barbituric acid-reactive species (TBARS) were determined according to Uchiyama and Mihara (1978), in which malondialdehyde (MDA), an end-product of fatty acid caused by free radicals (Mruk et al., 2002). peroxidation, reacts with thiobarbituric acid (TBA) to form a colored complex. The In this study, we measured the effects of a 2-or-4-week expo- amount of TBARS was measured at 532 nm. sure to MTBE on the reproductive system of male Sprague–Dawley rats, including measurements of the reproductive hormone level in 2.4. Sperm count and the semina deformity ratio serum, sperm count, semina deformity ratio, pathological observation of testes, and the mRNA expression of androgen binding pro- One epididymis of each animal was isolated and cleared of adhering tissues. The cauda epididymis was chopped into small pieces (about 1 mm3) and incubated in tein (ABP) in the testes. We hypothesized that MTBE influences 10 ml of Ham’s F-12 medium at 32 °C for 1 h (Chitra et al., 2002). Then, 1 ml of male reproductive system through oxidative stress, and thus mea- the above solution was diluted with 9 ml Ham’s F-12 medium. The diluted solution sured the antioxidant and peroxide levels in the serum and testes, was transferred into each chamber of the haemocytometer, and sperm number was including the MDA content and total antioxidant ability in the ser- counted. To minimize subjective errors, all operations were performed by one per- son blinded to the group assignment of animals. Then 7–10 ll of suspended sperm um, mRNA expression of 8-oxoguanine DNA glycosidase (OGG1), was smeared on a slide and dyed with Wright Stain for microscopic examination. and extracellular form of superoxide dismutase (SODEX) in testes. 200 sperm of every animal were observed by recording 10–15 slides with an optical microscope (Nikon Corporation, Chiyoda-ku, Tokyo, Japan). The abnormal sperm 2. Materials and methods was observed and the percent of abnormal sperm was counted.

Methyl tert-butyl ether (MTBE), CAS No. 1634-04-4, 99.8% of purity was pur- 2.5. Pathological observation chased from Tedia Company Inc. (Fairﬁeld, OH, USA). Total antioxidant ability test kits and maleic dialdehyde (MDA) test kits were obtained from Nanjing Jiancheng Testicular tissue blocks were ﬁxed in Bouin ’s Fluid (Zhen, 1978). Then, samples Bioengineering Inc. (Nanjing, China). testosterone (T), luteinizing hormone (LH) were sectioned by routine methods and this procedure was followed by H&E stain- and follicle stimulating hormone (FSH) Radioimmunoassay (RIA) kits were pur- ing. Sections were observed with an optical microscope (Nikon Corporation, chased from Beijing Furui Bioengineering Inc. (Beijing, China). Trizol, M–MLV Re- Chiyoda-ku, Tokyo, Japan). verse Transcriptase, dNTP mix and Ribonuclease Inhibitors were purchased from Promega. (Madison, WI, USA). 2Taq PCR MasterMix was obtained from Tiangen Bio- 2.6. Expression of androgen binding protein (ABP), 8-oxoguanine DNA glycosidase tech (Beijing) Co. Ltd. (Beijing, China). All other chemicals were of analytical grade. (OGG1), extracellular form of superoxide dismutase (SODEX) mRNA in testes by RT–PCR

