Complex I Assembly Into Supercomplexes Determines Differential Mitochondrial ROS Production in Neurons and Astrocytes

Complex I assembly into supercomplexes determines differential mitochondrial ROS production in neurons and astrocytes

Irene Lopez-Fabuela, Juliette Le Douceb, Angela Loganc, Andrew M. Jamesc, Gilles Bonventob, Michael P. Murphyc, Angeles Almeidad, and Juan P. Bolañosa,1 aInstitute of Functional Biology and Genomics, University of Salamanca–Consejo Superior de Investigaciones Cientificas, 37007 Salamanca, Spain; bCommissariat à l’Energie Atomique et aux Energies Alternatives, Département des Sciences du Vivant, Institut d’Imagerie Biomédicale, Molecular Imaging Center, CNRS UMR 9199, Université Paris-Sud, Université Paris-Saclay, F-92260 Fontenay-aux-Roses, France; cMedical Research Council Mitochondrial Biology Unit, Cambridge Biomedical Campus, Cambridge CB2 0XY, United Kingdom; and dInstitute of Biomedical Research of Salamanca, University Hospital of Salamanca, 37007 Salamanca, Spain

Edited by Rafael Radi, Universidad de la Republica, Montevideo, Uruguay, and approved September 23, 2016 (received for review August 18, 2016) Neurons depend on oxidative phosphorylation for energy generation, neurons and astrocytes and that these structural differences regulate whereas astrocytes do not, a distinctive feature that is essential for different rates of mitochondrial ROS production and respiration. neurotransmission and neuronal survival. However, any link between these metabolic differences and the structural organization of the Results mitochondrial respiratory chain is unknown. Here, we investigated More Complex I Is Free in Astrocytes than in Neurons, Affecting this issue and found that, in neurons, mitochondrial complex I is Mitochondrial Function and ROS Production. Mitochondrial com- predominantly assembled into supercomplexes, whereas in astro- plexes can organize into supercomplexes in a process that has been cytes the abundance of free complex I is higher. The presence of free claimed to regulate electron transfer efficiency (23). Therefore, we complex I in astrocytes correlates with the severalfold higher reactive assessed whether the structural organization of the mitochondrial oxygen species (ROS) production by astrocytes compared with respiratory chain differed between neurons and astrocytes. To do neurons. Using a complexomics approach, we found that the complex this, digitonin-solubilized mitochondria (24) from primary cultures CELL BIOLOGY I subunit NDUFS1 was more abundant in neurons than in astrocytes. of C57BL/6 mouse neurons and astrocytes were analyzed by blue Interestingly, NDUFS1 knockdown in neurons decreased the associa- native gel electrophoresis (BNGE). Complex I occurred both on its tion of complex I into supercomplexes, leading to impaired oxygen own and also bound with complex III, notably in a I+III2 super- consumption and increased mitochondrial ROS. Conversely, over- complex and, to a lesser extent, in a I +III supercomplex (Fig. 1A) expression of NDUFS1 in astrocytes promoted complex I incorporation 2 2 (25). The composition of these supercomplexes was confirmed by into supercomplexes, decreasing ROS. Thus, complex I assembly into electrotransfer of the proteins to nitrocellulose followed by immu- supercomplexes regulates ROS production and may contribute to the noblotting against either a complex I subunit (NADH:ubiquinone bioenergetic differences between neurons and astrocytes. oxidoreductase subunit B8, NDUFB8) or a complex III subunit redox | brain | bioenergetics | lactate | glycolysis (ubiquinol-cytochrome C reductase core protein III, UQCRC2) (Fig. 1A). Interestingly, we observed a significant difference between astrocytes and neurons in the proportion of complex I that was free he brain is a metabolically demanding organ (1) that requires relative to that which was part of a supercomplex. The ratio of free Ttight cooperation between neurons and astrocytes (2). Astro- cytes provide crucial metabolic and structural support (3, 4) and are key players in neurotransmission (5–7) and behavior (8). The status Significance of many major redox couples in the brain is also regulated by astrocytes (9), through their high content of antioxidant compounds Neurons depend on oxidative phosphorylation for survival, and enzymes (10) and by the constitutive stabilization of the mas- whereas astrocytes do not. Mitochondrial respiratory chain (MRC) ter antioxidant transcriptional activator, nuclear factor erythroid complexes can be organized in higher structures called super- 2-related factor 2 (Nrf2) (11). Thus, astrocytes are equipped to protect complexes, which dictate MRC electron flux and energy efficiency. themselves when exposed to excess reactive oxygen species (ROS) Whether the specific metabolic shapes of neurons and astrocytes (12) and reactive nitrogen species (13, 14). Moreover, astrocytes also are determined by the specific organization of MRC complexes is provide nearby neurons with protective antioxidant precursors unknown. Here, we found that, in astrocytes, most complex I is through a cell-signaling mechanism involving glutamate receptor ac- free, resulting in poor mitochondrial respiration but high reactive oxygen species (ROS) production. In contrast, neurons show tivation by neurotransmission (11, 15, 16). The tight coupling between complex I to be mostly embedded into supercomplexes, thus astrocytes and neurons therefore helps in energy and redox metabo- resulting in high mitochondrial respiration and low ROS pro- lism during normal brain function. duction. Thus, MRC organization dictates different bioenergetics Intriguingly, the ATP used by neurons is supplied by oxidative preferences of neurons and astrocytes impacting on ROS pro- phosphorylation, whereas most energy needs of astrocytes are met by duction, possibly playing a role in neurodegenerative diseases. glycolysis (17). In fact, the survival of neurons requires oxidative phosphorylation (18, 19). The different energy metabolisms of the Author contributions: J.P.B. designed research; I.L.-F., J.L.D., A.L., A.M.J., G.B., M.P.M., and two cell types are closely coupled, with astrocytes releasing the gly- A.A. performed research; I.L.-F., A.L., M.P.M., A.A., and J.P.B. analyzed data; and J.P.B. colytic end product, lactate, which is used by neighboring neurons to wrote the paper. drive oxidative phosphorylation (20–22). As the molecular mecha- The authors declare no conflict of interest. nisms underlying the markedly different modes of ATP production in This article is a PNAS Direct Submission. the two cell types are not understood, we investigated whether the Freely available online through the PNAS open access option. organization of the mitochondrial respiratory chain in brain cells 1To whom correspondence should be addressed. Email: [email protected]. could contribute. Here, we report that the extent of supercomplex This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. formation by the mitochondrial respiratory chain is quite different in 1073/pnas.1613701113/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1613701113 PNAS Early Edition | 1of6 to assembled complex I was higher, whereas the ratio of free to assembled complex III was lower, in astrocytes compared with neurons (Fig. 1A and Fig. S1A). This pattern of respiratory chain organization was confirmed in freshly isolated neurons and astrocytes (Fig. S1 B and C) and in cells cultured at 11% O2, instead of 21% (Fig. S1D). The relative abundance of complex I versus complex III in astrocytes was twice that in neurons, as judged by Western blotting of whole-cell extracts (Fig. 1B). These data suggest that the relatively low amount of complex III in astrocytes may limit I–III supercomplex formation, and thereby increase the proportionofcomplexIinastrocytesthatis not present in supercomplexes. To further interrogate the differences in respiratory chain assembly between these two cell types, we next performed proteomic quantitative analyses of complex I subunits by mass spectrometry of gel slices from blue native gels of digitonin-solubilized mitochondria from astrocytes or neurons. As shown in Fig. 1C, measurement of complex I subunits showed that their amounts present in free complex I, relative to those present in I+III2 plus I2+III2 supercomplexes, was about twofold greater in astrocytes compared with neurons. This was further assessed by assaying rotenone-sensitive NADH-ubiquinone oxidoreductase activity in proteins electroeluted from blue native gel slices containing the supercomplexes (SC) or free complex I (CI). This showed that the NADH-ubiquinone oxidoreductase activity in the free complex I band was higher in astrocytes than in neurons (Fig. 1D). Because •− complex I catalyzes O2 production (26), we next determined ROS in complex I-containing slices excised from the blue native gels, and we found that ROS production from the free complex I band was higher in astrocytes than in neurons (Fig. 1E). These results confirm that the ratio of free complex I to that present in supercomplexes is higher in astrocytes than it is in neurons. Because the organization of respiratory complexes into supercomplexes is reported to affect mitochondrial function and ROS production (24, 25), we next determined O2 consumption in mitochondria isolated from astrocytes and neurons. State 3 pyruvate/ malate-driven (Fig. 1F) and succinate-driven (Fig. S1E)O2 consumption in astrocytes was significantly lower than that in neurons. To ascertain whether there were any differences in mitochondrial ROS production between these two cell types, we also determined the rate of H2O2 formation in isolated mitochondria. As shown in Fig. 1G, mitochondrial ROS production was higher in mitochondria from astrocytes than from neurons, either from endogenous Fig. 1. Different assembly of complex I into supercomplexes between neurons substrates or in the presence of pyruvate/malate. Thus, the pres- and astrocytes correlates with ROS production and mitochondrial respiration. ence or absence of complex I in supercomplexes in the respiratory (A) Digitonin-solubilized isolated mitochondria from mouse astrocytes and chain in neurons and astrocytes correlates with differences in neurons were subjected to blue native gel electrophoresis (BNGE) followed by in-gel complex I activity assay. Complex I occurs both free and bound with mitochondrial function and ROS production. complex III (I+III2 and I2+III2 supercomplexes). Direct electrotransfer of the native proteins to nitrocellulose followed by immunoblotting against NDUFB8 Astrocytes Produce More Mitochondrial ROS than Neurons. To see (a complex I subunit) or UQCRC2 (a complex III subunit). (B) Western blotting whether the differences in ROS production by mitochondria isolated against NDUFB8 and UQCRC2 in whole-cell protein extracts showing the rela- from neurons and astrocytes also occurred in intact cells, we de- tive abundance of complex I versus complex III in astrocytes and neurons. termined the rate of H2O2 generation by intact neurons and astro- (C) Slices were excised from digitonin-solubilized isolated astrocyte and neu- cytes in primary cultures from mice and rats. Astrocytes produced ronal mitochondria blue native gels, and the abundances of complex I subunits H O about one order of magnitude faster than neurons, from + + 2 2 in free complex I (CI), relative to the abundance of those in I III2 and I2 III2 both rat and mouse and under all culture conditions investigated supercomplexes (SC), were assessed by complexomics. (D) Rotenone-sensitive (Fig. 2A and Fig. S2 A–C). We next assessed mitochondrial ROS NADH-ubiquinone oxidoreductase activity of the excised and electroeluted free complex I and complex I-supercomplexes bands from the blue native gel in production (27) using the mitochondria-targeted probes MitoSox astrocytes and neurons. Data were not normalized per protein abundance in and MitoB (28) in intact cells. The MitoSox fluorescence and the the eluate, as we aimed to assess the amount of total complex I activity present MitoP/MitoB ratio were higher in astrocytes than in neurons B C D–H in each band. (E)In-gelH2O2 production in the excised SC and CI bands from (Fig. 2 and and Fig. S2 ), indicating an elevation of mi- the BNGE in astrocytes and neurons. H2O2 production values were normalized tochondrial ROS in astrocytes compared with neurons under these by the NADH dehydrogenase-activity band intensity obtained in the BNGE. conditions. Interestingly, the differences in MitoSox fluorescence (F) Pyruvate/malate (5 mM each)-driven mitochondrial oxygen consumption in and in mitochondrial H2O2 production, between neurons and isolated mitochondria from neurons or astrocytes under state 2 (0 mM ADP) or astrocytes, were unchanged after Δψm disruption with carbonyl state 3 (1 mM ADP), either in the absence or in the presence of KCN (2 mM). cyanide m-chlorophenyl hydrazone (CCCP) (Fig. 2 D and E), (G)RateofH2O2 production assessed using the AmplexRed assay, in mito- Δψ chondria isolated from neurons and astrocytes, in the presence and absence of suggesting that the difference is not due to differences in m pyruvate/malate (5 mM each). Data are the mean values ± SEM from n = 3–4 affecting probe distribution. Other nonmitochondrial ROS sources, independent culture preparations (Student’s t test; ANOVA post hoc Bonfer- such as xanthine oxidase, NADPH oxidases, and nitric oxide syn- roni). *P < 0.05. thase, did not appear to contribute to the high rate of ROS

