TET2 Binds the Androgen Receptor and Loss Is Associated with Prostate Cancer

ORIGINAL ARTICLE TET2 binds the androgen receptor and loss is associated with prostate cancer

ML Nickerson1,14, S Das2,KMIm3, S Turan1, SI Berndt4,HLi1,5,HLou1,5, SA Brodie4,6, JN Billaud7, T Zhang8, AJ Bouk4,6, D Butcher9, Z Wang4, L Sun10, K Misner1,WTan1,5, A Esnakula11, D Esposito12, WY Huang4, RN Hoover4, MA Tucker4, JR Keller10, J Boland4,6, K Brown8, SK Anderson1, LE Moore4, WB Isaacs13, SJ Chanock4, M Yeager4,6, M Dean1,14 and T Andresson2

Genetic alterations associated with prostate cancer (PCa) may be identified by sequencing metastatic tumour genomes to identify molecular markers at this lethal stage of disease. Previously, we characterized somatic alterations in metastatic tumours in the methylcytosine dioxygenase ten-eleven translocation 2 (TET2), which is altered in 5–15% of myeloid, kidney, colon and PCas. Genome-wide association studies previously identified non-coding risk variants associated with PCa and melanoma. We perform fine-mapping of PCa risk across TET2 using genotypes from the PEGASUS case-control cohort and identify six new risk variants in introns 1 and 2. Oligonucleotides containing two risk variants are bound by the transcription factor octamer-binding protein 1 (Oct1/POU2F1) and TET2 and Oct1 expression are positively correlated in prostate tumours. TET2 is expressed in normal prostate tissue and reduced in a subset of tumours from the Cancer Genome Atlas (TCGA). Small interfering RNA-mediated TET2 knockdown (KD) increases LNCaP cell proliferation, migration and wound healing, verifying loss drives a cancer phenotype. Endogenous TET2 bound the androgen receptor (AR) and AR-coactivator proteins in LNCaP cell extracts, and TET2 KD increases prostate-specific antigen (KLK3/PSA) expression. Published data reveal TET2 binding sites and hydroxymethylcytosine proximal to KLK3. A gene co-expression network identified using TCGA prostate tumour RNA-sequencing identifies co-regulated cancer genes associated with 2-oxoglutarate (2-OG) and succinate metabolism, including TET2, lysine demethylase (KDM) KDM6A, BRCA1-associated BAP1, and citric acid cycle enzymes IDH1/2, SDHA/B, and FH. The co-expression signature is conserved across 31 TCGA cancers suggesting a putative role for TET2 as an energy sensor (of 2-OG) that modifies aspects of androgen-AR signalling. Decreased TET2 mRNA expression in TCGA PCa tumours is strongly associated with reduced patient survival, indicating reduced expression in tumours may be an informative biomarker of disease progression and perhaps metastatic disease.

Oncogene advance online publication, 7 November 2016; doi:10.1038/onc.2016.376

INTRODUCTION Germline TET2 variants are associated with an increased risk of Metastatic prostate cancer (mPCa) is poorly controlled using prostate12,13 and endometrial7 cancers, and melanoma.8 Thus, existing therapies and is responsible for more than 258 000 deaths germline and somatic alterations implicate TET2 as a cancer gene worldwide each year.1 Molecular markers that distinguish indolent in MPDs and epithelial cancers. from aggressive disease and identify therapeutic targets may Previously, we sequenced the exomes of five distinct metastatic improve patient stratification for precision medicine. Genetic tumours and healthy tissue from a patient with PCa and identified 11 analysis to determine the precise molecular chronology of causal four cancer gene alterations, an inherited breast cancer-1 14 alterations arising during progression of PCa to castration-resistant (BRCA1) truncation (p.E23fs*) associated with PCa, a somatic and metastatic disease has been difficult, in part, because of deletion giving rise to a fusion of the transmembrane protease 15 the very high heterogeneity of primary adenocarcinomas and a TMPRSS2 and the transcription factor (TF) ERG, a somatic 16 paucity of metastatic tumours. missense substitution in a bromodomain of PBRM1, and a somatic Frequent somatic ten-eleven translocation 2 (TET2) alterations TET2 missense substitution (p.P562A). Significantly, the TET2 have been observed in myeloproliferative disorders (MPDs),2,3 substitution was observed in all 11 mPCa tumours but not in the mastocytosis and polycythemia vera, and in fewer but significant primary tumour, suggesting altered TET2 may provide a survival numbers of epithelial-derived tumours,4–11 including PCa.9–11 benefitdistinctfromalteredBRCA1, TMPRSS2-ERG and PBRM1.17

1Cancer and Inflammation Program, National Cancer Institute, National Institutes of Health, Frederick, MD, USA; 2Protein Characterization Laboratory, Cancer Research Technology Program, Leidos Biomedical Research, Inc., Frederick National Laboratory for Cancer Research, Frederick, MD, USA; 3Data Science for Genomics, Ellicott City, MD, USA; 4Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA; 5Basic Research Program, Leidos Biomedical Research, Inc., Frederick National Laboratory for Cancer Research, Frederick, MD, USA; 6Cancer Genomics Research Laboratory, Leidos Biomedical Research, Inc., Frederick National Laboratory for Cancer Research, Frederick, MD, USA; 7Ingenuity Systems, Inc., Redwood City, CA, USA; 8Laboratory of Translational Genomics, National Cancer Institute, Bethesda, MD, USA; 9Pathology and Histotechnology Laboratory, Leidos Biomedical Research, Inc., Frederick National Laboratory for Cancer Research, Frederick, MD, USA; 10Mouse Cancer Genetics Program, National Cancer Institute, National Institutes of Health, Frederick, MD, USA; 11Department of Pathology, Howard University College of Medicine, Howard University Hospital, NW, Washington, DC, USA; 12Protein Expression Laboratory, Leidos Biomedical Research, Inc., Frederick National Laboratory for Cancer Research, Frederick, MD, USA and 13School of Medicine, Johns Hopkins University, Baltimore, MD, USA. Correspondence: Dr ML Nickerson, Laboratory of Translational Genomics, National Cancer Institute, 8717 Grovemont Circle, Rm. 225C, Bethesda, MD 20892-4605, USA. E-mail: [email protected] 14Current address: Laboratory of Translational Genomics, National Cancer Institute, Bethesda, MD, USA. Received 21 September 2015; revised 15 August 2016; accepted 29 August 2016 TET2 defects in prostate cancer ML Nickerson et al 2 Analysis of mPCa tumours from additional patients showed TET2 but not further examined (Figure 1c). In silico analysis of alterations in 13/30 tumours11,18 and we identified a frameshift TF-binding sites revealed that rs17508261 was located in an Oct1/ truncation (p.T229fs*) in DU145, an androgen-independent cell POU2F119-binding DNA sequence motif (Supplementary line derived from an mPCa brain tumour. Thus, the presence of Figure S1). Supershift analysis with TF-specific antibodies showed germline and somatic TET2 alterations suggests an altered TET2 altered migration or reduced binding to labelled oligonucleotides may be associated with progression in a subset of PCa patients. containing rs17508261-C and rs7655890-T in the presence of an In this study, we identify six new PCa risk variants in TET2 anti-Oct1 antibody whereas no supershift was observed with other introns 1 and 2, and show TET2 physically interacts with the TF antibodies examined. The SNP genotypes indicate rs17508261-C androgen receptor (AR) and AR-coactivators PSPC1, NONO and and rs7655890-T are risk and protective alleles, respectively SFPQ. TET2 loss drives a cancer phenotype by increasing LNCaP (Figure 1e; Supplementary Tables S1). Thus, rs17508261-C may prostate cell proliferation and invasion, and KLK3/PSA expression. be a functionally significant PCa risk variant due to Oct1 binding. Network analysis reveals TET2-AR interacts with proteins that are Three risk variants, rs7679673-A, rs17508261-C and rs7655890-G, frequently altered across cancers. We identify a TET2-associated were in linkage disequilibrium in a rare risk haplotype co-expression signature in the Cancer Genome Atlas (TCGA) in PCa (Supplementary Table S2). To test the effect of these alleles on tumours that includes cancer genes encoding functions related to TET2 expression, we genotyped rs7679673, rs17508261 and 2-oxoglutarate (2-OG) and succinate metabolism. The signature rs7655890 in 11 PCa cell lines and examined normalized TET2 is observed across cancers indicating frequent dis-regulation of expression. We found no association between the SNP genotype 2-OG and succinate metabolism in cancer. and TET2a mRNA expression (Supplementary Figure S2), but did observe that 4 of 11 (36%) PCa cell lines, DU145, PC3, PWR-1E and RESULTS VCaP, exhibited significantly reduced TET2 expression (Figure 1f; Supplementary Tables S3). TET2 expression in DU145 cells may be PCa risk variants 11 reduced due to a p.T229fs* mutation. We genotyped 47 TET2 locus single nucleotide polymorphisms To analyse the relationship between TET2 and Oct1 expression, (SNPs) in 4838 cases and 3053 controls in the PEGASUS cohort as we measured the mRNA levels of TET2 and Oct1 in 12 PCa cell lines part of the Cancer Genetic Markers of Susceptibility Study using real-time, quantitative PCR (Supplementary Figure S3). (National Cancer Institute, Bethesda, MD) (Supplementary Table S1). Pearson correlation showed a positive but not significant Seven, including the previously reported promoter variant, 12 correlation between TET2 and Oct1 expression. We examined rs7679673 and six new SNPs in introns 1 and 2, were found to TET2 and Oct1 expression in an independent dataset, TCGA PCa fi ⩽ À4 be signi cantly associated with increased PCa risk (P 10 ) tumours, using tumour RNA sequencing and observed a positive (Table 1, Figure 1a). SNP rs7679673 retained the highest association Pearson correlation indicating co-expression (P = 0.0097, with risk (P =1.6×10À6) followed by rs1015521 in intron 2 À5 Supplementary Figure S3). Thus, risk SNPs within the TET2 (P =8.6×10 ). Two SNPs in intron 1, rs17508261 and rs6825684, transcriptional locus conclusively identify TET2 as the PCa risk had a slightly more protective homozygous odds ratio (0.68 and 0.69, gene on chr 4q24. The significance of Oct1-binding to TET2 risk respectively) than rs7679673 (0.72). variants relative to Oct1’s described roles in cancer stem cells and We examined TF binding to oligonucleotides containing the the cell cycle remains to be determined.19,20 new risk SNPs by electrophoretic mobility shift assay and observed protein binding to oligonucleotide probes containing rs17508261-C and rs7655890-G/T in LNCaP and PC3 cell line nuclear extracts Somatic alterations in epithelial cancers (Figure 1b). TF binding was confirmed in repeat experiments and The spectrum of somatic mutations indicates that TET2 functions additional proteins interacting with these oligonucleotides in as a tumour suppressor in MPD,2,3 so we assembled 97 somatic kidney 293, cervical HeLa and breast MCF7 cells were observed mutations observed in epithelial tumours from published

Table 1. TET2 variants associated with PCa risk

Overall Rank Locusa Allelesb MAFc χ2, 1dfd P Het OR 95% CI Hom OR 95% CI

58 rs7679673 C,A 0.412/0.372 23.02 1.60E-06 0.85 0.79–0.91 0.72 0.63–0.82 326 rs1015521 G,T 0.365/0.334 15.43 8.56E-05 0.87 0.81–0.93 0.76 0.66–0.87 417 rs7655890 T,G 0.347/0.317 14.76 1.22E-04 0.87 0.81–0.94 0.76 0.66–0.87 497 rs6839705 C,A 0.378/0.348 14.29 1.57E-04 0.88 0.82–0.94 0.77 0.67–0.88 504 rs17508261 T,C 0.136/0.115 14.23 1.62E-04 0.83 0.75–0.91 0.68 0.56–0.83 505 rs6825684 G,A 0.141/0.120 14.23 1.62E-04 0.83 0.75–0.91 0.69 0.56–0.83 557 rs2047409 T,C 0.395/0.364 13.99 1.84E-04 0.88 0.82–0.94 0.77 0.67–0.88 Abbreviations: CI, conﬁdence interval. het, heterozygous; OR, odds ratio. Estimate assuming a multiplicative odds model. Homozygous (hom) OR. aNCBI dbSNP identiﬁer. bFirst nucleotide major allele; second nucleotide effect allele. cMinor allele frequency (controls/cases, MAF). d1 d.f. trend test.

Figure 1. PCa risk SNPs. (a) Risk SNPs and TET2 isoforms. Locations of risk SNPs and binding sites of siRNAs used in this study are indicated. Vertical dotted line, alternative ﬁrst exons; horizontal dotted line (TET2a-delex2), transcript structure not determined; white, non-coding; black, protein-coding. (b) Electrophoretic mobility shift assays show nuclear protein binding to rs17508261-C and rs7655890-G/T oligonucleotides in PCa cell line nuclear extracts (arrow). (c) Nuclear proteins associate with oligonucleotides containing the indicated variant in repeat experiments and extracts from additional cell lines (arrows). Black arrows, not further examined. (d) Supershift assays in the presence of TF antibodies show altered complex migration in the presence of anti-Oct1 (*) compared with probe alone (**). (e) A rare risk SNP haplotype (risk/risk) binds Oct1 (grey circle). Prot, protective. (f) TET2a expression is reduced in a subset of prostate cell lines (3.87 ± 0.75 [average] versus 1.67 ± 0.27 [low]). Expression analysed in triplicate; P-value, two-tailed Wilcoxon rank sum test; error bars, mean ± s.d.

Oncogene (2016), 1 – 12 © 2016 Macmillan Publishers Limited, part of Springer Nature. TET2 defects in prostate cancer ML Nickerson et al 3 studies,4–11 TCGA and the Catalogue of Somatic Mutations in suppressor in epithelial cancer. Additional experimental data are Cancer (COSMIC) (Supplementary Figure S4a; Supplementary required to conﬁrm whether all alterations have a similar effect on Table S5). Forty-nine (51%) alterations were predicted to be loss function. Recent next generation sequencing-molecular analyses of function, indicating that TET2 potentially functions as a tumour of PCa9–11,21,22 available through the cBioPortal for Cancer

© 2016 Macmillan Publishers Limited, part of Springer Nature. Oncogene (2016), 1 – 12 TET2 defects in prostate cancer ML Nickerson et al 4 Genomics23 reveal a low but significant number of somatic TET2 We evaluated the normalized TET2 mRNA expression in tumours alterations (Supplementary Figure S4b). We were able to assess compared to the NAT using a Z-score ⩽ –2.0 criteria, and identified TET2 status in 246 primary adenocarcinomas and 117 metastatic 7 of 131 (5.3%) primary tumours and 7 of 19 (36.8%) metastatic tumours and observed a significantly greater number of somatic tumours with significantly reduced expression (‘Low’) as compared alterations in metastatic as compared to primary tumours to the average (Figure 2c). Reduced expression in 3 of 14 (21%) (23 [20%] and 14 [6%], respectively; Fisher’s exact test TET2-low tumours were attributable to copy number variation loss; 9 P = 4.7 × 10À4). Additionally, several studies identified tumours gene sequencing data were not available. Thus, unknown with focal or homozygous loss of TET2 (Supplementary additional mechanism(s) reduce mRNA expression in the majority – Figure S4c).5,11,24 of tumours. Retrospective Kaplan Meier analysis revealed shor- tened disease-free survival (DFS) in the seven patients with TET2- low primary tumours as compared with 123 patients with tumours À6 Reduced expression in advanced, lethal PCa displaying average TET2 expression (P = 6.4 ×10 ; Figure 2d). Thus, reduced TET2 mRNA expression in tumours is significantly Reduced TET2 expression in MPD is a predictor of disease associated with a lethal subtype of PCa. progression and poor overall survival.25,26 We re-examined 9 We confirmed by real time-polymerase chain reaction (RT-PCR) normalized mRNA expression in a recent PCa study of 29 and western blot (WB) using a previously described monoclonal matched normal adjacent tissue (NAT) samples, 131 primary antibody27 that TET2a (NM_001127208; 2002 amino acids [aa]) tumours and 19 metastatic tumours. Expression decreased when was highly expressed in prostate tissue, tumours and cell lines. fi comparing the NAT with primary tumours, though not signi - TET2a and TET2b (NM_017628; 1165 aa) were both expressed in cantly, but was significant when comparing primary with prostate samples and are transcribed 810 base pairs apart (HG19) metastatic tumours (P = 0.01; Figure 2a). Expression was reduced (Figures 1a and 2e–h; Supplementary Table S4). All samples in 145 primary and metastatic tumours with a high (⩾ 7) versus exhibited alternative splicing of the TET2a untranslated exon 2 low (o7) combined Gleason score (P = 0.006; Figure 2b). There (TET2a-deleted exon 2 [TET2a-delex2]). was no association between reduced TET2 expression and tumour Immunohistochemistry of serial sections of a PCa tissue stage (P = 0.44, data not shown). microarray revealed TET2 and 5-hydroxymethylcytosine (hmC)

Figure 2. TET2 alterations and expression in prostate cancer. Reduced TET2 expression in subsets of (a) metastatic tumours; (b) high (⩾7) Gleason score tumours; (c) primary and metastatic tumours; two-tailed Wilcoxon rank sum test; and (d) tumours from patients with reduced DFS (P = 6.4 ×10À6; log rank test). (e) TET2a is the most highly expressed transcript in normal prostate tissue (n = 11, two-tailed paired T-test) as shown by quantitative PCR performed in triplicate. (f) TET2a containing exons 1-3 (E1/E2/E3) and TET2a-delex2 containing exons 1 and 3 (E1/E3) are expressed in all prostate samples as shown by RT-PCR. (g) TET2a and TET2a-delex2 are expressed in RNA from a PCa patient with a somatic TET2 mutation. (h) TET2 protein in cell lines as shown by WB using TET2 antibody, MAb-179-050 (Diagenode, Denville, NJ, USA); PCa unless indicated: A, VCaP; B, 22RV1; C, HeLa (cervix); D, LNCaP; E, PC3; F, DU145; G, MCF7 (breast); H, HEK293T (kidney). Note the additional band in the DU145 lysate, a cell line with a TET2 p.T229fs* mutation. Left, molecular weight (MW) in kiloDaltons (kD). Error bars, mean ± s.d.