2.1. Animals and housing Total RNAs were extracted from testes with Trizol method. 2 lg RNA was rever-

sely transcribed into cDNAs using 5 lg of oligo (dT)18 and an M-MLV reverse trans- Rats were utilized in accordance with federal guidelines for the humane care criptase kit (Promega, Madison, WI) in a final reaction volume of 20 ll. From this and use of laboratory animals (National Institutes of health, 1985), and the study reaction’s product, 3 ll was used and served as a template for PCR in combination was approved by the Nanjing University Institutional Animal Care and Use Commit- with 0.3 lg of each of the target gene sense and anti-sense primers, which were co- tee. 80 Male Sprague–Dawley rats (28–30 days old) purchased from the Animal amplified with the rat cytoplasmic b-actin primers. The primers used for the ampli- House of Nanjing Medical University were used in this study. Animals were identi- fication of ABP, OGG1, SODEX and b-actin are shown in Table 1. Co-amplification fied by tail tattoo, housed in polycarbonate cages with chip hardwood animal bed- with b-actin was included to ensure that equal amounts of RNA were reversely ding, and allowed ad libitum access to feed and filtered tap water. The animals were transcribed and amplified in each reaction tube. The cycling parameters for the housed in an air-conditioned room at a temperature 20–22 °C and 50–70% humidity PCR reaction of ABP were as follows: denaturation at 94 °C for 30 s, annealing at with controlled lighting (12 h of light and 12 h of darkness) for 10 days prior to 60 °C for 45 s, and extension at 72 °C for 1 min. Thirty cycles were performed. experiments and fed a pellet diet and water. The cycling parameters for the PCR reaction of OGG1 and SODEX were as follows: For the in vivo study, rats were dosed with 0, 400, 800, 1600 mg/kg/d by gavage. MTBE was mixed with peanut oil by weighing the appropriate amount of MTBE. During the acclimation period, 80 rats were evenly assigned to A and B groups by a stratified randomization according to their weights. Rats in each group were fur- Table 1 ther assigned to 4 groups using the same method and there were 10 rats in each of Primer sequence used for RT–PCR analysis the 8 small groups, namely Control A, MTBE A1, MTBE A2, MTBE A3, Control B, Target gene Primer sequence 50–30 Excepted References MTBE B1, MTBE B2 and MTBE B3. The rats in group A were administered MTBE size (bp) by gavage for 2 weeks at target concentrations of 0, 400, 800 or 1600 mg/kg/d (Group Control A, MTBE A1, A2 and A3, respectively). The rats in group B were ABP forward GAGAAGGGAGAGGTGGCCT 954 Wang et al., administered MTBE by gavage for 4 weeks at target concentrations of 0, 400, 800 prime 2005 or 1600 mg/kg/d (Group Control B, MTBE B1, B2 and B3, respectively). Each rat ABP reverse GCTCAAGGCTACTTTGAATAC was observed for clinical signs at daily gavage, and group observations were made primer during exposure. Body weight and food consumption were measured everyday. OGG1 forward AACATTGCTCGCATCACTGGC 356 Verjat et al., To obtain pure serum, blood was collected via carotid artery. A fine tube was in- primer 2000 serted into the carotid of a rat to draw blood into a test tube. The volume of ex- OGG1 reverse GATGTCCACAGGCACAGCCTG tracted blood reached 3.5–4.5% body weight. Blood was kept at 4 °C overnight. primer Serum was obtained by centrifugation at 1000g for 30 min (the hemolyzed sample SODEX forward ATGGTGGCCTTCTTGTTCTGC 447 Mruk and was discarded). At the end of the 2 or 4 week period the respective rats were eutha- primer Chen, 2000 nized by decapitation and the liver, kidney, testis and epididymis were quickly re- SODEX reverse GTGCTGTGGGTGCGGCACACC moved and weighed. primer b-Actin TCACCGAGGCCCCTCTGAACCCTA 641 Mruk and forward Chen, 2000 2.2. Serum hormone analysis primer b-Actin reverse GGCAGTAATCTCCTTCTGCATCCT Serum T, LH and FSH concentrations were measured by SN-695 a gamma coun- primer ter radio immunoassay (RIA) program at department of RIA in Clinical School of 2404 D. Li et al. / Food and Chemical Toxicology 46 (2008) 2402–2408

Table 2 Effects of MTBE on some indices related to the reproductive system of male SD rats in B group

Group Control B (n = 8) 400 mg/kg/d (n = 7) 800 mg/kg/d (n = 9) 1600 mg/kg/d (n =9) Body weight 237.06 ± 25.9 227.54 ± 52.3 242.96 ± 56.1 218.89 ± 36.2 Epididymis weight 0.718 ± 0.144 0.684 ± 0.15 0.758 ± 0.1 0.666 ± 0.18 relative weight of epididymis 0.301 ± 0.039 0.303 ± 0.028 0.321 ± 0.05 0.305 ± 0.085 Sperm numbers (106/ml) 77.703 ± 51.211 101.571 ± 38.66 117.3 ± 38.66 88.403 ± 43.806