2of6 | www.pnas.org/cgi/doi/10.1073/pnas.1613701113 Lopez-Fabuel et al. sorted according to the astrocyte-specific plasma membrane protein integrin β5 (29), showed a similar difference in ROS (Fig. S4 A and B). Finally, we found that the rate of mitochondrial ROS production was higher in astrocytes than in neurons freshly purified from the mouse brain using magnetic-activated cell sorting (MACS) technology (Fig. S4C). Thus, astrocytes produce mitochondrial ROS severalfold faster than neurons.

High ROS Production by Astrocytes Correlates with Deactive Complex I. Given that complex I is a major source of mitochondrial ROS (27), we analyzed the specific activity of complex I in neurons and in astrocytes. As shown in Fig. 3A, complex I activity was very similar in both cell types, as were the activities of other respiratory chain complexes (Fig. S5A). The complex I inhibitor, rotenone, stimulated mitochondrial ROS production to a great extent in neurons, but only slightly in astrocytes; however, antimycin stimulated mitochondrial ROS production in both cell types (Fig. 2D and Fig. S2H). The mild effect of rotenone on mitochondrial ROS production in astrocytes was intriguing. Because rotenone stimulates forward (FET) and inhibits the reverse (RET) electron transfer to O2 at complex I (26, 29), we determined the contribution of RET to ROS production, and we found that RET-mediated ROS is negligible in astrocytes (Fig. S5 B and C). Because the ubiquinone binding site is inaccessible in deactive complex I (30, 31), rendering it insensitive to rotenone, we hypothesized that there were different proportions of deactive and active complex I in neurons and astrocytes. As shown in Fig. 3B (Fig. S5D), the proportion of deactive complex CELL BIOLOGY

Fig. 2. Higher mitochondrial ROS production in astrocytes than in neurons occurs ex vivo. (A) Rates of H2O2 production assessed using the AmplexRed assay, in intact C56BL/6 mouse neurons and astrocytes in primary culture. (B) Mitochondrial ROS was quantified using the MitoSox assay in the intact cells (C57BL/6) by flow cytometry. (C) Mitochondrial ROS levels assessed using MitoB probe. Ratio between MitoP (oxidized form) versus MitoB is normalized per million of cells. (D) Mitochondrial membrane potential (Δψm) (Left) and MitoSox fluorescence (Right) were determined in basal conditions and after the inhibition of complex I (rotenone) or complex III (antimycin). Rotenone or antimycin was used at 10 μM, each, for 15 min. Furthermore, MitoSox fluorescence was evaluated after cell preincubation with the uncoupler CCCP (10 μM, 15 min). (E) Mitochondrial H2O2 production after Δψm abolishment with the uncoupler CCCP (10 μM). (F) Mitochondrial ROS abundance (MitoSox) assessed by flow cytometry (FC) in freshly isolated neurons and astrocytes from adult brain mouse expressing GFP governed either by an astrocyte (gfa-ABC1D) or a neuronal (PGK) promoter. Cell specificity of promoter-driven GFP expression was validated by immunofluorescence (I.F.) microscopy using astrocyte (GFAP) or neuronal (NeuN) markers. (Magnification: 40×.) Data are the mean values ± SEM from n = 3–4 independent culture preparations or n = 8 animals (Student’s t test; ANOVA post hoc Bonferroni). *P < 0.05. Fig. 3. Astrocytes present a high proportion of deactive complex I, with a reduced abundance of NDUFS1 subunit. (A) Mitochondrial complex I production in astrocytes (Fig. S3 and Table S1). Thus, we conclude (rotenone-sensitive NADH-ubiquinone oxidoreductase) activity, as assessed that mitochondrial ROS production is greater in astrocytes than spectrophotometrically in cell homogenates, in astrocytes and neurons. in neurons. (B) Deactive complex I activity, as assessed by the difference in rotenone- We next investigated mitochondrial ROS production in neurons sensitive NADH-ubiquinone oxidoreductase activity obtained with or without and astrocytes acutely dissociated from the mouse brain. For this, N-ethylmaleimide (NEM) (10 mM) in astrocytes and neurons. (C) Complex I brain cells were isolated from mice previously stereotaxically in- subunits, excised from complex I-containing bands from a blue native gels, were rated according to their signal intensities. The arrow indicates the most jected with adenoassociated viruses (AAVs) expressing green easily observed complex I subunit (NDUFS1) present both in free and in bound fluorescence protein (GFP) under the control of either an astrocyte (supercomplexes) complex I fractions in neurons and astrocytes. (D) NDUFS1 or a neuronal specific promoter. Cells were then subjected to mi- protein abundance in neurons and astrocytes, as assessed by BNGE either tochondrial ROS assessment by flow cytometry analysis using followed by direct electroblotting [also with complex III-UQCRC2 plus com- MitoSox. As shown in Fig. 2F, the MitoSox fluorescence was higher plex IV–MT-CO1 (mitochondrially encoded cytochrome C oxidase I) subunits] + in astrocyte promoter-driven GFP cells [expressing the astrocyte or by second-dimension SDS/PAGE immunoblotting followed by densitometric band intensity quantification. Coomassie-stained proteins from the specific glial-fibrillary acidic protein (GFAP)] than in neuron pro- + BNGE were used as loading control. CIII, complex III subunit UQCRC2; CIV, moter-driven GFP cells [expressing the neuron-specific neuronal complex IV subunit MT-CO1. Data are the mean values ± SEM from n = 3–4 nuclei (NeuN)]. Moreover, freshly isolated mouse brain cells, independent culture preparations (Student’s t test). *P < 0.05.

