DOCSLIB.ORG

Bacteria and Methanogen Community in the Rumen Fed Different Levels of Grass-Legume Silages

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Bacteria and Methanogen Community in the Rumen Fed Different Levels of Grass-Legume Silages BIODIVERSITAS ISSN: 1412-033X Volume 20, Number 4, April 2019 E-ISSN: 2085-4722 Pages: 1055-1062 DOI: 10.13057/biodiv/d200417 Bacteria and methanogen community in the rumen fed different levels of grass-legume silages RONI RIDWAN1,, IMAN RUSMANA2, YANTYATI WIDYASTUTI1, KOMANG G. WIRYAWAN3, BAMBANG PRASETYA1, MITSUO SAKAMOTO4, MORIYA OHKUMA4 1Research Center for Biotechnology, Indonesian Institute of Sciences. Jl. Raya Jakarta Bogor Km. 46, Cibinong, Bogor 16911, West Java, Indonesia Tel:+62-21-8754587, Fax: +62-21-8754588, email: [email protected], [email protected] 2Department of Biology, Faculty of Mathematics and Natural Sciences, Institut Pertanian Bogor. Jl. Raya Dramaga, Bogor 16680, West Java, Indonesia 3Department of Animal Nutrition, Faculty of Animal Sciences, Institut Pertanian Bogor. Jl. Raya Dramaga, Bogor 16680, West Java, Indonesia 4Microbe Division/Japan Collection of Microorganisms RIKEN Bioresource Center, Tsukuba, Ibaraki, Japan Manuscript received: 7 January 2019. Revision accepted: 22 March 2019. Abstract. Ridwan R, Rusmana I, Widyastuti Y, Wiryawan KG, Prasetya B, Sakamoto M, Ohkuma M. 2019. Bacteria and methanogen community in the rumen fed different levels of grass-legume silages. Biodiversitas 20: 1055-1062. This study aimed to investigate the effects of dietary grass-legume silages on the microbial community by using a culture-independent approach. Treatments consisted of R0: 50% Pennisetum purpureum and 50 % concentrate; R1: 20% P. purpureum, 50 % concentrate, and 30% grass-legumes silage; R2: 20% P. purpureum, 35 % concentrate, and 45% grass-legumes silage; and R3; 20% P. purpureum, 20 % concentrate, and 60% grass- legumes silage. The rumen fluid obtained from fistulated cattle was used for T-RFLP, 16S rDNA clone library, and qPCR analyses. The results indicated that bacterial diversity was dominated by Bacteroidetes, Firmicutes, and methanogen by Methanobacteriales, based on partial 16S rDNA sequences. The microbial communities were dominated by Prevotella brevis, P. ruminicola, Succiniclasticum ruminis, and Methanobrevibacter ruminantium, M. smithi, M. thueri, and M. millerae. The increasing silage diet in a rumen suppressed methanogenesis by reducing population distribution of Methanobacteriales, directly or indirectly, by reducing the diversity of bacterial populations. Generally, the increase silage in the diet changed the bacterial and methanogen community. Grass-legume silage diets of less than 45% are potential for ruminant diet to reduce methane production by a decrease of 4% in the relative distribution of methanogens in the rumen. Keywords: 16S rDNA sequence, culture-independent, grass-legumes silage, microbial community INTRODUCTION of feed for sustainable ruminant production (Ridwan et al. 2015). The rumen a complex microbiome of bacteria and Up until recently, information regarding the methanogen plays an important role in feed metabolisms. microbiome community in the rumen of Ongole cattle has Naturally, methane (CH4) is produced during feed been limited. Examination of the microbial community in fermentation by methanogens in the rumen, which the rumen, based on cultural methods, has produced limited constitutes an energy loss and reduces the productivity of results that include less than 1-2 % from total microbes and the ruminant. Ruminant is one contributor of enteric CH4 is highly misleading. Molecular analyses, based on culture- emissions into the environment from the livestock sector independent methods using the 16S rDNA sequence, (Patra et al. 2012; Ji and Park 2012), and potent greenhouse should be used for additional information of microbial gas that contributes to global warming and climate change diversity from unculturable rumen microbes. Many useful (IPCC 2014; Bodas et al. 2012). methods may be used for metagenomic assays based on One of the most limiting