*P < 0.05, **P < 0.01 vs. Control. denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s, and extension at 72 °C for ences (SPSS) for windows version 10.0 (SPSS Inc., Chicago, IL, USA). The signiﬁcance 30 s. Thirty cycles were performed. The cycles were followed by an extension at of the difference from the respective controls for each experimental test condition 72 °C for 15 min. Aliquots of 5 ll of PCR product were resolved into a 1.5% agarose was evaluated with a one-way analysis of variance (ANOVA) followed by Dunnett t- gel containing 0.5 lg/ml ethidium bromide. The gel was put on an UV-transillumi- test. In all cases, p < 0.05 was considered signiﬁcant. nator (Gel Doc EQ, Bio-Rad, USA) and photographed. The gene signal was measured by a densitometer and standardized in relation to the b-actin signal using a digital imaging and analysis system. 3. Results

2.7. Data analysis Table 2 shows effects of MTBE on some indices related to the reproductive system of male SD rats in 4 weeks. A rat treated with Values are expressed as the mean ± standard deviation (SD). All calculations and MTBE showed no significant difference in its body weight, its epi- statistical analyses were generated using the Statistical Package for the Social Sci- didymis weight, its relative weight of epididymis and its sperm numbers among B groups. Fig. 1 shows the abnormal sperm per- centages following the administered MTBE doses. With the increasing of MTBE concentration, the abnormal sperm percent was significantly increased (p < 0.05 or p < 0.01). Histopathological examination revealed alterations in the testes of MTBE treated groups (Figs. 2 and 3). Rats in control A and control B showed a compact and regular arrangement of cells in seminiferous tubules. The 1600 mg/kg/d in Group A had less compact cells (Fig. 2), and 800 and 1600 mg/kg/d in Group B showed an irregular and disordered arrangement, with the shedding of cellular material from the seminiferous epithelium (Fig. 3). The effects of MTBE on serum hormone levels (T, LH, FSH) are shown in Fig. 4. T levels were significant lower in the 800 and 1600 mg/kg/d subgroups of Group A (p < 0.01), and the level of T in 800 mg/kg/d subgroup of Group B was significantly higher when compared with the control group, respectively (p < 0.05). In con- Fig. 1. Effects of MTBE exposure on the semina deformity ratio in male SD rats. Data trast, the serum LH levels were significantly higher in the 400, represent mean ± SD (n = 7–9/group). *P < 0.05, **P < 0.01 vs. Control. 800 and 1600 mg/kg/d subgroups of Group A (p < 0.05). The serum

Fig. 2. Effects of MTBE on the testis microstructures of A group rats (dyed with HE). D. Li et al. / Food and Chemical Toxicology 46 (2008) 2402–2408 2405

Fig. 3. Effect of MTBE on the testis microstructures of B group rats (dyed with HE).

FSH level in 800 and 1600 mg/kg/d subgroups of Group A were also tration, the abnormal sperm percentage was significantly in- significantly increased (p < 0.05). creased. Furthermore, through histopathological examination we Fig. 5 shows effects of MTBE on peroxide level and total antiox- found that high doses of MTBE influences the seminiferous epithe- idant ability in a male SD rat. Serum MDA content reflected the lium. The arrangement of cells in MTBE groups was irregular and peroxide level of the rat. MDA content in 1600 mg/kg/d subgroup disordered. Intercellular connections were not compact. It was of A group and of 400 mg/kg/d subgroup of B group were signifi- indicated that MTBE could pass blood-testis barrier and disturb cantly higher (p < 0.05). The total antioxidant ability in the 400, the junction between Sertoli cells and germ cells. In spermatogen- 800 and 1600 mg/kg/d subgroups of A group and in the1600 mg/ esis, the Sertoli cell of the seminiferous epithelium plays a crucial kg/d subgroup of B group were all significantly higher (p < 0.01). role. Histopathological changes caused immature germ cells to en- Figs. 6–8 shows effects of MTBE on expression of ABP, OGG1 and ter into the seminiferous tube and spermatogenesis to stagnate.

