DOCSLIB.ORG

Ruijia Wang Dissertation Final.Pdf (2.726Mb)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ruijia Wang Dissertation Final.Pdf (2.726Mb) Bulk segregant RNA-seq reveals expression and positional candidate genes and allele-specific expression for disease resistance against enteric septicemia of catfish by Ruijia Wang A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama December 14, 2013 Key word: Bulk segregant analysis (BSA); Bulk segregant RNA-seq (BSR-Seq); Bulk frequency ratio (BFR); Disease resistance; catfish; Allele-specific expression Copyright 2013 by Ruijia Wang Approved by Zhanjiang Liu, Chair, Alumni Professor, School of Fisheries David Rouse, Alumni Professor, School of Fisheries, Nannan Liu, Professor, Department of Entomology and Plant Pathology Jeffery Terhune, Associate Professor, School of Fisheries Abstract The application of RNA-seq has accelerated gene expression profiling and identification of gene-associated SNPs in many species. However, the integrated studies of gene expression along with SNP mapping have been lacking. Coupling of RNA-seq with bulked segregant analysis (BSA) should allow correlation of expression patterns and associated SNPs with the correlated phenotypes. In this study, we demonstrated the use of bulked segregant RNA-seq (BSR-Seq) for the analysis of differentially expressed genes and associated SNPs with disease resistance against enteric septicemia of catfish (ESC). A total of 1,255 differentially expressed genes were found between resistant and susceptible fish. In addition, 56,419 SNPs were identified as significant SNPs between susceptible and resistant fish located on 4,304 unique genes. Mapping of the significant SNPs, along with analysis of differentially expressed genes, allowed identification of candidate genes underlining disease resistance against ESC disease. This study demonstrated the use of BSR-Seq for the identification of genes involved in disease resistance against ESC through expression profiling and mapping of significantly associated SNPs. BSR-Seq is applicable to analysis of genes underlining various performance and production traits without significant investment in the development of large genotyping platforms such as SNP arrays. ii Acknowledgments The author is very grateful to Dr. Zhanjiang Liu for his constant guidance, support and patience in the past years. I have been very fortunate in having Dr. Zhanjiang Liu as my supervisors. His scientific attitude and philosophy have had a profound influence on me. I am also is grateful for time and expertise offered to me by my committee members: Dr. Nannan Liu, Dr. David Rouse and Dr. Jeffery Terhune, and the dissertation outside reader, Dr. Bernhard Kaltenboeck. I would also like to express my gratitude to Huseyin Kucuktas and Ludmilla Kaltenboeck for technical help, and the colleagues in the laboratory for their help, collaboration, and friendship. I am grateful to my parents and my beloved wife for their endless love and support. iii Table of Contents Abstract ........................................................................................................................................... ii Acknowledgments .......................................................................................................................... iii List of Tables .................................................................................................................................. ii List of Illustrations ......................................................................................................................... iii List of Abbreviations ..................................................................................................................... iv I. Introduction and literature review ............................................................................................... 1 I.1 ESC disease in channel catfish .......................................................................................... 1 I.2 SNPs studies in catfish and other species .......................................................................... 2 I.3 Deep sequencing of transcriptome response to bacterium infection ................................. 3 I.4 BSA and BSR-seq ............................................................................................................. 4 II Materials and methods................................................................................................................. 7 II.1 ESC bacterial challenge.................................................................................................... 7 II.2 Sampling and RNA isolation ............................................................................................ 8 II.3 Illumina sequencing ......................................................................................................... 8 II.4 De novo assembly ............................................................................................................. 9 II.5 Gene identification and annotation................................................................................... 9 II.6 Transcript-level gene expression analysis of different groups ....................................... 10 II.7 Sequencing mapping and significant SNP identification ............................................... 10 II.8 Analysis of bulk frequency ratios and allele specific expression ................................... 11 ii II.9 Genomic location of ESC resistance-related genes ........................................................ 12 III Results ...................................................................................................................................... 12 III.1 Sequence assembly and analysis ................................................................................... 12 III.2 Differentially expressed genes after infection .............................................................. 14 III.3 Comparison of gene expression in resistant fish and susceptible fish after infection ................................................................................................................................ 15 III.4 Identification of SNPs and significant SNPs ................................................................ 