factors in feeding cattle with 16S rDNA, such as terminal-restriction fragment length forage is nutrient quality and sustainability. Calliandra polymorphism (T-RFLP) (Khafipour et al. 2009; Cadillo et calothyrsus contains high crude protein (21-30%) and a al. 2008), 16S rDNA clone library (Danielsson et al. 2012; total tannin 8-14%. Since crude protein supplies total N for Fernando et al. 2010), and qPCR (Tajima et al. 2001; microbes to synthesize protein, polyphenolics are a useful Bustin et al. 2009). Moreover, additional data on microbial nutritional strategy to reduces CH4 emissions (Lopez et al. diversity and clustering will be advantageous. The 2010). The increased level of silage diets in a rumen in objective of this study was to investigate the bacteria and vitro fermentation system suppressed both methane methanogen communities in the rumen of Ongole cattle, production and protozoa population (Ridwan et al. 2014). fed different levels of silage containing C. calothyrsus. The combination of grasses and legumes (1:1) is an alternative solution for improving the crude protein content 1056 BIODIVERSITAS 20 (4): 1055-1062, April 2019 MATERIALS AND METHODS The DNA samples were used for molecular analyses consisted of T-RFLP, 16S rDNA clone library, and qPCR. Animals and feedstuffs The 16S rDNA amplification was performed as Feeding trials were carried out using three fistulated described previously by Ridwan et al. (2014, 2015). DNA Ongole cattle (according to consideration of animal was amplified by using primers 6FAM-27F welfare), as approved by the Animal Care and Use (5’AGAGTTTGATCCTGGCTCAG3’) and 1492R Committee of Bogor Agricultural University. Silage was (5’GGTTACCTTGTTACGACTT3’) for bacteria and produced according to the result of previous research 6FAM-Met86F (5’GCTCAGTAACACGTGG3’) and (Ridwan et al. 2014, 2015). Grass-legume silages were Met1340R 5’CGGTGTGTGCAAGGAG3’) for made by using a wilted Pennisetum purpureum hybrid (a methanogens. Amplification of each PCR reaction was in a type of grass) and C. calothyrsus (Fabaceae; red flower) total volume of 50 μL, and consisted of 5 μL of dissolved legumes, with the proportion of 50%:50% (w/w). The DNA (<1 μg), 0.5 μL of 1.25U Takara Ex Taq (Takara grasses were provided by the plant collection of the Shuzo), 5 μL of 10x Ex Taq buffer, 4 μL of dNTP mixture Research Center for Biotechnology, Indonesian Institute of (2.5 mmolL-1), 10 pmol of each primer and up to 50 μL of Sciences, Cibinong, Bogor, West Java, indonesia. Legumes pure distilled water. The 16S rDNA was amplified by using were collected from PT. Perkebunan Nusantara VIII a Biometra Thermocycler TGradient with the following Gunung Mas Cisarua, Bogor, West Java, Indonesia. Forage program for bacteria: 95°C for 3 min, followed by 30 cycles was chopped to lengths of approximately 3-5 cm. Readily consisting of 95°C for 30 s, 50°C for 30 s and 72°C for 1.5 available carbohydrate (10%) and silage inoculants of the min, with a final extension at 72°C for 10 min. The Biotechnology Culture Collection of Microorganism, program for methanogens was 94°C for 5 min, followed by Research Center for Biotechnology, Indonesian Institute of 30 cycles of 94°C for 30 s, 57°C for 30 s, and 68°C for 1 Sciences (Lactobacillus plantarum BTCC570) (2.5x106 min; with a final extension at 68°C for 7 min. Amplified CFU/g silage material) were added as silage additives. The DNAs were verified by electrophoresis of 5 μL aliquots of silages were prepared in plastic drum silos (capacity PCR product on a 1.5% agarose gel in 1x TAE buffer. The 80kg/drum). The silages were incubated at room PCR products were purified with an Ultra Clean PCR temperature (30°C) for 30 days. After incubation, the CleanUp Kit (Mo Bio Laboratories, Inc.,). The purified 16S silages were opened for quality analysis before being used rDNA amplicons were stored at -20°C for further analysis for the feeding trial. For the quality evaluation of silages, of T-RFLP and 16S rDNA clone library. proximate analysis, fiber fraction, and tannin contents were conducted as described previously (Ridwan et al. 2015). Molecular