DOCSLIB.ORG

A Patient with Rothmund-Thomson Syndrome and All Features of RAPADILINO

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Patient with Rothmund-Thomson Syndrome and All Features of RAPADILINO OBSERVATION A Patient With Rothmund-Thomson Syndrome and All Features of RAPADILINO Richard Kellermayer, MD, PhD; H. Annika Siitonen, MSc; Kinga Hadzsiev, MD; Marjo Kestilä, PhD; György Kosztolányi, MD, PhD Background: Mutations of the human helicase gene carries a truncating mutation and a newly identified mis- RECQL4 have been identified in a subset of patients with sense mutation of RECQL4. The proband uniquely de- Rothmund-Thomson syndrome (RTS) and in children veloped all criteria of RAPADILINO in addition to his with the diagnosis of RAPADILINO syndrome (RAdial prominent skin findings. hypoplasia/aplasia, PAtellar hypoplasia/aplasia, cleft or highly arched PAlate, DIarrhea and DIslocated joints, LIttle Conclusions: Patients with RTS may possess all fea- size [Ͼ2 SDs below the mean in height] and LImb mal- tures of RAPADILINO. Consequently, a genetic ap- formation, and slender NOse and NOrmal intelligence). proach to RTS and RAPADILINO could be beneficial. This While many features of the 2 genetic disorders overlap, approach may provide a better understanding of the wide poikiloderma—a hallmark of RTS—has been described variety of related phenotypic findings and improve prog- as generally absent in RAPADILINO syndrome. nostics. Observations: We report herein a patient with RTS who Arch Dermatol. 2005;141:617-620 UGUSTE ROTHMUND1 AND humans and with several features of pre- Sydney Thomson2 de- mature aging and/or cancer predisposi- scribed 2 separate medi- tion.8-10 Mutations in the RECQ-like genes cal conditions that were BLM, WRN, and RECQL4 can result in thought to be part of the Bloom syndrome, Werner syndrome, and Asame entity and consequently designated RTS, respectively.8 Rothmund-Thomson syndrome (RTS) by The RECQL4 gene contains 21 exons William Taylor3 (Online Mendelian In- in less than 6.5 kilobases of genomic se- heritance in Man [OMIM] 268400). This quence with 13 introns that are less than is a rare, autosomal recessive disorder char- 100 base pairs in length.11 This peculiar acterized by a poikilodermatous rash start- gene structure predisposes mutated ing in infancy, cataracts, growth retarda- RECQL4 messenger RNA to diffuse mis- tion, skeletal abnormalities, hair loss, and splicing alterations.12 Consequently, in- a high incidence of malignancies, espe- tronic size constraint and point muta- cially osteosarcomas.4,5 In 1999, Kitao and tions in the introns of the RECQL4 gene coworkers6 linked a subset of RTS cases have been shown to play a role in the de- Author Affiliations: to mutations in the human helicase gene velopment of RTS in addition to exonic de- 12-14 Department of Medical Genetics RECQL4. Recent observations in Recql4- fects. A cohort study of 33 patients and Child Development, deficient mice support a pathogenic role showed that in about 57% of RTS cases, University of Pécs, Pécs, for this molecular defect in RTS.7 mutations of both RECQL4 alleles can be Hungary (Drs Kellermayer, RECQL4 is a member of the human detected. Only 1 allele was found to carry Hadzsiev, and Kosztolányi); RECQ helicase family. DNA helicases are a missense or a deleterious mutation in an- Department of Molecular a highly conserved group of enzymes that other 27% of the individuals with this dis- Medicine, National Public unwind DNA. These proteins function in order.15 In addition, linkage findings were Health Institute, Helsinki, all processes in which access to single- negative in 1 family.15 These observa- Finland (Ms Siitonen and Dr Kestilä); and MTA-PTE stranded DNA is required, including DNA tions reveal genetic heterogeneity in this Clinical Genetics Research replication, DNA repair and recombina- disorder and leave open the possibility of Group, Pécs, Hungary tion, and transcription of RNA. Deficien- other RTS gene loci. (Dr Kosztolányi). cies of these proteins have been associ- Apart from RTS cases, a recent study Financial Disclosure: None. ated with genomic instability disorders in found RECQL4 mutations in patients with (REPRINTED) ARCH DERMATOL/ VOL 141, MAY 2005 WWW.ARCHDERMATOL.COM 617 ©2005 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/28/2021 RAPADILINO syndrome (OMIM 266280).16 The acro- (5ЈTGTGGC3Ј) for the same area. These results suggest the mu- nym stands for the specific features of this autosomal re- tation does not have an effect on the splicing. cessive disorder: RAdial hypoplasia/aplasia, PAtellar hy- poplasia/aplasia, cleft or highly arched