DOCSLIB.ORG

Epithelial Cells and Modifies T Cell Selection Selectively Expressed in Medullary Thymic the Ubiquitin-Like Modifier FAT10 Is

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Epithelial Cells and Modifies T Cell Selection Selectively Expressed in Medullary Thymic the Ubiquitin-Like Modifier FAT10 Is The Ubiquitin-like Modifier FAT10 Is Selectively Expressed in Medullary Thymic Epithelial Cells and Modifies T Cell Selection This information is current as Stefanie Buerger, Valerie L. Herrmann, Sarah Mundt, Nico of September 23, 2021. Trautwein, Marcus Groettrup and Michael Basler J Immunol published online 23 September 2015 http://www.jimmunol.org/content/early/2015/09/23/jimmun ol.1500592 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2015/09/23/jimmunol.150059 Material 2.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 23, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published September 23, 2015, doi:10.4049/jimmunol.1500592 The Journal of Immunology The Ubiquitin-like Modifier FAT10 Is Selectively Expressed in Medullary Thymic Epithelial Cells and Modifies T Cell Selection Stefanie Buerger,* Valerie L. Herrmann,* Sarah Mundt,* Nico Trautwein,† Marcus Groettrup,*,‡ and Michael Basler*,‡ HLA-F adjacent transcript 10 (FAT10) is a cytokine-inducible ubiquitin-like modifier that is highly expressed in the thymus and directly targets FAT10-conjugated proteins for degradation by the proteasome. High expression of FAT10 in the mouse thymus could be assigned to strongly autoimmune regulator–expressing, mature medullary thymic epithelial cells, which play a pivotal role in negative selection of T cells. Also in the human thymus, FAT10 is localized in the medulla but not the cortex. TCR Vb- segment screening revealed a changed T cell repertoire in FAT10-deficient mice. Analysis of five MHC class I– and II–restricted Downloaded from TCR-transgenic mice demonstrated an altered thymic negative selection in FAT10-deficient mice. Furthermore, the repertoire of peptides eluted from MHC class I molecules was influenced by FAT10 expression. Hence, we identified FAT10 as a novel modifier of thymic Ag presentation and epitope-dependent elimination of self-reactive T cells, which may explain why the fat10 gene could recently be linked to enhanced susceptibility to virus-triggered autoimmune diabetes. The Journal of Immunology, 2015, 195: 000–000. http://www.jimmunol.org/ he maturation of T cells in the thymus is a highly or- Ubiquitin-like modifiers (ULM) posttranslationally modify chestrated process. Somatic TCR gene rearrangements of cellular targets in diverse biological pathways in analogy to the T several distinct gene segments called variable, joining, ubiquitin system. The covalent modification with the cytokine- and diversity leads to unique TCRs expressed on individual inducible ULM HLA-F adjacent transcript 10 (FAT10) tar- T lymphocytes. These developing T cells interact via their TCR gets proteins in a ubiquitin-independent manner for proteasomal with self-peptide–MHC complexes that are displayed by thymic degradation (3–5). FAT10 is conjugated to its substrates via APCs. In a process called positive selection, immature double- isopeptide-linkage mediated by an E1, E2, and possibly E3 positive (DP) thymocytes (CD4+CD8+) that express TCRs with enzyme cascade, in which UBA6 and UBA6-specific E2 en- intermediate avidity for self-peptide–MHC complexes are selected zyme (6, 7) serve as E1-type activating and E2-type conjugating by guest on September 23, 2021 to differentiate into mature single-positive (SP) thymocytes (CD4+ enzymes, respectively (6, 8, 9). The insight