DOCSLIB.ORG

T Cell Immunity in Vitro +CD8 Endothelial Cells Secrete IL-12 And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
T Cell Immunity in Vitro +CD8 Endothelial Cells Secrete IL-12 And TLR1/2 Ligand−Stimulated Mouse Liver Endothelial Cells Secrete IL-12 and Trigger CD8+ T Cell Immunity In Vitro This information is current as Jia Liu, Min Jiang, Zhiyong Ma, Kirsten K. Dietze, of October 2, 2021. Gennadiy Zelinskyy, Dongliang Yang, Ulf Dittmer, Joerg F. Schlaak, Michael Roggendorf and Mengji Lu J Immunol published online 13 November 2013 http://www.jimmunol.org/content/early/2013/11/12/jimmun ol.1301262 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/11/13/jimmunol.130126 Material 2.DC1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on October 2, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published November 13, 2013, doi:10.4049/jimmunol.1301262 The Journal of Immunology TLR1/2 Ligand–Stimulated Mouse Liver Endothelial Cells Secrete IL-12 and Trigger CD8+ T Cell Immunity In Vitro Jia Liu,* Min Jiang,† Zhiyong Ma,* Kirsten K. Dietze,* Gennadiy Zelinskyy,* Dongliang Yang,‡ Ulf Dittmer,* Joerg F. Schlaak,† Michael Roggendorf,* and Mengji Lu* Liver sinusoidal endothelial cells (LSECs) are unique organ-resident APCs capable of Ag cross-presentation and subsequent tol- erization of naive CD8+ T cells. Under certain conditions, LSECs can switch from a tolerogenic to an immunogenic state and promote the development of T cell immunity. However, little is known about the mechanisms of LSECs to induce T cell immunity. In this study, we investigated whether functional maturation of LSECs can be achieved by TLR ligand stimulation and elucidated the mechanisms involved in LSEC-induced T cell immunity. We demonstrate that pretreatment of LSECs with palmitoyl-3- cysteine-serine-lysine-4 (P3C; TLR1/2 ligand) but not poly(I:C) (TLR3 ligand) or LPS (TLR4 ligand) reverted their suppressive Downloaded from properties to induce T cell immunity. Importantly, P3C stimulation caused functional maturation of Ag-presenting LSECs and enabled them to activate virus-specific CD8+ T cells. The LSEC-mediated CD8+ T cell immunity was initiated by soluble mediators, one of which was IL-12 secreted at a low but sustained level after P3C stimulation. P3C stimulation did not induce programmed death ligand 1 expression on LSECs, thereby favoring T cell proliferation and activation instead of suppression. Our data suggest that LSECs undergo maturation exclusively in response to TLR1/2 ligand stimulation and that the immunological status of LSECs was dependent upon the balance between programmed death ligand 1 and IL-12 expression. These results have implications for our http://www.jimmunol.org/ understanding of liver-specific tolerance and autoimmunity and for the development of strategies to overcome T cell tolerance in situations such as chronic viral liver infections or liver cancer. The Journal of Immunology, 2013, 191: 000–000. oll-like receptors, as evolutionarily conserved, germline- The liver is continuously exposed to food and microbial Ags that encoded pattern recognition receptors (PRRs), play a cru- are transported from the gut via the portal circulation, and it T cial role in early host defense by recognizing so-called exhibits barrier functions toward environmental Ags. Therefore, pathogen-associated molecular patterns (PAMP). Thus, they serve the risk of immune activation in the liver appears quite high in the as an important link between innate and adaptive immunity (1). body. It seems that the liver has in turn acquired special mecha- by guest on October 2, 2021 Ligation of TLRs or cytoplasmic PRRs causes functional matura- nisms of immune tolerance to avoid an overactivation of innate and tion of professional APCs, in particular dendritic cells (DCs) (2). adaptive immune responses (8, 9). The liver is known for its ability This leads to increased expression of costimulatory molecules such to induce Ag-specific immune tolerance rather than immunity as CD80/CD86 and CD40 as well as increased release of IL-12, (10). Liver nonparenchymal cells, including liver sinusoidal en- which are required to promote cytotoxic CD8+ T cell differentia- dothelial cells (LSECs) and Kupffer cells, play a crucial role in tion and activation (3–5). maintaining the homeostasis of the hepatic microenvironment Previously, TLR2 was able to mediate antiviral actions against through induction of Ag-specific T cell tolerance (11–13). Among hepatitis B virus (HBV) and was