PAlate, DIarrhea REPORT OF A CASE and DIslocated joints, LIttle size (Ͼ2 SDs below the mean in height) and LImb malformation, and slender NOse and NOrmal intelligence.17 This entity is most prevalent in The male patient was born at 37 weeks’ gestation from Finland, where in all observed cases a specific splice site the second pregnancy of a mother with multiple sclero- mutation of the RECQL4 intron 7 was found in either ho- sis. His birth weight was 1550 g (Ӷthird percentile); mozygous or compound heterozygous form.16 Al- length, 38 cm (Ӷthird percentile); and head circumfer- though several hallmarks of RAPADILINO have been re- ence, 31 cm (third to tenth percentile). Bilateral radial ported in RTS cases, their collective appearance and the aplasia and absence of the thumbs was noted immedi- peculiar absence of ectodermal symptoms (poikilo- ately after birth along with hypospadias, bilateral ingui- derma, sparse scalp hair, and sparse brows and lashes) nal hernia, prominent anterior fontanelle, slender nose, that are present in RAPADILINO syndrome have distin- and micrognathia. At age 10 weeks, findings from his car- guished it as a separate disorder.16 The prevalence of os- diac, ophthalmologic, and spinal radiographs and head teosarcoma for patients with RAPADILINO (7%) is ap- ultrasound evaluations were negative. This workup was parently lower than for a cohort of patients with RTS and prompted by failure to thrive, which was accompanied RECQL4 mutations.6,13-16,18-20 However, no study has clearly by loose voluminous stools. His loose stools and poor documented the risk of osteosarcoma over time in pa- growth persisted. At age 2 to 3 months, he developed a tients with RAPADILINO. progressive, light-sensitive skin rash. Patients with RTS have also been reported to develop At age 22 months (length, 67 cm [Ӷthird percen- cutaneous squamous cell carcinoma, noncutaneous ma- tile]; weight, 5620 g [Ӷthird percentile]), he was rehos- lignancies, and myelodysplasia on rare occasions.21,22 pitalized for failure to thrive and persistent diarrhea. His In addition, there are more female than male patients extensive workup revealed bilateral absence of the pa- with RAPADILINO syndrome, and they seem to be tellae, subluxation of the femoral heads, and prominent more severely affected, while patients with RTS are osteoporosis in addition to the earlier radiographic find- more commonly male.15,16 However, a non-Finnish pa- ings. An abdominal ultrasound showed the spleen to be tient with RAPADILINO syndrome has been described localized at the upper pole of the left kidney in a circum- who developed poikiloderma, but the case was later re- ferential position. Both lactose intolerance and fat mal- visited and reclassified as either a severe form of RTS or absorption were detected. Through a genetic evalua- a new syndrome.23,24 Indeed, despite the differences, tion, he was diagnosed as having RAPADILINO syndrome, there are significant phenotypic overlaps between RTS and the dermatologist’s opinion was that the patient had and RAPADILINO. Consequently, the possibility that xeroderma pigmentosum. His chromosomal evaluation these diseases are subtypes of a single disorder has been revealed a normal 46,XY karyotype with no signs of in- considered.16 stability. The patient’s diarrhea resolved by age 4 years. He un- derwent corrective surgical procedures to correct the de- METHODS formities of his upper forelimbs, hypospadias, and in- guinal hernias. During a repeated dermatology evaluation, Verbal and written informed consent was obtained from the par- he was found to have poikiloderma, not xeroderma pig- ents, who also authorized the scientific presentation of the data. mentosum, and he was rediagnosed as having RTS. RECQL4 polymerase chain reaction and direct sequencing were On a follow-up genetic examination at age 9 years, performed according to Siitonen et al.16 All of the exons of RECQL4 the patient was a bright little boy who attended fourth were sequenced. In addition, each intron except intron 12 was grade with no difficulties and had a mildly hoarse voice. fully sequenced. However, exon-intron boundaries of intron 12 He was proportionately small: weight, 13 kg (Ӷthird were analyzed. No splice site mutations or intronic deletions percentile); height, 106 cm (Ӷthird percentile); and were found in the RECQL4 gene. Primers for mutation detection Ͼ were ex7-9-F GTGGCCAGTGGTTGTCTTG and ex7-9-R head circumference, 46.5 cm ( 2 SDs below the mean). TTAGGGGACAAGCAGCAGTT for exons 7 through 9 and He had sparse hair with areas of alopecia, sparse eye- ex17-19-F GTTGGAGACGAGGTTGGAGA and ex17-19-R brows, a prominent forehead, slender