Lopez-Fabuel et al. PNAS Early Edition | 3of6 assessed the NDUFS1 protein abundance. NDUFS1 protein abundance was higher in neurons than in astrocytes, as judged by BNGE followed by immunoblotting directly, or after second- dimension SDS/PAGE (Fig. 3D). We found that NDUFS1 knockdown in neurons (Fig. 4A) diminished free and supercomplex- assembled complex I abundance (Fig. 4 B and C). Consistent with this, ROS production increased in free complex I and in complex I-containing supercomplexes bands excised from the blue native gel (Fig. 4D) and in the intact NDUFS1-silenced neurons (Fig. 4E). These effects impaired the electron transfer efficiency through the mitochondrial respiratory chain, as judged by the decreased pyruvate/malate-driven O2 consumption (state 3) in isolated mitochondria (Fig. 4F). Conversely, NDUFS1 overexpression in astrocytes (Fig. 5A) increased free complex I and promoted its assembly into supercomplexes (Fig. 5 B and C). Consistent with this, ROS production by free complex I and complex I-containing supercomplexes excised from the blue native gel decreased (Fig. 5D), as did ROS production in the intact NDUFS1-overexpressing astrocytes (Fig. 5E). This was not associated with an increase in pyruvate/malate-driven O2 consumption (state 3) (Fig. 5F), which Fig. 4. NDUFS1 knockdown in neurons disassembles complex I from is consistent with the low abundance of complex III in astrocytes supercomplexes increasing ROS and impairing mitochondrial respiration. (A) limiting electron transfer to O2 (Fig. 1B). Thus, modulation of Neurons were transfected with a siRNA against NDUFS1 (or a control siRNA), complex I assembly into supercomplexes affects mitochondrial and 3 d after, NDUFS1 protein abundance was analyzed by Western blotting O consumption and ROS production. in the whole-cell extracts, followed by densitometric band quantification. 2 β-Actin was used as loading control. (B) Digitonin-solubilized isolated mitochondria from NDUFS1–knocked-down neurons were subjected to BNGE followed by in-gel complex I activity assay, and direct electroblotting against complex I subunit NDUFS1, and complex III (UQCRC2) plus complex IV (MT- CO1). Bands corresponding to supercomplexes (SC) and free complex I (CI) were excised from the blue native gels, and subjected to second-dimension SDS/PAGE immunoblotting against NDUFS1 and NADH:ubiquinone oxidoreductase core subunit V1 (NDUFV1) NADH:ubiquinone oxidoreductase core subunit V1 (NDUFV1). NDUFV1 abundance was assessed to distinguish between expression or stability of complex I. Coomassie-stained proteins from the BNGE were used as loading control. (C) Densitometric quantification analyses of the NDUFS1 and NDUFV1 band intensities shown in B.(D) In-gel

H2O2 production in the excised SC and CI bands from the BNGE of digitonin- solubilized isolated mitochondria from control and NDUFS1–knocked-down neurons. H2O2 production values were normalized by the NADH dehydrogenase-activity band intensity obtained in the BNGE. (E) Mitochondrial ROS assessed using the MitoSox assay in intact cells by flow cytometry. (F) Rate of pyruvate/malate (5 mM each; 1 mM ADP)-driven mitochondrial oxygen consumption in isolated mitochondria from neurons. CIII, complex III subunit UQCRC2; CIV, complex IV subunit MT-CO1. Data are the mean values ± SEM from n = 3–4 independent culture preparations (Student’s t test). *P < 0.05.

I is one-third (∼33%) of total complex I in astrocytes, but only Fig. 5. Overexpression of NDUFS1 in astrocytes assembles complex I in ∼5% in neurons. Given that deactive complex I preferentially supercomplexes and decreases ROS production. (A) Astrocytes were trans- transfers electrons to O2 instead of to ubiquinone (30, 31), our fected with the full-length NDUFS1 cDNA (or control plasmid), and 1 d after, results suggest that the high proportion of deactive complex I NDUFS1 protein abundance was analyzed by Western blotting in the whole- β in astrocytes may contribute to the higher mitochondrial ROS cell extracts, followed by densitometric band quantification. -Actin was used as loading control. (B) Digitonin-solubilized isolated mitochondria from production of these cells. NDUFS1-overexpressing astrocytes were subjected to BNGE followed by in- gel complex I activity assay, and direct electroblotting against complex I Modulation of Complex I Assembly into Supercomplexes Alters ROS subunit NDUFS1, and complex III (UQCRC2) plus complex IV (MT-CO1). Bands Production and Respiration in Neurons and Astrocytes. To see corresponding to supercomplexes (SC) and free complex I (CI) were excised whether ROS production and respiration are affected by the from the blue native gel, and subjected to second-dimension SDS/PAGE proportion of complex I incorporated into supercomplexes, we immunoblotting against NDUFS1 and NDUFV1. Coomassie-stained proteins first assessed the relative abundance of complex I subunits in from the BNGE were used as loading control. (C) Densitometric quantification analyses of the NDUFS1 and NDUFV1 band intensities shown in B. complex I-containing bands from the blue native gel. The ma- (D) In-gel H2O2 production in the excised SC and CI bands from the BNGE of jority of complex I subunits were asymmetrically distributed, both digitonin-solubilized isolated mitochondria from control and NDUFS1-over- C in astrocytes and in neurons (Fig. 3 ). This is consistent with expressing astrocytes. H2O2 production values were normalized by the recent work showing different states of subcomplex I aggregates NADH dehydrogenase-activity band intensity obtained in the BNGE. in aging (32). Interestingly, we observed that the only complex I (E) Mitochondrial ROS as assessed using the MitoSox assay in intact cells by subunit that was distributed equally in both cell types was flow cytometry. (F) Rate of pyruvate/malate (5 mM each; 1 mM ADP)-driven mitochondrial oxygen consumption in isolated mitochondria from astro- NADH:ubiquinone oxidoreductase core subunit S1 (NDUFS1) cytes. CIII, complex III subunit UQCRC2; CIV, complex IV subunit MT-CO1. (Fig. 3C), which harbors three out of the eight Fe–Sclustersof Data are the mean values ± SEM from n = 3–4 independent culture prepa- complex I (33). Given its essential role in electron transfer, we next rations (Student’s t test). *P < 0.05.