Oncogene (2016), 1 – 12 © 2016 Macmillan Publishers Limited, part of Springer Nature. TET2 defects in prostate cancer ML Nickerson et al 5 were depleted in tumours as compared to the NAT confirm a TET2–AR interaction (data not shown), suggesting it may (Supplementary Figure S5). We observed TET2- and hmC- be specific to prostate cells. positive epithelial cells and TET2-negative, hmC-positive stromal SFPQ and NONO regulate AR-mediated gene expression by cells. The stromal cells exhibiting 5-hmC staining suggests TET1 recruiting the transcription regulator SIN3A. SIN3A was detected by or TET3 may be active. TET2 was observed in the cytoplasm, WB after IP with anti-AR antibodies (Figure 4c); however, we did not indicating likely cytoplasmic-to-nuclear shuttling similar to that detect a TET2–SIN3A interaction (data not shown). Treatment of cells previously observed for several TET2-AR nexus proteins with dihydrotestosterone (DHT) followed by IP with anti-AR antibodies, described below, including the AR, BAP1 and the E1A binding and WB with anti-TET2 or anti-SFPQ antibodies showed that protein p300 (EP300). interactions in the presence of DHT are slightly (SFPQ) or completely reduced (TET2) when DHT is removed (Figure 4d). Experiments were TET2 loss is associated with cancer progression independently replicated and not due to a DHT effect on protein in the lysates (data not shown). Thus, a DHT-sensitive, SIN3A-indepen- We identified two small interfering RNAs (siRNAs) (Figure 1a; dent, TET2–AR complex is observed in LNCaP cells. Supplementary Table S3) that reduced TET2 protein levels by 460% in both LNCaP and DU145 cells, comparable to the reduction observed in tumours. Treatment of LNCaP cells with TET2 loss alters expression of genes associated with PCa siRNA siTET2-1 reduced TET2 protein levels by 63% (37 ± 6 and A TET2–AR interaction suggests a potential role in regulating the 100 ± 27, respectively) after 24 h as compared with untreated cells expression of genes associated with PCa, possibly through hmC – (Figures 3a–c) [normalized mRNA expression was reduced by 41% formation.25 27 We examined the expression of 53 genes in LNCaP as compared with untreated LNCaP (18 ± 1 and 30 ± 1, respec- cells after TET2 KD by siTET2-1 using quantitative PCR to tively)]. Treatment with a non-targeting scrambled siRNA (scRNA) determine whether the expression of genes known to be did not significantly alter TET2 expression. responsive to androgen35 or genes encoding AR pathway proteins In vitro, TET2 knockdown (KD) after siTET2-1 treatment increased (AR signalling array, Bio-Rad, Hercules, CA, USA) are altered, either LNCaP cell proliferation by 200% after 24 h as compared with of which could alter androgen signalling. The expression of 24 untreated cells (1 × 106 cells versus 5 × 105 cells, respectively) genes were excluded due to significant differences in expression (Figure 3d). scRNA treatment did not alter proliferation (P = 0.36). between untreated and scRNA-treated cells (two-tailed T-test Similarly, TET2 KD increased the proliferation of androgen- Po0.05), leaving 29 assays in the final analysis. Of these, 12 genes independent DU145 cells by 193% (Supplementary Figure S6). had a significant expression change (P-value o0.05 and/or |fold TET2 KD in LNCaP cells revealed rapid wound healing as compared change| of at least 1.1) (Supplementary Table S8). Comparing gene with untreated cells after 48 h (49.5% and 23.5% closure, expression between scRNA and siTET2-1 treated cells, TET2 respectively) (Figures 3e and f). After TET2 KD, we observed expression was the most significantly reduced, by 1.7 fold LNCaP cells migrating into the wound area, and this migration was (P = 1.9 × 10-7). The expression of six genes was increased after independently confirmed by multiple experiments. TET2 KD TET2 KD, including KLK3/PSA,36 hydroxyprostaglandin dehydro- increased LNCaP cell transwell invasion through matrigel in genase HPGD and a centromeric nucleosome-associated protein Boyden chambers by 236% as compared to untreated cells CENPN. The expression of five additional genes was decreased, (123 ± 30 and 52 ± 19 cells, respectively) (Figures 3g and h). Colony including an extracellular signal-regulated kinase MAP2K1, the formation in soft agar did not differ between comparison groups glycogen synthase kinase GSK3B and the GSK3B-complex protein (P = 0.22; Supplementary Figure S6). Thus, reduced TET2 mRNA beta-catenin (CTNNB1). and protein increase in vitro prostate cell proliferation, wound We confirmed the effect of TET2 KD using a second independent healing and invasion; characteristics favouring cancer progression siRNA (siTET2-4) recently described by Takayama et al37 (Figure 1a; and metastasis. Supplementary Table S3). We performed three independent treat- ments of LNCaP cells with siTET2-4 or a GC-matched scRNA control in TET2 binding proteins in HEK293T cells theabsenceandpresenceofDHT.AnalysisofquantitativeWBs reveal a 52% reduction of TET2 protein compared to scRNA treated We purified TET2 binding proteins from human embryonic kidney cells, similar to the KD achieved using siTET2-1 (Figure 5a). 293T (HEK293T) cells using exogenous 3x FLAG-tagged TET2 Unfortunately, a key transfection reagent (siGene, Promega, Japan) (FLAG-TET2) and affinity purification and mass spectrometry was not available to obtain a more effective KD similar to that (Supplementary Tables S6 and S7). We identified the acetylgluco- achieved by Takayama et al.37 Comparing scRNA-treated cells samine transferase OGT, which catalyzes the transfer of acet- without DHT to scRNA-treated cells with DHT showed DHT treatment ylglucosamine to histones.28,29 Putative TET2 interactors were decreased TET2 protein by 33%, confirming previous observations.37 enriched in proteins with RNA and chromatin binding functions. PSA protein expression was significantly increased (Po0.05; Several AR binding proteins were detected, including PSPC1,30 Figure 5b), confirming the gene expression results (Supplementary filamin A31 and KDM6A.10,32,33 Additionally, AR-coactivator pro- Table S8) are correlated with increased protein using two distinct teins, the octamer-binding NONO and the splicing factor SFPQ siRNAs targeting TET2. DHT treatment further increased PSA as were enriched in TET2 affinity purifications as compared to the expected independent of TET2 status. controls (Supplementary Figure S7). PSPC1, NONO and SFPQ bind The expression changes after TET2 KD indicate TET2 may the AR to regulate transcription;34 however, AR peptides were not regulate the expression of a subset of androgen-responsive observed. Using forward and reverse immunoprecipitation (IP), we genes.35 We investigated whether there were TET2 binding sites confirmed TET2 interactions with PSPC1, OGT and NONO in and hmC proximal to genes with expression changes in HEK293T cells. Supplementary Table S8 using recently published chromatin IP-sequencing data from LNCaP cells.37 TET2 binding sites were TET2-AR binding in prostate cells identified near each gene examined that were accompanied in a We confirmed the interactions between endogenous TET2 and more regional genomic context by hmC and methylcytosine (mC) OGT, PSPC1, NONO and SFPQ in LNCaP cells using IP with the in LNCaP cells. AR binding sites were observed near these genes in appropriate antibodies (Figure 4a). Reciprocal IP of endogenous sequencing data from DHT-treated prostate cell line, BicR TET2 with anti-TET2 antibody confirmed the interactions (Supplementary Figure S8, Supplementary Table S9). Thus, TET2 (Figure 4b). Anti-AR antibody precipitated TET2, NONO and OGT KD increases the expression of PSA, an androgen-AR responsive in LNCaP cells (Figure 4c). Additional IPs in HEK293T cells failed to biomarker, in the same direction as DHT treatment, indicating

Figure 3. TET2 loss is associated with a cancer phenotype. (a) Reduced TET2a at 24 h after siTET2-1 treatment across six biological replicates; P-value, one-tailed T-test. (b) Reduced TET2 (α-TET2) at 24 h by WB. (c) Quantitated WBs in triplicate at 24 h. Controls not shown. (d) TET2 KD (siTET2) increases in vitro LNCaP cell proliferation at 24 h (black) from time 0 (grey); P-value, two-tailed T-test. (e and f) wound healing at 24 and 48 h; P-value, two-tailed T-test. (g and h) transwell invasion; P-value, two-tailed T-test. Gross cell morphology appears unchanged after the invasion assay. Untd, untreated; scRNA treatment; siTET2, siTET2-1 treatment; size bar, 100 μm; error bars, mean ± s.d. All experiments were performed in triplicate using 40 nM siTET2-1. TET2 antibody: MAb-179-050, Diagenode, Denville, NJ, USA.

TET2 has a role in regulating the expression of at least a subset of interactions reveal a ‘nexus’ of interacting cancer gene products androgen-AR responsive genes (Figure 5c). (cancer proteins) with diverse functions: epigenetic (left), basal transcription (middle) and ‘output’ to mRNA splicing and the cell cycle (right) (Figure 6, Table 2 and Supplementary Table S10). The TET2–AR interact with cancer proteins nexus includes the oncogenic proteins AR and cyclin D1, and TET2 and AR are encoded by frequently altered cancer genes multiple tumour suppressors associated with DNA and RNA (Supplementary Figure S9) and published protein–protein transcription (Figure 6b). Cancer proteins in multiple signalling

Figure 4. Endogenous TET2 interactors in LNCaP cells. (a) Top, IP with α-OGT or α-PSPC1, but not α-FLAG, precipitates endogenous TET2 (α-TET2). Bottom, IP with α-NONO or α-SFPQ, not α-Rab, precipitates endogenous TET2. (b) IP with α-TET2, not anti-mouse IgG (α-Mab), precipitates endogenous OGT (α-OGT), PSPC1 (α-PSPC1), NONO (α-NONO) and SFPQ (α-SFPQ). (c) IP with α-AR, not α-Rab, precipitates endogenous NONO, SIN3A (α-SIN3A), TET2 and OGT. (d) DHT (+DHT) and IP with α-AR, not α-Rab, precipitates endogenous TET2 and SFPQ. Experiment 1 (top), row 1 and 2, short exposure; experiment 2, row 3, short exposure; row 4, long exposure. Left, molecular weight in kD. Lysate, total protein. pathways converge on the nexus, including androgen signalling the co-expression network comprised of TET2-AR nexus compo- (AR,10,38,39 KDM6A,10,32,33 TET2), DNA repair (BAP110,40,41), insulin nents and genes encoding 2-OG/succinate metabolizing enzymes signalling (OGT) and oxygen sensing (Figure 6c). The distribution that is observed in PCa is observed in all 31 TCGA cancers of somatic alterations in a recent PCa study10 indicates the nexus (Supplementary Figure S10c) indicating a conserved and is targeted by largely mutually distinct alterations across nexus frequently dis-regulated network across cancers. genes in a majority (72%) of tumours, most frequently by altered AR and nuclear receptor coactivator 2 (NCOA2) (Supplementary Figure S9e). Core nexus proteins physically interact with additional DISCUSSION cancer proteins as identified by the COSMIC Cancer Gene Census This study implicates TET2 as a tumour suppressor in PCa that is altered (Figure 6d). by multiple mechanisms: germline non-coding risk SNPs and rare We examined tumour gene co-expression networks based on missense substitutions;11 somatic sequence changes and copy number RNA-sequencing from tumours for TCGA PCa tumours and 30 variation (primarily loss); and reduced mRNA expression in tumours. additional cancers to identify transcriptional modules correlated The genetic complexity of TET2 alterations in PCa requires that multiple with TET2. Similar analyses have identified the transcriptional approaches be applied to understand causality to disease, which we responses of cells to changing conditions and identified have done using fine mapping of PCa risk, identification of binding co-regulated interacting proteins to provide mechanistic insight proteins (AR), experimental TET2 KD combined with cell-based and underlying complex cellular processes.42,43 expression assays (PSA), and computational mining of protein The analysis confirmed the inversely correlated expression in interactions and tumour gene expression datasets. PCa tumours between TET2 and KLK3 (as observed above), Fine mapping revealed six SNPs in introns 1 and 2 that are CTNNB1, GSK3B and the cyclic-AMP dependent kinase PRKACB,as significantly associated with PCa in the PEGASUS cohort, supporting we observed in LNCaP cells after TET2 KD (Figure 6e, TET2 asthecausalgeneassociatedwiththepromoterriskSNP Supplementary Figure S10a). We did not observe co-expression rs7679673.12 Somatic alterations in 6% of primary and 20% of between TET2 and the majority of androgen-AR genes by the metastatic tumours, reduced mRNA expression in a subset of analysis similar to our experimental results after TET2 KD in LNCaP tumours, and experimental evidence that TET2 KD increases LNCaP cells, suggesting a likely distinct rather than general function for cell proliferation and invasion indicate TET2 is a tumour suppressor TET2 in androgen-AR signalling. in PCa. TET2 may have been overlooked as a PCa gene until this The primary role of TET2 is to catalyze hmC formation from mC study because diverse mechanisms alter TET2 during disease in DNA. TET2 binds 2-OG, O2, Fe2+ and zinc as cofactors and progression and somatic copy number variation appears to be produces succinate, potentially indicating a role for TET2 as an more frequent in less-studied metastatic PCa disease. oxygen and redox-sensitive energy (metabolite) sensor.44,45 We TET2 catalyzes hmC formation45 and future studies will examine examined the co-expression of genes encoding TET2-AR nexus global gene expression and the role of hmC in androgen-AR proteins and proteins associated with 2-OG and succinate signalling. DNA hmC is catalyzed at developmentally associated metabolism (citric acid cycle enzymes46) and observed a robust enhancers48 that may mediate gene expression by a recently signal (Figure 6f, Supplementary Figure S10b). The expression of described genomic looping mechanism49 linked to the synthesis of genes encoding enzymes producing 2-OG (IDH1 and IDH247) are hmC-modified RNA.50 TET2 alteration or loss in cancer may disrupt inversely correlated with the expression of genes encoding 2-OG these genomic arrangements to dysregulate gene expression. consuming enzymes (TET1-3 and KDM6A). This transcriptional A role for TET2 in androgen-AR signalling is supported by the module is likely designed to tightly regulate and maintain 2-OG/ identification of TET2 interaction with the AR and AR-transcriptional succinate levels. co-activators PSPC1, NONO and SFPQ by affinity chromatography– Genes co-expressed with TET2 encode additional TET-family mass spectrometry and IP. Increased KLK3/PSA mRNA and protein enzymes TET1 and TET3, a large number of KDMs, and the oxygen expression in LNCaP cells after treatment with two different 46 (O2) sensing components von Hippel-Lindau (VHL), HIF1, ARNT siRNAs targeting TET2, and anti-correlated expression in TCGA PCa and EGLN1 (Supplementary Figure S11). The O2 sensing compo- tumours by RNA next-generation sequencing, confirms a role for nents of the co-expression network likely reflect the regulation of TET2 in regulating PSA expression. Down-regulation of TET2 by 37 oxygen levels by TET-enzymes (O2 consuming dioxygenases) and DHT is in agreement with recent observations and indicates hypoxia-responsive proteins such as HIF1 and ARNT. Significantly, complex feedback mechanisms. The combination of an enzyme

Figure 5. PSA increases in response to TET2 KD and DHT treatment. (a) LNCaP cells were treated with 40 nM siTET2-4 directed against TET2 (Si) or low GC content scRNA (Scr) as a control. DHT (or ETOH vehicle) was added to 10 nM ﬁnal concentration 48 h post siRNA transfection; 24 h post-hormone treatment, cells were lysed and processed for WB analysis. A representative of three WBs is shown, which were analysed by densitometry with ImageJ software. (b) Loss of TET2 or treatment with DHT increases PSA protein levels. TUBB, b-tubulin; DHT, dihydrotestosterone; *P = 5×10À3, two-tailed T-test; error bars, mean ± s.d. (c) A hypothetical model of TET2-AR signalling: (1) Germline PCa risk SNPs inﬂuence TET2 expression. (2) TET2 binds the AR. (3) A TET2-AR complex may mediate gene expression changes potentially via DNA 5-hmC (lollipop). (4) TET2 loss depletes TET2. (5) Altered transcription facilitates PCa progression. T, testosterone.

activity dependent on 2-OG and co-expression with 2-OG We defined a nexus of interacting cancer proteins with functions associated gene products indicates TET2 is an energy sensor in relevant to cancer, enriched in proteins encoded by X-chromosome a position to integrate 2-OG levels with androgen signals. We loci and single copy in males, that indicates additional epigenetic propose a quite reasonable hypothesis that TET2 modifies modifications are likely involved in androgen-AR signalling. androgen-AR signalling by the synthesis of hmC that influences Epigenetic modifications with varying half-lives would provide a gene expression based on the metabolic state (2-OG, succinate, mechanism to encode upstream pathway signals for short- and oxygen, iron and zinc) of the cell. Experiments are planned to long-term regulation of cellular processes (gene expression). The examine the underlying mechanism(s). nexus is enriched in enzymes that alter histones, DNA and RNA, A 2-OG co-expression module highly enriched in cancer proteins indicating the histone code51,52 should be expanded to indicates the transcriptional network is frequently targeted for dis- incorporate TET enzyme-catalyzed nucleic acid modifications. regulation by both germline (BAP1, fumarate hydratase (FH), TET2 KD increases the proliferation of androgen-dependent neurofibromin 1 (NF1), succinate dehydrogenases (SDHA, SDHB), and LNCaP and androgen-independent DU145 cells, supporting that VHL)46 and somatic mutations (AR, IDH2,47 KDM6A and, TET2). The TET2 functions downstream in the androgen-dependency pathway. mutations that converge on the TET2-AR nexus and TET2 co- Thus, therapy targeting TET2 loss may be effective in PCa with expression network indicate tumours that share a common defect upstream AR alterations. Reduced TET2 expression is more prevalent associated with 2-OG/succinate metabolism. in tumours that have progressed to metastatic disease and have a

Figure 6. TET2-AR is associated with proteins encoded by frequently altered cancer genes. (a) Protein functions. (b) Associated disease functions. (c) Associated signalling pathways. (d) Interacting cancer proteins from the Cancer Gene Census (COSMIC; August 2015). Black line, interactions, this study; blue, oncogene; orange, tumour suppressor; grey, uncertain; white, not frequently altered in cancer. Co-expressed androgen-AR genes (e) and 2-OG/succinate-associated genes (f) whose expression is anti-correlated (red dots) or correlated (blue dots) with TET2 by Pearson correlation in TCGA PAD tumours based on RNA-sequencing available through the cBioPortal (Broad Institute, Cambridge, MA). A gene–gene expression correlation is indicated by a circle if the Pearson correlation P-valueo0.01; the coloured scoring index is included in Supplementary Figure S10; the gene order is based on a hierarchical clustering method. higher Gleason score, and is associated with signiﬁcantly reduced miR-29b increased TET2 expression and reduced tumour growth in DFS in PCa similar to MPDs.25–27,53 These results complement those an animal model of PCa. Thus, reduced TET2 expression in prostate of Takayama et al.37 who found that high expression of miR-29b tumours may be an informative biomarker to identify patients likely targets TET2 and predicts poor outcome. Decreased expression of to progress to metastatic disease.