showntoplayanimportantrolein those different cell populations involved in the induction of he- HBV infection (6). Our previous experiments indicated that TLR2 patic tolerance, LSECs are particularly important because they are may activate various APCs, including liver nonparenchymal cells (7). strategically located in the liver sinusoids to interact with pas- senger leukocytes (14). In addition, LSECs have extraordinary *Institute of Virology, University Hospital of Essen, University of Duisburg-Essen, scavenger function. For example, LSECs take up more hepato- 45122 Essen, Germany; †Department of Gastroenterology and Hepatology, Univer- tropic viruses (such as HBV and hepatitis C virus) from the blood sity Hospital of Essen, University of Duisburg-Essen, 45122 Essen, Germany; and ‡ than other hepatic cells during viral infection (15, 16), and they Department of Infectious Diseases, Union Hospital, Tongji Medical College, + + Huazhong University of Science and Technology, 430022 Wuhan, China are highly efficient in presenting Ags to CD4 and CD8 T cells. + Received for publication May 13, 2013. Accepted for publication October 12, 2013. However, cross-presentation to CD8 T cells by LSECs can in- duce Ag-specific immune tolerance in contrast to professional This work was supported by Deutsche Forschungsgemeinschaft Grants Transregio + TRR60 and GRK1045/2. APCs such as DCs (11). Naive CD8 T cells that are primed by Address correspondence and reprint requests to Prof. Mengji Lu, Institute of Virol- LSECs are initially activated to proliferate and express activation ogy, University Hospital of Essen, Hufelandstrasse 55, 45122 Essen, Germany. markers, like CD69 and CD25, but finally exhibit low IL-2 and E-mail address: [email protected] IFN-g production and low cytotoxicity (11). The induction of The online version of this article contains supplemental material. tolerance correlates with the expression of the negative costimu- Abbreviations used in this article: bmDC, bone marrow–derived dendritic cell; DC, latory molecule ligand programmed death ligand 1 (PD-L1) by dendritic cell; FDR, false discovery rate; FV, Friend virus; HBV, hepatitis B virus; LSEC, liver sinusoidal endothelial cell; P3C, palmitoyl-3-cysteine-serine-lysine-4; LSECs, as LSECs from PD-L1–deficient mice failed to induce + PAMP, pathogen-associated molecular pattern; PD-1, programmed death 1; PD-L1, CD8 T cell tolerance (13). programmed death ligand 1; PRR, pattern recognition receptor; tg, transgenic; However, it is still unclear whether ligation of TLRs or PRRs can WHcAg, woodchuck hepatitis virus core Ag. cause functional maturation of LSECs and revert their suppressive Copyright Ó 2013 by The American Association of Immunologists, Inc. 0022-1767/13/$16.00 properties to induce T cell immunity. Although it has been reported www.jimmunol.org/cgi/doi/10.4049/jimmunol.1301262 2 ACTIVATION OF LSECs BY TLR1/2 LIGANDS that murine CMV-infected LSECs were able to trigger CD8+ T cell analyzed for activation/proliferation by flow cytometry. For determination of the maturation of LSEC function, corresponding peptide-loaded LSECs or immunity, the authors failed to clarify the mechanisms of the + + LSEC maturation (14). Physiologic exposure of the liver to bac- DCs were cocultured with FV TCR tg CD8 T cells or CD8 Tcellsfrom woodchuck hepatitis virus core Ag (WHcAg)-immunized mice for either 3 terial degradation products is normally not associated with local or 7 d. Blocking Abs were added when indicated. After 3 d, cytokine con- inflammatory responses (17). This suggests that organ-resident APCs centrations in supernatants were assessed by ELISA. After 7 d, intracellular such as LSECs may have evolved the ability to differentiate vari- IFN-g staining was performed to determine the percentage of IFN-g–pro- + + eties of TLR stimulations, and thus perform different sentinel ducing CD8 T cells. The ratio of CD8 T cells to LSECs/DCs was 2:1. functions such as inducing immune tolerance or immunity. There- DNA vaccination fore, we determined whether organ-resident LSECs show plasticity Recombinant eukaryotic expression plasmid pCGWHc, which expresses and switch from a tolerogenic to an immunogenic APC upon PAMP WHcAg, was constructed by our laboratory (A. Kosinska, unpublished stimulation. In this study, we show that LSECs undergo immuno- data). Mice were pretreated with cardiotoxin (Latoxan, Valence, France) by logical maturation
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Data Sheet Huil36g (152 A.A.)