into the biological 2 2 CD8 or CD4 CD8+). Selected thymocytes that express TCRs function of FAT10 is still in its infancy. So far, FAT10 has been with high affinity for self-Ags and self-MHC are intrathymically implicated in multiple cellular processes like apoptosis (4, 10), eliminated during negative selection to produce a self-tolerant T cell spindle checkpoint control during mitotic cell cycle (11), and repertoire (1). Mature medullary thymic epithelial cells (mTECs) NF-kB activation (12). Basal FAT10 expression is most prom- contribute to self-tolerance through the promiscuous expression of inent in organs of the immune system, like thymus, fetal liver, tissue-specific Ags in the thymus, which is mainly controlled by the lymph nodes, and spleen (13, 14). In addition, expression of transcription factor autoimmune regulator (Aire) (2). FAT10 can be synergistically induced by the proinflammatory cytokines IFN-g and TNF-a (15), and it is upregulated during *Division of Immunology, Department of Biology, University of Konstanz, D-78457 dendritic cell (DC) maturation (14). The fusion of FAT10 to the Konstanz, Germany; †Department of Immunology, Interfaculty Institute for Cell N termini of two different viral Ags strongly accelerated their Biology, University of Tubingen,€ D-72076 Tubingen,€ Germany; and ‡Biotechnology Institute Thurgau at the University of Konstanz, CH-8280 Kreuzlingen, Switzerland degradation by the proteasome and enhanced the presentation of their T cell epitopes on MHC class I (MHC-I) molecules Received for publication March 10, 2015. Accepted for publication August 25, 2015. (16–18). These results suggest that linkage to FAT10 can feed This work was supported by German Research Foundation Grant GR 1517/10-2 and the Collaborative Research Center SFB969 (Project C01) (to M.G.). Ags into the MHC-I Ag processing pathway. Moreover, FAT10 Address correspondence and reprint requests to Dr. Michael Basler and Prof. Marcus binds to the autophagy adaptor p62 (19) and colocalizes in Groettrup, Division of Immunology, Department of Biology, University of Konstanz, cells with p62 and the autophagosome marker LC3B (20), Universitaetsstrasse 10, D-78457 Konstanz, Germany. E-mail addresses: michael. which opens the possibility that FAT10-conjugated proteins [email protected] (M.B.) and [email protected] (M.G.) may be processed for MHC class II (MHC-II)–mediated presen- The online version of this article contains supplemental material. tation by targeting them to autophagosomes. Analysis of FAT10- Abbreviations used in this article: Adig, autoimmune regulator–driven Igrp-Gfp; deficient mice demonstrated an enhanced sensitivity toward Aire, autoimmune regulator; cDC, conventional DC; cTEC, cortical thymic 2/2 epithelial cell; DC, dendritic cell; DN, double-negative; DP, double-positive; EpCAM, endotoxin challenge (13). Additionally, FAT10 mice have epithelial cellular adhesion molecule; FAT10, HLA-F adjacent transcript 10; GP, an extended lifespan and reduced adiposity compared with glycoprotein; HEK, human embryonic kidney; HPRT, hypoxanthine-guanine phosphoribosyltransferase; LCMV, lymphocytic choriomeningitis virus; MHC-I, wild-type mice (21). MHC class I; MHC-II, MHC class II; mTEC, medullary thymic epithelial cell; In this study, we could assign the previously recognized high pDC, plasmacytoid DC; SP, single-positive; TEC, thymic epithelial cell; tg, trans- FAT10 expression in the thymus (14) to terminally differenti- genic; ULM, ubiquitin-like modifier. ated mTECs. Thereby, FAT10 influenced the selection of thy- Copyright Ó 2015 by The American Association of Immunologists, Inc. 