© 2016 Macmillan Publishers Limited, part of Springer Nature. Oncogene (2016), 1 – 12 10 noee(06,1 (2016), Oncogene – 2©21 amla ulsesLmtd ato pigrNature. Springer of part Limited, Publishers Macmillan 2016 © 12 Table 2. Characteristics of a TET2-AR cancer protein nexus

Gene Locusa Germlineb Somaticc Epigenetics Signalling pathway Notes

AR Xq12 Androgen insensitivity, Prostate, stomach, lung — Androgen signalling Single copy in males 300068 BAP1 3p21 Tumour Predisposition Melanoma, kidney, Deubiquitinates histone H2A K119ub Ubiquitin signalling, BRCA DNA repair Frequently deleted in TET2 Syndrome, 614327 mesothelioma, bladder and HCFC1 (chr. Xq28) ccRCC, cytoplasm to nucleus shuttle eet npott cancer prostate in defects CCND1/Cyclin D1 11q13 VHLS, kidney and colon Oesophagus, breast, — Integrates DNA damage, hormone, growth Cytoplasm to nucleus cancer; multiple head and neck, bladder, factor, and differentiation signals to regulate shuttle

myeloma risk; 168461 lung the cell cycle G1/S transition with CDK4 and Rb Nickerson ML CREBBP/CBP 16p13 Rubinstein-Taybi Breast, bladder, lung, Acetylates histones, NCOA1, and Oxygen sensing with HIF1A, cAMP-dependent Cytoplasm to nucleus Syndrome, 180849 colon, stomach, uterus FOXO1; bromodomain binds acetylated transcription, others shuttle; acetyl-CoA, zinc histone lysine binding EP300 22q13 Rubinstein-Taybi Bladder, colorectal, Acetylates histone H3 K122 and K27, Oxygen sensing with HIF1A, cAMP-dependent Cytoplasm to nucleus Syndrome, 613684 cervical, melanoma, ALX1 K131, SIRT2, and HDAC1; bromo- transcription, others shuttle; acetyl-CoA, zinc lung domain binds acetylated histone lysine binding al et KAT2B/PCAF 3p24 — Breast, kidney, bladder, Acetylates histone H3 and H4, and Oxygen sensing with HIF1A, cAMP-dependent Deleted in 490% ccRCC; lung, stomach, PTEN; bromodomain binds acetylated transcription, others acetyl-CoA, zinc binding melanoma histone lysine KDM6A Xp11 Kabuki Syndrome, Bladder, kidney, Demethylates histone H3 K27me3/2; Androgen signalling Single copy in males; iron, 300867 esophogus, lung, correlated with H3 K4me and H2Aub zinc, ascorbate binding myeloid leukemia NONO Xq13 Papillary kidney cancer, Breast, prostate, lung, — Androgen signalling, cAMP-dependent Single copy in males; fusion 300854 uterus, kidney transcription, nuclear paraspeckles gene with enhancer- binding TF, TFE3 (chr. Xp11) OGT Xq13 — Prostate, uterus, Glycosylates histone H2B S112 and H4, Insulin signalling, glycolysis, hexosamine Cytoplasm to nucleus melanoma AKT1, and EZH2; correlated with DNA biosynthesis shuttle, single copy in hmC and histone H3 K27me3 males, cytotoxic mitochondrial isoform TET2 4q24 Prostate cancer risk MPD, melanoma, colon, DNA 5-mC to hmC, fC, and caC; 2- Androgen signalling O2, iron, zinc binding gene kidney, prostate oxoglutarate to succinate; correlated with H2B GlcNAc Abbreviations: caC, carboxylcytosine; ccRCC, clear cell kidney cancer; chr, chromosome; fC, formylcytosine; GlcNAc, glycosylation; hmC, hydroxymethylcytosine; mC, methylcytosine; me, methylation; me2/3, di- and tri-methylation; MPD, myelo-proliferative disorders; ub, ubiquitin; VHLS, von Hippel-Lindau Syndrome; —, no data or unknown. aChromosome location. bAlterations associated with disease, OMIM #. cSelected tissues from COSMIC and the cBioPortal. TET2 defects in prostate cancer ML Nickerson et al 11 MATERIALS AND METHODS The authors have no conflicts to disclose. Financial Support: This work is supported in Genotyping part by the Intramural Research Program of the National Institutes of Health, the National Cancer Institute and by Leidos Biomedical Research, Inc., under contract Genotyping utilized the 2.5 M Bead Array (Illumina, San Diego, CA, USA). # HHSN261200800001E. SNP genotyping in cell lines utilized primers as shown in Supplementary Table S3, standard PCR conditions, Big Dye sequencing reagents and a 3730 Genetic Analyzer (Life Technologies, Carlsbad, CA, USA). REFERENCES 1 Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. Cell culture and transfection CA Cancer J Clin 2011; 61:69–90. LNCaP cells were cultured in RPMI 1640 (Life Technologies) with 10% fetal 2 Delhommeau F, Dupont S, Della V, James C, Trannoy S, Masse A et al. Mutation in bovine serum. In experiments examining effects of DHT, charcoal stripped TET2 in myeloid cancers. N Engl J Med 2009; 360: 2289–2301. FBS (Life Technologies) was substituted. Cells (2 × 105) were seeded into 3 Saint-Martin C, Leroy G, Delhommeau F, Panelatti G, Dupont S, James C et al. six-well plates and grown to 70–80% confluency before treatment with Analysis of the ten-eleven translocation 2 (TET2) gene in familial myeloproliferative scRNA and siTET2-1 and transfection reagent (Santa Cruz Biotechnology, neoplasms. Blood 2009; 114: 1628–1632. Dallas, TX, USA). Lipofectamine 3000 (Life Technologies) was used for 4 Seshagiri S, Stawiski EW, Durinck S, Modrusan Z, Storm EE, Conboy CB et al. siTET2-4 transfections. Cell-based assays are in the Supplementary Recurrent R-spondin fusions in colon cancer. Nature 2012; 488: 660–664. Materials and Methods. HEK293T cells were cultured to ~ 60% confluency 5 Sato Y, Yoshizato T, Shiraishi Y, Maekawa S, Okuno Y, Kamura T et al. Integrated in Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum molecular analysis of clear-cell renal cell carcinoma. Nat Genet 2013; 45: (Clontech, Mountain View, CA, USA) and 100 μg/ml penicillin/streptomycin. 860–867. Cells were transfected with a construct expressing an N-terminal 3x-FLAG- 6 Brennan CW, Verhaak RG, McKenna A, Campos B, Noushmehr H, Salama SR et al. TET2 using Fugene HD (Roche, Indianapolis, IN, USA) and were grown for The somatic genomic landscape of glioblastoma. Cell 2013; 155:462–477. an additional 72 h in a 5% CO2/95% air-humidified incubator at 37 °C. 7 Setiawan VW, Schumacher F, Prescott J, Haessler J, Malinowski J, Wentzensen N et al. Cross-cancer pleiotropic analysis of endometrial cancer. Carcinogenesis 2014; 35 – fi fi : 2068 2073. Af nity puri cation 8 Song F, Amos CI, Lee JE, Lian CG, Fang S, Liu H et al. Identification of a melanoma 3x-FLAG-TET2 was purified using a mouse anti-FLAG M2 monoclonal susceptibility locus and somatic mutation in TET2. Carcinogenesis 2014; 35: antibody covalently bound to agarose beads (Sigma-Aldrich, St Louis, 2097–2101. MO, USA). The eluate was analysed by nanoflow reverse-phase liquid 9 Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS et al. chromatography-tandem mass spectrometry. Additional details are Integrative genomic profiling of human prostate cancer. Cancer Cell 2010; 18: included in the Supplementary Materials and Methods. 11–22. 10 Grasso CS, Wu YM, Robinson DR, Cao X, Dhanasekaran SM, Khan AP et al. The Gene expression mutational landscape of lethal castration-resistant prostate cancer. Nature 2012; 487:239–243. TET2a and TET2a-delex2 expression were measured using FAM-labelled 11 Nickerson ML, Im KM, Misner KJ, Tan W, Lou H, Gold B et al. Somatic alterations Hs00969056 and Hs01061044, respectively (Life Technologies). TET2b fi contributing to metastasis of a castration-resistant prostate cancer. Hum Mutat expression measurements utilized TET2b-speci c exon 3 primers and a 2013; 34:1231–1241. FAM-labelled probe (Supplementary Table S3). Expression was normalized 12 Eeles RA, Kote-Jarai Z, Al Olama AA, Giles GG, Guy M, Severi G et al. Identification to HPRT1 (Hs02800695, Life Technologies) using the delta CT method to of seven new prostate cancer susceptibility loci through a genome-wide determine relative gene expression based on a human universal control of association study. Nat Genet 2009; 41: 1116–1121. 100% (Clontech). cDNA from TET2 KD cells was prepared using a Cells-to-Ct 13 Pomerantz MM, Werner L, Xie W, Regan MM, Lee GS, Sun T et al. Association of kit (Ambion/Life Technologies, Foster City, CA, USA). Assays for individual prostate cancer risk loci with disease aggressiveness and prostate cancer-specific genes (Applied Biosystems, Waltham, MA, USA) and the AR array mortality. Cancer Prev Res 2011; 4:719–728. (#10047227, Bio-Rad) were purchased. Expression was normalized by 14 Tonin P, Weber B, Offit K, Couch F, Rebbeck TR, Neuhausen S et al. Frequency of β -actin (Applied Biosystems) or the geometric mean of HPRT1 and GAPDH recurrent BRCA1 and BRCA2 mutations in Ashkenazi Jewish breast cancer families. (AR array). See the Supplementary Materials and Methods for details about Nat Med 1996; 2: 1179–1183. the co-expression analyses. 15 Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW et al. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in Clinical impact of TET2 loss prostate cancer. Science 2005; 310:644–648. 16 Varela I, Tarpey P, Raine K, Huang D, Ong C-K, Stephens P et al. Exome sequencing Samples included 29 NAT, 131 primary tumours and 19 metastatic identifies frequent mutation of the SWI/SNF complex gene PBRM1 in renal tumours.9 Stage and grade were available for 14 and 18 metastatic carcinoma. Nature 2011; 469: 539–542. tumours, respectively. 17 Pena-Llopis S, Christie A, Xie XJ, Brugarolas J. Cooperation and antagonism among cancer genes. Cancer Res 2013; 73: 4173–4179. Statistical analysis 18 Liu W, Laitinen S, Khan S, Vihinen M, Kowalski J, Yu G et al. Copy number analysis TET2 expression differences between clinical groups was assessed using a indicates monoclonal origin of lethal metastatic prostate cancer. Nat Med 2009; two-tailed Wilcoxon rank sum test, TET2 isoform and gene panel 15:559–565. expression by a two-tailed T-test, and DFS by a log-rank test, all using 19 Segil N, Roberts SB, Heintz N. Mitotic phosphorylation of the Oct-1 homeodomain R (www.R-project.org). and regulation of Oct-1 DNA binding activity. Science 1991; 254:1814–1816. 20 Obinata D, Takayama K, Urano T, Murata T, Kumagai J, Fujimura T et al. Oct1 regulates cell growth of LNCaP cells and is a prognostic factor for prostate cancer. CONFLICT OF INTEREST Int J Cancer 2012; 130: 1021–1028. 21 Barbieri CE, Baca SC, Lawrence MS, Demichelis F, Blattner M, Theurillat JP et al. fl The authors declare no con ict of interest. Exome sequencing identifies recurrent SPOP, FOXA1 and MED12 mutations in prostate cancer. Nat Genet 2012; 44: 685–689. ACKNOWLEDGEMENTS 22 Baca SC, Prandi D, Lawrence MS, Mosquera JM, Romanel A, Drier Y et al. Punctuated evolution of prostate cancer genomes. Cell 2013; 153: 666–677. We thank Drs Berton Zbar, Steve Bova and Tammy Naab for comments; and Lisa 23 Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO et al. Integrative Garland, Mary Thompson and Allen Kane for technical assistance. This work is analysis of complex cancer genomics and clinical profiles using the cBioPortal. supported in part by the Intramural Research Program of the National Institutes of Sci Signal 2013; 6: pl1. Health, the National Cancer Institute, and by Leidos Biomedical Research, Inc., under 24 Beroukhim R, Mermel CH, Porter D, Wei G, Raychaudhuri S, Donovan J et al. The contract # HHSN261200800001E. The content of this publication does not necessarily landscape of somatic copy-number alteration across human cancers. Nature 2010; reflect the views or policies of the Department of Health and Human Services, nor 463:899–905. does mention of trade names, commercial products or organizations imply 25 Scopim-Ribeiro R, Machado-Neto JA, de Melo Campos P, Silva CA, Favaro P, endorsement by the US government. The funders had no role in study design, Lorand-Metze I et al. Ten-Eleven-Translocation 2 (TET2) is downregulated in data collection and analysis, decision to publish, or preparation of the manuscript. myelodysplastic syndromes. Eur J Haematol 2014; 94:413–418.

© 2016 Macmillan Publishers Limited, part of Springer Nature. Oncogene (2016), 1 – 12 TET2 defects in prostate cancer ML Nickerson et al 12 26 Yang H, Liu Y, Bai F, Zhang JY, Ma SH, Liu J et al. Tumor development is associated 39 Cancer Genome Atlas Research Network, The Molecular Taxonomy of Primary with decrease of TET gene expression and 5-methylcytosine hydroxylation. Prostate Cancer. Cell 2015; 163: 1011–1025. Oncogene 2013; 32: 663–669. 40 Pena-Llopis S, Vega-Rubin-de-Celis S, Liao A, Leng N, Pavia-Jimenez A, Wang S 27 Ko M, Huang Y, Jankowska AM, Pape UJ, Tahiliani M, Bandukwala HS et al. et al. BAP1 loss defines a new class of renal cell carcinoma. Nat Genet 2012; 44: Impaired hydroxylation of 5-methylcytosine in myeloid cancers with mutant. 751–759. TET2. Nature 2010; 468: 839–843. 41 Nickerson ML, Dancik GM, Im KM, Edwards MG, Turan S, Brown J et al. Concurrent 28 Chen Q, Chen Y, Bian C, Fujiki R, Yu X. TET2 promotes histone O-GlcNAcylation alterations in TERT, KDM6A, and the BRCA pathway in bladder cancer. Clin Cancer during gene transcription. Nature 2013; 493:561–564. Res 2014; 20: 4935–4948. 29 Lynch TP, Ferrer CM, Jackson SR, Shahriari KS, Vosseller K, Reginato MJ. Critical 42 Zhang B, Horvath S. A general framework for weighted gene co-expression net- role of O-linked beta-N-acetylglucosamine transferase in prostate cancer invasion, work analysis. Stat Appl Genet Mol Biol 2005; 4: Article 17 [epub 12 August 2005]. angiogenesis, and metastasis. J Biol Chem 2012; 287: 11070–11081. 43 Sharan R, Ulitsky I, Shamir R. Network-based prediction of protein function. 30 Passon DM, Lee M, Rackham O, Stanley WA, Sadowska A, Filipovska A et al. Mol Syst Biol 2007; 3:88. Structure of the heterodimer of human NONO and paraspeckle protein compo- 44 Hu L, Li Z, Cheng J, Rao Q, Gong W, Liu M et al. Crystal structure of TET2- nent 1 and analysis of its role in subnuclear body formation. Proc Natl Acad Sci DNA complex: insight into TET-mediated 5mC oxidation. Cell 2013; 155: USA 2012; 109: 4846–4850. 1545–1555. 31 Loy CJ, Sim KS, Yong EL. Filamin-A fragment localizes to the nucleus to regulate 45 Hu L, Lu J, Cheng J, Rao Q, Li Z, Hou H et al. Structural insight into substrate androgen receptor and coactivator functions. Proc Natl Acad Sci USA 2003; 100: preference for TET-mediated oxidation. Nature 2015; 527:118–122. 4562–4567. 46 Linehan MW, Srinivasan R, Schmidt LS. The genetic basis of kidney cancer: 32 van Haaften G, Dalgliesh GL, Davies H, Chen L, Bignell G, Greenman C et al. a metabolic disease. Nat Rev Urol 2010; 7:277–285. Somatic mutations of the histone H3K27 demethylase gene UTX in human cancer. 47 Figueroa ME, Abdel-Wahab O, Lu C, Ward PS, Patel J, Shih A et al. Leukemic Nat Genet 2009; 41: 521–523. IDH1 and IDH2 mutations result in a hypermethylation phenotype, disrupt 33 Guo G, Sun X, Chen C, Wu S, Huang P, Li Z et al. Whole-genome and whole-exome TET2 function, and impair hematopoietic differentiation. Cancer Cell 2010; 18: sequencing of bladder cancer identifies frequent alterations in genes involved in 553–567. sister chromatid cohesion and segregation. Nat Genet 2013; 45: 1459–1463. 48 Sérandour AA, Avner S, Oger F, Bizot M, Percevault F, Lucchetti-Miganeh C et al. 34 Dong X, Sweet J, Challis JR, Brown T, Lye SJ. Transcriptional activity of androgen Dynamic hydroxymethylation of deoxyribonucleic acid marks differentiation- receptor is modulated by two RNA splicing factors, PSF and p54nrb. Mol Cell Biol associated enhancers. Nucleic Acids Res 2012; 40:8255–8265. 2007; 27: 4863–4875. 49 Hsieh CL, Fei T, Chen Y, Li T, Gao Y, Wang X et al. Enhancer RNAs participate in 35 Norris JD, Chang CY, Wittmann BM, Kunder RS, Cui H, Fan D et al. The home- androgen receptor-driven looping that selectively enhances gene activation. odomain protein HOXB13 regulates the cellular response to androgens. Mol Cell Proc Natl Acad Sci USA 2014; 111:7319–7324. 2009; 36: 405–416. 50 Fu L, Guerrero CR, Zhong N, Amato NJ, Liu Y, Liu S et al. Tet-mediated formation of 36 Lilja H, Ulmert D, Vickers AJ. Prostate-specific antigen and prostate cancer: 5-hydroxymethylcytosine in RNA. J Am Chem Soc 2014; 136: 11582–11585. prediction, detection and monitoring. Nat Rev Cancer 2008; 8: 268–278. 51 Strahl B, Allis C. The language of covalent histone modifications. Nature 2000; 403: 37 Takayama K, Misawa A, Suzuki T, Takagi K, Hayashizaki Y, Fujimura T et al. TET2 41–45. repression by androgen hormone regulates global hydroxymethylation status 52 Jenuwein T, Allis C. Translating the histone code. Science 2001; 293: 1074–1080. and prostate cancer progression. Nat Commun 2015; 6: 8219. 53 Metzeler KH, Maharry K, Radmacher MD, Mrózek K, Margeson D, Becker H et al. 38 Robinson D, Van Allen EM, Wu YM, Schultz N, Lonigro RJ, Mosquera JM et al. TET2 mutations improve the new European LeukemiaNet risk classification of Integrative clinical genomics of advanced prostate cancer. Cell 2015; 161: acute myeloid leukemia: a Cancer and Leukemia Group B study. J Clin Oncol 2011; 1215–1228. 29: 1373–1381.

Supplementary Information accompanies this paper on the Oncogene website (http://www.nature.com/onc)

ML Nickerson1,14, S Das2, KM Im3, S Turan1, SI Berndt4, H Li1,5, H Lou1,5, SA Brodie4,6, JN Billaud7, T Zhang8, AJ Bouk4,6, D Butcher9, Z Wang4, L Sun10, K Misner1, W Tan1,5, A Esnakula11, D Esposito12, WY Huang4, RN Hoover4, MA Tucker4, JR Keller10, J Boland4,6, K Brown8, SK Anderson1, LE Moore4, WB Isaacs13, SJ Chanock4, M Yeager4,6, M Dean1,14 and T Andresson2

1Cancer and Inflammation Program, National Cancer Institute, National Institutes of Health, Frederick, MD, USA 2Protein Characterization Laboratory, Cancer Research Technology Program, Leidos Biomedical Research, Inc., Frederick National Laboratory for Cancer Research, Frederick, MD, USA 3Data Science for Genomics, Ellicott City, MD, USA 4Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA 5Basic Research Program, Leidos Biomedical Research, Inc., Frederick National Laboratory for Cancer Research, Frederick, MD, USA 6Cancer Genomics Research Laboratory, Leidos Biomedical Research, Inc., Frederick National Laboratory for Cancer Research, Frederick, MD, USA 7Ingenuity Systems, Inc., Redwood City, CA, USA 8Laboratory of Translational Genomics, National Cancer Institute, Bethesda, MD, USA 9Pathology and Histotechnology Laboratory, Leidos Biomedical Research, Inc., Frederick National Laboratory for Cancer Research, Frederick, MD, USA 10Mouse Cancer Genetics Program, National Cancer Institute, National Institutes of Health, Frederick, MD, USA 11Department of Pathology, Howard University College of Medicine, Howard University Hospital, NW, Washington, DC, USA 12Protein Expression Laboratory, Leidos Biomedical Research, Inc., Frederick National Laboratory for Cancer Research, Frederick, MD, USA 13School of Medicine, Johns Hopkins University, Baltimore, MD, USA 14Current address: Laboratory of Translational Genomics, National Cancer Institute, Bethesda, MD, USA

Running Title: TET2 defects in prostate cancer

Keywords: cancer risk variant; androgen signaling; metabolic sensor; epigenetics; oxoglutarate

Financial Support: This work is supported in part by the Intramural Research Program of the National Institutes of Health, the National Cancer Institute and by Leidos Biomedical Research, Inc., under contract # HHSN261200800001E.

Correspondence: Michael L. Nickerson, Ph.D., Laboratory of Translational Genomics, National Cancer Institute, 8717 Grovemont Circle, Rm. 225C, Bethesda, MD 20892-4605. Phone: 301- 451-2724; Fax: 301-402-3134; E-mail: [email protected]

Conflict of Interest: The authors declare no conflict of interest. The contents of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. government. The funders had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript.

