DOCSLIB.ORG

(A) Lsecs Were St

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(A) Lsecs Were St Supplemental figure 1. LSECs suppress T cell cytokine production and proliferation via PD-1/PD-L1 interaction. (A) LSECs were stained by either isotype control antibodies or anti-CD146, anti-NK1.1, anti-DX5, anti-CD11b, anti-CD11c, and anti-F4/80 after magnetic microbead purification. The purity of the cell fractions was then measured by flow cytometry. (B) Unstimulated or anti-CD3 (1 μg/ml) and anti-CD28 (1 μg/ml) stimulated splenocytes from C57BL/6 mice were cultured with or without LSECs at a ratio of 1:2 (LSECs:splenocytes). T cell cytokine production and proliferation were measured after 48 h. Anti-CD3/CD28 stimulated splenocytes only were used as responder controls (RC). Unstimulated splenocytes alone were used as negative control (NC). Unstimulated splenocytes cocultured with LSECs were used as unstimulated control (UC). (C) LSECs were cocultured with polyclonal-stimulated splenocytes in contact or transwell (LSECs and splenocytes separated by a semipermeable membrane) 96-well plates. T cell cytokine production and proliferation were measured after 48 h. (D) LSECs were incubated with 10 μg/ml isotype control antibodies (iso Ab) or anti-PD-L1 antibody (αPD-L1) for 1 h. Polyclonal stimulated splenocytes were cultured with antibodies treated LSECs. T cell cytokine production and proliferation were measured after 48 h. Data shown are the mean ± SD of one out of 3 representative experiments. *p < 0.05; **p < 0.01. Supplemental figure 2. TLR1/2 signaling does neither increase the costimulatory molecules expression nor the PD-L1 expression on LSECs. LSECs were stimulated in vitro by 10 μg/ml P3C(TLR1/2), 10 μg/ml poly(I:C)(TLR3), 10 μg/ml LPS(TLR4), or 50 ng/ml IFN-γ for either 24 h (A) or 6 h (B). (A) The changes of CD80, CD86, and PD-L1 1 expression on cells were then determined by flow cytometry. (B) The changes of CD80, CD86, and PD-L1 expression at the RNA level were determined by real-time RT-PCR. Results are representative of two independent experiments. (C) C57BL/6 mice were intraperitoneally injected with PBS or 100 μg P3C. LSECs from those animals were obtained 24 h later. The expression of CD80, CD86, and PD-L1 was determined by flow cytometry. (D) C57BL/6 mice were intraperitoneally injected with PBS or 100 μg P3C. Splenic DCs from those animals were obtained 24 h later. The expression of CD80 and CD86 was determined by flow cytometry. Supplemental figure 3. TLR1/2 stimulated LSECs do not inhibit activation induced CD8 T cell apoptosis. (A) Unstimulated or anti-CD3 (1 μg/ml) and anti-CD28 (1 μg/ml) stimulated splenocytes from C57BL/6 mice were cultured with or without LSECs at a ratio of 1:2 (LSECs:splenocytes). CD 8 T cell apoptosis and death were analyzed by using Annexin V and 7-AAD staining after 48 h. Anti-CD3/CD28 stimulated splenocytes only were used as responder controls (RC). Unstimulated splenocytes alone were used as negative control (NC). (B) P3C pretreated or untreated LSECs pulsed with 2 µg/ml FV peptide (FV GagL CTL epitope aa 85-93). Naïve FV-TCR TCR transgenic CD8+ T cells were cocultured with those LSECs or cultured alone (NC). As positive control (PC), the T cells were cocultured with bone marrow-derived FV peptide-pulsed DCs. CD 8 T cell apoptosis and death were analyzed by using Annexin V and 7-AAD staining after 72 h. Annexin V positive and 7-AAD negative cells are considered as early apoptosis cells and Annexin V and 7-AAD double positive cells are considered as end stage apoptosis and death cells. 