0022-1767/15/$25.00 mocytes probably due to negative selection and altered peptide www.jimmunol.org/cgi/doi/10.4049/jimmunol.1500592 2 FAT10 CODETERMINES THYMIC T CELL SELECTION presentation. Hence, we describe a previously unknown function temperature followed by incubation with primary Abs in 5% (w/v) BSA/ of FAT10 in modifying thymic T cell selection. PBS overnight at 4˚C. After washing three times with PBS/0.1% (v/v) Tween 20, the secondary Abs were diluted in 5% (w/v) BSA/PBS and incubated for 1 h at room temperature. Sections were mounted using Materials and Methods Kaiser’s glycerol gelatin (Merck) or Mowiol. All images were obtained Mice, viruses, and media using a point laser-scanning microscope Zeiss LSM 510 Meta (Carl Zeiss) at the Bioimaging Center of the University of Konstanz. Image analysis C57BL/6 mice (H-2b) were originally purchased from Charles River 2/2 was performed using ImageJ software (National Institutes of Health, Laboratories (Sulzfeld, Germany). FAT10 mice (13) were kindly pro- Bethesda, MD). The following reagents were used: monoclonal mouse vided by A. Canaan and S. M. Weissman (Yale University School of anti-human FAT10 (4F1) was purified from hybridoma supernatant Medicine, New Haven, CT). P14 mice (transgenic [tg] line 318) (22) were (19). Rat anti-human Aire (TM-724) was purchased from eBioscience obtained from Dr. Oliver Planz (Tubingen€ University, Tubingen,€ Ger- (Frankfurt, Germany). Polyclonal rabbit anti-Cytokeratin 5 was purchased many). OT-I (23), OT-II (24), and Smarta mice (25), were provided by the from Covance (purchased via Hiss Diagnostic, Freiburg, Germany). Mu- Swiss Immunological Mutant Mouse Repository. HY TCR-tg mice (26) rine thymic cortex was stained with mouse anti-cytokeratin 18 (RGE53;
Load more

Recommended publications
  • Comparative Gene Expression Profiling of Stromal Cell Matrices
    ell Res C ea m rc te h S & f o T h l Journal of Tiwari et al., J Stem Cell Res Ther 2013, 3:4 e a r n a r p u DOI: 10.4172/2157-7633.1000152 y o J ISSN: 2157-7633 Stem Cell Research & Therapy Research Article Open Access Comparative Gene Expression Profiling of Stromal Cell Matrices that Support Expansion of Hematopoietic Stem/Progenitor Cells Abhilasha Tiwari1,2, Christophe Lefevre2, Mark A Kirkland2*, Kevin Nicholas2 and Gopal Pande1* 1CSIR-Centre for Cellular and Molecular Biology (CCMB), Hyderabad, India 2Deakin University, Waurn Ponds, Geelong, VIC, Australia Abstract The bone marrow microenvironment maintains a stable balance between self-renewal and differentiation of hematopoietic stem/progenitor cells (HSPCs). This microenvironment, also termed the “hematopoietic niche”, is primarily composed of stromal cells and their extracellular matrices (ECM) that jointly regulate HSPC functions. Previously, we have demonstrated that umbilical cord blood derived HSPCs can be maintained and expanded on stromal cell derived acellular matrices that mimic the complexity of the hematopoietic niche. The results indicated that matrices prepared at 20% O2 with osteogenic medium (OGM) were best suited for expanding committed HSPCs, whereas, matrices prepared at 5% O2 without OGM were better for primitive progenitors. Based upon these results we proposed that individual constituents of these matrices could be responsible for regulation of specific HSPC functions. To explore this hypothesis, we have performed comparative transcriptome profiling of these matrix producing cells, which identified differential expression of both known niche regulators, such as Wnt4, Angpt2, Vcam and Cxcl12, as well as genes not previously associated with HSPC regulation, such as Depp.
