BIODIVERSITAS ISSN: 1412-033X Volume 20, Number 4, April 2019 E-ISSN: 2085-4722 Pages: 1055-1062 DOI: 10.13057/biodiv/d200417 Bacteria and methanogen community in the rumen fed different levels of grass-legume silages RONI RIDWAN1,, IMAN RUSMANA2, YANTYATI WIDYASTUTI1, KOMANG G. WIRYAWAN3, BAMBANG PRASETYA1, MITSUO SAKAMOTO4, MORIYA OHKUMA4 1Research Center for Biotechnology, Indonesian Institute of Sciences. Jl. Raya Jakarta Bogor Km. 46, Cibinong, Bogor 16911, West Java, Indonesia Tel:+62-21-8754587, Fax: +62-21-8754588, email: [email protected], [email protected] 2Department of Biology, Faculty of Mathematics and Natural Sciences, Institut Pertanian Bogor. Jl. Raya Dramaga, Bogor 16680, West Java, Indonesia 3Department of Animal Nutrition, Faculty of Animal Sciences, Institut Pertanian Bogor. Jl. Raya Dramaga, Bogor 16680, West Java, Indonesia 4Microbe Division/Japan Collection of Microorganisms RIKEN Bioresource Center, Tsukuba, Ibaraki, Japan Manuscript received: 7 January 2019. Revision accepted: 22 March 2019. Abstract. Ridwan R, Rusmana I, Widyastuti Y, Wiryawan KG, Prasetya B, Sakamoto M, Ohkuma M. 2019. Bacteria and methanogen community in the rumen fed different levels of grass-legume silages. Biodiversitas 20: 1055-1062. This study aimed to investigate the effects of dietary grass-legume silages on the microbial community by using a culture-independent approach. Treatments consisted of R0: 50% Pennisetum purpureum and 50 % concentrate; R1: 20% P. purpureum, 50 % concentrate, and 30% grass-legumes silage; R2: 20% P. purpureum, 35 % concentrate, and 45% grass-legumes silage; and R3; 20% P. purpureum, 20 % concentrate, and 60% grass- legumes silage. The rumen fluid obtained from fistulated cattle was used for T-RFLP, 16S rDNA clone library, and qPCR analyses. The results indicated that bacterial diversity was dominated by Bacteroidetes, Firmicutes, and methanogen by Methanobacteriales, based on partial 16S rDNA sequences. The microbial communities were dominated by Prevotella brevis, P. ruminicola, Succiniclasticum ruminis, and Methanobrevibacter ruminantium, M. smithi, M. thueri, and M. millerae. The increasing silage diet in a rumen suppressed methanogenesis by reducing population distribution of Methanobacteriales, directly or indirectly, by reducing the diversity of bacterial populations. Generally, the increase silage in the diet changed the bacterial and methanogen community. Grass-legume silage diets of less than 45% are potential for ruminant diet to reduce methane production by a decrease of 4% in the relative distribution of methanogens in the rumen. Keywords: 16S rDNA sequence, culture-independent, grass-legumes silage, microbial community INTRODUCTION of feed for sustainable ruminant production (Ridwan et al. 2015). The rumen a complex microbiome of bacteria and Up until recently, information regarding the methanogen plays an important role in feed metabolisms. microbiome community in the rumen of Ongole cattle has Naturally, methane (CH4) is produced during feed been limited. Examination of the microbial community in fermentation by methanogens in the rumen, which the rumen, based on cultural methods, has produced limited constitutes an energy loss and reduces the productivity of results that include less than 1-2 % from total microbes and the ruminant. Ruminant is one contributor of enteric CH4 is highly misleading. Molecular analyses, based on culture- emissions into the environment from the livestock sector independent methods using the 16S rDNA sequence, (Patra et al. 2012; Ji and Park 2012), and potent greenhouse should be used for additional information of microbial gas that contributes to global warming and climate change diversity from unculturable rumen microbes. Many useful (IPCC 2014; Bodas et al. 2012). methods may be used for metagenomic assays based on One of the most limiting factors in feeding cattle with 16S rDNA, such as terminal-restriction fragment length forage is nutrient quality and sustainability. Calliandra polymorphism (T-RFLP) (Khafipour et al. 2009; Cadillo et calothyrsus contains high crude protein (21-30%) and a al. 2008), 16S rDNA clone library (Danielsson et al. 2012; total tannin 8-14%. Since crude protein supplies total N for Fernando et al. 2010), and qPCR (Tajima et al. 2001; microbes to synthesize protein, polyphenolics are a useful Bustin et al. 2009). Moreover, additional data on microbial nutritional strategy to reduces CH4 emissions (Lopez et al. diversity and clustering will be advantageous. The 2010). The increased level of silage diets in a rumen in objective of this study was to investigate the bacteria and vitro fermentation system suppressed both methane methanogen communities in the rumen of Ongole cattle, production and protozoa population (Ridwan et al. 2014). fed different levels of silage containing C. calothyrsus. The combination of grasses and legumes (1:1) is an alternative solution for improving the crude protein content 1056 BIODIVERSITAS 20 (4): 1055-1062, April 2019 MATERIALS AND METHODS The DNA samples were used for