4of6 | www.pnas.org/cgi/doi/10.1073/pnas.1613701113 Lopez-Fabuel et al. Discussion neuronal death in Parkinson’s disease (41–43). If so, interventions Here, we report that neurons and astrocytes organize their mi- aimed at maintaining complex I stability would be a promising tochondrial respiratory chains differently, with altered proportions therapeutic approach against this, and other neurodegenerative of complex I free or present in supercomplexes. In astrocytes, less diseases. complex I is assembled into supercomplexes, leaving more free complex I. In contrast, in neurons, more complex I is assembled Materials and Methods into supercomplexes. These differences correlate with changes Ethical Use of Animals. Wistar rats and C57BL/6 mice were bred at the Animal in ROS production and respiration, with the more free complex Experimentation Unit of the University of Salamanca. All protocols were I segregating with elevated ROS production. Furthermore, approved by the Bioethics Committee of the University of Salamanca in accordance with the Spanish legislation (law 6/2013). these rates of mitochondrial ROS formation are altered by reorganizing the mitochondrial respiratory chain in response to Primary Cell Cultures. Primary cultures of Wistar rat or C57BL/6 mouse cortical up-modulation and down-modulation of NDUFS1 levels. In- neurons and astrocytes were prepared from embryonic day 15.5–16.5 terestingly, the rate of ROS formation inversely correlated with (neurons) or postnatal 0–24 h (astrocytes), as described previously (44) (SI electron transfer efficiency in neurons, with NDUFS1 knock- Materials and Methods). down impairing mitochondrial O2 consumption but increasing ROS. In contrast, NDUFS1 overexpression in astrocytes de- Mitochondria Isolation and Solubilization. Mitochondria were isolated creased ROS, although it did not increase mitochondrial O2 according to a previously published protocol (24) and solubilized with consumption. This effect on free complex I abundance can be digitonin at 4 g/g (5 min in ice) (SI Materials and Methods). explained by the reduced abundance of complex III in astrocytes that limits the amount of complex I that can be sequestered Mitochondrial Respiration. To measure the state 3 oxygen consumption rates, into supercomplexes. we used a Clark-type electrode (Rank Brothers). Neuronal and astrocytic cells were recollected by trypsinization and mitochondria were immediately The lack of effect of ADP at stimulating pyruvate/malate O2 μ consumption in astrocyte mitochondria is in good agreement with obtained. Freshly isolated mitochondria (100 g) were suspended in the respiration medium (125 mM KCl, 2 mM KH2PO4, 1 mM MgCl2, 0.5 mg/mL the high deactive complex I proportion, and the low complex III BSA, 10 mM Hepes, pH 7.4). Oxygen consumption was determined after the abundance, found in these cells. Thus, NADH-derived electrons addition of 5 mM pyruvate plus 5 mM malate, or 5 mM succinate (state 2), are inefficiently transferred to ubiquinone by deactive complex I followed by the addition of 1 mM ADP (state 3). (30, 31), and subsequently to complex IV due to the low pro- CELL BIOLOGY portion of complex III in astrocytes. Moreover, given the low ROS Determination. Mitochondrial ROS was detected using the fluorescent complex III abundance in astrocytes, it would be reasonable to probe MitoSox (Life Technologies) and MitoB probe (SI Materials and speculate that ubiquinone pool would be favored toward its re- Methods). For H2O2 assessments, AmplexRed (Life Technologies) was used duced status, a factor known to cause complex I deactivation (34). (SI Materials and Methods). H2O2 measured directly form blue native gel Whether a positive loop of complex I deactivation, which is slices were performed in the presence of 20 μM NADH and 40 U/mL SOD promoted by ROS (34), takes place in astrocytes is a tempting (SI Materials and Methods). possibility that remains to be explored. Mitochondrial Membrane Potential. The mitochondrial membrane potential Our results may help explain the different redox and bio- Δψ energetic features of neurons and astrocytes. Thus, the greater ( m) was assessed using the probe DiIC1 (5) (Life Technologies) (50 nM) by flow cytometry (SI Materials and Methods). proportion of complex I assembled into supercomplexes in neurons may contribute to the higher respiration rate of neurons Activity of Mitochondrial Complexes. Cells were collected and suspended in compared with astrocytes. This is consistent with the dependence phosphate buffer (PB: 0.1 M KH2PO4 pH 7.0). After three cycles of freeze/ of neurons on oxidative phosphorylation for neurotransmis- thawing, to ensure cellular disruption, complex I, complex II, complex II–III, sion and survival (17–19). In contrast, the smaller proportion of complex IV, and citrate synthase activities were determined spectrophoto- complex I that is assembled into supercomplexes in astrocytes metrically as indicated in SI Materials and Methods. may contribute to their lower respiration rate and is consistent with their more glycolytic metabolism (17–22). A further in- BNGE. For the assessment of complex I organization, digitonin-solubilized triguing aspect is that the large difference in mitochondrial ROS mitochondria (10–50 μg) were loaded in NativePAGE Novex 3–12% (vol/vol) production between neurons and astrocytes correlates with the gels (Life Technologies). After electrophoresis, in-gel NADH dehydrogenase amount of free complex I. This may explain why astrocytes pro- activity was evaluated (45). After identification of individual complex I and duce more ROS than neurons, and hence are equipped with complex I-containing supercomplexes bands according to the NADH dehydrogenase activity, either a direct electrotransfer or a second-dimension a robust redox antioxidant system (35, 36). Indeed, astrocytes SDS/PAGE were performed to identify some subunits of the mitochondrial express functionally active Nrf2 (11), a transcription factor that complexes. Thus, individual complex I or complex I-containing supercomplexes is activated by ROS (37) and governs expression of a range of bands were excised from the gel and denatured in 1% SDS (containing 1% antioxidant genes that protect both astrocytes and their neigh- β-mercaptoethanol) during 1 h. The proteins contained in the gel slices were boring neurons (38). separated electrophoretically, followed by Western blotting against NDUFS1- In conclusion, the extent of assembly of complex I into or NDUFV1-specific antibodies. Coomassie staining of BNGE gels was per- supercomplexes is different between neurons and astrocytes, and formed, as an indicator of loaded protein, during 15 min followed by different contributes to some of the differences in mitochondrial metabo- steps of destaining with 10% (vol/vol) acetic acid plus 20% (vol/vol) methanol. lism and ROS generation between these cells. However, the Direct transfer of BNGE was performed after soaking the gels for 20 min (4 °C) · – functional and mechanistic role of supercomplexes is currently in carbonate buffer (10 mM NaHCO3,3mMNa2CO3 10H2O, pH 9.5 10). Pro- unclear and disputed (39). In future work, it will be important teinstransfertonitrocellulosemembraneswascarriedoutat300mA,60V,1h to determine whether the differences in respiration and ROS at 4 °C in carbonate buffer. between neurons and astrocytes are due to the properties of the Electroelution of Proteins. Following BNGE and in-gel NADH dehydrogenase supercomplexes themselves (40), or whether the balance be- activity, individual and complex I-containing supercomplexes bands were tween the relative levels of complexes I and III is more critical. excised, and the proteins electroeluted. To electroelute proteins, gel slices Furthermore, it will be very interesting to explore whether were placed in an electrodialysis membrane (Dialysis Tubing-Visking; Medicall changes in complex I incorporation into supercomplexes and/or International), and an electric field was applied during 4 h at 100 V. The its balance with complex III contribute to excessive ROS associ- samples containing the electroeluted proteins were collected, and the ated in pathological situations, such as in the dopaminergic complex I-specific activity was determined.

Lopez-Fabuel et al. PNAS Early Edition | 5of6 Mass Spectrometry. Mass spectrometry analysis was carried out in the multiple-values comparisons, we used one-way ANOVA followed by the blue native gel slices excised from the individual complex I, complex Bonferroni test. The statistical analysis was performed using the SPSS soft- I-containing supercomplexes, and in the interbands, at the Medical Re- ware. In all cases, P < 0.05 was considered significant. search Council Mitochondrial Biology Unit (Cambridge, UK) as described in SI Materials and Methods. ACKNOWLEDGMENTS. We acknowledge Monica Carabias and Monica Resch for technical assistance; Noëlle Dufour, Charlène Joséphine, and Alexis Protein Determinations. Protein samples were quantified by the BCA protein assay Bemelmans for AAVs production; and Charlène Joséphine, Martine Guillerm- kit (Thermo) following the manufacturer’s instructions, using BSA as a standard. ier, Diane Houitte, and Gwenaëlle Aurégan for stereotaxic injections of AAVs. J.P.B. is funded by the Ministry of Economy and Competitiveness (SAF2013-41177-R), Instituto de Salud Carlos III (RD12/0043/0021), European Statistical Analysis. All measurements were carried out at least in three dif- Union (EU) SP3-People-MC-ITN Programme (608381), EU BATCure Grant ferent culture preparations or animals, and the results were expressed as the 666918, and NIH/National Institute on Drug Abuse Grant 1R21DA037678-01. mean values ± SEM. For the comparisons between two groups of values, the A.A. is funded by Instituto de Salud Carlos III (PI12/00685 and RD12/ statistical analysis of the results was performed by Student’s t test. For 0014/0007).