    Growth Factor Data Sheet GoldBio growth factors are manufactured for RESEARCH USE ONLY and cannot be sold for human consumption! Interleukin-36G (IL36G) is a pro-inflammatory cytokine that plays an important role in the pathophysiology of several diseases. IL36A, IL36B and IL36G (formerly IL1F6, IL1F8, and IL1F9) are IL1 family members that signal through the IL1 receptor family members IL1Rrp2 (IL1RL2) and IL1RAcP. IL36G is secreted when transfected into 293-T cells and could constitute part of an independent signaling system analogous to that of IL1A and IL1B receptor agonist and interleukin-1 receptor type I (IL1R1). Furthermore, IL36G also can function as an agonist of NFκB activation through the orphan IL1- receptor-related protein 2. Human IL36G (152 a.a.) shares 58%, 59%, 68% and 69% amino acid sequence identity with mouse, rat, bovine and equine IL36G, respectively, and 23-57% amino acid sequence identity with other family members. Catalog Number 1110-36F Product Name IL36G (IL-36 gamma), Human (152 a.a.) Recombinant Human Interleukin-36γ IL36G, IL36γ Interleukin 1 Homolog 1 (IL1H1) Interleukin 1-Related Protein 2 (IL1RP2) Interleukin 1 Family, Member 9 (IL1F9) Source Escherichia coli MW ~17.0 kDa (152 amino acids) Sequence SMCKPITGTI NDLNQQVWTL QGQNLVAVPR SDSVTPVTVA VITCKYPEAL EQGRGDPIYL GIQNPEMCLY CEKVGEQPTL QLKEQKIMDL YGQPEPVKPF LFYRAKTGRT STLESVAFPD WFIASSKRDQ PIILTSELGK SYNTAFELNI ND Accession Number Q9NZH8 Purity >95% by SDS-PAGE and HPLC analyses Biological Activity Fully biologically active when compared to standard. The ED50 as determined by its ability to induce IL-8 secretion by human preadipocytes is less than 10 ng/ml, corresponding to a specific activity of >1 × 105 IU/mg.
    [Show full text]
  • ROS Production Induced by BRAF Inhibitor Treatment Rewires
    Cesi et al. Molecular Cancer (2017) 16:102 DOI 10.1186/s12943-017-0667-y RESEARCH Open Access ROS production induced by BRAF inhibitor treatment rewires metabolic processes affecting cell growth of melanoma cells Giulia Cesi, Geoffroy Walbrecq, Andreas Zimmer, Stephanie Kreis*† and Claude Haan† Abstract Background: Most melanoma patients with BRAFV600E positive tumors respond well to a combination of BRAF kinase and MEK inhibitors. However, some patients are intrinsically resistant while the majority of patients eventually develop drug resistance to the treatment. For patients insufficiently responding to BRAF and MEK inhibitors, there is an ongoing need for new treatment targets. Cellular metabolism is such a promising new target line: mutant BRAFV600E has been shown to affect the metabolism. Methods: Time course experiments and a series of western blots were performed in a panel of BRAFV600E and BRAFWT/ NRASmut human melanoma cells, which were incubated with BRAF and MEK1 kinase inhibitors. siRNA approaches were used to investigate the metabolic players involved. Reactive oxygen species (ROS) were measured by confocal microscopy and AZD7545, an inhibitor targeting PDKs (pyruvate dehydrogenase kinase) was tested. Results: We show that inhibition of the RAS/RAF/MEK/ERK pathway induces phosphorylation of the pyruvate dehydrogenase PDH-E1α subunit in BRAFV600E and in BRAFWT/NRASmut harboring cells. Inhibition of BRAF, MEK1 and siRNA knock-down of ERK1/2 mediated phosphorylation of PDH. siRNA-mediated knock-down of all PDKs or the use of DCA (a pan-PDK inhibitor) abolished PDH-E1α phosphorylation. BRAF inhibitor treatment also induced the upregulation of ROS, concomitantly with the induction of PDH phosphorylation.