SODEX, respectively. In each figure, the upper section is representa- Additionally, we presumed that due to these destroyed microstruc- tive agarose gel electrophoresis, and the lower section displayed tures, a mass of sperm went into the epididymis and led to increase the result using a digital imaging and analysis system. It was found of the amount of sperm in groups MTBE B1, B2 and B3. that the mRNA level of ABP in1600 mg/kg/d of A group, 800 and It has been reported that MTBE might disrupt normal hormonal 1600 mg/kg/d of B group significantly descended (P < 0.05) signaling (Williams et al., 2000). In this study, we detected T, LH (Fig. 6). The mRNA level of OGG1 in 1600 mg/kg/d of A group sig- and FSH in the test subjects. After a two-week treatment, serum nificantly descended (P < 0.05) (Fig. 7). The mRNA level of SODEX in T levels were significantly decreased in MTBE groups A2 and A3, 1600 mg/kg/d of A group significantly ascended (P < 0.05) (Fig. 8). LH levels were significantly increased in MTBE groups A1, A2 and A3, and FSH levels were significantly increased in MTBE group 4. Discussion A3. In Williams’s study, he showed that SD rats given high MTBE doses orally for 15 or 28 days resulted in mild changes in T and MTBE, an environmental contaminant, has been reported to in- LH levels. The decreasing of levels of T and LH for 15 days was ob- duce reproductive abnormalities in male rats (Belpoggi et al., 1995; served with a little difference from our results. The level of LH with Bird et al., 1997; Clegg et al., 1997; Williams et al., 2000). A previ- MTBE dose is decreased, which is not consistent with Leydig cell ous study demonstrated that MTBE was a low-toxic compound, tumorigens (Borghoff and Williams, 2000). As secretion of LH and the LD50 of MTBE for rat was 3433.6 mg/kg (Zhao et al., was regulated by T in a negative feedback manner, we deduced 1999). Thus, in this study, male SD rats were exposed to MTBE that decreased testosterone levels in MTBE groups resulted in the by gavage at 400, 800, 1600 mg/kg/day for 2 or 4 weeks. excess secretion of LH. Previous studies demonstrated that secre- In previous research study (Moreels et al., 2006) proved that tion of FSH was regulated by inhibin and T through a negative feed- chronic exposure to MTBE negatively affects fish sperm motility back mechanism. Therefore, we deduced that MTBE firstly at concentrations that are environmentally relevant and several or- damaged Sertoli cells and inhibited the inhibin secretion of Sertoli ders of magnitude lower than concentrations induces acute effects. cells and the testosterone secretion of Leydig cells, then the But, further studies on effects of MTBE on the reproductive system decreasing of the inhibin and testosterone secretion resulted in of male mammals are lacking. In present experiments, it was found the increasing of FSH secretion. On the other hand, it was found that MTBE had no adverse influence on body weight, epididymis that rats given 440 mg/kg/d MTBE orally for 4 weeks resulted in weight, relative weight of epididymis and sperm amount after a central nervous system (CNS) depression (Johnson and Boyne, four-week treatment. However by the increasing of MTBE concen- 1992). Therefore, we concluded that MTBE decreased the secretion 2406 D. Li et al. / Food and Chemical Toxicology 46 (2008) 2402–2408

Fig. 5. Effects of MTBE on serum peroxide level and total antioxidant ability of male SD rat. MDA content represent serum peroxide level. Data represent mean ± SD (n = 7–9/group). *P < 0.05; **P < 0.01 vs. Control.