1. Magistretti PJ (2006) Neuron-glia metabolic coupling and plasticity. J Exp Biol 209(Pt 12): 27. Murphy MP (2009) How mitochondria produce reactive oxygen species. Biochem J 2304–2311. 417(1):1–13. — 2. Allen NJ, Barres BA (2009) Neuroscience: Glia more than just brain glue. Nature 28. Cochemé HM, et al. (2011) Measurement of H2O2 within living Drosophila during 457(7230):675–677. aging using a ratiometric mass spectrometry probe targeted to the mitochondrial 3. Kimelberg HK, Nedergaard M (2010) Functions of astrocytes and their potential as matrix. Cell Metab 13(3):340–350. therapeutic targets. Neurotherapeutics 7(4):338–353. 29. Foo LC (2013) Purification of rat and mouse astrocytes by immunopanning. Cold 4. Perea G, Sur M, Araque A (2014) Neuron-glia networks: Integral gear of brain func- Spring Harb Protoc 2013(5):421–432. tion. Front Cell Neurosci 8:378. 30. Babot M, et al. (2014) ND3, ND1 and 39kDa subunits are more exposed in the de- 5. Parpura V, et al. (1994) Glutamate-mediated astrocyte-neuron signalling. Nature active form of bovine mitochondrial complex I. Biochim Biophys Acta 1837(6): 369(6483):744–747. 929–939. 6. Perea G, Navarrete M, Araque A (2009) Tripartite synapses: Astrocytes process and 31. Roberts PG, Hirst J (2012) The deactive form of respiratory complex I from mammalian + + control synaptic information. Trends Neurosci 32(8):421–431. mitochondria is a Na /H antiporter. J Biol Chem 287(41):34743–34751. 7. Araque A, et al. (2014) Gliotransmitters travel in time and space. Neuron 81(4): 32. Miwa S, et al. (2014) Low abundance of the matrix arm of complex I in mitochondria – 728 739. predicts longevity in mice. Nat Commun 5:3837. 8. Oliveira JF, Sardinha VM, Guerra-Gomes S, Araque A, Sousa N (2015) Do stars govern 33. Janssen RJ, Nijtmans LG, van den Heuvel LP, Smeitink JA (2006) Mitochondrial com- our actions? Astrocyte involvement in rodent behavior. Trends Neurosci 38(9): plex I: Structure, function and pathology. J Inherit Metab Dis 29(4):499–515. – 535 549. 34. Dröse S, Stepanova A, Galkin A (2016) Ischemic A/D transition of mitochondrial 9. Schreiner B, et al. (2015) Astrocyte depletion impairs redox homeostasis and triggers complex I and its role in ROS generation. Biochim Biophys Acta 1857(7):946–957. – neuronal loss in the adult CNS. Cell Rep 12(9):1377 1384. 35. Diaz-Hernandez JI, Almeida A, Delgado-Esteban M, Fernandez E, Bolaños JP (2005) 10. Makar TK, et al. (1994) Vitamin E, ascorbate, glutathione, glutathione disulfide, and Knockdown of glutamate-cysteine ligase by small hairpin RNA reveals that both enzymes of glutathione metabolism in cultures of chick astrocytes and neurons: Ev- catalytic and modulatory subunits are essential for the survival of primary neurons. idence that astrocytes play an important role in antioxidative processes in the brain. J Biol Chem 280(47):38992–39001. – J Neurochem 62(1):45 53. 36. Fernandez-Fernandez S, Almeida A, Bolaños JP (2012) Antioxidant and bioenergetic 11. Jimenez-Blasco D, Santofimia-Castaño P, Gonzalez A, Almeida A, Bolaños JP (2015) coupling between neurons and astrocytes. Biochem J 443(1):3–11. Astrocyte NMDA receptors’ activity sustains neuronal survival through a Cdk5-Nrf2 37. Tebay LE, et al. (2015) Mechanisms of activation of the transcription factor Nrf2 by pathway. Cell Death Differ 22(11):1877–1889. redox stressors, nutrient cues, and energy status and the pathways through which it 12. Dringen R, Pfeiffer B, Hamprecht B (1999) Synthesis of the antioxidant glutathione in attenuates degenerative disease. Free Radic Biol Med 88(Pt B):108–146. neurons: Supply by astrocytes of CysGly as precursor for neuronal glutathione. 38. Johnson DA, Johnson JA (2015) Nrf2—a therapeutic target for the treatment of J Neurosci 19(2):562–569. neurodegenerative diseases. Free Radic Biol Med 88(Pt B):253–267. 13. Bolaños JP, Heales SJR, Land JM, Clark JB (1995) Effect of peroxynitrite on the mi- 39. Blaza JN, Serreli R, Jones AJ, Mohammed K, Hirst J (2014) Kinetic evidence against tochondrial respiratory chain: Differential susceptibility of neurones and astrocytes in partitioning of the ubiquinone pool and the catalytic relevance of respiratory-chain primary culture. J Neurochem 64(5):1965–1972. supercomplexes. Proc Natl Acad Sci USA 111(44):15735–15740. 14. Bolaños JP, et al. (1996) Nitric oxide-mediated mitochondrial damage: A potential 40. Maranzana E, Barbero G, Falasca AI, Lenaz G, Genova ML (2013) Mitochondrial re- neuroprotective role for glutathione. Free Radic Biol Med 21(7):995–1001. spiratory supercomplex association limits production of reactive oxygen species from 15. Deighton RF, et al. (2014) Nrf2 target genes can be controlled by neuronal activity in complex I. Antioxid Redox Signal 19(13):1469–1480. the absence of Nrf2 and astrocytes. Proc Natl Acad Sci USA 111(18):E1818–E1820. 41. Perry TL, Godin DV, Hansen S (1982) Parkinson’s disease: A disorder due to nigral 16. Baxter PS, et al. (2015) Synaptic NMDA receptor activity is coupled to the transcrip- glutathione deficiency? Neurosci Lett 33(3):305–310. tional control of the glutathione system. Nat Commun 6:6761. 42. Schapira AH, et al. (1989) Mitochondrial complex I deficiency in Parkinson’s disease. 17. Almeida A, Moncada S, Bolaños JP (2004) Nitric oxide switches on glycolysis through the Lancet 1(8649):1269. AMP protein kinase and 6-phosphofructo-2-kinase pathway. Nat Cell Biol 6(1):45–51. 43. Schapira AH (2012) Mitochondrial diseases. Lancet 379(9828):1825–1834. 18. Almeida A, Almeida J, Bolaños JP, Moncada S (2001) Different responses of astrocytes 44. Requejo-Aguilar R, et al. (2014) PINK1 deficiency sustains cell proliferation by re- and neurons to nitric oxide: The role of glycolytically generated ATP in astrocyte protection. Proc Natl Acad Sci USA 98(26):15294–15299. programming glucose metabolism through HIF1. Nat Commun 5:4514. 19. Herrero-Mendez A, et al. (2009) The bioenergetic and antioxidant status of neurons 45. Diaz F, Barrientos A, Fontanesi F (2009) Evaluation of the mitochondrial respiratory is controlled by continuous degradation of a key glycolytic enzyme by APC/C-Cdh1. chain and oxidative phosphorylation system using blue native gel electrophoresis. Nat Cell Biol 11(6):747–752. Curr Protoc Hum Genet Chapter 19:Unit19.4. 20. Pellerin L, Magistretti PJ (1994) Glutamate uptake into astrocytes stimulates aerobic 46. Subbalakshmi GY, Murthy CR (1985) Isolation of astrocytes, neurons, and synapto- glycolysis: A mechanism coupling neuronal activity to glucose utilization. Proc Natl somes of rat brain cortex: Distribution of enzymes of glutamate metabolism. – Acad Sci USA 91(22):10625–10629. Neurochem Res 10(2):239 250. 21. Bouzier-Sore AK, Voisin P, Canioni P, Magistretti PJ, Pellerin L (2003) Lactate is a 47. Ragan CI, Wilson MT, Darley-Usmar VM, Lowe PN (1987) Subfractionation of mito- preferential oxidative energy substrate over glucose for neurons in culture. J Cereb chondria and isolation of the proteins of oxidative phosphorylation. Mitochondria: A Blood Flow Metab 23(11):1298–1306. Practical Approach, eds Darley-Usmar VM, Rickwood D, Wilson MT (IRL, London), pp 22. Allaman I, Bélanger M, Magistretti PJ (2011) Astrocyte-neuron metabolic relation- 79–112. ships: For better and for worse. Trends Neurosci 34(2):76–87. 48. King TE (1967) Preparation of succinate cytochrome c reductase and the cytochrome 23. Bianchi C, Genova ML, Parenti Castelli G, Lenaz G (2004) The mitochondrial re- b-c1 particle, and reconstitution of succinate cytochrome c reductase. Methods spiratory chain is partially organized in a supercomplex assembly: Kinetic evidence Enzymol 10:216–225. using flux control analysis. J Biol Chem 279(35):36562–36569. 49. Wharton DC, Tzagoloff A (1967) Cytochrome oxidase from beef heart mitochondria. 24. Acín-Pérez R, Fernández-Silva P, Peleato ML, Pérez-Martos A, Enriquez JA (2008) Methods Enzymol 10:245–250. Respiratory active mitochondrial supercomplexes. Mol Cell 32(4):529–539. 50. Shepherd D, Garland PB (1969) The kinetic properties of citrate synthase from rat liver 25. Lapuente-Brun E, et al. (2013) Supercomplex assembly determines electron flux in the mitochondria. Biochem J 114(3):597–610. mitochondrial electron transport chain. Science 340(6140):1567–1570. 51. Starkov AA (2010) Measurement of mitochondrial ROS production. Methods Mol Biol 26. Kussmaul L, Hirst J (2006) The mechanism of superoxide production by NADH:ubi- 648:245–255. quinone oxidoreductase (complex I) from bovine heart mitochondria. Proc Natl Acad 52. Olsen C, Rustad A, Fonnum F, Paulsen RE, Hassel B (1999) 3-Nitropropionic acid: An Sci USA 103(20):7607–7612. astrocyte-sparing neurotoxin in vitro. Brain Res 850(1-2):144–149.

6of6 | www.pnas.org/cgi/doi/10.1073/pnas.1613701113 Lopez-Fabuel et al. Supporting Information