2 Supplemental table 1. Gene expression difference analysis in P3C stimulated LSECs. In the table, the fold changes (log2 Ratio) of genes, which were significantly regulated in P3C stimulated LSECs (compared to untreated LSEC), are shown. Significantly regulated genes were selected using the following criteria: fold change>2 (Log2 Ratio≥ ±1), false discovery rate (FDR)<0.001. 3 A n.s. n.s. B * 60000 ** 150000 C 60000 150000 * ** 40000 100000 40000 100000 pg/ml pg/ml 20000 50000 20000 50000 IFN- IFN- Proliferation cpm Proliferation cpm 0 0 0 0 NC UC RC LSEC NC UC RC LSEC RC Contact Transwell RC Contact Transwell ¢CD3/¢CD28 - - + + ¢CD3/¢CD28 - - + + LSEC - + - + LSEC - + - + n.s. n.s. 5000 * 800 * * 5000 * 800 4000 4000 600 600 3000 3000 pg/ml pg/ml 400 400 2000 2000 IL-2 pg/ml IL-2 pg/ml TNF- 200 TNF- 200 1000 1000 0 0 0 0 NC UC RC LSEC NC UC RC LSEC RC Contact Transwell RC Contact Transwell ¢CD3/¢CD28 - - + + ¢CD3/¢CD28 - - + + LSEC - + - + LSEC - ++- n.s. n.s. D 50000 150000 ** ** 40000 100000 30000 pg/ml 20000 50000 IFN- 10000 Proliferation cpm Proliferation 0 0 RC Iso Ab PD-L1 RC Iso Ab PD-L1 n.s. n.s. ** 8000 1000 * 800 6000 600 pg/ml 4000 400 IL-2 pg/ml IL-2 2000 TNF- 200 0 0 RC Iso Ab PD-L1 RC Iso Ab PD-L1 Supplementary Table 1: Gene expression difference analysis in P3C stimulated LSECs. In the table, the fold changes (log2 Ratio) of genes,which were significantly regulated in P3C stimulated LSECs (compared to untreated LSEC) are shown. Significantly regulated genes were selected using the following criteria: fold change>2 (Log2 Ratioı ±1), false discovery rate (FDR)<0.001. Symbols Gene names log2 Ratio Acpp acid phosphatase, prostate, isoform CRA_b 9.44 Gm6578 39S ribosomal protein L32, mitochondrial 9.40 Il1b interleukin-1 beta precursor 6.61 Pls1 plastin-1 5.86 Depdc1a DEP domain-containing protein 1A isoform 3 5.16 Taz tafazzin, isoform CRA_c 4.52 Chgb secretogranin-1 precursor 4.20 Nit1 nitrilase homolog 1 isoform 1 4.17 Ccl20 C-C motif chemokine 20 isoform 1 4.02 Fpr1 fMet-Leu-Phe receptor 3.81 Mmp13 collagenase 3 preproprotein 3.57 Rgs4 regulator of G-protein signaling 4 3.46 Il1a interleukin 1 alpha, isoform CRA_a 3.21 Nox4 NADPH oxidase 4 3.02 Ccl3 C-C motif chemokine 3 2.88 Kcnh1 potassium voltage-gated channel subfamily H member 1 isoform 2 2.83 Clec4a1 C-type lectin domain family 4, member a1 2.81 Cxcl5 C-X-C motif chemokine 5 precursor 2.78 Steap4 metalloreductase STEAP4 2.76 Il18r1 interleukin-18 receptor 1 isoform a 2.74 Cenpe centromere-associated protein E 2.69 Fpr2 formyl peptide receptor 2 2.69 Serf1 small EDRK-rich factor 1 2.64 Gm6377 novel protein 2.58 Cenph centromere protein H 2.58 Irg1 immune-responsive gene 1 2.58 Kif18a kinesin-like protein KIF18A 2.58 Cnr1 cannabinoid receptor 1 2.56 9930023K05Rik RIKEN cDNA 9930023K05, isoform CRA_c 2.56 Pilra paired immunoglobulin-like type 2 receptor alpha precursor 2.55 Nusap1 nucleolar and spindle-associated protein 1 isoform a 2.53 4930547N16Rik mCG16776, isoform CRA_b 2.52 Esco2 N-acetyltransferase ESCO2 2.48 Hjurp Holliday junction