    [Show full text]
  • Sorbonne Université́
    Sorbonne Université́ École Doctorale ED515 – Complexité́ du vivant INSERM UMRS 933 : Physiopathologie des maladies génétiques d'expression pédiatrique Mécanismes physiopathologiques impliqués dans la différenciation du tractus génital masculin Matthieu Peycelon Thèse de Doctorat de Génétique Humaine Dirigée par Pr. Jean-Pierre Siffroi Présentée et soutenue publiquement le 19 décembre 2019 Devant un jury composé de : Brigitte BENZACKEN PU-PH Université Paris 13 Rapporteur Anne-Françoise SPINOIT Professeur Université de Gand Rapporteur Irène NETCHINE PU-PH Université Paris 6 Examinateur Nicolas KALFA PU-PH Université de Montpellier Examinateur Alaa EL GHONEIMI PU-PH Université Paris 7 Président Jean-Pierre SIFFROI PU-PH Université Paris 6 Directeur de thèse Sorbonne Université́ École Doctorale ED515 – Complexité́ du vivant INSERM UMRS 933 : Physiopathologie des maladies génétiques d'expression pédiatrique Mécanismes physiopathologiques impliqués dans la différenciation du tractus génital masculin Matthieu Peycelon Thèse de Doctorat de Génétique Humaine Dirigée par Pr. Jean-Pierre Siffroi Présentée et soutenue publiquement le 19 décembre 2019 Devant un jury composé de : Brigitte BENZACKEN PU-PH Université Paris 13 Rapporteur Anne-Françoise SPINOIT Professeur Université de Gand Rapporteur Irène NETCHINE PU-PH Université Paris 6 Examinateur Nicolas KALFA PU-PH Université de Montpellier Examinateur Alaa EL GHONEIMI PU-PH Université Paris 7 Président Jean-Pierre SIFFROI PU-PH Université Paris 6 Directeur de thèse Ce travail de thèse a été réalisé́ sous la direction du Professeur Jean-Pierre Siffroi, au sein de l’unité́ mixte de recherche INSERM / Sorbonne Université UMR_S933 dirigée par le Professeur Serge Amselem. Adresse : Département de Génétique Médicale, Hôpital Armand Trousseau ; 26 avenue du Docteur Arnold Netter, 75012, Paris.
    [Show full text]
  • Tissue-Specific Transcriptome for Poeciliopsis Prolifica Reveals
    INVESTIGATION Tissue-Specific Transcriptome for Poeciliopsis prolifica Reveals Evidence for Genetic Adaptation Related to the Evolution of a Placental Fish Nathaniel K. Jue,*,1 Robert J. Foley,* David N. Reznick,† Rachel J. O’Neill,* and Michael J. O’Neill*,2 *Institute for Systems Genomics and Department of Molecular and Cell Biology, University of Connecticut, Storrs, CT 06269 and †Department of Biology, University of California, Riverside, CA 92521 ABSTRACT The evolution of the placenta is an excellent model to examine the evolutionary processes KEYWORDS underlying adaptive complexity due to the recent, independent derivation of placentation in divergent transcriptome animal lineages. In fishes, the family Poeciliidae offers the opportunity to study placental evolution with positive selection respect to variation in degree of post-fertilization maternal provisioning among closely related sister gene expression species. In this study, we present a detailed examination of a new reference transcriptome sequence for the placenta live-bearing, matrotrophic fish, Poeciliopsis prolifica, from multiple-tissue RNA-seq data. We describe the fish genetic components active in liver, brain, late-stage embryo, and the maternal placental/ovarian complex, as well as associated patterns of positive selection in a suite of orthologous genes found in fishes. Results indicate the expression of many signaling transcripts, “non-coding” sequences and repetitive elements in the maternal placental/ovarian complex. Moreover, patterns of positive selection in protein sequence evolution were found associated with live-bearing fishes, generally, and the placental P. prolifica, specifi- cally, that appear independent of the general live-bearer lifestyle. Much of the observed patterns of gene expression and positive selection are congruent with the evolution of placentation in fish functionally converging with mammalian placental evolution and with the patterns of rapid evolution facilitated by the teleost-specific whole genome duplication event.