Lopez-Fabuel et al. 10.1073/pnas.1613701113 SI Materials and Methods day 7 for neurons, or at day 14 for astrocytes, washed with PBS, Primary Cell Cultures. Primary cultures of rat or mice cortical and incubated in KRPG buffer (145 mM NaCl, 5.7 mM Na2HPO4, neurons (44) were prepared from fetal Wistar rats of 16.5 d of 4.86 mM KCl, 0.54 mM CaCl2, 1.22 mM MgSO4, 5.5 mM glucose, gestation, and 15.5 d in C57BL/6 mice, seeded at 2.0 × 105 cells per pH 7.35) in the presence of 9.45 μM AmplexRed containing 2 cm in different-sized plastic plates coated with poly-D-lysine 0.1 U/mL horseradish peroxidase. Luminescence was recorded for (10 μg/mL) and incubated in Neurobasal (Life Technologies) 2 h at 30-min intervals using a Fluoroskan Ascent FL (Thermo supplemented with 2 mM glutamine and 2% (vol/vol) B27 sup- Scientific) (excitation, 538 nm; emission, 604 nm). Slopes were plement (Life Technologies), either with antioxidants (AO) or used for calculations of the rates of H2O2 formation. VAS2870 or μ minus antioxidants (MAO) (i.e., lacking vitamin E, vitamin E allopurinol (1, 5, 10, 50, and 100 M) and nitro-L-arginine methyl μ acetate, superoxide dismutase, catalase, and glutathione). Cells ester (NAME) (50, 100, 250, 500, and 1,000 M) were added to the reaction buffer during the determination. H2O2 was measured were incubated at 37 °C in a humidified 5% (vol/vol) CO2-containing atmosphere. At 72 h after plating, medium was replaced. either from the endogenous substrates or with pyruvate/malate μ – Cells were used at day 7. Astrocytes in primary culture were (5 mM each) in isolated mitochondria, using 5 gofproteins obtained from 0- to 24-h-old neonates, and cell suspension aliquots of freshly obtained intact mitochondria, using the 2 same protocol as described for intact cells. To assess the effect seeded at the ratio of three to four brains per 175-cm plastic μ flask, in DMEM supplemented with 10% (vol/vol) fetal serum of CCCP in mitochondrial H2O2 production, CCCP (10 M) (11). To detach nonastrocytic cells, after 1 wk in vitro, the flasks was added to the mixture at the start of the determination, as were shaken at 180 rpm overnight. The supernatant was dis- indicated. The determination of H2O2 directly form blue native gel electrophoresis (BNGE) gel slices was performed in the carded, and the attached, astrocyte-enriched cells were reseeded μ at 0.5–1 × 105 cells per cm2 in different-sized plates. Astrocytes presence of 20 M NADH and 40 U/mL SOD; luminescence was were used for experiments on day 14. recorded every 5 min during 50 min, and the in-gel H2O2 production values were normalized by the NADH dehydrogenase- Cell Transfections. Cells were transfected using Lipofectamine LTX- activity band intensity obtained in the BNGE. PLUS Reagent (Life Technologies) according to the manufacturer’s MitoB. For mitochondrial assessment of H O production, intact protocol. Transfections were performed 24 h before cell collec- 2 2 neurons and astrocytes, seeded in 12-well plates, were incubated tion. NDUFS1 was expressed using a plasmid vector harboring during 6 h with 5 μM MitoB and 50 U/mL catalase. After this the NDUFS1 full-length cDNA (MC206222; Origene), using time, the medium was removed and frozen under liquid N . pcDNA3.1(+) (V790-20; Invitrogen) as control. Cotransfection in 2 MitoB and its oxidized form (MitoP) were analyzed in the cell a 9:1 relation were performed with peGFPc1 plasmid (6084-1; + media by liquid chromatography–MS/MS as described (28). The Clontech) to allow the selection of GFP cells by flow cytometry. MitoP/MitoB ratio was normalized by the cell number. For protein knockdown experiments, we used small interfering RNAS (siRNAs) against NDUFS1 (siNDUFS1) (s105592; Life Mitochondrial Membrane Potential. The mitochondrial membrane Technologies) and p22phox (sip22phox) (s64648; Life Technologies). potential (Δψm) was assessed using the probe DiIC1 (5) (Life A siRNA control (siControl) (4390843; Life Technologies) was Technologies) (50 nM) by flow cytometry. For this purpose, used in parallel. Transfections with siRNAs were performed with suspended cells were incubated with the probe at 37 °C for 30 min Lipofectamine RNAiMAX reagent (Life Technologies) according in the presence of PBS. Δψ values were expressed in arbitrary ’ m to the manufacturer s protocol using a siRNA final concentration units. CCCP (10 μM) was added to cells (15 min) to define of 9 nM. Cells were used after 3 d. the depolarized value. Mitochondrial depolarization was also assessed after 15-min incubation with antimycin A (10 μM) or Mitochondrial ROS. Mitochondrial ROS was detected using the rotenone (10 μM). fluorescent probe MitoSox (Life Technologies). Cells were in- μ + − cubated with 2 M MitoSox for 5, 15, 30, 45, and 60 min at 37 °C Brain Dissociation and Integrin-β5 / Cell Selection. Brain dissocia- in a 5% (vol/vol) CO2 atmosphere in HBSS buffer (134.2 mM tion of C57BL/6 adult mice was performed enzymatically and NaCl, 5.26 mM KCl, 0.43 mM KH2PO4, 4.09 mM NaHCO3, 0.33 mechanically following a previously published protocol (46). Cells · mM Na2HPO4 2H2O, 5.44 mM glucose, 20 mM Hepes, 4 mM were stained with integrin-β5 antibody (29) (1/500; 14-0497; · CaCl2 2H2O, pH 7.4). Cells were then washed with PBS eBioscience) to identify astrocytes during 1.5 h in PBS at room · (136 mM NaCl, 2.7 mM KCl, 7.8 mM Na2HPO4 2H2O, 1.7 mM temperature. Cells were incubated with the secondary antibody KH2PO4, pH 7.4) and trypsinized. MitoSox fluorescence was (1/500; Alexa 488; ab150105; Abcam) 30 min at 37 °C, in the •− assessed by flow cytometry (in arbitrary units). Electron transport presence of MitoSox (2 μM) or DiIC1 (5) (50 nM) in PBS. O2 inhibitors were added to the mixture during 5, 15, and 30 min and Δψm were measured in integrin-β5–positive and –negative [10 μM antimycin A (Sigma) or rotenone (Sigma)]. The treatment cells by flow cytometry. The specificity of integrin-β5 antibody of cells with the inhibitors did not change cell population, assessed was ascertained by Western blotting in cell-sorted cells (FACS + by side scatter (granularity) versus forward scatter (cell size) pa- Aria III Cell Sorter; BD Biosciences). Integrin-β5 and Integrin- − rameters by flow cytometry. CCCP uncoupler was preincubated for β5 cells were collected in different tubes and lysed with radio- 15 min (10 μM). Mitochondrial localization of MitoSox was immunoprecipitation assay (RIPA) buffer (1% SDS, 2 mM assessed by fluorescence confocal microscopy at different times. EDTA, 12.5 mM Na2HPO4, 1% Triton X-100, 150 mM NaCl, MitoSox colocalization in mitochondria was confirmed after the pH 7) for Western blot analysis using GFAP and microtubule- coincubation of cells with the Cytopainter Mitochondrial Staining associated protein 2 (MAP2) antibodies. Kit (1/1,000; Abcam). Generation of AAVs. We used two types of AAV to mediate H2O2 Determination. For H2O2 assessments, AmplexRed (Life transgene expression in either neurons or astrocytes. To target Technologies) was used. Cells were plated onto 96-well plate, at astrocytes, AAV of the 2/9 serotype, using the minimal gfa-ABC1D