analyses The experiment was arranged in a cross over design T-RFLP analysis was performed as described with four treatment diets and three sampling periods as previously by Ridwan et al. (2014, 2015) based on the replications. The experimental diets consisted of the method of Sakamoto et al. (2006) and Danielsson et al. following: R0: 50% Pennisetum purpureum and 50% (2012), with some modification. The conditions of 16S concentrate; R1: 20% P. purpureum, 50 % concentrate, and rDNA amplification were described above. The purified 30% grass-legumes silage; R2: 20% P. purpureum, 35 % PCR product (2 µl) was digested with four restriction concentrate, and 45% grass-legumes silage; and R3; 20% enzymes that consisted of 20U of AluI, HhaI, MspI and P. purpureum, 20 % concentrate, and 60% grass-legumes RsaI (TaKaRa Shuzo Japan) in total volume 10 µL at 37oC silage. Each treatment was administered for 17 days, and for 1 h. The restriction digest product (2 µL) was mixed rumen samples were collected on days 7, 12, and 17 as with 8µl of Hi-Di Formamide (Applied Biosystems, Foster replication sampling periods. All cattle were given amounts City, CA) and 1µL standard Gene ScanTM 1200 LIZ of feed equal to 2% dry matter of their body weight (245 (Applied Biosystems, Foster City, CA). Each sample was kg). The Nutrient and chemical composition of diets are denatured at 95oC for 2 min and then immediately placed shown in Table 1. on ice. The length of terminal restriction fragment (T-RF) was determined on an ABI PRISM 3100 Genetic Analyzer Sample collection, DNA extraction, and 16S rDNA (Applied Biosystems). T-RF sizes were estimated by using amplification local method peak scan version 2.0 (Applied Biosystems). The rumen fluid was obtained from each of the three T-RFs with area peaks of less than 2% total area were fistulated cattle 3 hours after morning feeding. Samples of excluded from the analysis. DNA fragments were resolved rumen fluid were mixed, homogenized, filtered by using to one base pair by manual alignment of the standard peaks sterilized double cheesecloth, and transferred to a sterilized from different electropherograms.
Load more

Recommended publications
  • Genotyping of Uncultured Archaea in a Polluted Site of Suez Gulf, Egypt, Based on 16S Rrna Gene Analyses
    Egyptian Journal of Aquatic Research (2014) 40,27–33 National Institute of Oceanography and Fisheries Egyptian Journal of Aquatic Research http://ees.elsevier.com/ejar www.sciencedirect.com FULL LENGTH ARTICLE Genotyping of uncultured archaea in a polluted site of Suez Gulf, Egypt, based on 16S rRNA gene analyses Hosam Easa Elsaied * Aquagenome Resources and Biotechnology Research Group, National Institute of Oceanography, 101-El-Kasr El-Eini Street, Cairo, Egypt Received 3 February 2014; revised 11 March 2014; accepted 11 March 2014 Available online 18 April 2014 KEYWORDS Abstract Culture-independent 16S rRNA gene analysis approach was used to explore and evalu- Archaea; ate archaea in a polluted site, El-Zeitia, Suez Gulf, Egypt. Metagenomic DNA was extracted from a 16S rRNA gene diversity; sediment sample. Archaeal 16S rRNA gene was PCR amplified using universal archaeal primers, Sediment; followed by cloning and direct analyses by sequencing. Rarefaction analysis showed saturation, Suez Gulf recording 21 archaeal 16S rRNA gene phylotypes, which represented the total composition of archaea in the studied sample. Phylogenetic analysis showed that all recorded phylotypes belonged to two archaeal phyla. Sixteen phylotypes were located in the branch of methanogenic Eur- yarchaeota and more closely related to species of the genera Methanosaeta and Methanomassiliicoc- cus. Five phylotypes were affiliated to the new archaeal phylum Thaumarchaeota, which represented by species Candidatus nitrosopumilus. The recorded phylotypes had unique sequences, characteriz- ing them as new phylogenetic lineages. This work is the first investigation of uncultured archaea in the Suez Gulf, and implicated that the environmental characteristics shaped the diversity of archa- eal 16S rRNA genes in the studied sample.