nose, highly CACTGCATCCACAGAGCAAG for exons 17 through 19. arched palate, and micrognathia. A striking upper limb The NetGene2 program (http://www.cbs.dtu.dk/services abnormality was observed, as described herein. A /NetGene2/) was used to predict creation of a possible new splice prominent, diffuse dermatosis affected all parts of the site by the R1021W amino acid change. For alterations in ex- body, characterized by variegated cutaneous pigmenta- onic splicing enhancer (ESE) elements, the ESEfinder pro- tion, atrophy, and telangiectasia. The dermatosis ap- gram (http://exon.cshl.edu/ESE/) was used. The mutation did peared more erythematous on sun-exposed areas such not cause a new splice site recognition sequence or a signifi- as the face, and the parents reported extreme sun sensi- cant effect on ESEs. Predictions for 4 splicing proteins, SF2/ ASF, SC35, SRp40, and SRp55, were used. Only SRp55 had a tivity.
Load more

Recommended publications
  • Open Full Page
    CCR PEDIATRIC ONCOLOGY SERIES CCR Pediatric Oncology Series Recommendations for Childhood Cancer Screening and Surveillance in DNA Repair Disorders Michael F. Walsh1, Vivian Y. Chang2, Wendy K. Kohlmann3, Hamish S. Scott4, Christopher Cunniff5, Franck Bourdeaut6, Jan J. Molenaar7, Christopher C. Porter8, John T. Sandlund9, Sharon E. Plon10, Lisa L. Wang10, and Sharon A. Savage11 Abstract DNA repair syndromes are heterogeneous disorders caused by around the world to discuss and develop cancer surveillance pathogenic variants in genes encoding proteins key in DNA guidelines for children with cancer-prone disorders. Herein, replication and/or the cellular response to DNA damage. The we focus on the more common of the rare DNA repair dis- majority of these syndromes are inherited in an autosomal- orders: ataxia telangiectasia, Bloom syndrome, Fanconi ane- recessive manner, but autosomal-dominant and X-linked reces- mia, dyskeratosis congenita, Nijmegen breakage syndrome, sive disorders also exist. The clinical features of patients with DNA Rothmund–Thomson syndrome, and Xeroderma pigmento- repair syndromes are highly varied and dependent on the under- sum. Dedicated syndrome registries and a combination of lying genetic cause. Notably, all patients have elevated risks of basic science and clinical research have led to important in- syndrome-associated cancers, and many of these cancers present sights into the underlying biology of these disorders. Given the in childhood. Although it is clear that the risk of cancer is rarity of these disorders, it is recommended that centralized increased, there are limited data defining the true incidence of centers of excellence be involved directly or through consulta- cancer and almost no evidence-based approaches to cancer tion in caring for patients with heritable DNA repair syn- surveillance in patients with DNA repair disorders.
    [Show full text]
  • EXTENDED CARRIER SCREENING Peace of Mind for Planned Pregnancies
    Focusing on Personalised Medicine EXTENDED CARRIER SCREENING Peace of Mind for Planned Pregnancies Extended carrier screening is an important tool for prospective parents to help them determine their risk of having a child affected with a heritable disease. In many cases, parents aren’t aware they are carriers and have no family history due to the rarity of some diseases in the general population. What is covered by the screening? Genomics For Life offers a comprehensive Extended Carrier Screening test, providing prospective parents with the information they require when planning their pregnancy. Extended Carrier Screening has been shown to detect carriers who would not have been considered candidates for traditional risk- based screening. With a simple mouth swab collection, we are able to test for over 419 genes associated with inherited diseases, including Fragile X Syndrome, Cystic Fibrosis and Spinal Muscular Atrophy. The assay has been developed in conjunction with clinical molecular geneticists, and includes genes listed in the NIH Genetic Test Registry. For a list of genes and disorders covered, please see the reverse of this brochure. If your gene of interest is not covered on our Extended Carrier Screening panel, please contact our friendly team to assist you in finding a gene test panel that suits your needs. Why have Extended Carrier Screening? Extended Carrier Screening prior to pregnancy enables couples to learn about their reproductive risk and consider a complete range of reproductive options, including whether or not to become pregnant, whether to use advanced reproductive technologies, such as preimplantation genetic diagnosis, or to use donor gametes.
