OBSERVATION A Patient With Rothmund-Thomson Syndrome and All Features of RAPADILINO Richard Kellermayer, MD, PhD; H. Annika Siitonen, MSc; Kinga Hadzsiev, MD; Marjo Kestilä, PhD; György Kosztolányi, MD, PhD Background: Mutations of the human helicase gene carries a truncating mutation and a newly identified mis- RECQL4 have been identified in a subset of patients with sense mutation of RECQL4. The proband uniquely de- Rothmund-Thomson syndrome (RTS) and in children veloped all criteria of RAPADILINO in addition to his with the diagnosis of RAPADILINO syndrome (RAdial prominent skin findings. hypoplasia/aplasia, PAtellar hypoplasia/aplasia, cleft or highly arched PAlate, DIarrhea and DIslocated joints, LIttle Conclusions: Patients with RTS may possess all fea- size [Ͼ2 SDs below the mean in height] and LImb mal- tures of RAPADILINO. Consequently, a genetic ap- formation, and slender NOse and NOrmal intelligence). proach to RTS and RAPADILINO could be beneficial. This While many features of the 2 genetic disorders overlap, approach may provide a better understanding of the wide poikiloderma—a hallmark of RTS—has been described variety of related phenotypic findings and improve prog- as generally absent in RAPADILINO syndrome. nostics. Observations: We report herein a patient with RTS who Arch Dermatol. 2005;141:617-620 UGUSTE ROTHMUND1 AND humans and with several features of pre- Sydney Thomson2 de- mature aging and/or cancer predisposi- scribed 2 separate medi- tion.8-10 Mutations in the RECQ-like genes cal conditions that were BLM, WRN, and RECQL4 can result in thought to be part of the Bloom syndrome, Werner syndrome, and Asame entity and consequently designated RTS, respectively.8 Rothmund-Thomson syndrome (RTS) by The RECQL4 gene contains 21 exons William Taylor3 (Online Mendelian In- in less than 6.5 kilobases of genomic se- heritance in Man [OMIM] 268400). This quence with 13 introns that are less than is a rare, autosomal recessive disorder char- 100 base pairs in length.11 This peculiar acterized by a poikilodermatous rash start- gene structure predisposes mutated ing in infancy, cataracts, growth retarda- RECQL4 messenger RNA to diffuse mis- tion, skeletal abnormalities, hair loss, and splicing alterations.12 Consequently, in- a high incidence of malignancies, espe- tronic size constraint and point muta- cially osteosarcomas.4,5 In 1999, Kitao and tions in the introns of the RECQL4 gene coworkers6 linked a subset of RTS cases have been shown to play a role in the de- Author Affiliations: to mutations in the human helicase gene velopment of RTS in addition to exonic de- 12-14 Department of Medical Genetics RECQL4. Recent observations in Recql4- fects. A cohort study of 33 patients and Child Development, deficient mice support a pathogenic role showed that in about 57% of RTS cases, University of Pécs, Pécs, for this molecular defect in RTS.7 mutations of both RECQL4 alleles can be Hungary (Drs Kellermayer, RECQL4 is a member of the human detected. Only 1 allele was found to carry Hadzsiev, and Kosztolányi); RECQ helicase family. DNA helicases are a missense or a deleterious mutation in an- Department of Molecular a highly conserved group of enzymes that other 27% of the individuals with this dis- Medicine, National Public unwind DNA. These proteins function in order.15 In addition, linkage findings were Health Institute, Helsinki, all processes in which access to single- negative in 1 family.15 These observa- Finland (Ms Siitonen and Dr Kestilä); and MTA-PTE stranded DNA is required, including DNA tions reveal genetic heterogeneity in this Clinical Genetics Research replication, DNA repair and recombina- disorder and leave open the possibility of Group, Pécs, Hungary tion, and transcription of RNA. Deficien- other RTS gene loci. (Dr Kosztolányi). cies of these proteins have been associ- Apart from RTS cases, a recent study Financial Disclosure: None. ated with genomic instability disorders in found RECQL4 mutations in patients with (REPRINTED) ARCH DERMATOL/ VOL 141, MAY 2005 WWW.ARCHDERMATOL.COM 617 ©2005 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/28/2021 RAPADILINO syndrome (OMIM 266280).16 The acro- (5ЈTGTGGC3Ј) for the same area. These results suggest the mu- nym stands for the specific features of this autosomal re- tation does not have an effect on the splicing. cessive disorder: RAdial hypoplasia/aplasia, PAtellar hy- poplasia/aplasia, cleft or highly arched PAlate, DIarrhea REPORT OF A CASE and DIslocated joints, LIttle size (Ͼ2 SDs below the mean in height) and LImb malformation, and slender NOse and NOrmal intelligence.17 This entity is most prevalent in The male patient was born at 37 weeks’ gestation from Finland, where in all observed cases a specific splice site the second pregnancy of a mother with multiple sclero- mutation of the RECQL4 intron 7 was found in either ho- sis. His birth weight was 1550 g (Ӷthird percentile); mozygous or compound heterozygous form.16 Al- length, 38 cm (Ӷthird percentile); and head