    [Show full text]
  • Research Article Diversity and Distribution of Archaea in the Mangrove Sediment of Sundarbans
    Hindawi Publishing Corporation Archaea Volume 2015, Article ID 968582, 14 pages http://dx.doi.org/10.1155/2015/968582 Research Article Diversity and Distribution of Archaea in the Mangrove Sediment of Sundarbans Anish Bhattacharyya,1 Niladri Shekhar Majumder,2 Pijush Basak,1 Shayantan Mukherji,3 Debojyoti Roy,1 Sudip Nag,1 Anwesha Haldar,4 Dhrubajyoti Chattopadhyay,1 Suparna Mitra,5 Maitree Bhattacharyya,1 and Abhrajyoti Ghosh3 1 Department of Biochemistry, University of Calcutta, 35 Ballygunge Circular Road, Kolkata, West Bengal 700019, India 2RocheDiagnosticsIndiaPvt.Ltd.,Block4C,AkashTower,NearRubyHospital,781Anandapur,Kolkata700107,India 3Department of Biochemistry, Bose Institute, P1/12, C. I. T. Road, Scheme VIIM, Kolkata, West Bengal 700054, India 4Department of Geography, University of Calcutta, 35 Ballygunge Circular Road, Kolkata, West Bengal 700019, India 5Norwich Medical School, University of East Anglia and Institute of Food Research, Norwich Research Park, Norwich, Norfolk NR4 7UA, UK Correspondence should be addressed to Dhrubajyoti Chattopadhyay; [email protected], Suparna Mitra; [email protected], Maitree Bhattacharyya; [email protected], and Abhrajyoti Ghosh; [email protected] Received 30 March 2015; Revised 25 June 2015; Accepted 14 July 2015 Academic Editor: William B. Whitman Copyright © 2015 Anish Bhattacharyya et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Mangroves are among the most diverse and productive coastal ecosystems in the tropical and subtropical regions. Environmental conditions particular to this biome make mangroves hotspots for microbial diversity, and the resident microbial communities play essential roles in maintenance of the ecosystem.
    [Show full text]
  • Insights Into Archaeal Evolution and Symbiosis from the Genomes of a Nanoarchaeon and Its Inferred Crenarchaeal Host from Obsidian Pool, Yellowstone National Park
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Microbiology Publications and Other Works Microbiology 4-22-2013 Insights into archaeal evolution and symbiosis from the genomes of a nanoarchaeon and its inferred crenarchaeal host from Obsidian Pool, Yellowstone National Park Mircea Podar University of Tennessee - Knoxville, [email protected] Kira S. Makarova National Institutes of Health David E. Graham University of Tennessee - Knoxville, [email protected] Yuri I. Wolf National Institutes of Health Eugene V. Koonin National Institutes of Health See next page for additional authors Follow this and additional works at: https://trace.tennessee.edu/utk_micrpubs Part of the Microbiology Commons Recommended Citation Biology Direct 2013, 8:9 doi:10.1186/1745-6150-8-9 This Article is brought to you for free and open access by the Microbiology at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Microbiology Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Authors Mircea Podar, Kira S. Makarova, David E. Graham, Yuri I. Wolf, Eugene V. Koonin, and Anna-Louise Reysenbach This article is available at TRACE: Tennessee Research and Creative Exchange: https://trace.tennessee.edu/ utk_micrpubs/44 Podar et al. Biology Direct 2013, 8:9 http://www.biology-direct.com/content/8/1/9 RESEARCH Open Access Insights into archaeal evolution and symbiosis from the genomes of a nanoarchaeon and its inferred crenarchaeal host from Obsidian Pool, Yellowstone National Park Mircea Podar1,2*, Kira S Makarova3, David E Graham1,2, Yuri I Wolf3, Eugene V Koonin3 and Anna-Louise Reysenbach4 Abstract Background: A single cultured marine organism, Nanoarchaeum equitans, represents the Nanoarchaeota branch of symbiotic Archaea, with a highly reduced genome and unusual features such as multiple split genes.