molecular analyses consisted of T-RFLP, 16S rDNA clone library, and qPCR. Animals and feedstuffs The 16S rDNA amplification was performed as Feeding trials were carried out using three fistulated described previously by Ridwan et al. (2014, 2015). DNA Ongole cattle (according to consideration of animal was amplified by using primers 6FAM-27F welfare), as approved by the Animal Care and Use (5’AGAGTTTGATCCTGGCTCAG3’) and 1492R Committee of Bogor Agricultural University. Silage was (5’GGTTACCTTGTTACGACTT3’) for bacteria and produced according to the result of previous research 6FAM-Met86F (5’GCTCAGTAACACGTGG3’) and (Ridwan et al. 2014, 2015). Grass-legume silages were Met1340R 5’CGGTGTGTGCAAGGAG3’) for made by using a wilted Pennisetum purpureum hybrid (a methanogens. Amplification of each PCR reaction was in a type of grass) and C. calothyrsus (Fabaceae; red flower) total volume of 50 μL, and consisted of 5 μL of dissolved legumes, with the proportion of 50%:50% (w/w). The DNA (<1 μg), 0.5 μL of 1.25U Takara Ex Taq (Takara grasses were provided by the plant collection of the Shuzo), 5 μL of 10x Ex Taq buffer, 4 μL of dNTP mixture Research Center for Biotechnology, Indonesian Institute of (2.5 mmolL-1), 10 pmol of each primer and up to 50 μL of Sciences, Cibinong, Bogor, West Java, indonesia. Legumes pure distilled water. The 16S rDNA was amplified by using were collected from PT. Perkebunan Nusantara VIII a Biometra Thermocycler TGradient with the following Gunung Mas Cisarua, Bogor, West Java, Indonesia. Forage program for bacteria: 95°C for 3 min, followed by 30 cycles was chopped to lengths of approximately 3-5 cm. Readily consisting of 95°C for 30 s, 50°C for 30 s and 72°C for 1.5 available carbohydrate (10%) and silage inoculants of the min, with a final extension at 72°C for 10 min. The Biotechnology Culture Collection of Microorganism, program for methanogens was 94°C for 5 min, followed by Research Center for Biotechnology, Indonesian Institute of 30 cycles of 94°C for 30 s, 57°C for 30 s, and 68°C for 1 Sciences (Lactobacillus plantarum BTCC570) (2.5x106 min; with a final extension at 68°C for 7 min. Amplified CFU/g silage material) were added as silage additives. The DNAs were verified by electrophoresis of 5 μL aliquots of silages were prepared in plastic drum silos (capacity PCR product on a 1.5% agarose gel in 1x TAE buffer. The 80kg/drum). The silages were incubated at room PCR products were purified with an Ultra Clean PCR temperature (30°C) for 30 days. After incubation, the CleanUp Kit (Mo Bio Laboratories, Inc.,). The purified 16S silages were opened for quality analysis before being used rDNA amplicons were stored at -20°C for further analysis for the feeding trial. For the quality evaluation of silages, of T-RFLP and 16S rDNA clone library. proximate analysis, fiber fraction, and tannin contents were conducted as described previously (Ridwan et al. 2015). Molecular analyses The experiment was arranged in a cross over design T-RFLP analysis was performed as described with four treatment diets and three sampling periods as previously by Ridwan et al. (2014, 2015) based on the replications. The experimental diets consisted of the method of Sakamoto et al. (2006) and Danielsson et al. following: R0: 50% Pennisetum purpureum and 50% (2012), with some modification. The conditions of 16S concentrate; R1: 20% P. purpureum, 50 % concentrate, and rDNA amplification were described above. The purified 30% grass-legumes silage; R2: 20% P. purpureum, 35 % PCR product (2 µl) was digested with four restriction concentrate, and 45% grass-legumes silage; and R3; 20% enzymes that consisted of 20U of AluI, HhaI, MspI and P. purpureum, 20 % concentrate, and 60% grass-legumes RsaI (TaKaRa Shuzo Japan) in total volume 10 µL at 37oC silage. Each treatment was administered for 17 days, and for 1 h. The restriction digest product (2 µL) was mixed rumen samples were collected on days 7, 12, and 17 as with 8µl of Hi-Di Formamide (Applied Biosystems, Foster replication sampling periods. All cattle were given amounts City, CA) and 1µL standard Gene ScanTM 1200 LIZ of feed equal to 2% dry matter of their body weight (245 (Applied Biosystems, Foster City, CA). Each sample was kg). The Nutrient and chemical composition of diets are denatured at 95oC for 2 min and then immediately placed shown in Table 1. on ice. The length of terminal restriction fragment (T-RF) was determined on an ABI PRISM 3100 Genetic Analyzer Sample collection, DNA extraction, and 16S rDNA (Applied Biosystems). T-RF sizes were estimated by using amplification local method peak scan version 2.0 (Applied Biosystems). The rumen fluid was obtained from each of the three T-RFs with area peaks of less than 2% total area were fistulated cattle 3 hours after morning feeding. Samples of excluded from the analysis. DNA fragments were resolved rumen fluid were mixed, homogenized, filtered by using to one base pair by manual alignment of the standard peaks sterilized double cheesecloth, and transferred to a sterilized from different electropherograms.