51 III.5 Bulk frequency ratios .................................................................................................... 52 III.6 Genes with large BFR caused by genetic segregation .................................................. 63 III.7 Genes with large BFR caused by allele-specific expression......................................... 67 III.8 Location of genes with high bulk frequency ratio (BFR) ............................................. 70 III.9 Parental origin of highly expressed alleles ................................................................... 76 IV Discussion ................................................................................................................................ 79 Involves in polyamine homeostasis .............................................................................................. 86 V Conclusions ............................................................................................................................... 89 Reference ...................................................................................................................................... 90 iii List of Tables Table 1 ....................................................................................................................................... 20 Table 2 ....................................................................................................................................... 21 Table 3 ....................................................................................................................................... 23 Table 4 ....................................................................................................................................... 24 Table 5 ....................................................................................................................................... 56 Table 6 ....................................................................................................................................... 59 Table 7 ....................................................................................................................................... 60 Table 8 ....................................................................................................................................... 73 Table 9 ....................................................................................................................................... 74 Table 10 ..................................................................................................................................... 92 ii List of Figures Figure 1 ...................................................................................................................................... 58 Figure 2 ...................................................................................................................................... 71 Figure 3 ...................................................................................................................................... 72 Figure 4 ...................................................................................................................................... 79 Figure 5 .....................................................................................................................................
Load more

Recommended publications
  • Exploring Novel Estrogen Receptors
    ExploringExploring novelnovel estrogenestrogen receptorsreceptors and How many drug targets? What are the relevant drug metabolizing enzymes? Tudor I. Oprea UNM Division of Biocomputing NMNM MLSCMLSC http://screening.health.unm.edu/ Support: New Mexico Molecular Libraries Screening Center (NIH MH074425) Strasbourg Summer School on Cheminformatics Obernai, Alsace, France, June 23 2008 The University of New Mexico ♦ Health Sciences Center Copyright © Tudor I. Oprea, 2007. All rights reserved SCHOOL OF MEDICINE MLIMLI inin NumbersNumbers NIHNIH RoadmapRoadmap InitiativeInitiative MolecularMolecular Libraries Libraries Initiative Initiative 44 Chemical Chemical Synthesis Synthesis MLSCNMLSCN (9+1) (9+1) PubChemPubChem ECCRECCR (6) (6) PredictivePredictive CentersCenters 99 centers centers (NLM)(NLM) ExploratoryExploratory ADMETADMET 11 NIH NIH intramural intramural CentersCenters (8)(8) 100100 x x 10 10 = = 1000 1000 assays assays CombiChemCombiChem ParallelParallel synthesis synthesis DOSDOS NotNot renewed renewed 44 centers centers + + DPI DPI 100k–500k100k–500k compounds compounds SAR matrix ~300,000 compounds Note: Subject http://nihroadmap.nih.gov The University of New Mexico > 1000 assays to change SCHOOL OF MEDICINE NMNM MLSCMLSC (3(3--yearyear summary)summary) U54MH074425U54MH074425 • 23 primary targets (62 assays) uploaded to PubChem • 38 targets total pipeline • ~ 2.4 million datapoints loaded into PubChem • Current throughput: 150,000 samples/week • first 6-plex (small GTP-ases) of the Roadmap • 2nd 6-plex (Bcl-2) also completed
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Novel Binding Partners of PBF in Thyroid Tumourigenesis
    NOVEL BINDING PARTNERS OF PBF IN THYROID TUMOURIGENESIS By Neil Sharma A thesis presented to the College of Medical and Dental Sciences at the University of Birmingham for the Degree of Doctor of Philosophy Centre for Endocrinology, Diabetes and Metabolism, School of Clinical and Experimental Medicine August 2013 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. SUMMARY Thyroid cancer is the most common endocrine cancer, with a rising incidence. The proto-oncogene PBF is over-expressed in thyroid tumours, and the degree of over-expression is directly linked to patient survival. PBF causes transformation in vitro and tumourigenesis in vivo, with PBF-transgenic mice developing large, macro-follicular goitres, effects partly mediated by the internalisation and repression of the membrane-bound transporters NIS and MCT8. NIS repression leads to a reduction in iodide uptake, which may negatively affect the efficacy of radioiodine treatment, and therefore prognosis. Work within this thesis describes the use of tandem mass spectrometry to produce a list of potential binding partners of PBF. This will aid further research into the pathophysiology of PBF, not just in relation to thyroid cancer but also other malignancies.