SUPPLEMENTARY INFORMATION

The Supplementary Information includes:

Supplementary Figures S1–S11

Supplementary Tables S1–S10

Supplementary Table S6 is provided as a separate Excel file

Supplementary Materials and Methods

Supplementary References

SUPPLEMENTARY FIGURES

Supplementary Figure S1. A screen for nuclear proteins that bind prostate cancer risk SNPs rs17508261 and rs7655890. Predicted transcription factor binding sites in TET2 intron 2 show rs17508261 (boxed) in a predicted Oct1 bind site using TFSEARCH. HG19 chromosome 4 positions are indicated (left).

Supplementary Figure S2. TET2 expression is slightly altered by the PCa risk SNP genotype.

Slightly reduced TET2 expression is observed in RNA from cell lines with the rs17508261-C

PCa risk allele that is not significantly different. Left, n = 2 cell lines; right, n = 9 cell lines.

Expression analyzed in triplicate; p-value, two-tailed Wilcoxon rank sum test; error bars, mean ±

SD.

Supplementary Figure S3. Pearson correlation analysis between TET2a and Oct1 mRNA expression in PCa cell lines and TCGA PCa tumors. (a) The expression of TET2a and Oct1 were examined in 12 PCa cell lines using qPCR in triplicate. The expression of TET2a was marginally but not significantly correlated with Oct1 expression (Pearson correlation r = 0.4600, p = 0.13).

The expression of other TET2 isoforms (TET2b and TET2a-delex2) were significantly correlated with Oct1 expression (data not shown; TET2b [r =0.7971, p = 0.0019]; TET2a-delex2 [r =

0.7465, p = 0.0053]). (b) The expression of TET2a and Oct1 were examined in TCGA PCa tumors using RNA NGS and show a significant correlation (Pearson correlation = 0.115732466, p = 9.74e-03). PCa cell lines examined were 22RV1, A17-D, CAHPV10, DU145, LNCaP,

NCIH660, PC3, PCa2b, PWY, PZHPV7, RWPE1 and VCaP.

Supplementary Figure S4. TET2 is altered in epithelial tumors. (a) The distribution of somatic alterations on the TET2 protein. Blue, deleterious; triangle, truncation or a splice junction alteration; dot, missense; square, synonymous; OGFE, oxoglutarate-iron binding; Cys, cysteine- rich; box 1 and 2, conserved in TET proteins. (b) Somatic alterations across cancers (cBioPortal for Cancer Genomics). *, PCa study/samples. (c) Focal TET2 loss in primary PCa tumors

(February 2015; www.broadinstitute.org/tcga). Each horizontal row represents a single tumor;

top, HG19 chr 4 coordinates.

Supplementary Figure S5. TET2 and 5- hydroxymethylcytosine (5-hmC) stained prostate tissue sections. Left side, each panel: hematoxylin and eosin (H&E)–stained section of tissue containing normal adjacent tissue (NAT; noncancer) and tumor (cancer) at low (4x) magnification. (a) Adenocarcinoma (right box; grade I-II, T2N0M0) from a 61-year-old male with NAT (left box). Arrows: 5-hmC staining in TET2-negative cells. (b) Tissue microarray

(TMA) core A6 containing an adenocarcinoma (lower left box; grade 2, stage IV, GS 3+3,

T3N0M1) and NAT (upper right box) from a 64-year-old male. (c) TMA core B5 containing mixed tissue from an adenocarcinoma (grade 3, stage IV, GS 5+4, T4N1M1) and NAT from an

80-year-old male. Right side, each panel: boxed regions (left side) shown at higher (20x)

magnification and stained as indicated. TET2 antibody: MAb-179-050, Diagenode, Denville, NJ,

USA; 5-hmC antibody: #39769, Active Motif, Carlsbad, CA, USA. GS, Gleason score.

Supplementary Figure S6. TET2 KD experiments in LNCaP and DU145 cells. (a) TET2 KD by siTET2-1 treatment (siTET2) increases the in vitro proliferation of androgen-independent

DU145 cells by 193% as compared with untreated (Untd) cells after 24h (5.8 ± 2 versus 3.0 ±

0.1x105 cells, respectively; p- value = 0.14, two-tailed student's T-test). (b) TET2 KD by siTET2-

1 slightly reduces LNCaP cell colony formation on soft agar (p = 0.22, one-tailed T-test), as

compared with Untd or scrambled (scRNA)-treated cells. Colonies were scanned and counted

after ~ 3 weeks. All results are the mean ± SD from four independent experiments. Treatment with scRNA did not have a significant effect on DU145 cell proliferation (data not shown).

Supplementary Figure S7. TET2 binding proteins in HEK293T kidney cells. (a) Peptide counts from affinity purification and MS (experiment 2) from mock transfected (control) and 3x FLAG-

TET2 transfected cells (FLAG-TET2). (b) Immunoprecipitation (IP) (top) from FLAG-TET2

(+), but not mock transfected cells (-) with anti-FLAG antibody (α-FLAG), precipitates (right)

endogenous PSPC1 (α-PSPC1) and FLAG-TET2 (α-FLAG). (c) IP from FLAG-TET2

transfected cells with anti-PSPC1 antibody (α-PSPC1) but not anti-rabbit IgG (α-Rab) precipitates (right) endogenous PSPC1 (α-PSPC1) and FLAG-TET2 (α-FLAG). (d) IP from

FLAG-TET2 transfected cells using anti-NONO antibody (α-NONO) but not α-Rab precipitates

(right) endogenous NONO (α-NONO) and FLAG-TET2 (α-FLAG) . (e) IP with α-FLAG from

FLAG-TET2 transfected cells but not mock transfections precipitates endogenous OGT (α-OGT) and FLAG-TET2 (α-FLAG). (f) IP (top) from FLAG-TET2 transfected cells (+) with anti-OGT

(α-OGT) but not α-Rab precipitates endogenous PSPC1 (α-PSPC1) and OGT (α-OGT). All experiments were performed in duplicate. Left, MW in kD.

Supplementary Figure S8. TET2 and AR binding sites and 5-methylcytosine (mC) and 5-

hydroxymethylcytosine (hmC) proximal to genes with altered expression after TET2 KD.

(a) TET2 binding sites (TET2) in LNCaP cells by chromatin immunoprecipitation-sequencing

(ChIP-seq)1 near genes with expression changes after TET2 KD. (b) Genes and TET2 binding

sites in a context of mC (mC) and hmC (hmC) DNA modifications in LNCaP cells, and AR

binding sites after dihydrotestosterone (DHT) treatment in BicR cells (AR). Box, gene of

interest. GEO datasets from 1Takayama et al., 2015; TET2, GSM1613322; mC, GSM1613323;

hmC, GSM1613324); AR, GSM1613312. Genes are displayed by the lowest p-value associated

with altered expression after TET2 KD. Signal scores were calculated using model-based analysis of ChIP-seq (MACS), with peak cutoffs for mC and hmC, p < 10e-5; and TET2 and AR

ChIP-seq: p < 1e-4.

Supplementary Figure S9. Somatic alterations in genes encoding TET2-AR nexus proteins. (a)

AR; (b) NONO; (c) KDM6A; (d) BAP1; (e) OncoPrint of gene alterations in one study1 shows

72% of PCa tumors harbor nexus alterations (cBioPortal for Cancer Genomics, Memorial Sloan

Kettering Cancer Center).2 Each column represents one tumor.

15 a

16 b

Supplementary Figure S10. A 2-OG co-expression network is associated with TET2. (a)

Marginal co-expression in TCGA PCa (PRAD) between TET2 and genes associated with androgen-AR signaling. (b) Strong co-expression in TCGA PCa of TET2 and genes encoding nexus proteins and proteins associated with 2-OG and succinate metabolism. A gene–gene expression correlation is indicated by a circle if the Pearson correlation p-value < 0.01; ride side, colored scoring index based on p-value; gene order, based on a hierarchical clustering method

(see Supplementary Materials and Methods). (c) A co-expression network that includes frequently altered cancer genes encoding TET2, nexus components, and proteins associated with

2-OG and succinate metabolism is observed across cancers.

Supplementary Figure S11. The mRNA expression of TET2a and genes encoding proteins

associated with 2-OG and succinate metabolism using TCGA PCa tumor RNA. The expression of genes co-expressed (left) or not co-expressed (right) with TET2 based on the analyses above

(Supplementary Figure S10) are shown in PCa tumors where TET2 expression (bottom) is

reduced (down) or elevated (up) as compared to the average expression in tumors (Z score ±

2.0). P-value, two-sided Wilcoxon rank sum test.

SUPPLEMENTARY TABLES

Supplementary Table S1. Novel TET2 PCa risk SNPs identified by genome-wide association studies in the PEGASUS cohort

Allele_ Score Locus Alleles MAF Geno_counts counts _x2 p Position SNP4- G|A 0.026|0.028 2787|145|3/4331|247|3 2935|4581 0.80 0.369893 106280574 106280574 rs7679673 C|A 0.412|0.372 1000|1332|503/1774|1969|649 2835|4392 23.02 1.60E-06 106280983 SNP4- A|C 0.152|0.167 2117|741|76/3202|1241|147 2934|4590 6.34 0.0118155 106288688 106288688 rs974801 T|C 0.381|0.383 1135|1366|437/1748|2155|675 2938|4578 0.07 0.7861761 106290513 rs2189234 C|A 0.361|0.373 1197|1335|387/1792|2086|643 2919|4521 1.69 0.1931412 106294947 rs2866773 A|G 0.085|0.095 2463|457|21/3760|798|38 2941|4596 4.79 0.0286066 106295955 SNP4- T|C 0.388|0.392 1098|1373|444/1676|2150|696 2915|4522 0.25 0.6147618 106301085 106301085 rs6825684 G|A 0.141|0.120 2164|726|51/3553|981|62 2941|4596 14.23 1.62E-04 106304092 rs9790517 C|T 0.228|0.215 1749|1032|154/2828|1546|213 2935|4587 3.68 0.0551132 106304227 SNP4- C|T 0.228|0.215 1751|1030|154/2832|1547|213 2935|4592 3.59 0.0581285 106304227 106304227 rs17035323 G|A 0.158|0.172 2092|757|86/3156|1281|150 2935|4587 5.50 0.0189954 106311427 SNP4- T|G 0.099|0.109 2360|529|24/3574|874|53 2913|4501 3.90 0.0482058 106314295 106314295 SNP4- G|A 0.056|0.060 2601|307|11/4039|516|18 2919|4573 0.88 0.347935 106316213 106316213 rs17508261 T|C 0.136|0.115 2184|692|51/3577|939|58 2927|4574 14.23 1.62E-04 106328351 SNP4- C|T 0.042|0.038 2695|237|4/4232|336|5 2936|4573 1.47 0.2254962 106331681 106331681 rs1015521 G|T 0.365|0.334 1178|1370|388/2016|2015|512 2936|4543 15.43 8.56E-05 106334899 SNP4- G|C 0.485|0.461 778|1448|691/1330|2224|977 2917|4531 7.79 0.0052522 106336410 106336410 rs7698522 T|C 0.101|0.110 2367|538|28/3612|896|55 2933|4563 3.50 0.0614249 106338205 rs2047409 T|C 0.395|0.364 1070|1377|460/1850|2047|624 2907|4521 13.99 1.84E-04 106356482 SNP4- A|C 0.088|0.097 2438|473|21/3720|806|42 2932|4568 3.89 0.0485755 106357811 106357811 rs7655890 T|G 0.347|0.317 1258|1325|357/2152|1974|471 2940|4597 14.76 1.22E-04 106359950 rs4699166 G|A 0.089|0.098 2434|478|21/3719|805|44 2933|4568 3.45 0.0631036 106361185 rs6839705 C|A 0.378|0.348 1139|1376|423/1966|2047|575 2938|4588 14.29 1.57E-04 106364184 rs7683416 C|T 0.470|0.448 824|1458|650/1412|2214|938 2932|4564 7.41 0.0064955 106372433 rs6843141 G|A 0.021|0.021 2819|119|2/4409|186|2 2940|4597 0.03 0.8608777 106375200 rs17253672 C|T 0.057|0.051 2619|305|15/4134|446|12 2939|4592 1.99 0.1583725 106375636 rs7670522 C|A 0.480|0.459 794|1471|676/1378|2218|997 2941|4593 6.59 0.0102416 106379814

SNP4- T|G 0.368|0.377 1168|1375|393/1817|2097|682 2936|4596 1.04 0.3076501 106383733 106383733 SNP4- T|C 0.365|0.375 1179|1370|388/1827|2090|677 2937|4594 1.28 0.2570259 106392236 106392236 SNP4- C|T 0.467|0.446 832|1454|640/1425|2193|935 2926|4553 6.61 0.0101362 106394385 106394385 rs4464576 G|A 0.223|0.212 1768|1027|141/2838|1548|198 2936|4584 2.75 0.0971549 106397331 SNP4- G|A 0.479|0.457 796|1466|672/1384|2221|989 2934|4594 6.91 0.0085571 106398351 106398351 SNP4- A|G 0.366|0.375 1178|1367|389/1823|2086|680 2934|4589 1.37 0.2422752 106398904 106398904 SNP4- T|C 0.367|0.377 1163|1369|388/1795|2081|676 2920|4552 1.43 0.2324835 106398905 106398905 SNP4- T|C 0.213|0.203 1786|939|140/2800|1410|186 2865|4396 2.21 0.1371582 106404905 106404905 SNP4- A|G 0.060|0.049 2598|322|14/4153|429|12 2934|4594 8.41 0.0037357 106411129 106411129 rs1498126 G|T 0.223|0.214 1759|1028|140/2809|1554|198 2927|4561 2.09 0.1478572 106411906 rs2726492 G|A 0.209|0.201 1832|950|135/2843|1444|174 2917|4461 1.48 0.223077 106414990 rs2454206 A|G 0.367|0.376 1176|1369|392/1820|2096|679 2937|4595 1.22 0.2693092 106416400 SNP4- A|G 0.031|0.030 2765|171|5/4327|266|3 2941|4596 0.10 0.7550335 106416449 106416449 rs2647256 G|A 0.210|0.200 1837|950|138/2938|1462|185 2925|4585 2.21 0.1371206 106421005 rs904274 G|T 0.048|0.047 2661|256|12/4153|409|10 2929|4572 0.02 0.8888763 106422082 SNP4- G|A 0.030|0.030 2764|169|5/4323|271|3 2938|4597 0.00 0.9884546 106430246 106430246 SNP4- A|G 0.368|0.374 1170|1359|397/1813|2101|663 2926|4577 0.59 0.4431133 106430892 106430892 SNP4- C|T 0.371|0.374 1156|1354|405/1784|2119|636 2915|4539 0.07 0.7920587 106434116 106434116 SNP4- T|G 0.392|0.398 1090|1394|453/1688|2159|748 2937|4595 0.55 0.45824 106435122 106435122 rs12639764 T|C 0.374|0.381 1151|1374|412/1792|2104|698 2937|4594 0.63 0.4280079 106435654 Locus, dbSNP number or chromosome 4 coordinate; MAF, minor allele frequency; Geno_counts, numbers of each genotyped allele; Position, HG18 chromosome 4 location; p ≤ 10-4 was judged as significant (bold).

Supplementary Table S2. Genotypes of two Oct1-binding TET2 PCa risk SNPs

rs7655890 Risk Prot

GG2 GT2 TT2 rs17508261 Risk CC1 123 1 0 CT1 419 1337 6

Prot TT 353 2302 3649

1rs17508261-C is associated with PCa risk and is bound by Oct1. 2rs7655890-T/G are bound by Oct1. Risk, risk allele; Prot, protective allele.

Supplementary Table S3. Primers, probes, and siRNAs ______Nam e Sequence

QPCR TET2a Hs00325999 (Taqman, Life Technologies) TET2b_For.1 TCAATATGATTTCCCATCTTGCA TET2b_Rev.1 GATAAACGCCATGTGTCTCAGTACA TET2b_Probe 1 ATGTGTAGGTAAGTGCCAGAA

RT-PCR TET2a_S1 GGTCCCGCTCGCATGCAAGTCA TET2a_AS1 GATCTGAAGGAGCCCAGAGAGAGA TET2a_AS2 GCAAACACTTGGAATACCCTCTACT

SNP Genotyping rs17508261_F ACCTCCTGTACTTCACCTGC rs17508261_R TCTACTGGGTCTTATGGTAGTTCC rs7655890_F GGATGTGCAGTTGGTTTAATGG rs7655890_R GTCAACTAAATTGTCACATCCCC rs7679673_F CTCCATATAGGGTGTCTGTCG rs7679673_R GCAAAGATCCTGCAAAGCTG

siRNA siTET2-1 GUACAGAAUAUAAAUCGUA; A-013776-13-0005, Accell siRNA, GE Dharmacon, Lafayette,CO siTET2-3 CCCAGAGTCCTAATCCATCTA; GS54790- SI04955762, Qiagen siTET2-4 GCCAGUAAACUAGCUGCAAUGCUAA; HSS123253, Life Technologies-ThermoFisher scRNA UAGCGACUAAACACAUCAA; D-001210-01-05, Non-targeting control siRNA, GE Dharmacon

Additional QPCR assays are included in Supplementary Table S8. ______

Supplementary Table S4. TET2 isoform expression and risk SNP genotypes in PCa cell lines Relative expression / HPRT1 2 Risk SNP genotype Androgen Androgen hEGF1 in Name Source Dise a se receptor sensitivity media TET2a Ave TET2b Ave TET2-delex2 Ave rs7679673 rs17508261 rs7655890 HPV18 transfection of normal PZHPV7 Non-tumorigenic - No Yes 4.81 1.56 0.71 CC TT TT prostate epithelial cells NCIH660 Lymph node metastasis Small Cell Carcinoma - No No 4.72 1.87 1.29 AC TT GT

CAHPV10 HPV18 transfection of high-grade Adenocarcinoma - No Yes 4.25 1.51 1.07 CC TT TT prostate adenocarcinoma cells Left supraclavicular lymph node LNCaP Carcinoma + Yes No 3.87 1.67 1.02 AC TT GT metastasis Human PCa cell line derived from 22RV1 Carcinoma NR Yes Yes 3.23 3.42 0.88 AC TT GT a mouse CWR22 xenograft 3.07 1.52 0.73 HPV18 transfection of normal RWPE-1 Normal + Yes Yes 3.22 1.44 0.90 CC TT TT prostate epithelial cells MDA PCa 2b Bone metastasis Adenocarcinoma + Yes Yes 2.98 1.15 0.66 AC CT GT PC3 Bone metastasis Grade IV - No No 1.83 0.65 0.22 CC TT TT DU145 Brain metastasis Carcinoma - No No 1.79 1.12 0.48 AA CT GG VCaP Vertebral bone metastasis Carcinoma + Yes No 1.78 0.74 0.29 CC TT TT Normal prostate with mild PWR-1E hyperplasia immortalized with an Normal + Yes Yes 1.27 1.55 0.54 AC TT GT adenovirus 12-SV40 hybrid virus Ordered by TET2a expression; 1Human epidermal growth factor; 2Relative expression using the human universal control (Clontech) as 100%; NR, not reported; Ave, average expression across all lines; grey, lines with abnormally reducedTET2a expression; HPRT1 , hypoxanthine phosphoribosyltransferase 1 Expression analyzed in triplicate; p-value, two-tailed Wilcoxon rank sum test; error bars, mean ± SD.