Fig. 4. Effects of MTBE on serum testosterone (T), luteinizing hormone (LH) follicle stimulating hormone (FSH) levels in male SD rats. Data represent mean ± SD (n = 7–9/group/time point). *P < 0.05 vs. Control. of testosterone possibly by directly inducing hypothalamus pitui- tary testis system stress or by indirectly inhibiting the CNS. ABP is secreted by the Sertoli cell and the secretion of ABP is regulated by FSH and androgen. ABP can combine with testosterone to maintain a high concentration of androgen in the testicle’s seminiferous tubule, which facilitates the development and the maturation of spermatogenic cells. The characteristics of ABP combining with androgen show that ABP participates in the sex differentiation and the maturation of germ cells. Our results, demonstrated that down-regulated ABP levels in MTBE groups could result in the decreasing of the ABP concentration. Therefore, we Fig. 6. Effects of different MTBE concentrations on the ABP mRNA expression levels in male rats by RT–PCR. Representative agarose gel electrophoresis is shown in the presumed that down-regulation of ABP expression in rats with upper, and the result using a digital imaging and analysis system is shown in the MTBE treatment may be involved in the decreasing of testosterone lower. Data represent mean ± SD (n = 5/group/time point). One set of RT–PCR res- levels and the damage to Sertoli cells. ults is shown: M, Marker; C, Control; 1, MTBE 1; 2, MTBE 2; 3, MTBE 3. D. Li et al. / Food and Chemical Toxicology 46 (2008) 2402–2408 2407

energy conservation system in the cell was the most sensitive site to the presence of MTBE, and this sensitivity involved oxidative stress since alkylhydroperoxide reductase C (AhpC) and two superoxide diamutases (SodM, SodF) were ampliﬁed (Krayl et al., 2003).

In this study, the enhanced expression of SODEX indicated that Ser- toli cells and spermatogenic cells must play an essential role in protecting the testis from free radical damage by the enhanced

expression of SODEX. Ahmed (1999), by inhibiting the nuclear activation factor NFKb which is modulated by reactive oxygen species, found that pro- grammed cell death reverted almost to the level of the control group, illustrating the importance of oxidative DNA repair as a mechanism. The other study revealed that MTBE induces a muta- genic pathway involving an oxidative DNA base and an intact repair system (Williams-Hill et al., 1999). The oxoguanine DNA glycosylase (OGG1) is a DNA repair enzyme that excises 7,8-dihy- dro-8-oxoguanine present in DNA damaged by oxidative stress. In this study, OGG1 expression levels decreased. It could not be dis- proved that MTBE-treated cells were damaged at the DNA-level. In conclusion, our data indicates that relatively high doses of MTBE can exert reproductive system toxicity of male rats. We found MTBE could disturb the secretions of testosterone, LH and FSH; inﬂuence the production of sperm; damage the seminiferous Fig. 7. Effects of different MTBE concentrations on the OGG1 mRNA expression tubule and Sertoli cells; and induce oxidative stress. At a molecule levels in male rats by RT–PCR. Representative agarose gel electrophoresis is shown in the upper, and the result using a digital imaging and analysis system is shown in level, expressions of ABP, OGG1 and SODEX experienced changes. the lower. Data represent mean ± SD (n = 5/group/time point). One set of RT–PCR Furthermore, it is assumed that MTBE may induce toxicity involv- results is shown: M, Marker; C, Control; 1, MTBE 1; 2, MTBE 2; 3, MTBE 3. ing through DNA damage by oxidative stress. Therefore, we concluded that relatively high doses MTBE could disrupt spermatogenesis, but the detailed disruption mechanism requires further investigation. Data from the present study could be employed for further study of reproductive system resulting from environmental MTBE.

Conﬂict of Interest Statement

The authors declare that there are no conﬂicts of interest.

Acknowledgements

The authors are grateful to the foundation of the program: Na- tional Natural Science Foundation of China (20577019); Key Labo- ratory of Yangtze River Water Environment, Ministry of Education, China (YRWEF07006).