    [Show full text]
  • The Genome Sequence of Methanohalophilus Mahii SLPT
    Hindawi Publishing Corporation Archaea Volume 2010, Article ID 690737, 16 pages doi:10.1155/2010/690737 Research Article TheGenomeSequenceofMethanohalophilus mahii SLPT Reveals Differences in the Energy Metabolism among Members of the Methanosarcinaceae Inhabiting Freshwater and Saline Environments Stefan Spring,1 Carmen Scheuner,1 Alla Lapidus,2 Susan Lucas,2 Tijana Glavina Del Rio,2 Hope Tice,2 Alex Copeland,2 Jan-Fang Cheng,2 Feng Chen,2 Matt Nolan,2 Elizabeth Saunders,2, 3 Sam Pitluck,2 Konstantinos Liolios,2 Natalia Ivanova,2 Konstantinos Mavromatis,2 Athanasios Lykidis,2 Amrita Pati,2 Amy Chen,4 Krishna Palaniappan,4 Miriam Land,2, 5 Loren Hauser,2, 5 Yun-Juan Chang,2, 5 Cynthia D. Jeffries,2, 5 Lynne Goodwin,2, 3 John C. Detter,3 Thomas Brettin,3 Manfred Rohde,6 Markus Goker,¨ 1 Tanja Woyke, 2 Jim Bristow,2 Jonathan A. Eisen,2, 7 Victor Markowitz,4 Philip Hugenholtz,2 Nikos C. Kyrpides,2 and Hans-Peter Klenk1 1 DSMZ—German Collection of Microorganisms and Cell Cultures GmbH, 38124 Braunschweig, Germany 2 DOE Joint Genome Institute, Walnut Creek, CA 94598-1632, USA 3 Los Alamos National Laboratory, Bioscience Division, Los Alamos, NM 87545-001, USA 4 Biological Data Management and Technology Center, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA 5 Oak Ridge National Laboratory, Oak Ridge, TN 37830-8026, USA 6 HZI—Helmholtz Centre for Infection Research, 38124 Braunschweig, Germany 7 Davis Genome Center, University of California, Davis, CA 95817, USA Correspondence should be addressed to Stefan Spring, [email protected] and Hans-Peter Klenk, [email protected] Received 24 August 2010; Accepted 9 November 2010 Academic Editor: Valerie´ de Crecy-Lagard´ Copyright © 2010 Stefan Spring et al.
    [Show full text]
  • Variations in the Two Last Steps of the Purine Biosynthetic Pathway in Prokaryotes
    GBE Different Ways of Doing the Same: Variations in the Two Last Steps of the Purine Biosynthetic Pathway in Prokaryotes Dennifier Costa Brandao~ Cruz1, Lenon Lima Santana1, Alexandre Siqueira Guedes2, Jorge Teodoro de Souza3,*, and Phellippe Arthur Santos Marbach1,* 1CCAAB, Biological Sciences, Recoˆ ncavo da Bahia Federal University, Cruz das Almas, Bahia, Brazil 2Agronomy School, Federal University of Goias, Goiania,^ Goias, Brazil 3 Department of Phytopathology, Federal University of Lavras, Minas Gerais, Brazil Downloaded from https://academic.oup.com/gbe/article/11/4/1235/5345563 by guest on 27 September 2021 *Corresponding authors: E-mails: [email protected]fla.br; [email protected]. Accepted: February 16, 2019 Abstract The last two steps of the purine biosynthetic pathway may be catalyzed by different enzymes in prokaryotes. The genes that encode these enzymes include homologs of purH, purP, purO and those encoding the AICARFT and IMPCH domains of PurH, here named purV and purJ, respectively. In Bacteria, these reactions are mainly catalyzed by the domains AICARFT and IMPCH of PurH. In Archaea, these reactions may be carried out by PurH and also by PurP and PurO, both considered signatures of this domain and analogous to the AICARFT and IMPCH domains of PurH, respectively. These genes were searched for in 1,403 completely sequenced prokaryotic genomes publicly available. Our analyses revealed taxonomic patterns for the distribution of these genes and anticorrelations in their occurrence. The analyses of bacterial genomes revealed the existence of genes coding for PurV, PurJ, and PurO, which may no longer be considered signatures of the domain Archaea. Although highly divergent, the PurOs of Archaea and Bacteria show a high level of conservation in the amino acids of the active sites of the protein, allowing us to infer that these enzymes are analogs.