Supplementary Table S5. Somatic TET2 alterations in tumors from epithelial tissue

HG19 Alteration Tissue of origin, chr 4 Protein Mutation number Sample-patient ID Sample pathology coordinate change type 1 TCGA-22-5473-01 Lung squamous cell 106155127 p.E10Q MS 2 A2 Prostate 106155227 p.R43I MS 3 TCGA-66-2783-01 Lung squamous cell 106155322 p.S75C MS 4 TCGA-AX-A05Z-01A-11W-A027-09 Endometrium 106155340 p.E81* Nons 5 587376 Colon 106155359 p.K87T MS 6 TCGA-A5-A0GV-01 Endometrium 106155367 p.Q90* Nons 7 587342 Colon 106155389 p.T97I MS Lung 8 TCGA-17-Z003-01A-01W-0746-08 106155397 p.E100* Nons adenocarcinoma 9 TCGA-D1-A17A-01A-11D-A12J-09 Endometrium 106155403 p.S104fs Del-FS p.delS102- Del-in 10 TCGA-D8-A27M-01A-11D-A16D-09 Breast 106155404 103 >F frame 11 TCGA-66-2758-01 Lung squamous cell 106155423 p.Q108Q Syn 12 TCGA-33-4547-01 Lung squamous cell 106155466 p.R123S MS Lung 13 TCGA-49-4486-01A-01D-1265-08 106155476 p.G126V MS adenocarcinoma

14 RK084_C01 Liver 106155482 p.Q129fs* Ins-FS Lung 15 TCGA-17-Z061-01A-01W-0747-08 106155487 p.E130Q MS adenocarcinoma Large intestine 16 TCGA-AG-3892-01 106155525 p.S142S MS adenocarcinoma 17 TCGA-D1-A16I-01 Endometrium 106155526 p.D143Y MS Lung 18 TCGA-17-Z046-01A-01W-0746-08 106155526 p.D143N MS adenocarcinoma 19 TCGA-BP-4781-01A-01D-1373-10 Kidney 106155681 p.D194E MS 20 TCGA-AA-3715-01A-01W-0900-09 Large intestine 106155700 p.N202fs Del-FS 21 DU145 cell line Prostate 106155784 p.T229fs1 Ins-FS 22 TCGA-41-2572-01A-01D-1353-08 Glioblastoma 106155901 p.S268A MS 23 587228 Large intestine 106155902 p.S268L MS 24 TCGA-AX-A063-01A-11W-A027-09 Endometrium 106155923 p.N275S MS 25 TCGA-AA-3525-01A-02W-0833-10 Large intestine 106155928 p.A277T MS 26 TCGA-B0-4828-01A-01D-1361-10 Kidney 106156048 p.Q317K MS 27 TCGA-AX-A0J0-01A-11D-A117-09 Endometrium 106156071 p.Q324H MS 28 TCGA-B0-4847-01A-01D-1361-10 Kidney 106156075 p.K326* Nons 29 587376 Colon 106156155 p.F352L MS 30 TCGA-A5-A0GB-01 Endometrium 106156398 p.E433E Syn 31 TCGA-B8-4153-01B-11D-1669-08 Kidney 106156445 p.V449E MS 32 PD4123a Breast 106156465 p.E456K MS

33 TCGA-BT-A20Q-01 Bladder 106156496 p.S466C MS 34 TCGA-B5-A11E-01A-11D-A10M-09 Endometrium 106156520 p.P474L MS 35 TCGA-AG-A002-01 Large intestine 106156521 p.P474P Syn 36 TCGA-BT-A20Q-01 Bladder 106156625 p.S509* Nons 37 K44 Kidney 106156666 p.G523* Nons 38 TCGA-AG-3890-01 Large intestine 106156671 p.E524E Syn 39 TCGA-AP-A059-01A-21D-A122-09 Endometrium 106156672 p.L525I MS 40 S00841 Lung small cell 106156677 p.Q526H MS Lung 41 TCGA-49-4507-01A-01D-1265-08 106156700 p.R534T MS adenocarcinoma 42 TCGA-AA-3715-01A-01W-0900-09 Colorectal 106156729 p.R544* Nons 43 TCGA-A5-A0VP-01 Endometrium 106156729 p.R544* Nons 44 TCGA-AX-A05Z-01A-11W-A027-09 Endometrium 106156748 p.R550Q MS 45 A17 Prostate 106156783 p.P562A MS 46 TCGA-CR-7388-01A-11D-2012-08 Head and neck 106156786 p.G563* Nons 47 TCGA-AP-A051-01A-21W-A027-09 Endometrium 106156840 p.R581C MS 48 TCGA-CN-5366-01A-01D-1434-08 Head and neck 106156862 p.S588* Nons 49 TCGA-34-5927-01A-11D-1817-08 Lung Squamous 106156934 p.G613fs Ins-FS 50 TCGA-GD-A2C5-01A-12D-A17V-08 Bladder 106156981 p.E628K MS 51 TCGA-BS-A0UJ-01A-12D-A10B-09 Endometrium 106157137 p.R680G MS 52 TCGA-B0-5115-01A-01D-1421-08 Kidney 106157368 p.L757V MS 53 TCGA-AX-A0J0-01A-11D-A117-09 Endometrium 106157375 p.T759N MS 54 TCGA-GV-A3JX-01A-11D-A20D-08 Bladder 106157401 p.D768H MS 55 TCGA-AG-A002-01 Rectum 106157443 p.E782* Nons 56 TCGA-BS-A0UV-01 Endometrium 106157490 p.F797F Syn 57 TCGA-AG-3878-01 Rectum 106157490 p.F797F Syn 58 TCGA-AX-A0J0-01A-11D-A117-09 Endometrium 106157540 p.R814H MS Lung 59 TCGA-44-6778-01A-11D-1855-08 106157611 p.T838A MS adenocarcinoma 60 TCGA-AX-A06H-01 Endometrium 106157645 p.T849I MS Lung 61 LC_C27 106157802 p.N901K MS adenocarcinoma 62 ccRCC-31 Kidney 106157842 p.A915P MS 63 ccRCC-31 Kidney 106157843 p.A915V MS 64 TCGA-33-4547-01 Lung squamous cell 106157923 p.P942S MS 65 TCGA-AA-3977-01A-01W-0995-10 Colorectal 106157965 p.L956I MS 66 TCGA-AX-A0J0-01 Endometrium 106157965 p.L956I MS 67 SWE-51 Prostate 106158013 p.S972A MS 68 TCGA-14-0813-01A-01W-0424-08 Glioblastoma 106158045 p.K982N MS 69 ccRCC-8 Kidney 106158301 p.T1069fs Ins-FS 70 TCGA-GV-A3JX-01A-11D-A20D-08 Bladder 106158369 p.K1090N MS 71 TCGA-AG-A002-01 Rectum 106158400 p.L1101I MS 72 TCGA-GV-A3JX-01A-11D-A20D-08 Bladder 106158415 p.E1106Q2 MS

ex4-2, 73 TCGA-AX-A06H-01 Endometrium 106162494 Spl splicing 74 587332 Colon 106162530 p.Y1148* Nons 75 ccRCC-93 Kidney 106164017 p.R1176T MS 76 TCGA-B5-A0JY-01A-11D-A10B-09 Endometrium 106164817 p.L1229I MS 77 PD4127a Breast 106164850 p.L1240V MS Lung ex6-1, 78 TCGA-17-Z045-01A-01W-0746-08 106180775 Spl adenocarcinoma splicing 79 PD6744a Bone 106180785 p.C1271W MS 80 TCGA-B5-A11R-01A-11D-A122-09 Endometrium 106190770 p.E1350Q4 MS 81 ccRCC-99 Kidney 106190800 p.L1360M4 MS 82 TCGA-E2-A10B-01A-11D-A10M-09 Breast 106190828 p.S1369L4 MS 83 TCGA-AR-A255-01A-11D-A167-09 Breast 106190872 p.D1384H3,4 MS 84 TCGA-CJ-4894-01A-01D-1373-10 Kidney 106190890 p.N1390H4 MS 85 ccRCC-100 Kidney 106193724 p.C1396R4 MS 86 ccRCC-76 Kidney 106193751 p.E1405Q4 MS 87 ccRCC-76 Kidney 106193752 p.E1405V4 MS 88 TCGA-CZ-4861-01A-01D-1373-10 Kidney 106193890 p.R1451Q4 MS 89 587342 Large intestine 106193965 p.A1476V4 MS 90 TCGA-D1-A17D-01 Endometrium 106196382 p.R1572Q4 MS 91 TCGA-BS-A0TJ-01 Endometrium 106196434 p.Y1589Y4 Syn 92 TCGA-AR-A0TX-01A-11D-A099-09 Breast 106196474 p.Q1603*4 Nons 93 TCGA-BS-A0UF-01A-11D-A10B-09 Endometrium 106196499 p.S1611Y4 MS 94 WA58 Prostate 106196784 p.F1706fs*4 Del-FS 95 TCGA-BP-4160-01A-02D-1366-10 Kidney 106196809 p.N1714K4 MS 96 587382 Colon 106197173 p.V1836M4 MS 97 A7 Prostate 106197336 p.N1890S4 MS

Mutations are annotated to the TET2a transcript and ordered by the genomic coordinate . Blue, a clearly/likely deleterious protein alteration defined as a nonsense, frameshift, or splice junction alteration; an altered proline, functionally annotated residue or a recurrently altered residue. MS, missense; Nons, nonsense; Del, deletion; FS, frameshift; Ins, insertion; Syn, synonymous; Spl, splice junction. Box, recurrently altered residue. 1An identical alteration was confirmed as somatic in leukemia (COSM110749); 2near phosphoserine p.S1107; 3p.D1384, an altered catalytic iron- binding residue; 4catalytic domain alteration (aa 1290–1905). Alterations after amino acid 1165 (n = 23) are unique to TET2a, as compared with TET2b. chr, chromosome.

Supplementary Table S6. Affinity purified peptides from candidate TET2-binding proteins in

HEK293T kidney cells

This is provided as a separate Excel file.

Supplementary Table S7. TET2 interacting proteins Protein/ Peptide group # Protein Accession Reference count1 1 Probable methylcytosine dioxygenase TET2 Q6N021 TET2 181 UDP-N-acetylglucosamine-peptide N- 2 O15294 OGT1 30 acetylglucosaminyltransferase 110 kDa subunit 3 Paraspeckle component 1 Q8WXF1 PSPC1 16 PSP2/ Paraspeckle 2/RNA binding motif protein 14 Q96PK6 RBM14 RNA binding motif protein 26 Q5T8P6 RBM26 4 Heterogeneous nuclear ribonucleoprotein C-like 1 O60812 HNRCL 16 Heterogeneous nuclear ribonucleoprotein D-like O14979 HNRDL

Heterogeneous nuclear ribonucleoprotein H2 P55795 HNRH2

Heterogeneous nuclear ribonucleoprotein D0 Q14103 HNRPD

Heterogeneous nuclear ribonucleoprotein G P38159 HNRPG

Heterogeneous nuclear ribonucleoprotein M P52272 HNRPM

Heterogeneous nuclear ribonucleoprotein A1-like HNRNPA1L Q32P51 2 2

Heterogeneous nuclear ribonucleoprotein U Q00839 HNRPU

Heterogeneous nuclear ribonucleoprotein U-like Q9BUJ2 HNRL1 protein 1 Heterogeneous nuclear ribonucleoprotein U-like Q1KMD3 HNRL2 protein 2 5 Filamin-A P21333 FLNA 9 Filamin-B O75369 FLNB

Filamin-C Q14315 FLNC

6 Lysine-specific demethylase 3B Q7LBC6 KDM3B 5 Lysine-specific demethylase 4A O75164 KDM4A

Lysine-specific demethylase 4C Q9H3R0 KDM4C

Lysine-specific demethylase 6A O15550 KDM6A

Lysine-specific demethylase 6B O15054 KDM6B

7 Retinoblastoma-binding protein RBBP4 Q09028 RBBP4 5 Serine/threonine-protein phosphatase 2A 55 kDa 8 P63151 2ABA 4 regulatory subunit B alpha isoform 9 High mobility group protein B2 P26583 HMGB2 4 High mobility group protein B3 O15347 HMGB3

10 Isoleucyl-tRNA synthetase, cytoplasmic P41252 IARS 4 11 NFX1-type zinc finger-containing protein 1 Q9P2E3 ZNFX1 4 1Combined peptides (≥ 4) observed in two independent FLAG-TET2 affinity purifications and not in the controls. Several proteins identified by < 4 peptides were included if the protein function was closely related to other proteins with enriched (≥ 4) peptide counts.

Supplementary Table S8. TET2 knockdown alters the expression of selected genes associated with PCa. Genes with significant expression differences (p<0.05) or |fold change| ≥ 1.1 between cells treated with scRNA and siTET2-1 are shown. scRNA siTET2 # biological 1 Fold 3 replicates Gene Assay details 2 p-value Details, comments avg stdev avg stdev Change (scRNA, siTET2) AMIGO2 Hs01938743 1.23 0.08 1.37 0.05 1.11 0.08 3,3 Norris et al., 2009 CENPN Hs01015931 1.13 0.01 1.20 0.01 1.06 3.89E-03 3,3 Norris et al., 2009 CTNNB1 AR gene array 1.04 0.09 0.95 0.09 -1.10 0.05 6,9

FKBP5 Hs01561006 1.16 0.01 1.19 4.77E-03 1.03 1.58E-03 3,3 Norris et al., 2009 GSK3B AR gene array 1.13 0.16 0.95 0.12 -1.19 0.05 6,9

HPGD Hs00960586 1.32 0.01 1.42 0.03 1.08 0.02 3,3 Norris et al., 2009 KLK3 AR gene array 1.08 0.17 1.24 0.14 1.14 0.09 6,8

MAP2K1 AR gene array 1.42 0.27 1.15 0.25 -1.23 0.16 4,8

NOV Hs00159631 1.48 0.04 1.38 0.02 -1.07 0.04 3,3 Norris et al., 2009 PRKACB AR gene array 1.11 0.18 0.98 0.09 -1.14 0.14 6,9

TET2 Hs00325999 1.33 0.07 0.77 0.04 -1.71 1.92E-07 6,6

TGFB1 AR gene array 1.13 0.16 1.27 0.20 1.13 0.17 6,8

1Taqman ID # (Life Technologies) or the AR gene array (Androgen Receptor Nuclear Signaling Array, #10047227, Bio-Rad); 2Expression difference between scrambled RNA (scRNA) and siTET2-1-treated (siTET2) cells; 3Student's two-tailed T-test comparing the expression between scRNA and siTET2 treated cells. Avg, average; stdev, standard deviation. Genes whose expression was influenced by scRNA (p<0.05) were excluded.

Supplementary Table S9. TET2 and AR binding sites and mC and hmC proximal to genes with altered expression after TET2 KD

Gene Peak Coord. Peak Gene Coord. (HG18) Peak Name Data Type Name (HG18) Score MACS_peak_3714 chr19:55993863-55994052 50.30 5-hmC KLK3 chr19:56049983-56055832 MACS_peak_3533 chr19:56037109-56037203 42.09 TET2 ChIP MACS_peak_3538 chr19:56187636-56187797 89.17 AR ChIP MACS_peak_5480 chr4:173917408-173917576 57.93 MACS_peak_5481 chr4:173919912-173920068 64.95 5-hmC MACS_peak_5482 chr4:177336124-177336189 122.04 HPGD chr4:175647955-175680186 MACS_peak_5572 chr4:175636558-175636644 51.56 TET2 ChIP MACS_peak_5800 chr4:175168242-175168561 193.43 AR ChIP MACS_peak_5801 chr4:175317774-175317948 90.65 MACS_peak_2763 chr16:79677274-79677345 97.51 5-hmC MACS_peak_2948 chr16:79639049-79639152 47.18 TET2 ChIP CENPN chr16:79597604-79624210 MACS_peak_2920 chr16:79917646-79917904 167.03 MACS_peak_2921 chr16:79921390-79921523 128.66 AR ChIP MACS_peak_2922 chr16:79922158-79922291 58.23 MACS_peak_1454 chr11:69803451-69803550 66.33 5-hmC MACS_peak_1366 chr11:69024007-69024108 42.09 CCND1 chr11:69165054-69178423 TET2 ChIP MACS_peak_1367 chr11:69241083-69241171 42.09 MACS_peak_1353 chr11:68873715-68874211 253.72 AR ChIP Data Type: 5-hmC, 5-hmC in LNCaP cells (GEO datasets: GSM1613324); TET2 ChIP, TET2 ChIP in LNCaP cells (GSM1613322); AR ChIP, AR ChIP in BicR cells (GSM1613312). Gene order, most significantly altered expression change after TET2 KD shown at top. MACS, Model-based Analysis of ChIP-Seq; data analyzed from Takayama et al., 2015.

Supplementary Table S10. Studies describing TET2-AR nexus protein interactions.

Protein Pair PubMed ID Reference AR-CCND1 7890635 Caplan AJ, et al. Hormone-dependent transactivation by the human androgen receptor is regulated by a dnaJ protein. J Biol Chem. 1995;270(10):5251-7. 10344732 Knudsen KE, et al. D-type cyclins complex with the androgen receptor and inhibit its transcriptional transactivation ability. Cancer Res. 1999;59(10):2297-301. 11328859 Reutens AT, et al. Cyclin D1 binds the androgen receptor and regulates hormone-dependent signaling in a p300/CBP- associated factor (P/CAF)-dependent manner. Mol Endocrinol. 2001;15(5):797-811. 11714699 Petre CE, et al. Cyclin D1: mechanism and consequence of androgen receptor co-repressor activity. J Biol Chem. 2002; 277(3):2207-15. 15558026 Petre-Draviam CE, et al. A central domain of cyclin D1 mediates nuclear receptor corepressor activity. Oncogene. 2005; 24(3):431-44. AR-EP300 10779504 Fu M, et al. p300 and p300/cAMP-response element-binding protein-associated factor acetylate the androgen receptor at sites governing hormone-dependent transactivation. J Biol Chem. 2000;275(27):20853-60. 11971970 Fu M, et al. Androgen receptor acetylation governs trans activation and MEKK1-induced apoptosis without affecting in vitro sumoylation and trans-repression function. Mol Cell Biol. 2002;22(10):3373-88. 14612401 Fu M, et al. Acetylation of androgen receptor enhances coactivator binding and promotes prostate cancer cell growth. Mol Cell Biol. 2003;23(23):8563-75. 18487222 Dai Y, et al. Prohibitin and the SWI/SNF ATPase subunit BRG1 are required for effective androgen antagonist-mediated transcriptional repression of androgen receptor-regulated genes. Carcinogenesis. 2008;29(9):1725-33. 23172223 Minges JT, et al. Melanoma antigen-A11 (MAGE-A11) enhances transcriptional activity by linking androgen receptor dimers. J Biol Chem. 2013;288(3):1939-52. 23518348 Qi J, et al. The E3 ubiquitin ligase Siah2 contributes to castration-resistant prostate cancer by regulation of androgen receptor transcriptional activity. Cancer Cell. 2013;23(3):332-46. 24480624 Zhong J, et al. p300 acetyltransferase regulates androgen receptor degradation and PTEN-deficient prostate tumorigenesis. Cancer Res. 2014;74(6):1870-80. AR-KDM6A 22722839 Grasso CS, et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 2012;487(7406):239-43. AR-PSPC1 12810069 Ishitani K, et al. p54nrb acts as a transcriptional coactivator for activation function 1 of the human androgen receptor. Biochem Biophys Res Commun. 2003;306(3):660-5. AR-SFPQ 12810069 Ishitani K, et al. p54nrb acts as a transcriptional coactivator for activation function 1 of the human androgen receptor. Biochem Biophys Res Commun. 2003;306(3):660-5. 17452459 Dong X, et al. Transcriptional activity of androgen receptor is modulated by two RNA splicing factors, PSF and p54nrb. Mol Cell Biol. 2007;27(13):4863-75. NONO-CCND1 21654808 Jirawatnotai S, et al. A function for cyclin D1 in DNA repair uncovered by protein interactome analyses in human cancers. Nature. 2011;474(7350):230-4. NONO-PSPC1 16148043 Fox AH, et al. P54nrb forms a heterodimer with PSP1 that localizes to paraspeckles in an RNA-dependent manner. Mol Biol Cell. 2005;16(11):5304-15. 16169070 Stelzl U, et al. A human protein-protein interaction network: a resource for annotating the proteome. Cell. 2005;122(6):957-68. 22416126 Passon DM, et al. Structure of the heterodimer of human NONO and paraspeckle protein component 1 and analysis of its role in subnuclear body formation. Proc Natl Acad Sci U S A. 2012;109(13):4846-50.