    [Show full text]
  • Funkce CDK12 a CDK13 V Regulaci Transkripce Hana Paculová
    MASARYKOVA UNIVERZITA PŘÍRODOVĚDECKÁ FAKULTA ÚSTAV BIOCHEMIE Funkce CDK12 a CDK13 v regulaci transkripce Disertační práce Hana Paculová Školitel: Mgr. Jiří Kohoutek, Ph.D Brno 2018 Bibliogra cký záznam Autorka: Mgr. Hana Paculová Prrodovedecáá aaául,a鏈 Maaarkáova unvverv,a Úa,av bvochemve Název práce: Funáce CDK12 a CDK13 v regulacv ,ranaárvpce Studijní program: Bvochemve Studijní obor: Bvochemve Školitel: Mgr. Jvr Kohou,eá鏈 Ph.D Akademický rok: 2017/2018 Po et stran: 89 Klí ová slova: Ckálvn-dependen,n ávnaaa鏈 CDK12鏈 ,ranaárvpce鏈 RNA polkmeraaa II鏈 raáovvna vaječnáů鏈 CHK1 Bibliographic entry Author: Mgr. Hana Paculová Facul,k oa acvence鏈 Maaarká unvverav,k Department of Biochemistry Title oF dissertation: CDK12 and CDK13 aunc,von vn ,ranacrvp,von regula,von Degree programme: Bvochemva,rk Field oF study: Bvochemva,rk Supervisor: Mgr. Jvr Kohou,eá鏈 Ph.D Academic year: 2017/2018 Number oF pages: 89 Keywords: Ckclvn-dependen ávnaae鏈 CDK12鏈 ,ranacrvp,von鏈 RNA polkmeraae II鏈 ovarvan cancer鏈 CHK1 Abstrakt Ckálvn-dependen,n ávnaaa 12 (CDK12) je ,ranaárvpčn ávnaaa鏈 á,erá rd expreav avých clových genů ,m鏈 že aoaaorkluje RNA polkmeraau II v průbehu elongačn aáe ,ranaárvpce. CDK12 je apojena do neáolváa bunečných preceaů鏈 což ahrnuje odpoveď na pošáoen DNA鏈 vývoj a bunečnou dvaerencvacv a aea,rvh mRNA. CDK12 bkla popaána jaáo jeden genů鏈 á,eré jaou čaa,o mu,ovánk v hvgh-grade aerónm ovarválnm áarcvnomu鏈 nvcméne vlvv ,ech,o mu,ac na aunácv CDK12 a jejvch role v áarcvnogenev dopoaud nebkla a,anovena. Zjva,vlv jame鏈 že ve,švna mu,ac CDK12鏈 á,eré bklk naleenk v nádorech鏈 brán vk,voren áomplexu CDK12 a Ckálvnem K a vnhvbuj ávnaaovou aá,vvv,u CDK12.
    [Show full text]
  • Cyclin D1 Is a Direct Transcriptional Target of GATA3 in Neuroblastoma Tumor Cells
    Oncogene (2010) 29, 2739–2745 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 $32.00 www.nature.com/onc SHORT COMMUNICATION Cyclin D1 is a direct transcriptional target of GATA3 in neuroblastoma tumor cells JJ Molenaar1,2, ME Ebus1, J Koster1, E Santo1, D Geerts1, R Versteeg1 and HN Caron2 1Department of Human Genetics, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands and 2Department of Pediatric Oncology, Emma Kinderziekenhuis, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands Almost all neuroblastoma tumors express excess levels of 2000). Several checkpoints normally prevent premature Cyclin D1 (CCND1) compared to normal tissues and cell-cycle progression and cell division. The crucial G1 other tumor types. Only a small percentage of these entry point is controlled by the D-type Cyclins that can neuroblastoma tumors have high-level amplification of the activate CDK4/6 that in turn phosphorylate the pRb Cyclin D1 gene. The other neuroblastoma tumors have protein. This results in a release of the E2F transcription equally high Cyclin D1 expression without amplification. factor that causes transcriptional upregulation of Silencing of Cyclin D1 expression was previously found to numerous genes involved in further progression of the trigger differentiation of neuroblastoma cells. Over- cell cycle (Sherr, 1996). expression of Cyclin D1 is therefore one of the most Neuroblastomas are embryonal tumors that originate frequent mechanisms with a postulated function in neuro- from precursor cells of the sympathetic nervous system. blastoma pathogenesis. The cause for the Cyclin D1 This tumor has a very poor prognosis and despite the overexpression is unknown.