    [Show full text]
  • CCR PEDIATRIC ONCOLOGY SERIES CCR Pediatric Oncology Series Recommendations for Surveillance for Children with Leukemia-Predisposing Conditions Christopher C
    CCR PEDIATRIC ONCOLOGY SERIES CCR Pediatric Oncology Series Recommendations for Surveillance for Children with Leukemia-Predisposing Conditions Christopher C. Porter1, Todd E. Druley2, Ayelet Erez3, Roland P. Kuiper4, Kenan Onel5, Joshua D. Schiffman6, Kami Wolfe Schneider7, Sarah R. Scollon8, Hamish S. Scott9, Louise C. Strong10, Michael F. Walsh11, and Kim E. Nichols12 Abstract Leukemia, the most common childhood cancer, has long been patients. The panel recognized that for several conditions, recognized to occasionally run in families. The first clues about routine monitoring with complete blood counts and bone the genetic mechanisms underlying familial leukemia emerged marrow evaluations is essential to identify disease evolution in 1990 when Li-Fraumeni syndrome was linked to TP53 muta- and enable early intervention with allogeneic hematopoietic tions. Since this discovery, many other genes associated with stem cell transplantation. However, for others, less intensive hereditary predisposition to leukemia have been identified. surveillance may be considered. Because few reports describ- Although several of these disorders also predispose individuals ing the efficacy of surveillance exist, the recommendations to solid tumors, certain conditions exist in which individuals are derived by this panel are based on opinion, and local expe- specifically at increased risk to develop myelodysplastic syn- rience and will need to be revised over time. The development drome (MDS) and/or acute leukemia. The increasing identifica- of registries and clinical trials is urgently needed to enhance tion of affected individuals and families has raised questions understanding of the natural history of the leukemia-predis- around the efficacy, timing, and optimal methods of surveil- posing conditions, such that these surveillance recommenda- lance.
    [Show full text]
  • Disease Reference Book
    The Counsyl Foresight™ Carrier Screen 180 Kimball Way | South San Francisco, CA 94080 www.counsyl.com | [email protected] | (888) COUNSYL The Counsyl Foresight Carrier Screen - Disease Reference Book 11-beta-hydroxylase-deficient Congenital Adrenal Hyperplasia .................................................................................................................................................................................... 8 21-hydroxylase-deficient Congenital Adrenal Hyperplasia ...........................................................................................................................................................................................10 6-pyruvoyl-tetrahydropterin Synthase Deficiency ..........................................................................................................................................................................................................12 ABCC8-related Hyperinsulinism........................................................................................................................................................................................................................................ 14 Adenosine Deaminase Deficiency .................................................................................................................................................................................................................................... 16 Alpha Thalassemia.............................................................................................................................................................................................................................................................
    [Show full text]
  • Senescence Induced by RECQL4 Dysfunction Contributes to Rothmund–Thomson Syndrome Features in Mice
    Citation: Cell Death and Disease (2014) 5, e1226; doi:10.1038/cddis.2014.168 OPEN & 2014 Macmillan Publishers Limited All rights reserved 2041-4889/14 www.nature.com/cddis Senescence induced by RECQL4 dysfunction contributes to Rothmund–Thomson syndrome features in mice HLu1, EF Fang1, P Sykora1, T Kulikowicz1, Y Zhang2, KG Becker2, DL Croteau1 and VA Bohr*,1 Cellular senescence refers to irreversible growth arrest of primary eukaryotic cells, a process thought to contribute to aging- related degeneration and disease. Deficiency of RecQ helicase RECQL4 leads to Rothmund–Thomson syndrome (RTS), and we have investigated whether senescence is involved using cellular approaches and a mouse model. We first systematically investigated whether depletion of RECQL4 and the other four human RecQ helicases, BLM, WRN, RECQL1 and RECQL5, impacts the proliferative potential of human primary fibroblasts. BLM-, WRN- and RECQL4-depleted cells display increased staining of senescence-associated b-galactosidase (SA-b-gal), higher expression of p16INK4a or/and p21WAF1 and accumulated persistent DNA damage foci. These features were less frequent in RECQL1- and RECQL5-depleted cells. We have mapped the region in RECQL4 that prevents cellular senescence to its N-terminal region and helicase domain. We further investigated senescence features in an RTS mouse model, Recql4-deficient mice (Recql4HD). Tail fibroblasts from Recql4HD showed increased SA-b-gal staining and increased DNA damage foci. We also identified sparser tail hair and fewer blood cells in Recql4HD mice accompanied with increased senescence in tail hair follicles and in bone marrow cells. In conclusion, dysfunction of RECQL4 increases DNA damage and triggers premature senescence in both human and mouse cells, which may contribute to symptoms in RTS patients.