    [Show full text]
  • Methanogens: Biochemical Background and Biotechnological Applications Franziska Enzmann1, Florian Mayer1 , Michael Rother2 and Dirk Holtmann1*
    Enzmann et al. AMB Expr (2018) 8:1 https://doi.org/10.1186/s13568-017-0531-x MINI-REVIEW Open Access Methanogens: biochemical background and biotechnological applications Franziska Enzmann1, Florian Mayer1 , Michael Rother2 and Dirk Holtmann1* Abstract Since fossil sources for fuel and platform chemicals will become limited in the near future, it is important to develop new concepts for energy supply and production of basic reagents for chemical industry. One alternative to crude oil and fossil natural gas could be the biological conversion of ­CO2 or small organic molecules to methane via metha‑ nogenic archaea. This process has been known from biogas plants, but recently, new insights into the methanogenic metabolism, technical optimizations and new technology combinations were gained, which would allow moving beyond the mere conversion of biomass. In biogas plants, steps have been undertaken to increase yield and purity of the biogas, such as addition of hydrogen or metal granulate. Furthermore, the integration of electrodes led to the development of microbial electrosynthesis (MES). The idea behind this technique is to use CO­ 2 and electrical power to generate methane via the microbial metabolism. This review summarizes the biochemical and metabolic background of methanogenesis as well as the latest technical applications of methanogens. As a result, it shall give a sufcient overview over the topic to both, biologists and engineers handling biological or bioelectrochemical methanogenesis. Keywords: Methanogens, Genetic tools, Biogas, Microbial electrosynthesis, Electroactivity Introduction process involving methanogens. Tese archaea use CO­ 2 Methanogens are biocatalysts, which have the potential and ­H2 and/or small organic molecules, such as acetate, to contribute to a solution for future energy problems by formate, and methylamine and convert it to methane.
    [Show full text]
  • International Code of Nomenclature of Prokaryotes
    2019, volume 69, issue 1A, pages S1–S111 International Code of Nomenclature of Prokaryotes Prokaryotic Code (2008 Revision) Charles T. Parker1, Brian J. Tindall2 and George M. Garrity3 (Editors) 1NamesforLife, LLC (East Lansing, Michigan, United States) 2Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (Braunschweig, Germany) 3Michigan State University (East Lansing, Michigan, United States) Corresponding Author: George M. Garrity ([email protected]) Table of Contents 1. Foreword to the First Edition S1–S1 2. Preface to the First Edition S2–S2 3. Preface to the 1975 Edition S3–S4 4. Preface to the 1990 Edition S5–S6 5. Preface to the Current Edition S7–S8 6. Memorial to Professor R. E. Buchanan S9–S12 7. Chapter 1. General Considerations S13–S14 8. Chapter 2. Principles S15–S16 9. Chapter 3. Rules of Nomenclature with Recommendations S17–S40 10. Chapter 4. Advisory Notes S41–S42 11. References S43–S44 12. Appendix 1. Codes of Nomenclature S45–S48 13. Appendix 2. Approved Lists of Bacterial Names S49–S49 14. Appendix 3. Published Sources for Names of Prokaryotic, Algal, Protozoal, Fungal, and Viral Taxa S50–S51 15. Appendix 4. Conserved and Rejected Names of Prokaryotic Taxa S52–S57 16. Appendix 5. Opinions Relating to the Nomenclature of Prokaryotes S58–S77 17. Appendix 6. Published Sources for Recommended Minimal Descriptions S78–S78 18. Appendix 7. Publication of a New Name S79–S80 19. Appendix 8. Preparation of a Request for an Opinion S81–S81 20. Appendix 9. Orthography S82–S89 21. Appendix 10. Infrasubspecific Subdivisions S90–S91 22. Appendix 11. The Provisional Status of Candidatus S92–S93 23.
    [Show full text]
  • A Metagenomics Roadmap to the Uncultured Genome Diversity in Hypersaline Soda Lake Sediments Charlotte D
    Vavourakis et al. Microbiome (2018) 6:168 https://doi.org/10.1186/s40168-018-0548-7 RESEARCH Open Access A metagenomics roadmap to the uncultured genome diversity in hypersaline soda lake sediments Charlotte D. Vavourakis1 , Adrian-Stefan Andrei2†, Maliheh Mehrshad2†, Rohit Ghai2, Dimitry Y. Sorokin3,4 and Gerard Muyzer1* Abstract Background: Hypersaline soda lakes are characterized by extreme high soluble carbonate alkalinity. Despite the high pH and salt content, highly diverse microbial communities are known to be present in soda lake brines but the microbiome of soda lake sediments received much less attention of microbiologists. Here, we performed metagenomic sequencing on soda lake sediments to give the first extensive overview of the taxonomic diversity found in these complex, extreme environments and to gain novel physiological insights into the most abundant, uncultured prokaryote lineages. Results: We sequenced five metagenomes obtained from four surface sediments of Siberian soda lakes with a pH 10 and a salt content between 70 and 400 g L−1. The recovered 16S rRNA gene sequences were mostly from Bacteria,evenin the salt-saturated lakes. Most OTUs were assigned to uncultured families. We reconstructed 871 metagenome-assembled genomes (MAGs) spanning more than 45 phyla and discovered the first extremophilic members of the Candidate Phyla Radiation (CPR). Five new species of CPR were among the most dominant community members. Novel dominant lineages were found within previously well-characterized functional groups involved in carbon, sulfur, and nitrogen cycling. Moreover, key enzymes of the Wood-Ljungdahl pathway were encoded within at least four bacterial phyla never previously associated with this ancient anaerobic pathway for carbon fixation and dissimilation, including the Actinobacteria.