    [Show full text]
  • Small-Molecule Inhibitors of Pendrin Potentiate the Diuretic Action of Furosemide
    BASIC RESEARCH www.jasn.org Small-Molecule Inhibitors of Pendrin Potentiate the Diuretic Action of Furosemide Onur Cil, Peter M. Haggie, Puay-wah Phuan, Joseph-Anthony Tan, and Alan S. Verkman Departments of Medicine and Physiology, University of California San Francisco, San Francisco, California ABSTRACT 2 2 Pendrin is a Cl /HCO3 exchanger expressed in type B and non-A, non-B intercalated cells in the distal 2 nephron, where it facilitates Cl absorption and is involved in Na+ absorption and acid-base balance. Pendrin-knockout mice show no fluid-electrolyte abnormalities under baseline conditions, although mice 2 with double knockout of pendrin and the Na+/Cl cotransporter (NCC) manifest profound salt wasting. Thus, pendrin may attenuate diuretic-induced salt loss, but this function remains unconfirmed. To clarify the physiologic role of pendrin under conditions not confounded by gene knockout, and to test the potential utility of pendrin inhibitors for diuretic therapy, we tested in mice a small-molecule pendrin inhibitor identified from a high-throughput screen. In vitro, a pyrazole-thiophenesulfonamide, PDSinh- 2 C01, inhibited Cl /anion exchange mediated by mouse pendrin with a 50% inhibitory concentration of 1–3 mM, without affecting other major kidney tubule transporters. Administration of PDSinh-C01 to mice at predicted therapeutic doses, determined from serum and urine pharmacokinetics, did not affect urine output, osmolality, salt excretion, or acid-base balance. However, in mice treated acutely with furosemide, + 2 administration of PDSinh-C01 produced a 30% increase in urine output, with increased Na and Cl ex- cretion. In mice treated long term with furosemide, in which renal pendrin is upregulated, PDSinh-C01 produced a 60% increase in urine output.
    [Show full text]
  • In Vitro Differentiation of Bone Marrow Mesenchymal Stem Cells Into Endometrial Epithelial Cells in Mouse: a Proteomic Analysis
    Int J Clin Exp Pathol 2014;7(7):3662-3672 www.ijcep.com /ISSN:1936-2625/IJCEP0000322 Original Article In vitro differentiation of bone marrow mesenchymal stem cells into endometrial epithelial cells in mouse: a proteomic analysis Qing Cong1,2, Bin Li1,2, Yisheng Wang1,2, Wenbi Zhang1,2, Mingjun Cheng1,2, Zhiyong Wu1,2, Xiaoyan Zhang1,2, Wei Jiang1,2, Congjian Xu1,2,3,4 1Obstetrics and Gynecology Hospital of Fudan University, 2Shanghai Key Laboratory of Female Reproductive Endocrine Related Diseases, 3Department of Obstetrics and Gynecology of Shanghai Medical School, 4Institute of Biomedical Sciences, Fudan University, Shanghai, P.R. China Received March 24, 2014; Accepted June 23, 2014; Epub June 15, 2014; Published July 1, 2014 Abstract: Objective: Mouse bone marrow mesenchymal stem cells (BMSCs) have been demonstrated to differenti- ate into female endometrial epithelial cells (EECs) in vivo. Our previous studies demonstrated that BMSCs can differentiate in the direction of EECs when co-cultured with endometrial stromal cells in vitro. Here, we obtain and analyse differential proteins and their relevant pathways in the process of BMSCs differentiating into EECs by iso- baric tags for relative and absolute quantitation (iTRAQ) proteomic analysis. Methods: A 0.4-µm pore size indirect co- culture system was established with female mice endometrial stromal cells (EStCs) restricted in the upper Transwell chamber and BMSCs in the lower well plate. After indirect co-culture for several days, the BMSCs were revealed to progressively differentiate towards EECs in vitro. Then, four groups were divided according to different co-culture days with single culture groups of BMSCs as controls.