circumfer- though several hallmarks of RAPADILINO have been re- ence, 31 cm (third to tenth percentile). Bilateral radial ported in RTS cases, their collective appearance and the aplasia and absence of the thumbs was noted immedi- peculiar absence of ectodermal symptoms (poikilo- ately after birth along with hypospadias, bilateral ingui- derma, sparse scalp hair, and sparse brows and lashes) nal hernia, prominent anterior fontanelle, slender nose, that are present in RAPADILINO syndrome have distin- and micrognathia. At age 10 weeks, findings from his car- guished it as a separate disorder.16 The prevalence of os- diac, ophthalmologic, and spinal radiographs and head teosarcoma for patients with RAPADILINO (7%) is ap- ultrasound evaluations were negative. This workup was parently lower than for a cohort of patients with RTS and prompted by failure to thrive, which was accompanied RECQL4 mutations.6,13-16,18-20 However, no study has clearly by loose voluminous stools. His loose stools and poor documented the risk of osteosarcoma over time in pa- growth persisted. At age 2 to 3 months, he developed a tients with RAPADILINO. progressive, light-sensitive skin rash. Patients with RTS have also been reported to develop At age 22 months (length, 67 cm [Ӷthird percen- cutaneous squamous cell carcinoma, noncutaneous ma- tile]; weight, 5620 g [Ӷthird percentile]), he was rehos- lignancies, and myelodysplasia on rare occasions.21,22 pitalized for failure to thrive and persistent diarrhea. His In addition, there are more female than male patients extensive workup revealed bilateral absence of the pa- with RAPADILINO syndrome, and they seem to be tellae, subluxation of the femoral heads, and prominent more severely affected, while patients with RTS are osteoporosis in addition to the earlier radiographic find- more commonly male.15,16 However, a non-Finnish pa- ings. An abdominal ultrasound showed the spleen to be tient with RAPADILINO syndrome has been described localized at the upper pole of the left kidney in a circum- who developed poikiloderma, but the case was later re- ferential position. Both lactose intolerance and fat mal- visited and reclassified as either a severe form of RTS or absorption were detected. Through a genetic evalua- a new syndrome.23,24 Indeed, despite the differences, tion, he was diagnosed as having RAPADILINO syndrome, there are significant phenotypic overlaps between RTS and the dermatologist’s opinion was that the patient had and RAPADILINO. Consequently, the possibility that xeroderma pigmentosum. His chromosomal evaluation these diseases are subtypes of a single disorder has been revealed a normal 46,XY karyotype with no signs of in- considered.16 stability. The patient’s diarrhea resolved by age 4 years. He un- derwent corrective surgical procedures to correct the de- METHODS formities of his upper forelimbs, hypospadias, and in- guinal hernias. During a repeated dermatology evaluation, Verbal and written informed consent was obtained from the par- he was found to have poikiloderma, not xeroderma pig- ents, who also authorized the scientific presentation of the data. mentosum, and he was rediagnosed as having RTS. RECQL4 polymerase chain reaction and direct sequencing were On a follow-up genetic examination at age 9 years, performed according to Siitonen et al.16 All of the exons of RECQL4 the patient was a bright little boy who attended fourth were sequenced. In addition, each intron except intron 12 was grade with no difficulties and had a mildly hoarse voice. fully sequenced. However, exon-intron boundaries of intron 12 He was proportionately small: weight, 13 kg (Ӷthird were analyzed. No splice site mutations or intronic deletions percentile); height, 106 cm (Ӷthird percentile); and were found in the RECQL4 gene. Primers for mutation detection Ͼ were ex7-9-F GTGGCCAGTGGTTGTCTTG and ex7-9-R head circumference, 46.5 cm ( 2 SDs below the mean). TTAGGGGACAAGCAGCAGTT for exons 7 through 9 and He had sparse hair with areas of alopecia, sparse eye- ex17-19-F GTTGGAGACGAGGTTGGAGA and ex17-19-R brows, a prominent forehead, slender nose, highly CACTGCATCCACAGAGCAAG for exons 17 through 19. arched palate, and micrognathia. A striking upper limb The NetGene2 program (http://www.cbs.dtu.dk/services abnormality was observed, as described herein. A /NetGene2/) was used to predict creation of a possible new splice prominent, diffuse dermatosis affected all parts of the site by the R1021W amino acid change. For alterations in ex- body, characterized by variegated cutaneous pigmenta- onic splicing enhancer (ESE) elements, the ESEfinder pro- tion, atrophy, and telangiectasia. The dermatosis ap- gram (http://exon.cshl.edu/ESE/) was used. The mutation did peared more erythematous on sun-exposed areas such not cause a new splice site recognition sequence or a signifi- as the face, and the parents reported extreme sun sensi- cant effect on ESEs. Predictions for 4 splicing proteins, SF2/ ASF, SC35, SRp40, and SRp55, were used. Only SRp55 had a tivity.