Supplementary Table S10. (Continued)

Protein Pair PubMed ID Reference NONO-SFPQ 9756848 Straub T, et al. The RNA-splicing factor PSF/p54 controls DNA-topoisomerase I activity by a direct interaction. J Biol Chem. 1998;273(41):26261-4. 10858305 Straub T, et al. PSF/p54(nrb) stimulates "jumping" of DNA topoisomerase I between separate DNA helices. Biochemistry. 2000; 39(25):7552-8. 11259580 Mathur M, et al. PSF is a novel corepressor that mediates its effect through Sin3A and the DNA binding domain of nuclear hormone receptors. Mol Cell Biol. 2001;21(7):2298-311. 11897684 Sewer MB, et al. Transcriptional activation of human CYP17 in H295R adrenocortical cells depends on complex formation among p54(nrb)/NonO, protein-associated splicing factor, and SF-1, a complex that also participates in repression of transcription. Endocrinology. 2002;143(4):1280-90. 11956159 Sewer MB and Waterman MR. Adrenocorticotropin/cyclic adenosine 3',5'-monophosphate-mediated transcription of the human CYP17 gene in the adrenal cortex is dependent on phosphatase activity. Endocrinology. 2002;143(5):1769-77. 12403470 Peng R, et al. PSF and p54nrb bind a conserved stem in U5 snRNA. RNA. 2002;8(10):1334-47. 15312650 Kanai Y, et al. Kinesin transports RNA: isolation and characterization of an RNA-transporting granule. Neuron. 2004;43(4):513-25. 15590677 Bladen CL, et al. Identification of the polypyrimidine tract binding protein-associated splicing factor, p54(nrb) complex as a candidate DNA double-strand break rejoining factor. J Biol Chem. 2005;280(7):5205-10. 15901501 DeCerbo J and Carmichael GG. Retention and repression: fates of hyperedited RNAs in the nucleus. Curr Opin Cell Biol. 2005; 17(3):302-8. 17452459 Dong X, et al. Transcriptional activity of androgen receptor is modulated by two RNA splicing factors, PSF and p54nrb. Mol Cell Biol. 2007;27(13):4863-75. 17507659 Hall-Pogar T, et al. Specific trans-acting proteins interact with auxiliary RNA polyadenylation elements in the COX-2 3'-UTR. RNA. 2007;13(7):1103-15. 17965020 Buxadé M, et al. The PSF-p54nrb complex is a novel Mnk substrate that binds the mRNA for tumor necrosis factor alpha. J Biol Chem. 2008;283(1):57-65. 18042045 Ito T, et al. Brm transactivates the telomerase reverse transcriptase (TERT) gene and modulates the splicing patterns of its transcripts in concert with p54(nrb). Biochem J. 2008;411(1):201-9. 18655028 Miyamoto K, et al. Proteomic identification of a PSF/p54nrb heterodimer as RNF43 oncoprotein-interacting proteins. Proteomics. 2008;8(14):2907-10. 20421735 Salton M, et al. Involvement of Matrin 3 and SFPQ/NONO in the DNA damage response. Cell Cycle. 2010;9(8):1568-76. 21988832 Wang J, et al. Toward an understanding of the protein interaction network of the human liver. Mol Syst Biol. 2011;7:536. OGT-BAP1 19615732 Sowa ME, et al. Defining the human deubiquitinating enzyme interaction landscape. Cell. 2009;138(2):389-403. 20805357 Yu H, et al. The ubiquitin carboxyl hydrolase BAP1 forms a ternary complex with YY1 and HCF-1 and is a critical regulator of gene expression. Mol Cell Biol. 2010;30(21):5071-85. 22878500 Dey A, et al. Loss of the tumor suppressor BAP1 causes myeloid transformation. Science. 2012;337(6101):1541-6. 24703950 Mashtalir N, et al. Autodeubiquitination protects the tumor suppressor BAP1 from cytoplasmic sequestration mediated by the atypical ubiquitin ligase UBE2O. Mol Cell. 2014;54(3):392-406. OGT-CCND1 21654808 Jirawatnotai S, et al. A function for cyclin D1 in DNA repair uncovered by protein interactome analyses in human cancers. Nature. 2011;474(7350):230-4. 23592772 Ma Z, et al. Hyper-O-GlcNAcylation is anti-apoptotic and maintains constitutive NF-kB activity in pancreatic cancer cells. J Biol Chem. 2013;288(21):15121-30. SFPQ-RNA Pol II 15901501 DeCerbo J and Carmichael GG. Retention and repression: fates of hyperedited RNAs in the nucleus. Curr Opin Cell Biol. 2005; 17(3):302-8. TET2-OGT 23352454 Vella P, et al. Tet proteins connect the O-linked N-acetylglucosamine transferase Ogt to chromatin in embryonic stem cells. Mol Cell. 2013;49(4):645-56. 23353889 Deplus R, et al. TET2 and TET3 regulate GlcNAcylation and H3K4 methylation through OGT and SET1/COMPASS. EMBO J. 2013; 32(5):645-55. Compiled using the Ingenuity Pathway Analysis (Qiagen-Ingenuity, January 2016). Not shown: OGT-EP300 and TET2-EP300 interactions as EP300 is considered a component of the basal transcriptional complex; and SFPQ-PSPC1 as they are considered components of a paraspeckles complex.

SUPPLEMENTARY MATERIALS AND METHODS

Cell lines were purchased from the American Type Culture Collection (Manassas, VA) for this study or were subjected to routine STR and mycoplasma testing.

Gene expression analysis and real time-polymerase chain reaction

TET2 isoforms: Total RNA was purchased from Ambion/Life Technologies (Foster City, CA,

USA), Clontech (Mountain View, CA, USA), and Capital Biosciences (Rockville, MD, USA), or was isolated from cell lines (indicated in Supplementary Table S4) using RNeasy (Qiagen,

Valencia, CA, USA). cDNA was synthesized using the Transcriptor First Strand cDNA

Synthesis Kit (Roche, Indianapolis, IN, USA) with oligonucleotide (dT)18 primer, according to

the manufacturer’s instructions. TET2 expression was normalized to HPRT1 (Hs02800695, Life

Technologies, Carlsbad, CA, USA) using the delta delta CT method to determine relative gene expression based on a human universal control (Clontech). Alternatively in experiments examining siTET2-4, LNCaP cells were counted and 1 x 105 cells were used as input for the

Cells-to-Ct kit (Thermo Scientific). Extracts were diluted 1:100 and used directly in qRT-PCR

reactions.

RT-PCR: Approximately 1 µg of total RNA was reverse-transcribed using SuperScript III

(Invitrogen, Carlsbad, CA, USA) and random hexamers in a total volume of 20 µl. cDNA was

diluted 1:100, and 5 µl was PCR-amplified in 50 µl using Platinum High Fidelity Taq DNA

polymerase (Invitrogen). PCR conditions: 35 cycles with 30 sec of denaturation at 94 °C, 1 min annealing at 60°C, 2 min extension at 68 °C, and a final 10 min extension at 68 °C. A 7900HT

Fast Real-Time PCR system (Applied Biosystems, Waltham, MA, USA) was used to determine critical threshold values. PCR products were separated in 1% agarose in 0.5x tris, borate, EDTA

buffer, stained with ethidium bromide, and visualized under ultraviolet light. Primer sequences are listed in Supplementary Table S3.

Co-expression analysis of TCGA tumor RNA-sequencing data

To identify the expression correlations between TET2 and genes encoding nexus and 2-OG pathway components, we downloaded all level 3 normalized mRNA expression data from the cBioPortal (RNA Seq V2 RSEM log2). In total, there was data from 31 cancer types with TCGA provisional RNA Seq V2 data. We performed both Pearson and Spearman correlation tests using

R (https://www.r-project.org) to confirm a Pearson correlation produced higher stringency

results. The co-expression pattern was visualized using the corrplot R package

(https://github.com/taiyun/corrplot). Heatmaps of the co-expression patterns for TET2 across all cancer types was generated by heatmap3 in the R package(https://github.com/slzhao/heatmap3).

A gene–gene correlation is only indicated by a circle on each figure if the Pearson correlation p-

value < 0.01. The gene order in each figure is based on a hierarchical clustering method.

Western blotting

Cells were harvested, washed with phosphate-buffered saline, and lysed in radio-

immunoprecipitation assay buffer, and 10–50 ug of protein were separated in 4–12% NuPAGE

Bis-Tris or Tris-Glycine gels (Novex, Life Technologies) and transferred to a polyvinyl

difluoride membrane (Invitrogen; Millipore, Billerica, MA, USA). Membranes were blocked in

1X TBST (Cell Signaling Technology, Danvers, MA, USA) with 5% dry milk for 1 h at room

temperature. A monoclonal mouse anti-TET2a antibody (MAb-179-050, Diagenode, Denville,

NJ, USA) was diluted 1:200–1:2000, and a polyclonal rabbit anti-TET2b antibody (R1086-1h;

Abiocode, Agoura Hills, CA, USA) was diluted 1:800. Rabbit anti-PSA/KLK3 (#5365 Cell

Signaling Technology) was diluted 1:1000. Anti-β-actin (#4967; Cell Signaling Technology) and anti-Tubulin (1:1000; Santa Cruz Biotechnology, Dallas TX, USA; and 1:1000; Cell Signaling

Technology #2128) were used as controls. Horse radish peroxidase-conjugated anti-mouse and anti-rabbit IgGs diluted 1:500–1:10,000 were used as secondary antibodies (Cell Signaling

Technology and Santa Cruz Biotechnology). Blots were exposed on enhanced chemiluminescence film after incubation with HyGLO™ Chemiluminescent HRP Antibody

Detection Reagent (Denville Scientific, Holliston, MA, USA). Alternatively, a Chemidoc MP

(Biorad) was used to capture and quantitate chemiluminesence signals.

Immunohistochemistry

Immunohistochemistry (IHC) was performed on sections of normal prostate tissue and prostate

tumors (#PRO01 and PRO03; Pantomics, Richmond, CA, USA), and on serial sections of a PCa

tissue microarray (TMA) with duplicate cores of six tumors and adjacent normal prostate tissue

(PR243a; US Biomax, Rockville, MD, USA), using standard Avidin-Biotin Complex methods.

Sections were deparaffinized, endogenous peroxidase was blocked, and microwave antigen

retrieval in citrate buffer was performed. Following incubation in 2% normal horse serum

(Vector Laboratories, Burlingame, CA, USA), a monoclonal mouse antibody against human

TET2 (Mab-179-050, Diagenode) was applied at a 1:10,000 dilution overnight at 4 °C.

Biotinylated horse anti-mouse IgG secondary antibody (Vector Laboratories) diluted 1:100 in

1.5% normal horse serum/PBS was applied for 30 min. Alternatively, a serial section of a TMA

was examined using a polyclonal rabbit antibody against 5-hmC (#39769; Active Motif,

Carlsbad, CA, USA) that was previously validated for IHC,3 diluted 1:10,000 and applied for 60 min, followed by a goat anti-rabbit IgG secondary antibody. Sections were rinsed and incubated

with Avidin-Biotin complex (Vector Laboratories) for 30 min, followed by a 5-min incubation

with 3,3′-diaminobenzidine, a hematoxylin counterstain, and were visualized on a digital scanner

(Aperio, Vista, CA, USA). IHC using only mouse IgG1 (Becton Dickinson, Franklin Lakes, NJ,

USA) showed a negligible signal and was used as a negative control for TET2 stains (data not shown). Slides were counterstained with hematoxylin to identify nuclei.

Electrophoretic mobility shift assays

Nuclear extracts were prepared from various cell lines using the CellLytic NuCLEAR extraction kit (Sigma-Aldrich, St. Louis, MO, USA). Double-stranded DNA oligonucleotide probes with sequences including each TET2 SNP were synthesized, and labeling and DNA–protein binding reactions were performed as previously described.4 Oligonucleotides were labeled with [α-

32P]dCTP (3,000 Ci/mmol; Perkin-Elmer, Waltham, MA, USA) using the Klenow fragment of

DNA polymerase I (Invitrogen). For antibody supershift experiments, nuclear extracts were

incubated with 2 μL of antibody for 1 h on ice before the addition of the 32P-labeled DNA

probe. The binding reaction was incubated for an additional 20 min at room temperature. Anti-

Oct1 antibodies against N- and C-terminus epitopes were obtained from Santa Cruz

Biotechnology.

Affinity purification of TET2-binding proteins

3x-FLAG-TET2a was purified using a mouse anti-FLAG M2 mAb covalently bound to agarose

beads (Sigma-Aldrich). HEK293T cells expressing 3x-FLAG-TET2a were washed twice with cold PBS and lysed in 0.1% NP-40 containing 50 mM Tris, pH 7.4, 150 mM NaCl, 0.5 mM

EDTA, and a protease inhibitor cocktail (Roche). Prior to clarification by centrifugation (14,000 rpm for 10 min at 4 °C), the cells were subjected to one round of freeze–thaw to enhance lysis.

The supernatant was incubated with 40 μL of anti-FLAG M2 agarose (Sigma) for 2 h and washed 3x in wash buffer (50 mM Tris, pH 7.4; 150 mM NaCl). TET2 was eluted via a 3x-

FLAG peptide challenge in 100 µL of elution buffer (6.25mM NH4HCO3, pH 8.4, 150 µg/mL

3x-FLAG peptide) for 20 min. After two rounds of elution, the sample was lyophilized and then

resuspended in 30 μL of 25 mM NH4HCO3, pH 8.4. The samples were subjected to overnight

digestion with trypsin (1 μg) at 37 °C, followed by lyophilization. The tryptic digest was reconstituted in 25% ACN/0.1% FA (100 μL) and fractionated using strong cation exchange

liquid chromatography.

Liquid chromatography and mass spectrometry

Nanoflow reversed-phase liquid chromatography (nanoRPLC) – tandem mass spectrometry

(MS) analyses were performed using a Prominence nanoflow liquid chromatography system

(Shimadzu, Kyoto, Japan), coupled online with a linear ion trap–MS (LTQ; Thermo Scientific,

Waltham, MA, USA). A microcapillary RPLC column (75 µm i.d. × 10 cm fused silica capillary with a flame-pulled tip) was slurry-packed in-house with 5 µm, 300 Å pore size, Jupiter C-18

stationary phase (Phenomenex, Torrance, CA, USA). The mobile phase A was 0.1% formic acid,

and mobile phase B was 0.1% formic acid in acetonitrile. Samples were loaded on a 5 µm, 300

Å, TARGA C18 trap column (Higgins Analytical, Mountain View, CA, USA) for concentration

and desalting at 20 μL/min. Peptides were eluted using a linear gradient of 5% to 42% mobile

phase B for 40 min at 0.20 µL/min, then to 98% B for an additional 10 min. The linear ion trap-

MS was operated in a data-dependent mode, in which each full MS1 scan was followed by seven

MS2 scans wherein the seven most-abundant molecular ions were dynamically selected for

collision-induced dissociation using normalized collision energy of 35%.

Acquired mass spectra were searched against the UniProt human proteomic database

from the European Bioinformatics Institute (released in January 2011), using the SEQUEST

algorithm implemented in the BioWorks 3.2 package (Thermo Scientific) with 1.4 Da for precursor ion tolerance and 0.5 Da for fragment ions tolerance with methionine oxidation included as dynamic modification. Only fully tryptic peptides having up to two miscleavages with charge state-dependent cross-correlation, X corr ≥ 2.1 for [M+H]1+, ≥ 2.5 for [M+2H]2+ and

3+ ≥ 3.2 for [M+3H] , and delta correlation (ΔCn) ≥ 0.08, were considered as positive

identification of a protein. The affinity purification and MS analysis were repeated, and high-

scoring peptides discussed in the text were identified in both experiments. Candidate TET2

interacting proteins were identified based on ≥ 4 eluted peptides in duplicate affinity

purifications, but not in the matched controls.

Co-immunoprecipitation

HEK293T cells transfected with 3x FLAG-TET2 were washed with ice-cold PBS and harvested

in lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 0.5mM EDTA, 0.1% NP-40, and 1x protease

inhibitor cocktail). Samples were lysed through one cycle of freeze–thaw and clarified by

centrifugation at 14,000 rpm for 10 min. Immunoprecipitation (IP) of 3x-FLAG-TET2 was

performed by incubating the supernatant with anti-FLAG M2 agarose (Sigma-Aldrich) for 2 h at

4 °C. For IP of PSPC1 and NONO, the clarified lysate was incubated with anti-PSPC1 antibody

(Santa Cruz Biotechnology) or anti-NONO antibody (Sigma-Aldrich), along with Protein G

Sepharose 4 Fast Flow (GE Healthcare, Madison, WI, USA) for 2 h at 4 °C. The affinity complex was washed three times with ice-cold PBS, was released from the beads by boiling in

2x lithium dodecyl sulfate sample buffer (Invitrogen), and was resolved on a 4–12% Bis-Tris gel

(Invitrogen). Samples were subjected to Western blotting (WB) analysis. Membranes were probed with antibodies for FLAG M2 (Sigma-Aldrich), PSPC1 (Santa Cruz Biotechnology) and

NONO (Sigma-Aldrich), and then with secondary mouse or rabbit antibodies (Thermo Scientific,

Waltham, MA USA) before detection with ECL (Thermo Scientific). Each co-

immunoprecipitation (co-IP) experiment was repeated twice, and representative results are

shown.

To examine IP of endogenous proteins in PCa cells, LNCaP cells cultured in 100-mm

dishes were lysed in lysis buffer, as described above. The lysates were clarified and incubated

with 2 µg of antibody along with 20 µl Protein G Sepharose 4 Fast Flow for 2 h at 4 °C. The

resins were washed with 1x TBS, boiled in LDS sample buffer and resolved on a 4–12% Bis-Tris

gel (Invitrogen) for WB. Antibodies used were anti-TET2 (Diagenode), and anti-AR and anti-

mSIN3A (Santa Cruz Biotechnology).

Cell-based assays

LNCaP cells were transfected with scrambled (scRNA) and siTET2-1 using the siRNA

Transfection Reagent (Santa Cruz Biotechnology) according to the manufacturer’s protocol. Cell

proliferation was measured by trypan blue dye exclusion assay.5 The attached cells were trypsinized and counted after 0, 24, and 48 h using a Countess Automated Cell Counter

(Invitrogen). Each experiment was performed in triplicate, three independent times. The wound-

healing assay was initiated 24 h after transfection by scraping the adherent cells with a sterilized

200-μl pipette tip (time = 0). Cells and debris were removed by 3x PBS rinse, and migration into

the denuded area was examined after 24 and 48 h using an IX70 microscope (Olympus, Center

Valley, PA, USA). The wound area was measured using Image J software (National Institutes of

Health, Bethesda, MD, USA). The percentage of wound closure was calculated by the formula:

6 % wound closure = [(At=0h – At=Δh) / At=0h] x 100%, in which A is the width of the wound and

Δh is 24 or 48 h after time = 0. Each experiment was performed in triplicate, two independent

times.