    [Show full text]
  • Characterization of BRCA1-Deficient Premalignant Tissues and Cancers Identifies Plekha5 As a Tumor Metastasis Suppressor
    ARTICLE https://doi.org/10.1038/s41467-020-18637-9 OPEN Characterization of BRCA1-deficient premalignant tissues and cancers identifies Plekha5 as a tumor metastasis suppressor Jianlin Liu1,2, Ragini Adhav1,2, Kai Miao1,2, Sek Man Su1,2, Lihua Mo1,2, Un In Chan1,2, Xin Zhang1,2, Jun Xu1,2, Jianjie Li1,2, Xiaodong Shu1,2, Jianming Zeng 1,2, Xu Zhang1,2, Xueying Lyu1,2, Lakhansing Pardeshi1,3, ✉ ✉ Kaeling Tan1,3, Heng Sun1,2, Koon Ho Wong 1,3, Chuxia Deng 1,2 & Xiaoling Xu 1,2 1234567890():,; Single-cell whole-exome sequencing (scWES) is a powerful approach for deciphering intra- tumor heterogeneity and identifying cancer drivers. So far, however, simultaneous analysis of single nucleotide variants (SNVs) and copy number variations (CNVs) of a single cell has been challenging. By analyzing SNVs and CNVs simultaneously in bulk and single cells of premalignant tissues and tumors from mouse and human BRCA1-associated breast cancers, we discover an evolution process through which the tumors initiate from cells with SNVs affecting driver genes in the premalignant stage and malignantly progress later via CNVs acquired in chromosome regions with cancer driver genes. These events occur randomly and hit many putative cancer drivers besides p53 to generate unique genetic and pathological features for each tumor. Upon this, we finally identify a tumor metastasis suppressor Plekha5, whose deficiency promotes cancer metastasis to the liver and/or lung. 1 Cancer Centre, Faculty of Health Sciences, University of Macau, Macau, SAR, China. 2 Centre for Precision Medicine Research and Training, Faculty of Health Sciences, University of Macau, Macau, SAR, China.
    [Show full text]
  • Transcriptome-Wide Identification of Transient RNA G-Quadruplexes In
    ARTICLE DOI: 10.1038/s41467-018-07224-8 OPEN Transcriptome-wide identification of transient RNA G-quadruplexes in human cells Sunny Y. Yang1, Pauline Lejault2, Sandy Chevrier3, Romain Boidot 3, A. Gordon Robertson4, Judy M.Y. Wong 1 & David Monchaud 2 Guanine-rich RNA sequences can fold into four-stranded structures, termed G-quadruplexes (G4-RNAs), whose biological roles are poorly understood, and in vivo existence is debated. 1234567890():,; To profile biologically relevant G4-RNA in the human transcriptome, we report here on G4RP-seq, which combines G4-RNA-specific precipitation (G4RP) with sequencing. This protocol comprises a chemical crosslinking step, followed by affinity capture with the G4- specific small-molecule ligand/probe BioTASQ, and target identification by sequencing, allowing for capturing global snapshots of transiently folded G4-RNAs. We detect wide- spread G4-RNA targets within the transcriptome, indicative of transient G4 formation in living human cells. Using G4RP-seq, we also demonstrate that G4-stabilizing ligands (BRACO-19 and RHPS4) can change the G4 transcriptomic landscape, most notably in long non-coding RNAs. G4RP-seq thus provides a method for studying the G4-RNA landscape, as well as ways of considering the mechanisms underlying G4-RNA formation, and the activity of G4-stabilizing ligands. 1 Faculty of Pharmaceutical Sciences, University of British Columbia, Pharmaceutical Sciences Building, 2405 Wesbrook Mall, Vancouver, BC V6T 1Z3, Canada. 2 Institut de Chimie Moléculaire (ICMUB), UBFC Dijon, CNRS UMR6302, 9, Rue Alain Savary, 21078 Dijon, France. 3 Platform of Transfer in Cancer Biology, Centre Georges-François Leclerc, BP 77980, 1, Rue Professeur Marion, 21079 Dijon, France.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Association of an Interleukin 1B Gene Polymorphism (-511) With