    [Show full text]
  • Blueprint Genetics Ectodermal Dysplasia Panel
    Ectodermal Dysplasia Panel Test code: DE0401 Is a 25 gene panel that includes assessment of non-coding variants. Is ideal for patients with a clinical suspicion of ectodermal dysplasia (hidrotic or hypohidrotic) or Ellis-van Creveld syndrome. About Ectodermal Dysplasia Ectodermal Dysplasia (ED) is a group of closely related conditions of which more than 150 different syndromes have been identified. EDs affects the development or function of teeth, hair, nails and sweat glands. ED may present as isolated or as part of a syndromic disease and is commonly subtyped according to sweating ability. The clinical features of the X-linked and autosomal forms of hypohidrotic ectodermal dysplasia (HED) can be indistinguishable and many of the involved genes may lead to phenotypically distinct outcomes depending on number of defective alleles. The most common EDs are hypohidrotic ED and hydrotic ED. X-linked hypohidrotic ectodermal dysplasia (HED) is caused by EDA mutations and explain 75%-95% of familial HED and 50% of sporadic cases. HED is characterized by three cardinal features: hypotrichosis (sparse, slow-growing hair and sparse/missing eyebrows), reduced sweating and hypodontia (absence or small teeth). Reduced sweating poses risk for episodes of hyperthermia. Female carriers may have some degree of hypodontia and mild hypotrichosis. Isolated dental phenotypes have also been described. Mutations in WNT10A have been reported in up to 9% of individuals with HED and in 25% of individuals with HED who do not have defective EDA. Approximately 50% of individuals with heterozygous WNT10A mutation have HED and the most consistent clinical feature is severe oligodontia of permanent teeth.
    [Show full text]
  • Xeroderma Pigmentosum
    Xeroderma pigmentosum Description Xeroderma pigmentosum, which is commonly known as XP, is an inherited condition characterized by an extreme sensitivity to ultraviolet (UV) rays from sunlight. This condition mostly affects the eyes and areas of skin exposed to the sun. Some affected individuals also have problems involving the nervous system. The signs of xeroderma pigmentosum usually appear in infancy or early childhood. Many affected children develop a severe sunburn after spending just a few minutes in the sun. The sunburn causes redness and blistering that can last for weeks. Other affected children do not get sunburned with minimal sun exposure, but instead tan normally. By age 2, almost all children with xeroderma pigmentosum develop freckling of the skin in sun-exposed areas (such as the face, arms, and lips); this type of freckling rarely occurs in young children without the disorder. In affected individuals, exposure to sunlight often causes dry skin (xeroderma) and changes in skin coloring (pigmentation). This combination of features gives the condition its name, xeroderma pigmentosum. People with xeroderma pigmentosum have a greatly increased risk of developing skin cancer. Without sun protection, about half of children with this condition develop their first skin cancer by age 10. Most people with xeroderma pigmentosum develop multiple skin cancers during their lifetime. These cancers occur most often on the face, lips, and eyelids. Cancer can also develop on the scalp, in the eyes, and on the tip of the tongue. Studies suggest that people with xeroderma pigmentosum may also have an increased risk of other types of cancer, including brain tumors.