References

Ahmed, F.E., 1999. The role of oxidative stress in environmental carcinogenesis. Environ. Carcino. Ecotox. Rev. C17, 111–142. Aravindan, G.R., Pineau, C.P., Bardin, C.W., Cheng, C.Y., 1996. Ability of trypsin in mimicking germ cell factors that affect Sertoli cell secretory function. J. Cellular Physiol. 168, 123–133. Aravindan, G.R., Mruk, D., Lee, W.M., Cheng, C.Y., 1997. Identiﬁcation, isolation, and characterization of a 41-kilodalton protein from rat germ cell-conditioned Fig. 8. Effects of different MTBE concentrations on the SODEX mRNA expression medium exhibiting concentration-dependent dual biological activities. levels in male rats by RT–PCR. Representative agarose gel electrophoresis is shown Endocrinology 138, 3259–3268. in the upper, and the result using a digital imaging and analysis system is shown in Belpoggi, F., Soffritti, M., Maltoni, C., 1995. Methyl-tert butyl ether (MTBE) a the lower. Data represent mean ± SD (n = 5/group/time point). One set of RT–PCR gasoline additive – causes testicular and lymphohaematopoietic cancers in rats. results is shown: M, Marker; C, Control; 1, MTBE 1; 2, MTBE 2; 3, MTBE 3. Toxicol. Ind. Health 11, 119–149. Belpoggi, F., Soffritti, M., Filippini, F., Maltoni, C., 1997. Results of long term experimental studies on the carcinogenicity of methyl-tert-butyl ether (MTBE). Ann. New York Acad. Sci. 837, 77–95. An assessment of the MTBE-induced oxidative stress revealed Bird, M.G., Burleigh-Flayer, H.D., Chun, J.S., Douglas, J.F., Kneiss, J.J., Andrews, L.S., that MTBE enhanced lipid peroxidation. Enhancement of lipid per- 1997. Oncogenicity studies of inhaled methyl tertiarybutyl ether (MTBE) in CD- oxidation induced increases of total antioxidant ability in serum. 1 mice and F-344 rats. J. Appl. Toxicol. (Suppl. 1), S45–S55. Borghoff, S.J., Williams, T.M., 2000. Species-speciﬁc tumor responses following Therefore, the participation of oxidative stress contributed to the exposure to methyl tert-butyl ether. CIIT Activities 20, 1–9. toxicity of MTBE. Chitra, K.C., Latchoumycandane, C., Mathur, P.P., 2002. Effect of nonylphenol on the Experiments (Aravindan et al., 1996, 1997) revealed that Sertoli antioxidant system in epididymal sperm of rats. Arch. Toxicol. 76, 545–551. Clegg, E.D., Cook, J.C., Chapin, R.E., Foster, P.M., Duston, G.P., 1997. Leydig cells cells and spermatogenic cells could produce an extracellular forms hyperplasia and adenoma formation: mechanisms and relevance to human. of superoxide dismutase (SODEX). Other studies revealed that the Reprod. Toxicol. 11, 107–121. 2408 D. Li et al. / Food and Chemical Toxicology 46 (2008) 2402–2408