Lopez-Fabuel et al. www.pnas.org/cgi/content/short/1613701113 1of8 promoter and expressing GFP was generated. To target neurons, the presence of 8 mM MgCl2, 2.5 mg/mL BSA, 0.15 mM NADH, AAV of the 2/10 serotype, using the mouse phosphoglycerate and 1 mM KCN. Changes in absorbance at 340 nm (30 °C) (e = − − kinase (PGK) promoter and expressing GFP was generated. 6.81 mM 1·cm 1) were recorded after the addition of 50 μM AAVs were used at a concentration of 3.3 × 1012 viral ge- ubiquinone and 10 μM rotenone. Deactive complex I was de- nomes per mL. termined after N-ethylmaleimide (NEM) treatment of cell homogenates (10 mM; 15 min; 15 °C). Complex I activity in the Stereotaxic Injections. Nine-week-old C57BL/6 male mice were presence of NEM exclusively reflects active form of complex I, anesthetized with a mixture of ketamine (150 mg/kg) and xylazine because NEM blocks the transition from deactive to active (10 mg/kg). Lidocaine (5 mg/kg) was injected s.c. on the skull conformation. When complex I activity was assessed in the 5 min before the beginning of surgery. Bilateral AAV injections electroeluted proteins from BNGE-excised bands, data were not were performed by using stereotaxic apparatus (Stoelting) to normalized per protein abundance in the band, because in these guide the placement of 28-gauge blunt needles into the so- cases we aimed to assess the amount of total complex I activity matosensory cortex (0.7 mm posterior to bregma, ±3 mm lateral present in each band. The activity of complex II (succinate– to midline, and 0.6 mm from the pial surface). Either 3 μLof ubiquinone oxidoreductase) (28) was determined at 600 nm −1 −1 AAV2/9-gfaABC1D GFP or AAV2/10-PGK-GFP was injected (30 °C) (e = 19.2 mM ·cm ) in PBS containing 8 mM MgCl2, using a 10-μL Hamilton syringe at a rate of 0.25 μL/min with 2.5 mg/mL BSA, 10 mM succinate, 3 mM KCN, 2 μg/mL anti- a pump (CMA-400; Harvard Apparatus). At the end of the in- mycin A, 5 μM rotenone, and 0.03 mM DCPIP. Fifty micromolar jection, the needle was left in place for 5 min before being slowly ubiquinone was added to the mixture to trigger the reaction. removed. The skin was sutured, and mice were allowed to re- Complex II–III (succinate–cytochrome c oxidoreductase) activity cover in a warming cabinet (Harvard Apparatus). (48) was determined in the presence of 100 mM phosphate + buffer, plus 0.6 mM EDTA(K ), 2 mM KCN, and 200 μM cy- Brain Dissociation After AAV Injections. Animals were used at 12 wk tochrome c. Changes in absorbance were recorded (550 nm; − − of age. The brain was extracted and cut in 1-mm slices, the 30 °C) (e = 19.2 mM 1·cm 1) after the addition of 20 mM suc- hemispheres were separated, and the fluorescent areas were cinate and 10 μM antimycin A. For complex IV (cytochrome c punched under a microscope in sections corresponding to cere- oxidase) activity, the first rate constant of cytochrome c oxidation bral cortex. Cells were separated using Neuronal Tissue Disso- was determined (49) in the presence of 10 mM phosphate buffer ciation Kit (P) (Miltenyi). After excision, MitoSox (2 μM) staining and 50 μM reduced cytochrome c; absorbance was recorded every was performed (30 min at 37 °C in PBS), and MitoSox fluores- e = −1· −1 + minute at 550 nm, 30 °C ( 19.2 mM cm ). Citrate synthase cence was evaluated in GFP cells by flow cytometry. activity (50) was measured in the presence of 93 mM Tris·HCl, 0.1% (vol/vol) Triton X-100, 0.2 mM acetyl-CoA, 0.2 mM DTNB; Purification of Neurons and Astrocytes from Brain Using the MACS the reaction was started with 0.2 mM oxaloacetate, and the ab- − − Technology. Mouse adult brain was dissociated using Neuronal sorbance was recorded at 412 nm (30 °C) (e = 13.6 mM 1·cm 1). Tissue Dissociation Kit (P) followed by cell separation using either the astrocyte-specific anti-ACSA-2 Microbead Kit (mouse) Mitochondria Isolation and Solubilization. Mitochondria were (Miltenyi) or the neuron-specific Neuron Isolation Kit (mouse) obtained according to a previously published protocol (24). Briefly, (Miltenyi) according to the manufacturer’s protocol (MACS cells (12–100 millions) were collected, and cell pellets were frozen technology). We confirmed the identity of the isolated fractions at −80 °C and homogenized (10 strokes) in a glass–Teflon Potter- by Western blotting against neuronal [neuron-specific class III Elvehjem, in Buffer A (83 mM sucrose, 10 mM Mops, pH 7.2). beta tubulin (TUJ1) and MAP2]- or astrocytic (GFAP)-specific The same volume of Buffer B (250 mM sucrose, 30 mM Mops) markers. was added to the sample, and the homogenate was centrifuged (1,000 × g, 5 min) to remove unbroken cells and nuclei. Centri- Immunofluorescence and Image Analysis. Following an overdose of fugation of the supernatant was then performed (12,000 × g, sodium pentobarbital, mice were perfused transcardially with 4% 2 min) to obtain the mitochondrial fraction, which was washed in (wt/vol) paraformaldehyde in PB. Brains were postfixed by in- Buffer C (320 mM sucrose, 1 mM EDTA, 10 mM Tris·HCl, cubation in the same solution overnight and cryoprotected by pH 7.4). Mitochondria were suspended in Buffer D (1 M 6-amino- incubation in a 30% (wt/vol) sucrose solution during 48 h. hexanoic acid, 50 mM Bis-Tris·HCl, pH 7.0). Solubilization of Floating coronal brain sections (40 μm) were cut on a freezing mitochondria was performed with digitonin at 4 g/g (5 min in ice). microtome, collected serially (interspace, 240 or 280 μm), and After a 30-min centrifugation at 13,000 × g, the supernatant was stored at −20 °C in a storing solution containing ethylene glycol, collected. For ROS measurement in isolated mitochondria, only glycerol, and PB, until analysis. Sections were blocked and in- highly enriched mitochondrial fractions were used (51). cubated overnight at 4 °C with a solution containing the primary antibody in 3% (vol/vol) normal goat serum (Sigma), 0.2% Tri- Primary Antibodies for Western Blotting. Immunoblotting was ton X-100 (Sigma) in PB. The primary antibodies used were performed with anti-GFAP (1/1000) (G6171; Sigma), anti-MAP2 GFAP-Cy3 (1/500 GA-5 clone; mouse; Sigma) and neuronal (1/500) (M1406; Sigma), anti-TUJ1 (1/1,000) (ab18207; Abcam), nuclear protein (NeuN; 1/500; mouse; MAB377; Chemicon). anti-NDUFS1 (1/500) (sc-50132; Santa Cruz Biotechnology), anti- They were then incubated for 1 h at room temperature with a NDUFB8 (1/1,000) (ab110242; Abcam), anti-UQCRC2 (1/1,000) fluorescent secondary antibody diluted at 1/500 (anti-mouse (A-11143; Molecular Probes), anti-p22phox (1/500) (sc-20781; Santa Alexa Fluor 594). The sections were mounted in FluorSave re- Cruz Biotechnologies), anti-MT-CO1 (1/1,000) (ab14705; Abcam), agent (Calbiochem; Merck), covered with a coverslip, and ana- and anti-β-Actin (1/30,000) (A5441; Sigma). lyzed with confocal microscopy (SP8; Leica) using a 40× objective. Western Blotting. Cells were lysed in RIPA buffer, supplemented with protease inhibitor mixture (Sigma), 100 μMphenyl- Activity of Mitochondrial Complexes. Cells were collected and methylsulfonyl fluoride, and phosphatase inhibitors (1 mM suspended in PBS (pH 7.0). After three cycles of freeze/thawing, o-vanadate). Samples were boiled for 5 min. Aliquots of cell lysates to ensure cellular disruption, complex I, complex II, complex (50 μg of protein, unless otherwise stated) were subjected to SDS/ II–III, complex IV, and citrate synthase activities were determined. PAGE on a 8% or 10% (vol/vol) acrylamide gel (MiniProtean; Bio- Rotenone-sensitive NADH-ubiquinone oxidoreductase activity Rad) including PageRuler Plus Prestained Protein Ladder (Thermo). (complex I) (47) was measured in KH2PO4 (20 mM; pH 7.2) in The resolved proteins were transferred electrophoretically to

Lopez-Fabuel et al. www.pnas.org/cgi/content/short/1613701113 2of8 nitrocellulose membranes (Amersham Protran Premium 0.45 ni- sequences to peptide fragmentation spectra, and subsequent trocellulose; Amersham). Membranes were blocked with 5% grouping to identify proteins, was performed using Proteome (wt/vol) low-fat milk in 20 mM Tris, 150 mM NaCl, and 0.1% Discoverer software (Thermo Scientific) in the Mascot protein (vol/vol) Tween 20, pH 7.5, for 1 h. Subsequent to blocking, identification program (Matrix Science). Mascot was configured membranes were immunoblotted with primary antibodies over- to use the Mus musculus subset of the Uniprot database current night at 4 °C. After incubation with horseradish peroxidase- in December 2013. Following spectrum-to-peptide sequence conjugated goat anti-rabbit IgG (Santa Cruz Biotechnologies), assignment, individual peptide relative intensities were quantified by goat anti-mouse IgG (Sigma and Bio-Rad), mouse anti-rabbit Proteome Discoverer using the workflow components “Event IgG (Sigma), or rabbit anti-goat IgG (Abcam) (all at 1/10,000 Detection” and “Precursor Ions Area Detection.” Having quanti- dilution, except goat anti-rabbit, 1/4,000, and mouse anti-rabbit, fied the peptides in a relative fashion, these components’ esti- 1/5,000), membranes were immediately incubated with the mates of protein relative intensities were performed by grouping enhanced chemiluminescence kit WesternBright ECL (Advansta), the peptides derived from the proteins and selecting, when pos- before exposure to Fuji Medical X-Ray film (Fujifilm), and the sible, the three most intense peptide relative intensities to obtain autoradiograms were scanned. Three to four biologically in- a representative mean value. From the different positions, the dependent replicates were always performed, although only one area of the different proteins was normalized to the maximum representative Western blot is shown in the article. The protein value to allow to cluster proteins and to obtain information on abundances of all Western blots per condition were measured by the abundance of each protein in the gel. In addition, the relative densitometry of the bands on the films using ImageJ 1.48u4 abundances of complex I subunits were estimated at different software (National Institutes of Health) and were normalized, positions. and the resulting values were used for the statistical analysis. Real-Time Quantitative PCR. This was performed in total RNA Mass Spectrometry. Mass spectrometry analysis was carried out in samples, purified from astrocytes or neurons using the GenElute the BNGE gel slices excised from the individual complex I, Mammalian Total RNA Miniprep Kit (Sigma), following the complex I-containing supercomplexes, and in the interbands, at the manufacturer’s protocol. Amplifications were performed in Medical Research Council Mitochondrial Biology Unit (Cam- 100 ng of RNA, using Power SYBR Green RNA-to-CT 1-Step bridge, UK). Fragments were excised and digested using standard kit (Applied Biosystems). Primers and conditions are summa- in-gel digestion protocols. The digested peptides were extracted, rized in Table S1. The mRNA abundance of each transcript was dried, and suspended in a solution of 0.1% formic acid. These normalized to the β-actin mRNA abundance obtained in the samples were then processed with an LTQ OrbiTrap XL mass same sample. The resulting normalized values in astrocytes were spectrometer (Thermo Fisher), following chromatography expressed as the fold change versus the corresponding normal- on a nanoscale reverse-phase column. Assignment of peptide ized values in neurons or control conditions.