    [Show full text]
  • Trichothiodystrophy
    Trichothiodystrophy Author: Doctor Alfredo Rossi1 and Doctor C. Cantisani. Creation date: June 2004 Scientific Editor: Prof Antonella Tosti 1Dipartimento di Malattie Cutanee-Veneree Chirurgia Plastica-Ricostruttiva, Università degli studi di Roma “La Sapienza” Abstract Keywords Definition Epidemiology Etiology Clinical description Diagnostic methods Prenatal diagnosis Management References Abstract Trichothiodystrophy (TTD) is a rare autosomal recessive genetic disorder characterized by abnormal synthesis of the sulphur containing keratins and consequently hair dysplasia, associated with numerous symptoms affecting mainly organs derived from the neuroectoderm. This phenotypic aspect is due to mutations in the DNA-dependent ATPase/helicase subunit of TFIIH, XPB and XPD. Abnormalities in excision repair of ultraviolet (UV)-damaged DNA are recognized in about half of the patients. The clinical appearance is characterized by brittle and fragile hair, congenital ichthyosis, nail and dental dysplasias, cataract, progeria-like face, growth and mental retardation. The abnormalities are usually obvious at birth, with variable clinical expression. The variants of TTD, depending on their different associations, are known by the initials BIDS, IBIDS, PIBIDS, SIBIDS, ONMRS, as well as the eponyms of the Pollit, Tay, Sabinas syndromes or Amish brittle hair. The exact prevalence of TTD is unknown, but appears to be rather uncommon. About 20 cases of PIBI(D)S have been reported in the literature. Up to 1991, clinical data of 15 cases with IBIDS were published. Prenatal diagnostic of TTD is available. There is no specific treatment. Keywords Brittle hair, photosensitivity, ichthyosis, BIDS, IBIDS, PIBIDS, SIBIDS, ONMRS, Tay-syndrome Definition tail pattern). They named it Trichothiodystrophy, Trichothiodystrophy (TTD) is a group of rare noticing also an increased Photosensitivity and autosomal recessive disorders with heterogenic Ichthyosis in these patients (PIBIDS).
    [Show full text]
  • Whole Genome Sequencing in an Acrodermatitis Enteropathica Family from the Middle East
    Hindawi Dermatology Research and Practice Volume 2018, Article ID 1284568, 9 pages https://doi.org/10.1155/2018/1284568 Research Article Whole Genome Sequencing in an Acrodermatitis Enteropathica Family from the Middle East Faisel Abu-Duhier,1 Vivetha Pooranachandran,2 Andrew J. G. McDonagh,3 Andrew G. Messenger,4 Johnathan Cooper-Knock,2 Youssef Bakri,5 Paul R. Heath ,2 and Rachid Tazi-Ahnini 4,6 1 Prince Fahd Bin Sultan Research Chair, Department of Medical Lab Technology, Faculty of Applied Medical Science, Prince Fahd Research Chair, University of Tabuk, Tabuk, Saudi Arabia 2Department of Neuroscience, SITraN, Te Medical School, University of Shefeld, Shefeld S10 2RX, UK 3Department of Dermatology, Royal Hallamshire Hospital, Shefeld S10 2JF, UK 4Department of Infection, Immunity and Cardiovascular Disease, Te Medical School, University of Shefeld, Shefeld S10 2RX, UK 5Biology Department, Faculty of Science, University Mohammed V Rabat, Rabat, Morocco 6Laboratory of Medical Biotechnology (MedBiotech), Rabat Medical School and Pharmacy, University Mohammed V Rabat, Rabat, Morocco Correspondence should be addressed to Rachid Tazi-Ahnini; [email protected] Received 4 April 2018; Revised 28 June 2018; Accepted 26 July 2018; Published 7 August 2018 Academic Editor: Gavin P. Robertson Copyright © 2018 Faisel Abu-Duhier et al. Tis is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. We report a family from Tabuk, Saudi Arabia, previously screened for Acrodermatitis Enteropathica (AE), in which two siblings presented with typical features of acral dermatitis and a pustular eruption but difering severity.