recognition protein 2.44 Ccl9 C-C motif chemokine 9 2.40 Cxcl2 C-X-C motif chemokine 2 precursor 2.38 Fam64a family with sequence similarity 64, member A 2.38 Prune2 protein prune homolog 2 2.34 Ccnb2 G2/mitotic-specific cyclin-B2 2.32 Aspm abnormal spindle-like microcephaly-associated protein homolog 2.32 Prelid2 PRELI domain-containing protein 2 2.29 Sncaip synuclein, alpha interacting protein (synphilin), isoform CRA_b 2.28 Tmem71 transmembrane protein 71 2.28 Mmp9 matrix metalloproteinase-9 precursor 2.28 Kif15 kinesin-like protein KIF15 2.28 Ccl6 C-C motif chemokine 6 precursor 2.24 Cxcl3 C-X-C motif chemokine 3 precursor 2.20 1-Mar E3 ubiquitin-protein ligase MARCH1 isoform 3 2.20 Il33 interleukin-33 precursor 2.20 Fam36a Protein FAM36A 2.20 Scd2 acyl-CoA desaturase 2 2.19 Snhg3 mCG118858 2.17 Kif20b kinesin-like protein KIF20B 2.16 Pkd2l2 polycystic kidney disease 2-like 2 protein 2.16 Psg22 mCG3735 2.16 Mis18bp1 expressed sequence C79407 2.15 Cldn2 claudin-2 2.15 8430408G22Rik protein DEPP 2.15 Hells lymphocyte-specific helicase 2.14 Casc5 protein CASC5 2.13 Myh15 myosin-15 2.12 Kctd12 BTB/POZ domain-containing protein KCTD12 2.10 Csf3r granulocyte colony-stimulating factor receptor precursor 2.08 2810417H13Rik mCG131663, isoform CRA_b 2.06 Cybb cytochrome b-245 heavy chain 2.06 Clec1a C-type lectin domain family 1 member A 2.06 Ect2 mKIAA4037 protein 2.04 C330027C09Rik RIKEN cDNA C330027C09, isoform CRA_a 2.03 Sgol1 shugoshin-like 1 2.02 C030044B11Rik mCG1043891 2.01 Rassf4 Ras association (RalGDS/AF-6) domain family member 4 2.00 St8sia4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 2.00 Efha2 EF-hand domain-containing family member A2 1.99 Prr11 proline-rich protein 11 1.98 Fam83b Protein FAM83B 1.97 Clec4n C-type lectin domain family 6 member A isoform 1 1.97 Enpp2 ectonucleotide pyrophosphatase/phosphodiesterase family member 2 isoform 1 1.97 Trp53i11 Trp53 inducible protein 11, isoform CRA_d 1.94 Prrg1 proline rich Gla (G-carboxyglutamic acid) 1 1.94 5830433M19Rik likely ortholog of H. sapiens chromosome 9 open reading frame 82 (C9orf82) 1.93 Cdca2 cell division cycle-associated protein 2 1.92 Cd14 monocyte differentiation antigen CD14 precursor 1.92 Col4a3 collagen alpha-3(IV) chain precursor 1.90 Gpr84 G-protein coupled receptor 84 1.90 Ccl4 C-C motif chemokine 4 1.89 Sorcs1 VPS10 domain-containing receptor SorCS1 1.89 Cenpf centromere protein F 1.89 Fam83d mCG15735 1.88 Bub1 budding uninhibited by benzimidazoles 1 homolog (S. cerevisiae), isoform CRA_a 1.87 Kif14 kinesin-like protein KIF14 1.86 Fam132b Protein FAM132B 1.85 Muc1 mucin-1 1.85 Plch1 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase eta-1 isoform 2 1.85 Ccdc15 coiled-coil domain-containing protein 15 1.84 Ube2c ubiquitin-conjugating enzyme E2 C 1.84 Cxcr4 C-X-C chemokine receptor type 4 1.82 Igfbp3 insulin-like growth factor-binding protein 3 1.82 Clec7a C-type lectin domain family 7 member A 1.81 Lcp2 lymphocyte cytosolic protein 2 1.80 Hmmr hyaluronan mediated motility receptor
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Assignment of the AK1:Np:ABO Linkage Group to Human Chromosome 9 (Somatic Cell Hybrids/Enzyme Markers/Gene Localization) A