Energy Information Administration (EIA), 2003. Status and impact of state MTBE Swenberg, J., Lehman-McKeeman, L.D., 1999. a2-Urinary globulin-associated bans, Washington, DC: US Department of Energy, March 2003 revision, http:// nephropathy as a mechanism of renal tubule cell carcinogenesis in male rats. www.tonto.eia.doe.gov/FTPROOT/service/mtbe.pdf (Accessed 5.12.2003). In: Capen, C.C., Dybing, E., Rice, J.M., Wilbourn, J.D. (Eds.), Apecies Differences: Faulk, R.O., Gray, J.S., 2001. Salem revisited: updating the MTBE controversy. Thyroid, Kidney and Urinary Bladder Carcinogenesis. IARC Scientific Publication Environ. Forensics 2, 29–59. No. 147, Lyon, France, pp. 95–118. Johnson, W., Boyne, R.A., 1992. Twenty-eight day oral (Gavage) toxicity study of Uchiyama, M., Mihara, M., 1978. Determination of malondialdehyde precursor in methyl tert-butyl ether (MTBE) in rats. IIT Research Institute Report 108100, tissues by thiobarbituric acid test. Anal. Biochem. 86, 271–278. Amoco Corporation, Chicago, IL. USEPA, 1988. Guidance on estimating motor vehicle emission reductions from the Li, D.M., Yin, D.Q., Han, X.D., 2007. Methyl tert-butyl ether (MTBE)-induced use of alternative fuels and fuel blends. Report No. EPA-AA-TSS-PA-87-4, Ann, cytotoxicity and oxidative stress in isolated rat spermatogenic cells. J. Appl. Arbor. ML. Toxicol. 27, 10–17. USEPA, 1998. MTBE Fact Sheet #1: Overview. EPA 510-F-97-014, US. EPA, Office of Li, D.M., Han, X.D., 2006. Evaluation of toxicity of methyl tert-butyl ether (MTBE) on Solid Waste and Emergency Response, Washington, DC. mouse spermatogenic cells in vitro. Toxicol. Ind. Health 22, 291–299. Verjat, T., Dhenaut, A., Radicella, J.P., Araneda, S., 2000. Detection of 8-oxoG DNA Krayl, M., Benndorf, D., Loffhagen, N., Babel, W., 2003. Use of proteomics and glycosylase activity and OGG1 transcripts in the rat CNS. Mutat. Res. 460, 127– physiological characteristics to elucidate ecotoxic effects of methyl tert-butyl 138. ether in Pseudomonas putida KT2440. Proteomics 3, 1544–1552. Wang, Y.B., Song, L., Zhu, Z.P., Chen, J.F., Wang, X.R., 2005. Effects of dibutyl Mehlman, M.A., 2000. Misclassification of carcinogenic methyl tertiary-butyl ether: phthalate on sertoli cells of rat testis. Zhonghua Yu Fang Yi Xue Za Zhi 39, 179– (MTBE) by the National Toxicology Program Board: smokescreen in, science out. 181. Arch. Environ. Health 55, 73–74. Williams-Hill, D., Spears, C.P., Prakash, S., Olah, G.A., Shamma, T., Moin, T., Kim, L.Y., Moreels, D., Van Cauwenberghe, K., Debaere, B., Rurangwa, E., Vromant, N., Hill, C.K., 1999. Mutagenicity studies of methyl-tert-butyl ether using the Ames Bastiaens, L., Diels, L., Springael, D., Merckx, R., Ollevier, F., 2006. Long-term tester strain TA102. Mutat. Res. 446, 15–21. exposure to environmentally relevant doses of methyl-tert-butyl ether causes Williams, T.M., Cattley, R.C., Borghoff, S., 2000. Alterations in endocrine responses significant reproductive dysfunction in the zebrafish (Danio rerio). Environ. on male Sprague–Dawley rats following oral administration of methyl tert- Toxicol. Chem. 25, 2388–2393. butyl ether. Toxicol. Sci. 54, 168–176. Mruk, D.D., Chen, C.Y., 2000. In vitro regulation of extracellular superoxide Zhao, J., Huang, G., Tian, S., 1999. Acute toxicity studies on methyl tertiary-butyl dismutase in sertoli cells. Life Sci. 67, 133–145. ether (MTBE). J Public Health (Oxf). 15, 264–265. Mruk, D.D., Silvestrini, B., Mo, M., Cheng, C.Y., 2002. Antioxidant superoxide Zhen, G.C. (Ed.), 1978. Microtechnique in Biology. People’s Education Press, Peking, dismutase-a review: its function, regulation in the testis, and role in male China. p. 7. fertility. Contraception 65, 305–311. Zhou, W., Yuan, D., Huang, G., Zhang, H., Ye, S., 2000. Mutagenicity of methyl Simmons, B.P., 1996. MTBE-where is it, and how did it get there? HydroVisions-Jan/ tertiary-butyl ether. J. Environ. Pathol. Toxicol. Oncol. 19, 35–39. Feb 96-Chemist’s Corner.