    [Show full text]
  • Table 1. Identified Proteins with Expression Significantly Altered in the Hippocampus of Rats of Exposed Group (Pb) Vs
    Table 1. Identified proteins with expression significantly altered in the hippocampus of rats of exposed group (Pb) vs. Control. Fold Change Accession Id a Protein Description Score Pb P35213 14-3-3 protein beta/alpha 85420 −0.835 P62260 14-3-3 protein epsilon 96570 −0.878 P68511 14-3-3 protein eta 85420 −0.844 P68255 14-3-3 protein theta 85420 −0.835 P63102 14-3-3 protein zeta/delta 105051 −0.803 P13233 2',3'-cyclic-nucleotide 3'-phosphodiesterase 151400 1.405 P68035 Actin, alpha cardiac muscle 1 442584 −0.942 P68136 Actin, alpha skeletal muscle 441060 −0.970 P62738 Actin, aortic smooth muscle 438270 −0.970 P60711 Actin, cytoplasmic 1 630104 −0.942 P63259 Actin, cytoplasmic 2 630104 −0.942 P63269 Actin, gamma-enteric smooth muscle 438270 −0.951 Q05962 ADP/ATP translocase 1 60100 −0.554 Q09073 ADP/ATP translocase 2 49102 −0.482 P84079 ADP-ribosylation factor 1 34675 −0.644 P84082 ADP-ribosylation factor 2 22412 −0.644 P61206 ADP-ribosylation factor 3 34675 −0.619 P61751 ADP-ribosylation factor 4 22412 −0.670 P84083 ADP-ribosylation factor 5 22412 −0.625 P04764 Alpha-enolase 46219 −0.951 P23565 Alpha-internexin 9478 1.062 P37377 Alpha-synuclein 89619 −0.771 P13221 Aspartate aminotransferase, cytoplasmic 23661 1.083 P00507 Aspartate aminotransferase, mitochondrial 46049 1.116 P10719 ATP synthase subunit beta, mitochondrial 232442 −0.835 P85969 Beta-soluble NSF attachment protein 9638 1.419 Q63754 Beta-synuclein 66842 −0.779 P11275 Calcium/calmodulin-dependent protein kinase type II subunit alpha 181954 1.105 P08413 Calcium/calmodulin-dependent protein kinase type II subunit beta 80840 1.127 P15791 Calcium/calmodulin-dependent protein kinase type II subunit delta 62682 1.105 Int.
    [Show full text]
  • Complement Peptide C3a Receptor 1 Promotes Optic Nerve Degeneration in DBA/2J Mice Jeffrey M
    Harder et al. Journal of Neuroinflammation (2020) 17:336 https://doi.org/10.1186/s12974-020-02011-z RESEARCH Open Access Complement peptide C3a receptor 1 promotes optic nerve degeneration in DBA/2J mice Jeffrey M. Harder1, Pete A. Williams1,2 , Catherine E. Braine1,3, Hongtian S. Yang1, Jocelyn M. Thomas1, Nicole E. Foxworth1, Simon W. M. John1,4,5* and Gareth R. Howell1,6,7* Abstract Background: The risk of glaucoma increases significantly with age and exposure to elevated intraocular pressure, two factors linked with neuroinflammation. The complement cascade is a complex immune process with many bioactive end-products, including mediators of inflammation. Complement cascade activation has been shown in glaucoma patients and models of glaucoma. However, the function of complement-mediated inflammation in glaucoma is largely untested. Here, the complement peptide C3a receptor 1 was genetically disrupted in DBA/2J mice, an ocular hypertensive model of glaucoma, to test its contribution to neurodegeneration. Methods: A null allele of C3ar1 was backcrossed into DBA/2J mice. Development of iris disease, ocular hypertension, optic nerve degeneration, retinal ganglion cell activity, loss of RGCs, and myeloid cell infiltration in C3ar1-deficient and sufficient DBA/2J mice were compared across multiple ages. RNA sequencing was performed on microglia from primary culture to determine global effects of C3ar1 on microglia gene expression. Results: Deficiency in C3ar1 lowered the risk of degeneration in ocular hypertensive mice without affecting intraocular pressure elevation at 10.5 months of age. Differences were found in the percentage of mice affected, but not in individual characteristics of disease progression.