    [Show full text]
  • Predisposition to Hematologic Malignancies in Patients With
    LETTERS TO THE EDITOR carcinomas but no internal cancer by the age of 29 years Predisposition to hematologic malignancies in and 9 years, respectively. patients with xeroderma pigmentosum Case XP540BE . This patient had a highly unusual pres - entation of MPAL. She was diagnosed with XP at the age Germline predisposition is a contributing etiology of of 18 months with numerous lentigines on sun-exposed hematologic malignancies, especially in children and skin, when her family emigrated from Morocco to the young adults. Germline predisposition in myeloid neo - USA. The homozygous North African XPC founder muta - plasms was added to the World Health Organization tion was present. 10 She had her first skin cancer at the age 1 2016 classification, and current management recommen - of 8 years, and subsequently developed more than 40 cuta - dations emphasize the importance of screening appropri - neous basal and squamous cell carcinomas, one melanoma 2 ate patients. Rare syndromes of DNA repair defects can in situ , and one ocular surface squamous neoplasm. She 3 lead to myeloid and/or lymphoid neoplasms. Here, we was diagnosed with a multinodular goiter at the age of 9 describe our experience with hematologic neoplasms in years eight months, with several complex nodules leading the defective DNA repair syndrome, xeroderma pigmen - to removal of her thyroid gland. Histopathology showed tosum (XP), including myelodysplastic syndrome (MDS), multinodular adenomatous/papillary hyperplasia. At the secondary acute myeloid leukemia (AML), high-grade age of 19 years, she presented with night sweats, fatigue, lymphoma, and an extremely unusual presentation of and lymphadenopathy. Laboratory studies revealed pancy - mixed phenotype acute leukemia (MPAL) with B, T and topenia with hemoglobin 6.8 g/dL, platelet count myeloid blasts.
    [Show full text]
  • Blueprint Genetics Bone Marrow Failure Syndrome Panel
    Bone Marrow Failure Syndrome Panel Test code: HE0801 Is a 135 gene panel that includes assessment of non-coding variants. Is ideal for patients with a clinical suspicion of inherited bone marrow failure syndromes. The genes on this panel are included in the Comprehensive Hematology Panel. About Bone Marrow Failure Syndrome Inherited bone marrow failure syndromes (IBMFS) are a diverse set of genetic disorders characterized by the inability of the bone marrow to produce sufficient circulating blood cells. Bone marrow failure can affect all blood cell lineages causing clinical symptoms similar to aplastic anemia, or be restricted to one or two blood cell lineages. The clinical presentation may include thrombocytopenia or neutropenia. Hematological manifestations may be accompanied by physical features such as short stature and abnormal skin pigmentation in Fanconi anemia and dystrophic nails, lacy reticular pigmentation and oral leukoplakia in dyskeratosis congenita. Patients with IBMFS have an increased risk of developing cancer—either hematological or solid tumors. Early and correct disease recognition is important for management and surveillance of the diseases. Currently, accurate genetic diagnosis is essential to confirm the clinical diagnosis. The most common phenotypes that are covered by the panel are Fanconi anemia, Diamond-Blackfan anemia, dyskeratosis congenita, Shwachman-Diamond syndrome and WAS-related disorders. Availability 4 weeks Gene Set Description Genes in the Bone Marrow Failure Syndrome Panel and their clinical significance
    [Show full text]
  • Hereditary Hearing Impairment with Cutaneous Abnormalities
    G C A T T A C G G C A T genes Review Hereditary Hearing Impairment with Cutaneous Abnormalities Tung-Lin Lee 1 , Pei-Hsuan Lin 2,3, Pei-Lung Chen 3,4,5,6 , Jin-Bon Hong 4,7,* and Chen-Chi Wu 2,3,5,8,* 1 Department of Medical Education, National Taiwan University Hospital, Taipei City 100, Taiwan; [email protected] 2 Department of Otolaryngology, National Taiwan University Hospital, Taipei 11556, Taiwan; [email protected] 3 Graduate Institute of Clinical Medicine, National Taiwan University College of Medicine, Taipei City 100, Taiwan; [email protected] 4 Graduate Institute of Medical Genomics and Proteomics, National Taiwan University College of Medicine, Taipei City 100, Taiwan 5 Department of Medical Genetics, National Taiwan University Hospital, Taipei 10041, Taiwan 6 Department of Internal Medicine, National Taiwan University Hospital, Taipei 10041, Taiwan 7 Department of Dermatology, National Taiwan University Hospital, Taipei City 100, Taiwan 8 Department of Medical Research, National Taiwan University Biomedical Park Hospital, Hsinchu City 300, Taiwan * Correspondence: [email protected] (J.-B.H.); [email protected] (C.-C.W.) Abstract: Syndromic hereditary hearing impairment (HHI) is a clinically and etiologically diverse condition that has a profound influence on affected individuals and their families. As cutaneous findings are more apparent than hearing-related symptoms to clinicians and, more importantly, to caregivers of affected infants and young individuals, establishing a correlation map of skin manifestations and their underlying genetic causes is key to early identification and diagnosis of syndromic HHI. In this article, we performed a comprehensive PubMed database search on syndromic HHI with cutaneous abnormalities, and reviewed a total of 260 relevant publications.
    [Show full text]