Transwell invasion assays using Matrigel-coated inserts (8-μm pore size, BD

Biosciences, Franklin Lakes, NJ, USA) were performed according to the manufacturer’s instructions. LNCaP cells were transfected with scRNA or siTET2-1, or were left untreated.

Cells were counted after 24 hr, and 5x105 cells in serum-free media were added to the top chamber. The bottom chamber contained RPMI 1640 media, with 10% fetal bovine serum providing the chemo-attractant. The cells were incubated for 48 h, non-invading cells were removed from the top chamber, and the membrane was stained with Diff-Quick stain (Fisher

Scientific, Waltham, MA, USA) and allowed to air dry (~24–48 h). Cell counts were obtained from photographs of the membrane using an IX70 microscope (Olympus). Each experiment was performed three independent times in triplicate.

Soft agar colony formation assays utilized LNCaP cells transfected with a scRNA or siTET2-1. Cells were trypsinized and counted 24 h post-transfection; 2 500 cells were suspended in 0.35% agarose (Sigma-Aldrich) and RPMI 1640 media, and then overlaid onto six-well culture plates (Corning, Corning, NY, USA) containing solidified bottom layers of 0.5% agarose in the same media. Cells were allowed to grow at 37 °C with 5% CO2 for 3–4 weeks. Plates were

imaged on an Optronix scanner, and imported images were counted using the Gelcount software

system (Oxford, Abingdon, United Kingdom).

SUPPLEMENTARY REFERENCES

1 Grasso CS, Wu YM, Robinson DR, Cao X, Dhanasekaran SM, Khan AP, et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature 2012; 487: 239–243.

2 Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal 2013; 6: p. pl1.

3 Ito S, D'Alessio AC, Taranova OV, Hong K, Sowers LC, Zhang Y. Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification. Nature 2010; 466: 1129–1133.

4 Lou H, Yeager M, Li H, Bosquet JG, Hayes RB, Orr N, et al. (2009). Fine mapping and functional analysis of a common variant in MSMB on chromosome 10q11.2 associated with prostate cancer susceptibility. Proc Natl Acad Sci USA 2009; 106: 7933–7938.

5 Ang J, Fang BL, Ashman LK, Frauman AG. The migration and invasion of human prostate cancer cell lines involves CD151 expression. Oncol Rep 2010; 24: 1593–7.

6 Yue PY, Leung EP, Mak NK, Wong RN. A simplified method for quantifying cell migration/wound healing in 96-well plates. J Biomol Screen 2010; 4: 427–433.

7 Takayama K, Misawa A, Suzuki T, Takagi K, Hayashizaki Y, Fujimura T, et al. TET2 repression by androgen hormone regulates global hydroxymethylation status and prostate cancer progression. Nat Commun 2015; 6: 8219.

Supplementary Table S6. Peptides observed after affinity purification with FLAG-TET2 and mass spectrometry in the elution from experiment 2 1 Protein Accession Reference No. of peptides

Methylcytosine dioxygenase TET2 Q6N021 TET2_HUMAN 432

Filamin-A P21333 FLNA_HUMAN 7

Paraspeckle component 1 Q8WXF1 PSPC1_HUMAN 5

UDP-N-acetylglucosamine--peptide N- O15294 OGT1_HUMAN 5 acetylglucosaminyltransferase 110 kDa subunit

40S ribosomal protein S25 P62851 RS25_HUMAN 4

14-3-3 protein gamma P61981 1433G_HUMAN 3

40S ribosomal protein S16 P62249 RS16_HUMAN 3

60S ribosomal protein L13 P26373 RL13_HUMAN 3

7-dehydrocholesterol reductase Q9UBM7 DHCR7_HUMAN 3

Cyclic nucleotide-gated cation channel beta-1 Q14028 CNGB1_HUMAN 3

DNA damage-binding protein 1 Q16531 DDB1_HUMAN 3

Heterogeneous nuclear ribonucleoprotein D0 Q14103 HNRPD_HUMAN 3

Multidrug resistance protein 1 B5AK60 B5AK60_HUMAN 3

Peroxiredoxin-2 P32119 PRDX2_HUMAN 3

Putative 40S ribosomal protein S10-like Q9NQ39 RS10L_HUMAN 3

Putative 60S ribosomal protein L13a-like MGC87657 Q6NVV1 R13AX_HUMAN 3

Serine/threonine-protein phosphatase 2A 55 kDa regulatory P63151 2ABA_HUMAN 3 subunit B alpha isoform

14-3-3 protein zeta/delta P63104 1433Z_HUMAN 2

60S ribosomal protein L15 P61313 RL15_HUMAN 2

Apolipoprotein O-like Q6UXV4 APOOL_HUMAN 2

ATPase inhibitor, mitochondrial Q9UII2 ATIF1_HUMAN 2

BolA-like protein 2 Q9H3K6 BOLA2_HUMAN 2

cDNA FLJ53554 B4DGK4 B4DGK4_HUMAN 2

Clathrin heavy chain 1 Q00610 CLH1_HUMAN 2

Cooperator of PRMT5 Q9NQ92 COPR5_HUMAN 2

Dedicator of cytokinesis protein 10 Q96BY6 DOC10_HUMAN 2

DNA excision repair protein ERCC-6-like Q2NKX8 ERC6L_HUMAN 2

Dolichyl-diphosphooligosaccharide--protein P04844 RPN2_HUMAN 2 glycosyltransferase subunit 2

Epiplakin P58107 EPIPL_HUMAN 2

Exportin-1 O14980 XPO1_HUMAN 2

Far upstream element-binding protein 2 Q92945 FUBP2_HUMAN 2

GTP-binding nuclear protein Ran P62826 RAN_HUMAN 2

Heat shock-related 70 kDa protein 2 P54652 HSP72_HUMAN 2

Heterogeneous nuclear ribonucleoprotein C-like 1 O60812 HNRCL_HUMAN 2 Heterogeneous nuclear ribonucleoprotein G P38159 HNRPG_HUMAN 2

High mobility group protein B3 O15347 HMGB3_HUMAN 2

Histone H2B type 1-A Q96A08 H2B1A_HUMAN 2

Histone-binding protein RBBP4 Q09028 RBBP4_HUMAN 2

Histone-lysine N-methyltransferase MLL2 O14686 MLL2_HUMAN 2

Hsc70-interacting protein P50502 F10A1_HUMAN 2

Microtubule-associated protein 1B P46821 MAP1B_HUMAN 2

Mitochondrial import receptor subunit TOM70 O94826 TOM70_HUMAN 2

NAD(P) transhydrogenase, mitochondrial Q13423 NNTM_HUMAN 2

NADH-ubiquinone oxidoreductase 75 kDa subunit, P28331 NDUS1_HUMAN 2 mitochondrial

Neuropilin 2, isoform CRA_g Q9H2E2 Q9H2E2_HUMAN 2

Neutral alpha-glucosidase AB Q14697 GANAB_HUMAN 2

NFX1-type zinc finger-containing protein 1 Q9P2E3 ZNFX1_HUMAN 2

Nuclear pore complex protein Nup160 Q12769 NU160_HUMAN 2

Poly [ADP-ribose] polymerase 1 P09874 PARP1_HUMAN 2

Prefoldin subunit 5 Q99471 PFD5_HUMAN 2

Protein 4.1 P11171 41_HUMAN 2

Protein ACN9 homolog, mitochondrial Q9NRP4 ACN9_HUMAN 2

Protein cordon-bleu O75128 COBL_HUMAN 2

Protein TFG Q92734 TFG_HUMAN 2

Protein transport protein Sec61 subunit beta P60468 SC61B_HUMAN 2

Ras-related protein Rab-25 P57735 RAB25_HUMAN 2

Ras-related protein Rab-5A P20339 RAB5A_HUMAN 2

RNA-binding protein 14 Q96PK6 RBM14_HUMAN 2

Serine/arginine-rich splicing factor 6 Q13247 SRSF6_HUMAN 2

Sodium-coupled neutral amino acid transporter 1 Q9H2H9 S38A1_HUMAN 2

Src substrate cortactin Q14247 SRC8_HUMAN 2

Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, P21912 DHSB_HUMAN 2 mitochondrial

Survival of motor neuron-related-splicing factor 30 O75940 SPF30_HUMAN 2

Thioredoxin domain-containing protein 12 O95881 TXD12_HUMAN 2

Transketolase-like protein 1 P51854 TKTL1_HUMAN 2

Translational activator GCN1 Q92616 GCN1L_HUMAN 2

Transmembrane protein 33 P57088 TMM33_HUMAN 2

Tyrosine aminotransferase P17735 ATTY_HUMAN 2

U2-associated protein SR140 O15042 SR140_HUMAN 2

1,25-dihydroxyvitamin D(3) 24-hydroxylase, mitochondrial Q07973 CP24A_HUMAN 1 10 kDa heat shock protein, mitochondrial P61604 CH10_HUMAN 1

1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase Q01970 PLCB3_HUMAN 1 beta-3

1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase Q9P212 PLCE1_HUMAN 1 epsilon-1

26S protease regulatory subunit 4 P62191 PRS4_HUMAN 1

26S protease regulatory subunit 7 P35998 PRS7_HUMAN 1

26S protease regulatory subunit 8 P62195 PRS8_HUMAN 1

26S proteasome non-ATPase regulatory subunit 13 Q9UNM6 PSD13_HUMAN 1

26S proteasome non-ATPase regulatory subunit 6 Q15008 PSMD6_HUMAN 1

3-ketoacyl-CoA thiolase, peroxisomal P09110 THIK_HUMAN 1

40S ribosomal protein S12 P25398 RS12_HUMAN 1

40S ribosomal protein S15a P62244 RS15A_HUMAN 1

40S ribosomal protein S17 P08708 RS17_HUMAN 1

40S ribosomal protein S7 P62081 RS7_HUMAN 1

40S ribosomal protein S8 P62241 RS8_HUMAN 1

60S ribosomal protein L17 P18621 RL17_HUMAN 1

60S ribosomal protein L22 P35268 RL22_HUMAN 1

60S ribosomal protein L23 P62829 RL23_HUMAN 1

60S ribosomal protein L24 P83731 RL24_HUMAN 1

A disintegrin and metalloproteinase with thrombospondin Q9UNA0 ATS5_HUMAN 1 motifs 5

A disintegrin and metalloproteinase with thrombospondin Q9P2N4 ATS9_HUMAN 1 motifs 9

Adenomatous polyposis coli protein P25054 APC_HUMAN 1

Adipocyte plasma membrane-associated protein Q9HDC9 APMAP_HUMAN 1

ADP-sugar pyrophosphatase Q9UKK9 NUDT5_HUMAN 1

Afamin P43652 AFAM_HUMAN 1

A-kinase anchor protein 12 Q02952 AKA12_HUMAN 1

Alanine aminotransferase 2 Q8TD30 ALAT2_HUMAN 1

Alpha-centractin P61163 ACTZ_HUMAN 1

AminoacyltRNA synthase complex-interacting multifunctional Q12904 AIMP1_HUMAN 1 protein 1

Antigen KI-67 P46013 KI67_HUMAN 1

Apoptotic chromatin condensation inducer in the nucleus Q9UKV3 ACINU_HUMAN 1

Ataxin-7-like protein 2 Q5T6C5 AT7L2_HUMAN 1

ATP synthase subunit d, mitochondrial O75947 ATP5H_HUMAN 1

ATP-binding cassette sub-family B member 7, mitochondrial O75027 ABCB7_HUMAN 1

ATP-dependent RNA helicase DDX42 Q86XP3 DDX42_HUMAN 1

AT-rich interactive domain-containing protein 4B Q4LE39 ARI4B_HUMAN 1

Autophagy-related protein 2 homolog B Q96BY7 ATG2B_HUMAN 1 BRI3-binding protein Q8WY22 BRI3B_HUMAN 1

BTB/POZ domain-containing protein KCTD17 Q8N5Z5 KCD17_HUMAN 1

BTB/POZ domain-containing protein KCTD2 Q14681 KCTD2_HUMAN 1

C2 domain-containing protein 3 Q4AC94 C2CD3_HUMAN 1

Calcium homeostasis endoplasmic reticulum protein Q8IWX8 CHERP_HUMAN 1

Calcium-activated potassium channel subunit alpha-1 Q12791 KCMA1_HUMAN 1

cAMP-dependent protein kinase catalytic subunit alpha P17612 KAPCA_HUMAN 1

Cation-independent mannose-6-phosphate receptor P11717 MPRI_HUMAN 1

CCAAT/enhancer-binding protein zeta Q03701 CEBPZ_HUMAN 1

CCR4-NOT transcription complex subunit 1 A5YKK6 CNOT1_HUMAN 1

CDNA FLJ25552 fis, clone JTH02127 Q8N7H8 Q8N7H8_HUMAN 1 cDNA FLJ46673 fis, clone TRACH3009061, weakly similar to Q6ZR43 Q6ZR43_HUMAN 1 ATP-binding cassette, sub-family A member 1 cDNA FLJ52040, highly similar to Mus musculus BCL2- associated transcription factor 1 (Bclaf1), transcript variant 3, B7Z8J9 B7Z8J9_HUMAN 1 mRNA cDNA FLJ52796, highly similar to Homo sapiens FGF B7Z7G6 B7Z7G6_HUMAN 1 receptor activating protein 1 (FRAG1), mRNA

cDNA FLJ53883, highly similar to C-jun-amino-terminal B7Z1L7 B7Z1L7_HUMAN 1 kinase-interacting protein 1

cDNA FLJ54922 B4DX64 B4DX64_HUMAN 1

cDNA FLJ59066 B7Z7H7 B7Z7H7_HUMAN 1

CDNA: FLJ23584 fis, clone LNG14307 Q9H5C5 Q9H5C5_HUMAN 1

Cell adhesion molecule 3 Q8N126 CADM3_HUMAN 1

Cell division cycle 5-like protein Q99459 CDC5L_HUMAN 1

Cell division protein kinase 12 Q9NYV4 CDK12_HUMAN 1

Centrosomal protein of 152 kDa O94986 CE152_HUMAN 1

Charged multivesicular body protein 4b Q9H444 CHM4B_HUMAN 1

Chromodomain-helicase-DNA-binding protein 3 Q12873 CHD3_HUMAN 1

Chromodomain-helicase-DNA-binding protein 5 Q8TDI0 CHD5_HUMAN 1

Class E basic helix-loop-helix protein 41 Q9C0J9 BHE41_HUMAN 1

Cleavage and polyadenylation specificity factor subunit 6 Q16630 CPSF6_HUMAN 1

Cleavage and polyadenylation specificity factor subunit 7 Q8N684 CPSF7_HUMAN 1

Cleavage stimulation factor subunit 2 P33240 CSTF2_HUMAN 1

C-myc promoter-binding protein Q7Z401 MYCPP_HUMAN 1

Coatomer subunit alpha P53621 COPA_HUMAN 1

Coatomer subunit gamma-2 Q9UBF2 COPG2_HUMAN 1

Cofilin-1 P23528 COF1_HUMAN 1

Coiled-coil domain-containing protein 38 Q502W7 CCD38_HUMAN 1

Coiled-coil domain-containing protein 9 Q9Y3X0 CCDC9_HUMAN 1

Collagen alpha-1(XVII) chain Q9UMD9 COHA1_HUMAN 1 Complement C1q tumor necrosis factor-related protein 2 Q9BXJ5 C1QT2_HUMAN 1

Complement factor H P08603 CFAH_HUMAN 1

Coproporphyrinogen-III oxidase, mitochondrial P36551 HEM6_HUMAN 1

Cullin-7 Q14999 CUL7_HUMAN 1

Cytochrome c oxidase subunit 5B, mitochondrial P10606 COX5B_HUMAN 1

Cytochrome c oxidase subunit 7A-related protein, O14548 COX7R_HUMAN 1 mitochondrial

Cytoplasmic dynein 1 light intermediate chain 1 Q9Y6G9 DC1L1_HUMAN 1

Cytosolic acyl coenzyme A thioester hydrolase O00154 BACH_HUMAN 1

Dapper homolog 3 Q96B18 DACT3_HUMAN 1

DCC-interacting protein 13-alpha Q9UKG1 DP13A_HUMAN 1

DDB1- and CUL4-associated factor 7 P61962 DCAF7_HUMAN 1

Dedicator of cytokinesis protein 2 Q92608 DOCK2_HUMAN 1

Dedicator of cytokinesis protein 3 Q8IZD9 DOCK3_HUMAN 1

Deoxyribonuclease-2-beta Q8WZ79 DNS2B_HUMAN 1

Diablo homolog, mitochondrial Q9NR28 DBLOH_HUMAN 1

DNA topoisomerase 2-alpha P11388 TOP2A_HUMAN 1

Dolichyl-diphosphooligosaccharide--protein P61803 DAD1_HUMAN 1 glycosyltransferase subunit DAD1

Dual specificity phosphatase 15 (Fragment) Q5QP64 Q5QP64_HUMAN 1

Dynactin subunit 1 Q14203 DCTN1_HUMAN 1

Dynein light chain 1, cytoplasmic P63167 DYL1_HUMAN 1

E3 ubiquitin-protein ligase NEURL1B A8MQ27 NEU1B_HUMAN 1

Ectonucleotidepyrophosphatase/phosphodiesterase family Q6UWV6 ENPP7_HUMAN 1 member 7

EH domain-binding protein 1-like protein 1 Q8N3D4 EH1L1_HUMAN 1

Elongation factor 1-delta P29692 EF1D_HUMAN 1

Elongation factor Tu, mitochondrial P49411 EFTU_HUMAN 1

Endonuclease 8-like 1 Q96FI4 NEIL1_HUMAN 1

Ensconsin Q14244 MAP7_HUMAN 1

Envoplakin Q92817 EVPL_HUMAN 1

Ephrin type-A receptor 7 Q15375 EPHA7_HUMAN 1

Epidermal growth factor-like protein 7 Q9UHF1 EGFL7_HUMAN 1

Eukaryotic translation initiation factor 1A, X-chromosomal P47813 IF1AX_HUMAN 1

Eukaryotic translation initiation factor 3 subunit G O75821 EIF3G_HUMAN 1

Eukaryotic translation initiation factor 3 subunit I Q13347 EIF3I_HUMAN 1

Eukaryotic translation initiation factor 6 P56537 IF6_HUMAN 1

Exosome complex exonuclease RRP44 Q9Y2L1 RRP44_HUMAN 1

Exportin-7 Q9UIA9 XPO7_HUMAN 1 FAS-associated factor 2 Q96CS3 FAF2_HUMAN 1

Fatty acyl-CoA reductase 1 Q8WVX9 FACR1_HUMAN 1

Fibronectin type III and SPRY domain-containing protein 2 A1L4K1 FSD2_HUMAN 1

FL cytokine receptor P36888 FLT3_HUMAN 1

Frizzled-5 Q13467 FZD5_HUMAN 1

FRMD4B protein (Fragment) Q6PEW6 Q6PEW6_HUMAN 1

G patch domain-containing protein 1 Q9BRR8 GPTC1_HUMAN 1

Gamma-aminobutyric acid type B receptor subunit 2 O75899 GABR2_HUMAN 1

Gasdermin-A Q96QA5 GSDMA_HUMAN 1

GLIS family zinc finger 3 transcript variant TS22 (fragment) Q1PHI1 Q1PHI1_HUMAN 1