    [Show full text]
  • WO 2016/147053 Al 22 September 2016 (22.09.2016) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2016/147053 Al 22 September 2016 (22.09.2016) P O P C T (51) International Patent Classification: (71) Applicant: RESVERLOGIX CORP. [CA/CA]; 300, A61K 31/551 (2006.01) A61P 37/02 (2006.01) 4820 Richard Road Sw, Calgary, AB, T3E 6L1 (CA). A61K 31/517 (2006.01) C07D 239/91 (2006.01) (72) Inventors: WASIAK, Sylwia; 431 Whispering Water (21) International Application Number: Trail, Calgary, AB, T3Z 3V1 (CA). KULIKOWSKI, PCT/IB20 16/000443 Ewelina, B.; 31100 Swift Creek Terrace, Calgary, AB, T3Z 0B7 (CA). HALLIDAY, Christopher, R.A.; 403 (22) International Filing Date: 138-18th Avenue SE, Calgary, AB, T2G 5P9 (CA). GIL- 10 March 2016 (10.03.2016) HAM, Dean; 249 Scenic View Close NW, Calgary, AB, (25) Filing Language: English T3L 1Y5 (CA). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, (30) Priority Data: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, 62/132,572 13 March 2015 (13.03.2015) US BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, 62/264,768 8 December 2015 (08. 12.2015) US DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, [Continued on nextpage] (54) Title: COMPOSITIONS AND THERAPEUTIC METHODS FOR THE TREATMENT OF COMPLEMENT-ASSOCIATED DISEASES (57) Abstract: The invention comprises methods of modulating the complement cascade in a mammal and for treating and/or preventing diseases and disorders as sociated with the complement pathway by administering a compound of Formula I or Formula II, such as, for example, 2-(4-(2-hydroxyethoxy)-3,5-dimethylphenyl)- 5,7-dimethoxyquinazolin-4(3H)-one or a pharmaceutically acceptable salt thereof.
    [Show full text]
  • Contig Protein Description Symbol Anterior Posterior Ratio
    Table S2. List of proteins detected in anterior and posterior intestine pooled samples. Data on protein expression are mean ± SEM of 4 pools fed the experimental diets. The number of the contig in the Sea Bream Database (http://nutrigroup-iats.org/seabreamdb) is indicated. Contig Protein Description Symbol Anterior Posterior Ratio Ant/Pos C2_6629 1,4-alpha-glucan-branching enzyme GBE1 0.88±0.1 0.91±0.03 0.98 C2_4764 116 kDa U5 small nuclear ribonucleoprotein component EFTUD2 0.74±0.09 0.71±0.05 1.03 C2_299 14-3-3 protein beta/alpha-1 YWHAB 1.45±0.23 2.18±0.09 0.67 C2_268 14-3-3 protein epsilon YWHAE 1.28±0.2 2.01±0.13 0.63 C2_2474 14-3-3 protein gamma-1 YWHAG 1.8±0.41 2.72±0.09 0.66 C2_1017 14-3-3 protein zeta YWHAZ 1.33±0.14 4.41±0.38 0.30 C2_34474 14-3-3-like protein 2 YWHAQ 1.3±0.11 1.85±0.13 0.70 C2_4902 17-beta-hydroxysteroid dehydrogenase 14 HSD17B14 0.93±0.05 2.33±0.09 0.40 C2_3100 1-acylglycerol-3-phosphate O-acyltransferase ABHD5 ABHD5 0.85±0.07 0.78±0.13 1.10 C2_15440 1-phosphatidylinositol phosphodiesterase PLCD1 0.65±0.12 0.4±0.06 1.65 C2_12986 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase delta-1 PLCD1 0.76±0.08 1.15±0.16 0.66 C2_4412 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma-2 PLCG2 1.13±0.08 2.08±0.27 0.54 C2_3170 2,4-dienoyl-CoA reductase, mitochondrial DECR1 1.16±0.1 0.83±0.03 1.39 C2_1520 26S protease regulatory subunit 10B PSMC6 1.37±0.21 1.43±0.04 0.96 C2_4264 26S protease regulatory subunit 4 PSMC1 1.2±0.2 1.78±0.08 0.68 C2_1666 26S protease regulatory subunit 6A PSMC3 1.44±0.24 1.61±0.08