    Proc. Nat. Acad. Sci. USA Vol. 73, No. 3, pp. 895-899, March 1976 Genetics Assignment of the AK1:Np:ABO linkage group to human chromosome 9 (somatic cell hybrids/enzyme markers/gene localization) A. WESTERVELD*§, A. P. M. JONGSMA*, P. MEERA KHANt, H. VAN SOMERENt, AND D. BOOTSMA* * Department of Cell Biology and Genetics, Erasmus University, Rotterdam, The Netherlands; t Department of Human Genetics, State University, Leiden, The Netherlands; and * Medical Biological Laboratory TNO, P.O. Box 45, Rijswijk 2100, The Netherlands Communicated by Victor A. McKusick, January 8,1976 ABSTRACT In man-Chinese hamster somatic cell hy- cytes were obtained from peripheral blood of male and fe- brids the segregation patterns of the loci for 25 human en- male donors. The details on production, isolation, and propa- zyme markers and human chromosomes were studied. The results provide evidence for the localization of the gene for gation of these hybrids have been published elsewhere (11). adenylate kinase-1 (AKI) on chromosome 9. Since the loci for In the hybrid and parental cell populations the following the ABO blood group (ABO), nail-patella syndrome (Np), and enzymes were analyzed by means of Cellogel electrophore- AK1 are known to be linked in man, the ABO.Np:AKj link- sis: glucose-6-phosphate dehydrogenase (G6PD); phospho- age group may be assigned to chromosome 9. glycerate kinase (PGK); a-galactosidase-A (a-Gal A); lactate dehydrogenases (LDH-A, LDH-B); 6-phosphogluconate de- In man several electrophoretically separable isoenzymes for hydrogenase (6PGD); phosphoglucomutases (PGMI, PGMs); adenylate kinase (AK; EC 2.7.4.3) have been described (1).
    [Show full text]
  • Data Sheet Huil36g (152 A.A.)
    Growth Factor Data Sheet GoldBio growth factors are manufactured for RESEARCH USE ONLY and cannot be sold for human consumption! Interleukin-36G (IL36G) is a pro-inflammatory cytokine that plays an important role in the pathophysiology of several diseases. IL36A, IL36B and IL36G (formerly IL1F6, IL1F8, and IL1F9) are IL1 family members that signal through the IL1 receptor family members IL1Rrp2 (IL1RL2) and IL1RAcP. IL36G is secreted when transfected into 293-T cells and could constitute part of an independent signaling system analogous to that of IL1A and IL1B receptor agonist and interleukin-1 receptor type I (IL1R1). Furthermore, IL36G also can function as an agonist of NFκB activation through the orphan IL1- receptor-related protein 2. Human IL36G (152 a.a.) shares 58%, 59%, 68% and 69% amino acid sequence identity with mouse, rat, bovine and equine IL36G, respectively, and 23-57% amino acid sequence identity with other family members. Catalog Number 1110-36F Product Name IL36G (IL-36 gamma), Human (152 a.a.) Recombinant Human Interleukin-36γ IL36G, IL36γ Interleukin 1 Homolog 1 (IL1H1) Interleukin 1-Related Protein 2 (IL1RP2) Interleukin 1 Family, Member 9 (IL1F9) Source Escherichia coli MW ~17.0 kDa (152 amino acids) Sequence SMCKPITGTI NDLNQQVWTL QGQNLVAVPR SDSVTPVTVA VITCKYPEAL EQGRGDPIYL GIQNPEMCLY CEKVGEQPTL QLKEQKIMDL YGQPEPVKPF LFYRAKTGRT STLESVAFPD WFIASSKRDQ PIILTSELGK SYNTAFELNI ND Accession Number Q9NZH8 Purity >95% by SDS-PAGE and HPLC analyses Biological Activity Fully biologically active when compared to standard. The ED50 as determined by its ability to induce IL-8 secretion by human preadipocytes is less than 10 ng/ml, corresponding to a specific activity of >1 × 105 IU/mg.