    [Show full text]
  • Microbiome of Seven Full-Scale Anaerobic Digestion Plants in South Korea: Effect of Feedstock and Operational Parameters
    energies Article Microbiome of Seven Full-Scale Anaerobic Digestion Plants in South Korea: Effect of Feedstock and Operational Parameters Michal Sposob 1,2,†, Hee-Sung Moon 3,†, Dongjin Lee 3 and Yeo-Myeong Yun 1,* 1 Department of Environmental Engineering, Chungbuk National University, 1 Chungdae-ro, Seowon-Gu, Cheongju 28644, Korea; [email protected] 2 NIBIO, Norwegian Institute of Bioeconomy Research, P.O. Box 115, N-1431 Ås, Norway 3 Waste-Energy Research Division, Environmental Resources Research Department, National Institute of Environmental Research, Environmental Research Complex, Incheon 22689, Korea; [email protected] (H.-S.M.); [email protected] (D.L.) * Correspondence: [email protected]; Tel.: +82-43-261-2466; Fax: +82-43-264-2465 † Both authors contributed equally to this work. Abstract: In this study, the microbiomes linked with the operational parameters in seven mesophilic full-scale AD plants mainly treating food waste (four plants) and sewage sludge (three plants) were analyzed. The results obtained indicated lower diversity and evenness of the microbial population in sludge digestion (SD) plants compared to food digestion (FD) plants. Candidatus Accumulibacter dominated (up to 42.1%) in SD plants due to microbial immigration from fed secondary sludge (up to 89%). Its potential activity in SD plants was correlated to H2 production, which was related to the dominance of hydrogenotrophic methanogens (Methanococcus). In FD plants, a balance between the hydrogenotrophic and methylotrophic pathways was found, while Flavobacterium and Levilinea played an important role during acidogenesis. Levilinea also expressed sensitivity to ammonia in FD plants. The substantial differences in hydraulic retention time (HRT), organic loading rate (OLR), and total ammonium nitrogen (TAN) among the studied FD plants did not influence the archaeal methane Citation: Sposob, M.; Moon, H.-S.; production pathway.
    [Show full text]
  • Microbiology of Lonar Lake and Other Soda Lakes
    The ISME Journal (2013) 7, 468–476 & 2013 International Society for Microbial Ecology All rights reserved 1751-7362/13 www.nature.com/ismej MINI REVIEW Microbiology of Lonar Lake and other soda lakes Chakkiath Paul Antony1, Deepak Kumaresan2, Sindy Hunger3, Harold L Drake3, J Colin Murrell4 and Yogesh S Shouche1 1Microbial Culture Collection, National Centre for Cell Science, Pune, India; 2CSIRO Marine and Atmospheric Research, Hobart, TAS, Australia; 3Department of Ecological Microbiology, University of Bayreuth, Bayreuth, Germany and 4School of Environmental Sciences, University of East Anglia, Norwich, UK Soda lakes are saline and alkaline ecosystems that are believed to have existed throughout the geological record of Earth. They are widely distributed across the globe, but are highly abundant in terrestrial biomes such as deserts and steppes and in geologically interesting regions such as the East African Rift valley. The unusual geochemistry of these lakes supports the growth of an impressive array of microorganisms that are of ecological and economic importance. Haloalk- aliphilic Bacteria and Archaea belonging to all major trophic groups have been described from many soda lakes, including lakes with exceptionally high levels of heavy metals. Lonar Lake is a soda lake that is centered at an unusual meteorite impact structure in the Deccan basalts in India and its key physicochemical and microbiological characteristics are highlighted in this article. The occurrence of diverse functional groups of microbes, such as methanogens, methanotrophs, phototrophs, denitrifiers, sulfur oxidizers, sulfate reducers and syntrophs in soda lakes, suggests that these habitats harbor complex microbial food webs that (a) interconnect various biological cycles via redox coupling and (b) impact on the production and consumption of greenhouse gases.