    [Show full text]
  • TET2 Binds the Androgen Receptor and Loss Is Associated with Prostate Cancer
    Oncogene (2016), 1–12 © 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved 0950-9232/16 www.nature.com/onc ORIGINAL ARTICLE TET2 binds the androgen receptor and loss is associated with prostate cancer ML Nickerson1,14, S Das2,KMIm3, S Turan1, SI Berndt4,HLi1,5,HLou1,5, SA Brodie4,6, JN Billaud7, T Zhang8, AJ Bouk4,6, D Butcher9, Z Wang4, L Sun10, K Misner1,WTan1,5, A Esnakula11, D Esposito12, WY Huang4, RN Hoover4, MA Tucker4, JR Keller10, J Boland4,6, K Brown8, SK Anderson1, LE Moore4, WB Isaacs13, SJ Chanock4, M Yeager4,6, M Dean1,14 and T Andresson2 Genetic alterations associated with prostate cancer (PCa) may be identified by sequencing metastatic tumour genomes to identify molecular markers at this lethal stage of disease. Previously, we characterized somatic alterations in metastatic tumours in the methylcytosine dioxygenase ten-eleven translocation 2 (TET2), which is altered in 5–15% of myeloid, kidney, colon and PCas. Genome-wide association studies previously identified non-coding risk variants associated with PCa and melanoma. We perform fine-mapping of PCa risk across TET2 using genotypes from the PEGASUS case-control cohort and identify six new risk variants in introns 1 and 2. Oligonucleotides containing two risk variants are bound by the transcription factor octamer-binding protein 1 (Oct1/POU2F1) and TET2 and Oct1 expression are positively correlated in prostate tumours. TET2 is expressed in normal prostate tissue and reduced in a subset of tumours from the Cancer Genome Atlas (TCGA). Small interfering RNA-mediated TET2 knockdown (KD) increases LNCaP cell proliferation, migration and wound healing, verifying loss drives a cancer phenotype.
    [Show full text]
  • C10ORF10/DEPP, a Transcriptional Target of FOXO3, Regulates ROS
    Salcher et al. Molecular Cancer 2014, 13:224 http://www.molecular-cancer.com/content/13/1/224 RESEARCH Open Access C10ORF10/DEPP, a transcriptional target of FOXO3, regulates ROS-sensitivity in human neuroblastoma Stefan Salcher2,4, Judith Hagenbuchner2,4, Kathrin Geiger4, Maximilian A Seiter1,4, Johannes Rainer3,4, Reinhard Kofler3,4, Martin Hermann5, Ursula Kiechl-Kohlendorfer2, Michael J Ausserlechner1,4* and Petra Obexer2,4* Abstract Background: FOXO transcription factors control cellular levels of reactive oxygen species (ROS) which critically contribute to cell survival and cell death in neuroblastoma. In the present study we investigated the regulation of C10orf10/DEPP by the transcription factor FOXO3. As a physiological function of C10orf10/DEPP has not been described so far we analyzed its effects on cellular ROS detoxification and death sensitization in human neuroblastoma cells. Methods: The effect of DEPP on cellular ROS was measured by catalase activity assay and live cell fluorescence microscopy using the ROS-sensitive dye reduced MitoTracker Red CM-H2XROS. The cellular localization of DEPP was determined by confocal microscopy of EYFP-tagged DEPP, fluorescent peroxisomal- and mitochondrial probes and co-immunoprecipitation of the PEX7 receptor. Results: We report for the first time that DEPP regulates ROS detoxification and localizes to peroxisomes and mitochondria in neuroblastoma cells. FOXO3-mediated apoptosis involves a biphasic ROS accumulation. Knockdown of DEPP prevented the primary and secondary ROS wave during FOXO3 activation and attenuated FOXO3- and H2O2-induced apoptosis. Conditional overexpression of DEPP elevates cellular ROS levels and sensitizes to H2O2 and etoposide-induced cell death. In neuronal cells, cellular ROS are mainly detoxified in peroxisomes by the enzyme CAT/catalase.