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • The Concise Guide to Pharmacology 2019/20
    Edinburgh Research Explorer THE CONCISE GUIDE TO PHARMACOLOGY 2019/20 Citation for published version: Cgtp Collaborators 2019, 'THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Transporters', British Journal of Pharmacology, vol. 176 Suppl 1, pp. S397-S493. https://doi.org/10.1111/bph.14753 Digital Object Identifier (DOI): 10.1111/bph.14753 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: British Journal of Pharmacology General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 28. Sep. 2021 S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Transporters. British Journal of Pharmacology (2019) 176, S397–S493 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Transporters Stephen PH Alexander1 , Eamonn Kelly2, Alistair Mathie3 ,JohnAPeters4 , Emma L Veale3 , Jane F Armstrong5 , Elena Faccenda5 ,SimonDHarding5 ,AdamJPawson5 , Joanna L
    [Show full text]
  • HER Inhibitor Promotes BRAF/MEK Inhibitor-Induced Redifferentiation in Papillary Thyroid Cancer Harboring BRAFV600E
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 12), pp: 19843-19854 Research Paper HER inhibitor promotes BRAF/MEK inhibitor-induced redifferentiation in papillary thyroid cancer harboring BRAFV600E Lingxiao Cheng1,*, Yuchen Jin1,*, Min Liu1, Maomei Ruan2, Libo Chen1 1Department of Nuclear Medicine, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai 200233, China 2Department of Nuclear Medicine, Shanghai Chest Hospital, Shanghai Jiao Tong University, Shanghai 200030, China *Co-first authors Correspondence to: Libo Chen, email: [email protected] Keywords: papillary thyroid cancer, redifferentiation, iodine, glucose, dabrafenib Received: October 20, 2016 Accepted: January 24, 2017 Published: February 28, 2017 ABSTRACT Redifferentiation therapy with BRAF/MEK inhibitors to facilitate treatment with radioiodine represents a good choice for radioiodine-refractory differentiated thyroid carcinoma, but recent initial clinical outcomes were modest. MAPK rebound caused by BRAF/MEK inhibitors-induced activation of HER2/HER3 is a resistance mechanism, and combination with HER inhibitor to prevent MAPK rebound may sensitize BRAFV600E- mutant thyroid cancer cells to redifferentiation therapy. To evaluate if inhibiting both BRAF/MEK and HER can produce stronger redifferetiation effect, we tested the effects of BRAF/MEK inhibitor dabrafenib/selumetinib alone or in combination with HER inhibitor lapatinib on the expression and function of iodine- and glucose-handling genes in BRAFV600E-positive BCPAP and K1 cells, using BHP 2-7 cells harboring RET/ PTC1 rearrangement as control. Herein, we showed that lapatinib prevented MAPK rebound and sensitized BRAFV600E-positive papillary thyroid cancer cells to BRAF/ MEK inhibitors. Dabrafenib/selumetinib alone increased iodine-uptake and toxicity and suppressed glucose-metablism in BRAFV600E-positive papillary thyroid cancer cells.
    [Show full text]