    [Show full text]
  • Systematic Bacteriology Second Edition
    BERGEY'S MANUAL® OF Systematic Bacteriology Second Edition Volume One The Archaea and the Deeply Branching and Phototrophic Bacteria Springer New York Berlin Heidelberg Barcelona HongKong London Milan Paris Singapore Tokyo BERGEY'S MANUAL® OF Systematic Bacteriology Second Edition Volume One The Archaea and the Deeply Branching and Phototrophic Bacteria David R. Boone Richard W. Castenholz EDITORS, VOLUME ONE George M. Garrity EDITOR-IN-CHIEF EDITORIAL BOARD James T. Staley, Chairman, David R. Boone, Vice Chairman, Don J. Brenner, Richard W. Castenholz, George M. Garrity, Michael Goodfellow, Noel R. Krieg, Fred A. Rainey, Karl-Heinz Schleifer WITH CONTRIBUTIONS FROM 105 COLLEAGUES Springer George M. Garrity Department of Microbiology and Molecular Genetics Bergey's Manual Trust Michigan State University East Lansing, MI 48824-1101 USA Library of Congress Cataloging-in-Publication Data Bergey's manual of systematic bacteriology / David R. Boone, Richard W. Castenholz, editors, volume 1 ; George M. Garrity, editor-in-chief.-2nd ed. p.cm. Includes bibliographical references and index. Contents: v.I. The archaea and the deeply branching and phototrophic bacteria. ISBN 0-387-98771-1 (alk. paper) 1. Bacteria-Classification. I. Title: Systematic bacteriology. II. Boone, David R. III. Castenholz, Richard W. IV. Garrity, George M. QR81.B462001 579.3'01 '2-dc21 2001020400 With 330 illustrations The following proprietary names of products are used in this volume: Casamino@ acids; Vector NTI®; XLI0-Gold®; Gelrite®; Tryptone@l; Phytagel@; bio-Trypcasew; Trypticasev; Oxoid® purified agar. Printed on acid-free paper. First edition published 1984-1989 by Bergey's Manual Trust and Williams & Wilkins, Baltimore. © 2001 Bergey's Manual Trust All rights reserved.
    [Show full text]
  • Contents Topic 1. Introduction to Microbiology. the Subject and Tasks
    Contents Topic 1. Introduction to microbiology. The subject and tasks of microbiology. A short historical essay………………………………………………………………5 Topic 2. Systematics and nomenclature of microorganisms……………………. 10 Topic 3. General characteristics of prokaryotic cells. Gram’s method ………...45 Topic 4. Principles of health protection and safety rules in the microbiological laboratory. Design, equipment, and working regimen of a microbiological laboratory………………………………………………………………………….162 Topic 5. Physiology of bacteria, fungi, viruses, mycoplasmas, rickettsia……...185 TOPIC 1. INTRODUCTION TO MICROBIOLOGY. THE SUBJECT AND TASKS OF MICROBIOLOGY. A SHORT HISTORICAL ESSAY. Contents 1. Subject, tasks and achievements of modern microbiology. 2. The role of microorganisms in human life. 3. Differentiation of microbiology in the industry. 4. Communication of microbiology with other sciences. 5. Periods in the development of microbiology. 6. The contribution of domestic scientists in the development of microbiology. 7. The value of microbiology in the system of training veterinarians. 8. Methods of studying microorganisms. Microbiology is a science, which study most shallow living creatures - microorganisms. Before inventing of microscope humanity was in dark about their existence. But during the centuries people could make use of processes vital activity of microbes for its needs. They could prepare a koumiss, alcohol, wine, vinegar, bread, and other products. During many centuries the nature of fermentations remained incomprehensible. Microbiology learns morphology, physiology, genetics and microorganisms systematization, their ecology and the other life forms. Specific Classes of Microorganisms Algae Protozoa Fungi (yeasts and molds) Bacteria Rickettsiae Viruses Prions The Microorganisms are extraordinarily widely spread in nature. They literally ubiquitous forward us from birth to our death. Daily, hourly we eat up thousands and thousands of microbes together with air, water, food.
    [Show full text]