    [Show full text]
  • The Expression of Decidual Protein Induced by Progesterone
    G C A T T A C G G C A T genes Article The Expression of Decidual Protein Induced by Progesterone (DEPP) Is Controlled by Three Distal Consensus Hypoxia Responsive Element (HRE) in Hypoxic Retinal Epithelial Cells Katrin Klee 1,2, Federica Storti 1, Jordi Maggi 2,3 , Vyara Todorova 1,4, Duygu Karademir 1,2, Wolfgang Berger 2,3,4, Marijana Samardzija 1 and Christian Grimm 1,2,4,* 1 Department of Ophthalmology, Lab for Retinal Cell Biology, University of Zurich, 8952 Schlieren, Switzerland; [email protected] (K.K.); [email protected] (F.S.); [email protected] (V.T.); [email protected] (D.K.); [email protected] (M.S.) 2 Center for Integrative Human Physiology (ZIHP), University of Zurich, 8006 Zurich, Switzerland; [email protected] (J.M.); [email protected] (W.B.) 3 Institute of Medical Molecular Genetic, University of Zurich, 8952 Schlieren, Switzerland 4 Neuroscience Center, University of Zurich, 8006 Zurich, Switzerland * Correspondence: [email protected]; Tel.: +41-43-253-3001 Received: 19 November 2019; Accepted: 14 January 2020; Published: 18 January 2020 Abstract: Hypoxia affects the development and/or progression of several retinopathies. Decidual protein induced by progesterone (DEPP) has been identified as a hypoxia-responsive gene that may be part of cellular pathways such as autophagy and connected to retinal diseases. To increase our understanding of DEPP regulation in the eye, we defined its expression pattern in mouse and human retina and retinal pigment epithelium (RPE). Interestingly, DEPP expression was increased in an age-dependent way in the central human RPE.
    [Show full text]
  • Gene Expression Analysis of Endometrium Reveals Progesterone Resistance and Candidate Susceptibility Genes in Women with Endometriosis
    0013-7227/07/$15.00/0 Endocrinology 148(8):3814–3826 Printed in U.S.A. Copyright © 2007 by The Endocrine Society doi: 10.1210/en.2006-1692 Gene Expression Analysis of Endometrium Reveals Progesterone Resistance and Candidate Susceptibility Genes in Women with Endometriosis Richard O. Burney,* Said Talbi,* Amy E. Hamilton, Kim Chi Vo, Mette Nyegaard, Camran R. Nezhat, Bruce A. Lessey, and Linda C. Giudice Downloaded from https://academic.oup.com/endo/article-abstract/148/8/3814/2502189 by guest on 14 June 2020 Department of Obstetrics and Gynecology (R.O.B., M.N., C.R.N.), Stanford University, Stanford, California 94305; Department of Obstetrics, Gynecology, and Reproductive Sciences (S.T., A.E.H., K.C.V., L.C.G.), University of California, San Francisco, San Francisco, California 94143-0138; and Department of Obstetrics and Gynecology (B.A.L.), University Medical Group, Greenville Hospital System, Greenville, South Carolina 29605 The identification of molecular differences in the endome- enhanced cellular survival and persistent expression of genes trium of women with endometriosis is an important step to- involved in DNA synthesis and cellular mitosis in the setting ward understanding the pathogenesis of this condition and of endometriosis. Comparative gene expression analysis of toward developing novel strategies for the treatment of asso- progesterone-regulated genes in secretory phase endome- ciated infertility and pain. In this study, we conducted global trium confirmed the observation of attenuated progesterone gene expression analysis of endometrium from women with response. Additionally, interesting candidate susceptibility and without moderate/severe stage endometriosis and com- genes were identified that may be associated with this disor- pared the gene expression signatures across various phases of der, including FOXO1A, MIG6, and CYP26A1.