    [Show full text]
  • ROS Production Induced by BRAF Inhibitor Treatment Rewires
    Cesi et al. Molecular Cancer (2017) 16:102 DOI 10.1186/s12943-017-0667-y RESEARCH Open Access ROS production induced by BRAF inhibitor treatment rewires metabolic processes affecting cell growth of melanoma cells Giulia Cesi, Geoffroy Walbrecq, Andreas Zimmer, Stephanie Kreis*† and Claude Haan† Abstract Background: Most melanoma patients with BRAFV600E positive tumors respond well to a combination of BRAF kinase and MEK inhibitors. However, some patients are intrinsically resistant while the majority of patients eventually develop drug resistance to the treatment. For patients insufficiently responding to BRAF and MEK inhibitors, there is an ongoing need for new treatment targets. Cellular metabolism is such a promising new target line: mutant BRAFV600E has been shown to affect the metabolism. Methods: Time course experiments and a series of western blots were performed in a panel of BRAFV600E and BRAFWT/ NRASmut human melanoma cells, which were incubated with BRAF and MEK1 kinase inhibitors. siRNA approaches were used to investigate the metabolic players involved. Reactive oxygen species (ROS) were measured by confocal microscopy and AZD7545, an inhibitor targeting PDKs (pyruvate dehydrogenase kinase) was tested. Results: We show that inhibition of the RAS/RAF/MEK/ERK pathway induces phosphorylation of the pyruvate dehydrogenase PDH-E1α subunit in BRAFV600E and in BRAFWT/NRASmut harboring cells. Inhibition of BRAF, MEK1 and siRNA knock-down of ERK1/2 mediated phosphorylation of PDH. siRNA-mediated knock-down of all PDKs or the use of DCA (a pan-PDK inhibitor) abolished PDH-E1α phosphorylation. BRAF inhibitor treatment also induced the upregulation of ROS, concomitantly with the induction of PDH phosphorylation.
    [Show full text]
  • GJA4/Connexin 37 Mutations Correlate with Secondary Lymphedema Following Surgery in Breast Cancer Patients
    biomedicines Article GJA4/Connexin 37 Mutations Correlate with Secondary Lymphedema Following Surgery in Breast Cancer Patients Mahrooyeh Hadizadeh 1,2, Seiied Mojtaba Mohaddes Ardebili 1, Mansoor Salehi 2, Chris Young 3, Fariborz Mokarian 4, James McClellan 5, Qin Xu 6, Mohammad Kazemi 2, Elham Moazam 4, Behzad Mahaki 7 ID and Maziar Ashrafian Bonab 8,* 1 Department of Medical Genetics, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz 5166614766, Iran; [email protected] (M.H.); [email protected] (S.M.M.A.) 2 Department of Genetics and Molecular Biology, Isfahan University of Medical Sciences, Isfahan 81746753461, Iran; [email protected] (M.S.); [email protected] (M.K.) 3 School of Allied Health Sciences, Faculty of Health and Life Sciences, De Montfort University, Leicester LE1 9BH, UK; [email protected] 4 Cancer Prevention Research Centre, Isfahan University of Medical Sciences, Isfahan 8184917911, Iran; [email protected] (F.M.); [email protected] (E.M.) 5 School of Biological Sciences, University of Portsmouth, Portsmouth PO1 2DY, UK; [email protected] 6 School of Pharmacy, Faculty of Health and Life Sciences, De Montfort University, Leicester LE1 9BH, UK; [email protected] 7 Department of Occupational Health Engineering, School of Health, Isfahan University of Medical Sciences, Isfahan 8174673461, Iran; [email protected] 8 Department of Biological Sciences, University of Chester, Chester CH1 4BJ, UK * Correspondence: [email protected]; Tel.: +44-(0)1244-513-056 Received: 31 December 2017; Accepted: 13 February 2018; Published: 22 February 2018 Abstract: Lymphedema is a condition resulting from mutations in various genes essential for lymphatic development and function, which leads to obstruction of the lymphatic system.