    400 LETTER TO JMG Association of an interleukin 1B gene polymorphism (−511) with Parkinson’s disease in Finnish patients K M Mattila, J O Rinne, T Lehtimäki, M Röyttä, J-P Ahonen, M Hurme ............................................................................................................................. J Med Genet 2002;39:400–402 lzheimer’s disease (AD) and Parkinson’s disease (PD) are the two most common neurodegenerative conditions Table 1 Genotype and allele frequencies of the IL1 characterised by the presence of abnormal accumula- gene cluster polymorphisms in AD, PD, and control A patients tion of proteins and loss of neurones in specific regions of the brain. The aetiology and pathogenesis of AD and PD still Controls remain largely unknown. Evidence has emerged that immune Polymorphism AD (n=92) PD (n=52) (n=73) mediated mechanisms may be important in the development − 12 IL1A ( 889) of these disorders, and cytokine interleukin 1 (IL1) is one of *1/*1 42 (0.46) 28 (0.54) 33 (0.45) the mediators suggested to be involved. *1/*2 39 (0.42) 20 (0.38) 29 (0.40) The IL1 family comprises three proteins, the proinflamma- *2/*2 11 (0.12) 4 (0.08) 11 (0.15) tory IL1α and IL1β and their inhibitor IL1 receptor antagonist *1 123 (0.67) 76 (0.73) 95 (0.65) *2 61 (0.32) 28 (0.27) 51 (0.35) (IL1Ra), which are encoded by the IL1A, IL1B, and IL1RN − genes respectively.3 Since IL1 may have a role in AD4–8 and in IL1B ( 511) 910 *1/*1 35 (0.38) 25 (0.48) 24 (0.32) PD, variation in the IL1A, IL1B, and IL1RN genes may be of *1/*2 47 (0.51) 25 (0.48) 30 (0.41) importance in the development of these disorders.
    [Show full text]
  • In Vivo Dual RNA-Seq Analysis Reveals the Basis for Differential Tissue Tropism of Clinical Isolates of Streptococcus Pneumoniae
    In Vivo Dual RNA-Seq Analysis Reveals the Basis for Differential Tissue Tropism of Clinical Isolates of Streptococcus pneumoniae Vikrant Minhas,1,4 Rieza Aprianto,2,4 Lauren J. McAllister,1 Hui Wang,1 Shannon C. David,1 Kimberley T. McLean,1 Iain Comerford,3 Shaun R. McColl,3 James C. Paton,1,5,6,* Jan-Willem Veening,2,5 and Claudia Trappetti,1,5 Supplementary Information Supplementary Table 1. Pneumococcal differential gene expression in the lungs 6 h post-infection, 9-47-Ear vs 9-47M. Genes with fold change (FC) greater than 2 and p < 0.05 are shown. FC values highlighted in blue = upregulated in 9-47-Ear, while values highlighted in red = upregulated in 9- 47M. Locus tag in 9-47- Product padj FC Ear Sp947_chr_00844 Sialidase B 3.08E-10 313.9807 Sp947_chr_02077 hypothetical protein 4.46E-10 306.9412 Sp947_chr_00842 Sodium/glucose cotransporter 2.22E-09 243.4822 Sp947_chr_00841 N-acetylneuraminate lyase 4.53E-09 227.7963 scyllo-inositol 2-dehydrogenase Sp947_chr_00845 (NAD(+)) 4.36E-09 221.051 Sp947_chr_00848 hypothetical protein 1.19E-08 202.7867 V-type sodium ATPase catalytic subunit Sp947_chr_00853 A 1.29E-06 100.5411 Sp947_chr_00846 Beta-glucoside kinase 3.42E-06 98.18951 Sp947_chr_00855 V-type sodium ATPase subunit D 8.34E-06 85.94879 Sp947_chr_00851 V-type sodium ATPase subunit C 2.50E-05 72.46612 Sp947_chr_00843 hypothetical protein 2.17E-05 65.97758 Sp947_chr_00839 HTH-type transcriptional regulator RpiR 3.09E-05 61.28171 Sp947_chr_00854 V-type sodium ATPase subunit B 1.32E-06 50.86992 Sp947_chr_00120 hypothetical protein 3.00E-04
    [Show full text]