    [Show full text]
  • Transcriptomics of Early Human Development
    TRANSCRIPTOMICS OF EARLY HUMAN DEVELOPMENT NAHENIWELA HERATH MUDIYANSELAGE WISHVA BANDARA HERATH NATIONAL UNIVERSITY OF SINGAPORE 2011 TRANSCRIPTOMICS OF EARLY HUMAN DEVELOPMENT NAHENIWELA HERATH MUDIYANSELAGE WISHVA BANDARA HERATH BSc. (Hons.), Grad. Chem. A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY NUS GRADUATE SCHOOL FOR INTEGRATIVE SCIENCES AND ENGINEERING NATIONAL UNIVERSITY OF SINGAPORE 2011 Acknowledgement My phD journey was an extremely eventful one. I was trained as a microbiologist and a chemist, then became a biochemist working on proteomics and ended up doing my thesis project as a developmental / molecular biologist on transcriptomics. Without the help of several special people this thesis would not have been possible. I would like to thank... Dr. Paul Robson, my supervisor, for giving me the opportunity to work under him, for his advice, insights and guidance throughout the project and for creating a stress-free environment in the lab which is a pleasure to work in. Prof. Justine Burley, for her kindness and support when I needed it the most. My wife Dulani, for being by my side, through thick and thin. Thank you! The trophoblast differentiation protocol which I use extensively in my thesis was first described by Dr. Luo Wenlong. Dr. Mikael Huss helped me with bioinformatic analysis and helped me learn python programming, Mr. Audi Harsono helped me in validating RNA-Seq data, Ms. Woon Chow Thai ran the microarrays, Ms. Jameelah Sheik Mohamed taught me stem cell culture and Dr. Guo Guoji helped me extract mouse embryo samples. I would also like to acknowledge NUS Graduate School for Integrative Sciences and Engineering (NGS) for my scholarship and the Genome Institute of Singapore (GIS) where I carried out my research.
    [Show full text]
  • Decreased Expression of C10orf10 and Its Prognostic Significance in Human Breast Cancer
    Decreased Expression of C10orf10 and Its Prognostic Significance in Human Breast Cancer Junjiang Deng1,2., Yan Dong1., Chong Li1, Wenwei Zuo1, Gang Meng3, Chengping Xu3, Jianjun Li1* 1 Department of Oncology, Southwest Hospital, Third Military Medical University, Chongqing, China, 2 Cadre’s Sanatorium, Third Military Medical University, Chongqing, China, 3 Department of Pathology, Southwest Hospital, Third Military Medical University, Chongqing, China Abstract Breast cancer is a common malignant tumor, which severely threatens the health of women with an increasing incidence in many countries. Here, we identified C10orf10 as a novel differentially expression gene using expression microarray screening. The expression analysis indicated that C10orf10 was frequently decreased in human breast cancers compared to noncancerous breast tissues (81/95, P = 0.0063). Kaplan-Meier analysis indicated that patients with low C10orf10 expression showed a poorer prognosis both in mRNA (n = 1115, P = 0.0013) and protein (n = 100, P = 0.003) levels. Univariate and multivariate analysis showed that the C10orf10 expression was an independent prognostic factor for overall survival of breast cancer patients. Further analysis revealed that low expression of C10orf10 was an unfavorable factor for the prognosis of the patients who were luminal A, luminal B, Her2+ subtypes, at histological grade 2, lymph node negative and ER positive. Our data provided the first evidence that C10orf10 expression was frequently decreased in breast cancer tissues, and low expression of C10orf10 may be an important prognostic factor for poorer survival time of breast cancer patients. Citation: Deng J, Dong Y, Li C, Zuo W, Meng G, et al. (2014) Decreased Expression of C10orf10 and Its Prognostic Significance in Human Breast Cancer.