Lopez-Fabuel et al. www.pnas.org/cgi/content/short/1613701113 3of8 Fig. S1. Organization of mitochondrial electron transport chain. (A) Relative abundance of complex I and complex III, in free complex (CI or CIII) versus the abundance of the complexes into I2+III2 and I+III2 supercomplexes (CI-SC or CIII-SC), after the quantification of bands intensity in direct immunoblotting of BNGE against either complex I subunit NDUFB8 or III subunit UQCRC2. (B) Characterization of neurons and astrocytes freshly purified from mouse brain using the MACS technology by Western blotting against neuronal (TUJ1 and MAP2) and astrocytic marker (GFAP). (C) Mitochondrial electron transport chain organization, assayed by BNGE followed by direct immunoblotting against complex I (CI; NDUFS1) or complex III (CIII; UQCRC2) plus complex IV (CIV; MT-CO1), from neurons and astrocytes freshly obtained from mouse brain using the MACS technology. The results of the quantification of the relative abundance of CI and CIII in free/supercomplexes bands (SC; I2+III2 plus I+III2) after electroblotting of BNGE is shown. (D) BNGE followed by direct immunoblotting against complex I subunit NDUFS1 (CI) in primary cultures of neurons and astrocytes incubated at 11% of O2 for 24 h. The Coomassie-stained proteins is shown as an indicator of loaded proteins. The quantification of the relative abundance of CI in free/supercomplexes bands (SC; I2+III2 plus I+III2) after electroblotting of BNGE in a representative experiment is shown. (E) Succinate (5 mM)-driven mitochondrial oxygen consumption in isolated mitochondria from neurons or astrocytes under state 2 (0 mM ADP) or state 3 (1 mM ADP), either in the absence or in the presence of KCN (2 mM). Data are the mean values ± SEM from n = 3–4 independent culture preparations or animals (Student’s t test). *P < 0.05.

Lopez-Fabuel et al. www.pnas.org/cgi/content/short/1613701113 4of8 Fig. S2. The higher ROS production in astrocytes compared with neurons is conserved in mouse and rat and is not dependent on cell culture conditions. (A)A kinetics analysis of H2O2 production in neurons and astrocytes from C57BL/6 mice assayed by AmplexRed shows linearity with time up to 2 h. (B) Rates of H2O2 production, as assessed using the AmplexRed assay, in intact C56BL/6 mouse or Wistar rat neurons and astrocytes in primary culture, after replacementofthe standard medium with antioxidants (standard medium or Neurobasal AO) or without antioxidant (Neurobasal MAO) for the last 24 h. (C) Rates of H2O2 production assessed using the AmplexRed assay, in mitochondria isolated from Wistar rat neurons and astrocytes in primary culture. (D) Mitochondrial ROS as quantified using the MitoSox assay in the intact cells by flow cytometry at different times. (E) Confocal images of neurons and astrocytes loaded with MitoSox showing mitochondrial-like localization of the probe at 5, 15, and 30 min, but both mitochondrial-like and nuclear (red arrows) localization at 45 and 60 min. Accordingly, MitoSox fluorescence was evaluated at 30 min (or 15 min) in all subsequent experiments. (Magnification: 40×.) (F) To confirm mitochondrial, but not nuclear, MitoSox localization at 30 min, confocal images of cultured mouse astrocytes and neurons were performed to show the colocalization of MitoSox (MitoS) with the mitochondrial-tagged dye Cytopainter (MitoT). (Magnification: 40×.) DAPI was used to stain nuclei. (G) Mitochondrial ROS as quantified using the MitoSox assay at 30 min in intact cells (Wistar rats) by flow cytometry. (H) Quantification of MitoSox fluorescence in neurons and astrocytes in primary culture in the absence (none) or presence of complex I (rotenone, 10 μM) or complex III (antimycin, 10 μM) inhibitors, at 5-, 15-, and 30-min reveals that 15 min is sufficient to achieve maximal increase in mitochondrial ROS. Data are the mean values ± SEM from n = 3–4 independent culture preparations (Student’s t test). *P < 0.05.

Lopez-Fabuel et al. www.pnas.org/cgi/content/short/1613701113 5of8 Fig. S3. Xanthine oxidase, nitric oxide synthase, or NADPH oxidases do not account for the high rate of ROS production by astrocytes. (A) Inhibition of •− xanthine oxidase, a well-known nonmitochondrial O2 source, using allopurinol at a wide range of effective concentrations, did not alter the rate of H2O2 production in mouse primary astrocytes. (B) Nitric oxide synthase (NOS) inhibition with nitro-L-arginine methyl ester (NAME) did not alter H2O2 production in astrocytes. (C) mRNA relative abundances of the nonmitochondrial NADPH oxidase (NOX)-1 (NOX1) and NOX2, and mitochondrial NOX4, well-known sources of superoxide, in neurons and astrocytes. (D) Inhibition of NOXs using VAS2870 at a wide range of effective concentrations did not alter the rate of H2O2 production in astrocytes. (E) siRNA-mediated knockdown of the NOXs assembly protein, p22phox, was confirmed by RT-qPCR and Western blotting in astrocytes. phox The rate of H2O2 production was unaltered in p22 -knockdown astrocytes. Data are the mean values ± SEM from n = 3–4 independent culture preparations (Student’s t test; ANOVA post hoc Bonferroni). *P < 0.05; n.s., not significant.

Lopez-Fabuel et al. www.pnas.org/cgi/content/short/1613701113 6of8 Fig. S4. Astrocytes produce ROS faster than neurons in freshly acutely dissociated cells from mice. (A) MitoSox fluorescence, as assessed by flow cytometry (FC), in freshly isolated neurons and astrocytes from the adult brain mouse. Identification of astrocytes was performed by incubation with astrocyte-specific anti-integrin β5+ cells and was confirmed by GFAP immunoblotting in the cell-sorted cells. Anti-integrin β5− cells were enriched in neurons as judged by MAP2 + immunoblotting in the cell-sorted cells. (B) Δψm was assessed using the DiIC1 (5) probe by flow cytometry (full depolarization by 10 μM CCCP) in integrin β5 − (astrocyte-enriched) and integrin β5 (neuron-enriched) cells. (C) Rates of H2O2 production, as assessed by the AmplexRed assay, in neurons and astrocytes freshly purified from C56BL/6 mouse brain using the MACS technology. Data are the mean values ± SEM from n = 3 animals (Student’s t test). *P < 0.05.

Lopez-Fabuel et al. www.pnas.org/cgi/content/short/1613701113 7of8 Fig. S5. Analysis of the mitochondrial respiratory chain complexes reveals higher proportion of deactive complex I in astrocytes than in neurons. (A) Specific activities of mitochondrial complex II–III (succinate–cytochrome c oxidoreductase), complex IV (cytochrome c oxidase), and citrate synthase, as assessed spectrophotometrically in whole-cell homogenates. (B) Specific activity of mitochondrial complex II (succinate–ubiquinone oxidoreductase) in neurons and astrocytes incubated in the absence or in the presence of the complex II inhibitor 3-nitropropionic acid (3NP). Citrate synthase activity denotes no changes by 3NP treatment. (C) Mitochondrial ROS abundance, as assessed by MitoSox fluorescence by flow cytometry in neurons and astrocytes incubated in the absence or in the presence of 3NP. The aim of this experiment was to analyze the contribution of reverse electron transfer (RET) to mitochondrial ROS production in both cell types. Because MitoSox fluorescence was not altered by 3NP treatment in astrocytes, we conclude that the contribution of RET to ROS production in astrocytes is negligible. MitoSox fluorescence was, however, increased in neurons, which is likely is due to 3NP excitotoxicity, as previously described (52), and not to RET- mediated ROS production. (D) Complex I activity, as assessed by the rotenone-sensitive NADH-ubiquinone oxidoreductase activity obtained with or without N-ethylmaleimide (NEM) (10 mM) in astrocytes and neurons to determine the proportion of deactive complex I. Data are the mean values ± SEM from n = 3–4 independent culture preparations (Student’s t test). *P < 0.05. Ast, astrocytes; Neu, neurons.

Table S1. Primers and conditions for RT-qPCR mRNA Forward, 5′–3′ Reverse, 5′–3′ Concentration, μM Temperature, °C

Nox1 CTGTAGGCGCCCTAAGTTTG AAACCGGAGGATCCTTTCAC 0.1 58 Nox2 ATGCAGGAAAGGAACAATGC GTGCACAGCAAAGTGATTGG 0.1 58 Nox3 ACAAATGCAGTGAGGCACAG CCGTGTTTCCAGGGAGAGTA 0.1 58 Nox4 TGCAGAGATATCCAGTCCTTCC TCCCATCTGTTTGACTGAGG 0.1 58 Duox1 CTGACCCACCACCTCTACATC CAGGAAGAAGATGTGGAAACG 0.1 58 Duox2 TGAGAATGGCTTCCTCTCCA TCCCGGAACATAGACTCCAC 0.1 58 p22phox CTGGCCTGATTCTCATCACT GGGATACTCCAGCAGACAGA 0.1 58 β-actin AGAGTCATGAGCTGCCTGAC CAACGTCACACTTCATGATG 0.4 58

Lopez-Fabuel et al. www.pnas.org/cgi/content/short/1613701113 8of8