    [Show full text]
  • Funkce CDK12 a CDK13 V Regulaci Transkripce Hana Paculová
    MASARYKOVA UNIVERZITA PŘÍRODOVĚDECKÁ FAKULTA ÚSTAV BIOCHEMIE Funkce CDK12 a CDK13 v regulaci transkripce Disertační práce Hana Paculová Školitel: Mgr. Jiří Kohoutek, Ph.D Brno 2018 Bibliogra cký záznam Autorka: Mgr. Hana Paculová Prrodovedecáá aaául,a鏈 Maaarkáova unvverv,a Úa,av bvochemve Název práce: Funáce CDK12 a CDK13 v regulacv ,ranaárvpce Studijní program: Bvochemve Studijní obor: Bvochemve Školitel: Mgr. Jvr Kohou,eá鏈 Ph.D Akademický rok: 2017/2018 Po et stran: 89 Klí ová slova: Ckálvn-dependen,n ávnaaa鏈 CDK12鏈 ,ranaárvpce鏈 RNA polkmeraaa II鏈 raáovvna vaječnáů鏈 CHK1 Bibliographic entry Author: Mgr. Hana Paculová Facul,k oa acvence鏈 Maaarká unvverav,k Department of Biochemistry Title oF dissertation: CDK12 and CDK13 aunc,von vn ,ranacrvp,von regula,von Degree programme: Bvochemva,rk Field oF study: Bvochemva,rk Supervisor: Mgr. Jvr Kohou,eá鏈 Ph.D Academic year: 2017/2018 Number oF pages: 89 Keywords: Ckclvn-dependen ávnaae鏈 CDK12鏈 ,ranacrvp,von鏈 RNA polkmeraae II鏈 ovarvan cancer鏈 CHK1 Abstrakt Ckálvn-dependen,n ávnaaa 12 (CDK12) je ,ranaárvpčn ávnaaa鏈 á,erá rd expreav avých clových genů ,m鏈 že aoaaorkluje RNA polkmeraau II v průbehu elongačn aáe ,ranaárvpce. CDK12 je apojena do neáolváa bunečných preceaů鏈 což ahrnuje odpoveď na pošáoen DNA鏈 vývoj a bunečnou dvaerencvacv a aea,rvh mRNA. CDK12 bkla popaána jaáo jeden genů鏈 á,eré jaou čaa,o mu,ovánk v hvgh-grade aerónm ovarválnm áarcvnomu鏈 nvcméne vlvv ,ech,o mu,ac na aunácv CDK12 a jejvch role v áarcvnogenev dopoaud nebkla a,anovena. Zjva,vlv jame鏈 že ve,švna mu,ac CDK12鏈 á,eré bklk naleenk v nádorech鏈 brán vk,voren áomplexu CDK12 a Ckálvnem K a vnhvbuj ávnaaovou aá,vvv,u CDK12.
    [Show full text]
  • Anti-GJA4 / Connexin 37 Antibody (ARG58815)
    Product datasheet [email protected] ARG58815 Package: 50 μg anti-GJA4 / Connexin 37 antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes GJA4 / Connexin 37 Tested Reactivity Hu, Ms, Rat Predict Reactivity Hm Tested Application ICC, IHC-Fr, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name GJA4 / Connexin 37 Species Human Immunogen Synthetic peptide corresponding to aa. 3-17 of Human Connexin 37 (DWGFLEKLLDQVQEH). Conjugation Un-conjugated Alternate Names Connexin-37; Gap junction alpha-4 protein; CX37; Cx37 Application Instructions Application table Application Dilution ICC 0.5 - 1 µg/ml IHC-Fr 1:200 - 1:1000 WB 0.1 - 0.5 µg/ml Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Properties Form Liquid Purification Affinity purification with immunogen. Buffer 0.9% NaCl, 0.2% Na2HPO4, 0.05% Thimerosal, 0.05% Sodium azide and 5% BSA. Preservative 0.05% Thimerosal and 0.05% Sodium azide Stabilizer 5% BSA Concentration 0.5 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C or below. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. www.arigobio.com 1/3 Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol GJA4 Gene Full Name gap junction protein, alpha 4, 37kDa Background This gene encodes a member of the connexin gene family.