    [Show full text]
  • White Adipose Tissue Beiging in Mice with Increased Growth Hormone Action
    White Adipose Tissue Beiging in Mice With Increased Growth Hormone Action A thesis presented to the faculty of the College of Health Sciences and Professions of Ohio University In partial fulfillment of the requirements for the degree Master of Science Katie M. Troike August 2017 © 2017 Katie M. Troike. All Rights Reserved. 2 This thesis titled White Adipose Tissue Beiging in Mice With Increased Growth Hormone Action by KATIE M. TROIKE has been approved for the School of Applied Health Sciences and Wellness and the College of Health Sciences and Professions by Darlene E. Berryman Adjunct Research Professor of Food and Nutrition Sciences Randy Leite Dean, College of Health Sciences and Professions 3 Abstract TROIKE, KATIE M., M.S., August 2017, Food and Nutrition Sciences White Adipose Tissue Beiging in Mice With Increased Growth Hormone Action Director of Thesis: Darlene E. Berryman White adipose tissue (WAT) is a complex and dynamic endocrine organ that is most commonly recognized for its energy storage capacity. Brown adipose tissue (BAT) functions to dissipate stored energy in the form of heat through a process known as nonshivering thermogenesis. This process is aided by the mitochondrial matrix protein, uncoupling protein 1 (UCP1), which creates a proton leak across the inner mitochondrial membrane causing chemical energy to be released as heat. More recently, clusters of brown-like or “beige” adipocytes have also been identified in WAT. These adipocytes have the capacity to interconvert between the two phenotypes, in part, through increasing their expression of UCP1. This “beiging” is dependent on environmental and chemical conditions present within the cell.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name Protein DEPP Gene Symbol DEPP Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Not Available Ensembl Gene ID ENSRNOG00000023465 Entrez Gene ID 0 Assay Information Unique Assay ID qRnoCED0007513 Assay Type SYBR® Green Detected Coding Transcript(s) ENSRNOT00000018133 Amplicon Context Sequence CTGGCTGGCCCATGACCTTGAAGTGACTTAGTTTCTCTTCCTTAGTTTTATCACG GTTAAAGTGAGTGTAGGCGGAATGACTACCTCTCAGATTGCTCTAATAAGGAGAT GCGGGCTGTACTCTGAGTGGCA Amplicon Length (bp) 102 Chromosome Location 4:214722990-214723121 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9994 cDNA Cq 21.68 cDNA Tm (Celsius) 79 gDNA Cq 25.32 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report DEPP, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • Single Nucleotide Polymorphisms in Candidate Genes Associated with Fertilizing Ability of Sperm and Subsequent Embryonic Development in Cattle1
    BIOLOGY OF REPRODUCTION (2013) 89(3):69, 1–7 Published online before print 31 July 2013. DOI 10.1095/biolreprod.113.111260 Single Nucleotide Polymorphisms in Candidate Genes Associated with Fertilizing Ability of Sperm and Subsequent Embryonic Development in Cattle1 Sarah D. Cochran,3 John B. Cole,4 Daniel J. Null,4 and Peter J. Hansen2,3,4 3Department of Animal Sciences, D.H. Barron Reproductive and Perinatal Biology Research Program, and Genetics Institute, University of Florida, Gainesville, Florida 4Animal Improvement Programs Laboratory, Agricultural Research Service, USDA, Beltsville, Maryland ABSTRACT GHR [4], PRLR [4], SERPINA14 [4], SPP [4], and DNAJC15 [6] have been associated with in vitro development of embryos Fertilization and development of the preimplantation embryo to the blastocyst stage. is under genetic control. The present goal was to test 434 single The existence of genes controlling fertilization and nucleotide polymorphisms (SNPs) for association with genetic embryonic development is indicative that some of the historical variation in fertilization and early embryonic development. The decline in fertility in dairy cattle [9, 10] may be the result of approach was to produce embryos from 93 bulls using in vitro increased frequency of alleles that inhibit development. There procedures (n ¼ 3–6 replicates per bull) and relate cleavage rate are SNPs in cattle for which the beneficial allele for milk (CR) and development of cleaved embryos to the blastocyst production is the less desirable allele for reproduction [11, 12]. stage (BDRC) to the genotype for each SNP. Bulls were selected Downloaded from www.biolreprod.org. Downloaded from www.biolreprod.org. to have either high or low estimates for predicted transmitted Therefore, selection for production traits may have reduced the ability for daughter pregnancy rate (DPR), an estimate of female frequency of alleles that benefit fertility.
    [Show full text]