Glutathione S-transferase P P09211 GSTP1_HUMAN 1

Glyceraldehyde-3-phosphate dehydrogenase P04406 G3P_HUMAN 1

Glypican-2 Q8N158 GPC2_HUMAN 1

G-protein coupled receptor family C group 5 member B Q9NZH0 GPC5B_HUMAN 1

G-protein-si Q86YR5 GPSM1_HUMAN 1

Granulocyte colony-stimulating factor receptor Q99062 CSF3R_HUMAN 1

Guanine nucleotide-binding protein subunit beta-2-like 1 P63244 GBLP_HUMAN 1

HCG2039358, isoform CRA_b Q8NA48 Q8NA48_HUMAN 1

HCLS1-associated protein X-1 O00165 HAX1_HUMAN 1

Heat shock 70 kDa protein 4L O95757 HS74L_HUMAN 1

Heat shock protein 105 kDa Q92598 HS105_HUMAN 1

Heterogeneous nuclear ribonucleoprotein M P52272 HNRPM_HUMAN 1

Histone deacetylase 6 Q9UBN7 HDAC6_HUMAN 1

Histone H2B type 1-B P33778 H2B1B_HUMAN 1

Histone-lysine N-methyltransferase MLL3 Q8NEZ4 MLL3_HUMAN 1

Homeobox protein Nkx-2.1 P43699 NKX21_HUMAN 1

Hyccin Q9BYI3 HYCCI_HUMAN 1

Importin-4 Q8TEX9 IPO4_HUMAN 1

Inactive ubiquitin carboxyl-terminal hydrolase 54 Q70EL1 UBP54_HUMAN 1

Influenza virus NS1A-binding protein Q9Y6Y0 NS1BP_HUMAN 1

Integrin alpha-V P06756 ITAV_HUMAN 1

Interferon-induced protein with tetratricopeptide repeats 5 Q13325 IFIT5_HUMAN 1

Isoleucyl-tRNAsynthetase, cytoplasmic P41252 SYIC_HUMAN 1

Kelch-like protein 20 Q9Y2M5 KLH20_HUMAN 1

Kinesin-1 heavy chain P33176 KINH_HUMAN 1

Kinesin-like protein KIF22 Q14807 KIF22_HUMAN 1 Kinesin-like protein KIF3C O14782 KIF3C_HUMAN 1

Lamin-B receptor Q14739 LBR_HUMAN 1

Laminin subunit alpha-2 P24043 LAMA2_HUMAN 1

Laminin subunit alpha-3 Q16787 LAMA3_HUMAN 1

La-related protein 1 Q6PKG0 LARP1_HUMAN 1

Leiomodin-1 P29536 LMOD1_HUMAN 1

Leiomodin-3 Q0VAK6 LMOD3_HUMAN 1

LETM1 and EF-hand domain-containing protein 1, O95202 LETM1_HUMAN 1 mitochondrial

Leucine zipper putative tumor suppressor 1 Q9Y250 LZTS1_HUMAN 1

Leucine-rich repeat and IQ domain-containing protein 3 A6PVS8 LRIQ3_HUMAN 1

Leucine-rich repeat transmembrane protein FLRT1 Q9NZU1 FLRT1_HUMAN 1

Leucine-rich repeat-containing protein 53 A6NM62 LRC53_HUMAN 1

Leucine-rich repeat-containing protein 8E Q6NSJ5 LRC8E_HUMAN 1

LIM domain kinase 1 P53667 LIMK1_HUMAN 1

LIM domain kinase 2 P53671 LIMK2_HUMAN 1

Low molecular weight phosphotyrosine protein phosphatase P24666 PPAC_HUMAN 1

Melanoma ubiquitous mutated protein (Fragment) Q13110 Q13110_HUMAN 1

Membrane-associated progesterone receptor component 1 O00264 PGRC1_HUMAN 1

Metastasis-associated in colon cancer protein 1 Q6ZN28 MACC1_HUMAN 1

Methyl-CpG-binding domain protein 5 Q9P267 MBD5_HUMAN 1

Microprocessor complex subunit DGCR8 Q8WYQ5 DGCR8_HUMAN 1

Microtubule-associated protein 9 Q49MG5 MAP9_HUMAN 1

Microtubule-associated serine/threonine-protein kinase 4 O15021 MAST4_HUMAN 1

Mitochondrial import inner membrane translocase subunit P62072 TIM10_HUMAN 1 Tim10

Mitochondrial import inner membrane translocase subunit O60220 TIM8A_HUMAN 1 Tim8 A

Mitochondrial import receptor subunit TOM22 homolog Q9NS69 TOM22_HUMAN 1

Mitoferrin-2 Q96A46 MFRN2_HUMAN 1

Mitotic checkpoint protein BUB3 O43684 BUB3_HUMAN 1

Monocarboxylate transporter 1 P53985 MOT1_HUMAN 1

M-phase inducer phosphatase 3 P30307 MPIP3_HUMAN 1

Mps one binder kinase activator-like 2 Q70IA6 MOB2_HUMAN 1

Mucin-16 Q8WXI7 MUC16_HUMAN 1

Multidrug resistance-associated protein 9 Q96J65 MRP9_HUMAN 1

Muscarinic acetylcholine receptor M5 P08912 ACM5_HUMAN 1

My003 protein Q9H3L6 Q9H3L6_HUMAN 1

Myosin-11 P35749 MYH11_HUMAN 1 Myosin-If O00160 MYO1F_HUMAN 1

NADH dehydrogenase [ubiquinone] 1 alpha subcomplex Q9P032 NDUF4_HUMAN 1 assembly factor 4

NADP-dependent malic enzyme, mitochondrial Q16798 MAON_HUMAN 1

Nascent polypeptide-associated complex subunit alpha Q13765 NACA_HUMAN 1

Nck-associated protein 5-like Q9HCH0 NCK5L_HUMAN 1

Neutral amino acid transporter B(0) Q15758 AAAT_HUMAN 1

Nexilin Q0ZGT2 NEXN_HUMAN 1

NFATC2-interacting protein Q8NCF5 NF2IP_HUMAN 1

NF-kappa-B essential modulator Q9Y6K9 NEMO_HUMAN 1

Nodal modulator 1 Q15155 NOMO1_HUMAN 1

Noggin Q13253 NOGG_HUMAN 1

Non-POU domain-containing octamer-binding protein Q15233 NONO_HUMAN 1

Non-structural maintenance of chromosomes element 1 Q8WV22 NSE1_HUMAN 1 homolog

Nuclear pore membrane glycoprotein 210-like Q5VU65 P210L_HUMAN 1

Nucleobindin-2 P80303 NUCB2_HUMAN 1

Nucleolar protein 9 Q5SY16 NOL9_HUMAN 1

Nucleoporin NDC1 Q9BTX1 NDC1_HUMAN 1

Nucleoporin NUP188 homolog Q5SRE5 NU188_HUMAN 1

Olfactory receptor 2AJ1 Q8NGZ0 O2AJ1_HUMAN 1

Olfactory receptor 6J1 Q8NGC5 OR6J1_HUMAN 1

Outer dense fiber protein 2 Q5BJF6 ODFP2_HUMAN 1

PCI domain-containing protein 2 Q5JVF3 PCID2_HUMAN 1

PDZ domain-containing protein 2 O15018 PDZD2_HUMAN 1

Peptidyl-prolylcis-trans isomerase B P23284 PPIB_HUMAN 1

Peptidyl-prolylcis-trans isomerase FKBP6 O75344 FKBP6_HUMAN 1

Peptidyl-prolylcis-trans isomerase-like 3 Q9H2H8 PPIL3_HUMAN 1

Peroxiredoxin-6 P30041 PRDX6_HUMAN 1

PEX5-related protein Q8IYB4 PEX5R_HUMAN 1

Phenylalanyl-tRNAsynthetase alpha chain Q9Y285 SYFA_HUMAN 1

Phosphatidylinositol transfer protein beta isoform P48739 PIPNB_HUMAN 1

Phosphoglycerate kinase 1 P00558 PGK1_HUMAN 1

Phosphoserine aminotransferase Q9Y617 SERC_HUMAN 1

Pleckstrin homology domain-containing family H member 3 Q7Z736 PKHH3_HUMAN 1

Podocalyxin O00592 PODXL_HUMAN 1

Potassium voltage-gated channel sub-family H member 3 Q9ULD8 KCNH3_HUMAN 1

POU domain, class 2, transcription factor 2 P09086 PO2F2_HUMAN 1 Prefoldin subunit 4 Q9NQP4 PFD4_HUMAN 1

Pre-mRNA 3′-end-processing factor FIP1 Q6UN15 FIP1_HUMAN 1

Probable ATP-dependent RNA helicase DDX5 P17844 DDX5_HUMAN 1

Probable cytosolic iron-sulfur protein assembly protein CIAO1 O76071 CIAO1_HUMAN 1

Probable E3 ubiquitin-protein ligase makorin-3 Q13064 MKRN3_HUMAN 1

Probable G-protein coupled receptor 37 O15354 GPR37_HUMAN 1

Probable histone acetyltransferase MYST1 Q9H7Z6 MYST1_HUMAN 1

Probable serine carboxypeptidase CPVL Q9H3G5 CPVL_HUMAN 1

Probable ubiquitin carboxyl-terminal hydrolase FAF-X Q93008 USP9X_HUMAN 1

Profilin-2 P35080 PROF2_HUMAN 1

Prolyl 4-hydroxylase subunit alpha-3 Q7Z4N8 P4HA3_HUMAN 1

Proteasome subunit alpha type-5 P28066 PSA5_HUMAN 1

Proteasome subunit alpha type-7-like Q8TAA3 PSA7L_HUMAN 1

Protein bicaudal D homolog 2 Q8TD16 BICD2_HUMAN 1

Protein CASP Q13948 CASP_HUMAN 1

Protein delta homolog 2 Q6UY11 DLK2_HUMAN 1

Protein DEPP Q9NTK1 DEPP_HUMAN 1

Protein disulfide-isomerase A3 P30101 PDIA3_HUMAN 1

Protein disulfide-isomerase A4 P13667 PDIA4_HUMAN 1

Protein dpy-19 homolog 1 Q2PZI1 D19L1_HUMAN 1

Protein FAM123A Q8N7J2 F123A_HUMAN 1

Protein FAM181A Q8N9Y4 F181A_HUMAN 1

Protein FAM19A3 Q7Z5A8 F19A3_HUMAN 1

Protein FAM98B Q52LJ0 FA98B_HUMAN 1

Protein GDF5OS, mitochondrial Q5U4N7 GDF5O_HUMAN 1

Protein LSM14 homolog B Q9BX40 LS14B_HUMAN 1

Protein Mdm4 O15151 MDM4_HUMAN 1

Protein MRVI1 Q9Y6F6 MRVI1_HUMAN 1

Protein NipSnap homolog 1 Q9BPW8 NIPS1_HUMAN 1

Protein prune homolog 2 Q8WUY3 PRUN2_HUMAN 1

Protein yippee-like 5 P62699 YPEL5_HUMAN 1

Protogenin Q2VWP7 PRTG_HUMAN 1

Putative cytochrome b-c1 complex subunit Rieske-like protein P0C7P4 UCRIL_HUMAN 1 1

Putative high mobility group protein B1-like 1 B2RPK0 HGB1A_HUMAN 1

Putative methyltransferase NSUN5C Q63ZY6 NSN5C_HUMAN 1

Putative methyltransferase NSUN7 Q8NE18 NSUN7_HUMAN 1 Putative p150 O00363 O00363_HUMAN 1

Putative protein arginine N-methyltransferase 10 Q6P2P2 ANM10_HUMAN 1

Putative serum amyloid A-3 protein P22614 SAA3_HUMAN 1

Putative signal peptidase complex catalytic subunit P0C7V7 SC11B_HUMAN 1

Q8WUC7_HUMA Putative uncharacterized protein (fragment) Q8WUC7 1 N

Putative uncharacterized protein DKFZp686H1615 Q7Z3I4 Q7Z3I4_HUMAN 1

RasGTPase-activating protein-binding protein 2 Q9UN86 G3BP2_HUMAN 1

Ras-related protein Rab-33A Q14088 RB33A_HUMAN 1

Ras-related protein Rab-9A P51151 RAB9A_HUMAN 1

RcNSEP1 (fragment) Q2VIK8 Q2VIK8_HUMAN 1

Receptor expression-enhancing protein 5 Q00765 REEP5_HUMAN 1

Regulator of nonsense transcripts 3B Q9BZI7 REN3B_HUMAN 1

Reticulon-4 Q9NQC3 RTN4_HUMAN 1

Retinol dehydrogenase 11 Q8TC12 RDH11_HUMAN 1

Rho GTPase-activating protein 10 A1A4S6 RHG10_HUMAN 1

Rho GTPase-activating protein 11A Q6P4F7 RHGBA_HUMAN 1

Rho-guanine nucleotide exchange factor Q8N1W1 RGNEF_HUMAN 1

RING finger protein 113B Q8IZP6 R113B_HUMAN 1

RNA polymerase II-associated protein 3 Q9H6T3 RPAP3_HUMAN 1

RNA-binding protein 26 Q5T8P6 RBM26_HUMAN 1

Septin-2 Q15019 SEPT2_HUMAN 1

Serine palmitoyltransferase 1 O15269 SPTC1_HUMAN 1

Serine/threonine-protein kinase SMG1 Q96Q15 SMG1_HUMAN 1

Serine/threonine-protein kinase TAO3 Q9H2K8 TAOK3_HUMAN 1

Serine/threonine-protein kinase WNK2 Q9Y3S1 WNK2_HUMAN 1

Serpin A12 Q8IW75 SPA12_HUMAN 1

SH3 and PX domain-containing protein 2B A1X283 SPD2B_HUMAN 1

SLAIN motif-containing protein 2 Q9P270 SLAI2_HUMAN 1

SLIT and NTRK-like protein 5 O94991 SLIK5_HUMAN 1

Small G protein signaling modulator 3 Q96HU1 SGSM3_HUMAN 1

Small nuclear ribonucleoprotein F P62306 RUXF_HUMAN 1

Snurportin-1 O95149 SPN1_HUMAN 1

Sodium/hydrogen exchanger 4 Q6AI14 SL9A4_HUMAN 1

Sodium-dependent phosphate transport protein 2B O95436 NPT2B_HUMAN 1

Solute carrier family 22 member 11 Q9NSA0 S22AB_HUMAN 1

Solute carrier family 25 member 45 Q8N413 S2545_HUMAN 1 Sp110 nuclear body protein Q9HB58 SP110_HUMAN 1

Specifically androgen-regulated gene protein Q9BW04 SARG_HUMAN 1

Splicing factor 3B subunit 5 Q9BWJ5 SF3B5_HUMAN 1

Suppressor of IKBKE 1 Q9BRV8 SIKE1_HUMAN 1

Survival motor neuron protein Q16637 SMN_HUMAN 1

Sushi repeat-containing protein SRPX P78539 SRPX_HUMAN 1

Synaptic vesicle membrane protein VAT-1 homolog Q99536 VAT1_HUMAN 1

Tau-tubulin kinase 2 Q6IQ55 TTBK2_HUMAN 1

T-complex protein 1 subunit beta P78371 TCPB_HUMAN 1

T-complex protein 1 subunit gamma P49368 TCPG_HUMAN 1

T-complex protein 1 subunit zeta-2 Q92526 TCPW_HUMAN 1

Testis-specific serine/threonine-protein kinase 2 Q96PF2 TSSK2_HUMAN 1

TGF-beta-activated kinase 1 and MAP3K7-binding protein 3 Q8N5C8 TAB3_HUMAN 1

Thioredoxin P10599 THIO_HUMAN 1

Thioredoxin-related transmembrane protein 1 Q9H3N1 TMX1_HUMAN 1

Titin Q8WZ42 TITIN_HUMAN 1

Transcription elongation factor B polypeptide 2 Q15370 ELOB_HUMAN 1

Transcription factor E2F7 Q96AV8 E2F7_HUMAN 1

Transcription factor-like 5 protein Q9UL49 TCFL5_HUMAN 1

Transforming acidic coiled-coil-containing protein 1 O75410 TACC1_HUMAN 1

Translocation protein SEC62 Q99442 SEC62_HUMAN 1

Transmembrane emp24 domain-containing protein 9 Q9BVK6 TMED9_HUMAN 1

Transmembrane protein 55B Q86T03 TM55B_HUMAN 1

tRNAwybutosine-synthesizing protein 3 homolog Q6IPR3 TYW3_HUMAN 1

Troponin I, cardiac muscle P19429 TNNI3_HUMAN 1

Tubulin beta-3 chain Q13509 TBB3_HUMAN 1

Tubulin beta-6 chain Q9BUF5 TBB6_HUMAN 1

Tyrosine-protein phosphatase non-receptor type 3 P26045 PTN3_HUMAN 1

U2 small nuclear ribonucleoprotein B P08579 RU2B_HUMAN 1

U3 small nucleolar RNA-associated protein 6 homolog Q9NYH9 UTP6_HUMAN 1

Ubiquitin-associated protein 2-like Q14157 UBP2L_HUMAN 1

UDP-N-acetylglucosamine transferase subunit ALG13 Q9NP73 ALG13_HUMAN 1 homolog

Uncharacterized protein C9JX15 C9JX15_HUMAN 1

Uncharacterized protein C9JG04 C9JG04_HUMAN 1

Uncharacterized protein A8MT86 A8MT86_HUMAN 1

Uncharacterized protein C9JH24 C9JH24_HUMAN 1 Uncharacterized protein C12orf55 Q96N23 CL055_HUMAN 1

Uncharacterized protein C13orf23 Q86XN7 CM023_HUMAN 1

Uncharacterized protein C1orf175 Q68CQ1 CA175_HUMAN 1

Uncharacterized protein C20orf151 Q8NC74 CT151_HUMAN 1

Uncharacterized protein C3orf14 Q9HBI5 CC014_HUMAN 1

Uncharacterized protein C3orf33 Q6P1S2 CC033_HUMAN 1

Uncharacterized protein KIAA0090 Q8N766 K0090_HUMAN 1

Uncharacterized protein KIAA0754 O94854 K0754_HUMAN 1

Uncharacterized protein KIAA1683 Q9H0B3 K1683_HUMAN 1

UPF0587 protein C1orf123 Q9NWV4 CA123_HUMAN 1

Urotensin-2 O95399 UTS2_HUMAN 1

Vacuolar fusion protein MON1 homolog B Q7L1V2 MON1B_HUMAN 1

Vacuolar protein sorting-associated protein 13B Q7Z7G8 VP13B_HUMAN 1

Vacuolar protein sorting-associated protein 37D Q86XT2 VP37D_HUMAN 1

Ventral anterior homeobox 2 Q9UIW0 VAX2_HUMAN 1

Vesicle transport through interaction with t-SNAREs homolog Q9UEU0 VTI1B_HUMAN 1 1B

Vesicle-fusing ATPase P46459 NSF_HUMAN 1

Voltage-dependent calcium channel subunit alpha-2/delta-1 P54289 CA2D1_HUMAN 1

WD repeat-containing protein 5B Q86VZ2 WDR5B_HUMAN 1

WD repeat-containing protein 67 Q96DN5 WDR67_HUMAN 1

Xin actin-binding repeat-containing protein 1 Q702N8 XIRP1_HUMAN 1

YTH domain family protein 2 Q9Y5A9 YTHD2_HUMAN 1

Zinc finger FYVE domain-containing protein 27 Q5T4F4 ZFY27_HUMAN 1

Zinc finger protein 276, isoform CRA A8K186 A8K186_HUMAN 1

Zinc finger protein 350 Q9GZX5 ZN350_HUMAN 1

Zinc finger protein 540 Q8NDQ6 ZN540_HUMAN 1

Zinc finger protein 585B Q52M93 Z585B_HUMAN 1

Zinc finger protein 646 O15015 ZN646_HUMAN 1

Zinc finger protein 828 Q96JM3 ZN828_HUMAN 1

1Peptides in the elution from experiment 2 of the FLAG-TET2, but not control, affinity purification;2TET2 peptide counts after subtraction of control peptides.