    [Show full text]
  • Chromosomal Assignment of the Genes for Human Aldehyde Dehydrogenase-1 and Aldehyde Dehydrogenase-2 LILY C
    Am J Hum Genet 38:641-648, 1986 Chromosomal Assignment of the Genes for Human Aldehyde Dehydrogenase-1 and Aldehyde Dehydrogenase-2 LILY C. Hsu,', AKIRA YOSHIDA,' AND T. MOHANDAS2 SUMMARY Chromosomal assignment of the genes for two major human aldehyde dehydrogenase isozymes, that is, cytosolic aldehyde dehydrogenase-1 (ALDH1) and mitochondrial aldehyde dehydrogenase-2 (ALDH2) were determined. Genomic DNA, isolated from a panel of mouse- human and Chinese hamster-human hybrid cell lines, was digested by restriction endonucleases and subjected to Southern blot hybridiza- tion using cDNA probes for ALDH1 and for ALDH2. Based on the distribution pattern of ALDH1 and ALDH2 in cell hybrids, ALDHI was assigned to the long arm of human chromosome 9 and ALDH2 to chromosome 12. INTRODUCTION Two major and at least two minor aldehyde dehydrogenase isozymes exist in human and other mammalian livers. One of the major isozymes, designated as ALDH 1, or E1, is of cytosolic origin, and another major isozyme, designated as ALDH2 or E2, is of mitochondrial origin. The two isozymes are different from each other with respect to their kinetic properties, sensitivity to disulfiram inactivation, and protein structure [1-5]. Remarkable racial differences be- tween Caucasians and Orientals have been found in these isozymes. Approxi- mately 50% of Orientals have a variant form of ALDH2 associated with dimin- ished activity, while virtually all Caucasians have the wild-type active ALDH2 Received July 10, 1985; revised September 23, 1985. This work was supported by grant AA05763 from the National Institutes of Health. ' Department of Biochemical Genetics, Beckman Research Institute of the City of Hope, Duarte, CA 91010.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Association of an Interleukin 1B Gene Polymorphism (-511) With
    400 LETTER TO JMG Association of an interleukin 1B gene polymorphism (−511) with Parkinson’s disease in Finnish patients K M Mattila, J O Rinne, T Lehtimäki, M Röyttä, J-P Ahonen, M Hurme ............................................................................................................................. J Med Genet 2002;39:400–402 lzheimer’s disease (AD) and Parkinson’s disease (PD) are the two most common neurodegenerative conditions Table 1 Genotype and allele frequencies of the IL1 characterised by the presence of abnormal accumula- gene cluster polymorphisms in AD, PD, and control A patients tion of proteins and loss of neurones in specific regions of the brain. The aetiology and pathogenesis of AD and PD still Controls remain largely unknown. Evidence has emerged that immune Polymorphism AD (n=92) PD (n=52) (n=73) mediated mechanisms may be important in the development − 12 IL1A ( 889) of these disorders, and cytokine interleukin 1 (IL1) is one of *1/*1 42 (0.46) 28 (0.54) 33 (0.45) the mediators suggested to be involved. *1/*2 39 (0.42) 20 (0.38) 29 (0.40) The IL1 family comprises three proteins, the proinflamma- *2/*2 11 (0.12) 4 (0.08) 11 (0.15) tory IL1α and IL1β and their inhibitor IL1 receptor antagonist *1 123 (0.67) 76 (0.73) 95 (0.65) *2 61 (0.32) 28 (0.27) 51 (0.35) (IL1Ra), which are encoded by the IL1A, IL1B, and IL1RN − genes respectively.3 Since IL1 may have a role in AD4–8 and in IL1B ( 511) 910 *1/*1 35 (0.38) 25 (0.48) 24 (0.32) PD, variation in the IL1A, IL1B, and IL1RN genes may be of *1/*2 47 (0.51) 25 (0.48) 30 (0.41) importance in the development of these disorders.
    [Show full text]