Regulation of Airway Epithelial Cell Migration by the Cystic Fibrosis Transmembrane Conductance Regulator

A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY

Katherine Rebecca Schiller

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

Scott M. O’Grady, Advisor

May 2010

Acknowledgments

First and foremost I would like to thank the members of my thesis committee, Dr. John Collister, and Dr. Paulo Kofuji for their time and input on my thesis project. I would also especially like to thank Dr. Mathur Kannan for his help and suggestions on my current thesis project as well as my last. I thank my husband for his love and support, and his patience and understanding throughout my graduate training. Finally, I thank my advisor, Dr. Scott O’Grady. His time and dedication to my training has given me valuable skills on which to build for my future endeavors in this field.

Abstract

The airway epithelium is a critical barrier between the noxious particles in

inspired air and the lung tissue. Mucociliary clearance is an essential function of the

airway epithelium to protect against infection and airway damage. By this process,

inhaled particles are trapped in the mucus lining the airway and propelled out of the

airways by ciliary movement. Transport of Cl- and Na+ ions controls fluid secretion in the

airways and the depth and viscosity of the periciliary liquid layer essential for cilia

movement. The ion channel cystic fibrosis transmembrane conductance regulator

- - (CFTR), transports Cl and HCO3 in the airways and other tissues, and controls the depth of the periciliary liquid layer. Cystic fibrosis is a fatal genetic disease in which CFTR is dysfunctional. As a result, mucociliary clearance is impaired and airways become chronically infected with microorganisms. Microorganism colonization results in recurrent inflammation and cycles of damage to the epithelial barrier followed by wound repair, eventually resulting in airway remodeling and ultimately respiratory failure. It has recently been demonstrated that the loss of CFTR function impairs epithelial restitution in the absence of infection. This suggests the CFTR plays a direct role in airway wound repair.

To test this hypothesis, the role of CFTR in the initial step of epithelial wound repair-cell migration- was assessed. An impedance based assay was used to objectively measure cell migration rates of human bronchial epithelial cells. Inhibition of CFTR transport and silencing of CFTR protein expression were used to assess the effect of the loss of functional CFTR on cell migration rate. The migration rate of an airway epithelial

cell line isolated from a cystic fibrosis patient was also compared to that of an airway epithelial cell line isolated from a healthy lung. A functional effect of CFTR on the process of lamellipodia protrusion during cell migration was also assessed morphometrically. Time lapse video images were also captured during wound closure of airway epithelial cells to assess how cell migration occurs. Additionally, the dependence

- - of airway epithelial cell migration on Cl and HCO3 transport was assessed using ion substitution and selective inhibitors of CFTR and other transporters of these ions. Further, the effect of changes in extracellular pH on migration rate was assessed.

- - The results of these studies revealed a role for CFTR transport of Cl and HCO3 to regulate airway epithelial cell migration. These studies contribute to the basic understanding of the repair process of the airways following damage and may potentially be important for the design of new treatments to limit airway damage in cystic fibrosis.

iii

Table of Contents

List of Tables ______vi

List of Figures ______vii

Chapter 1: Airway Wound Repair and Cystic Fibrosis______1 I. Function of the Airway Epithelium______1 II. Cystic Fibrosis______5 III. The Role of Airway Wound Repair in CF______7 IV. Epithelial Wound Repair and the Role of Ion Channels ______8 V. Scope, Central Hypothesis and Aims of the Thesis______12

Chapter 2: Airway Epithelia Dependence on CFTR for Wound Closure ______14 I. In Vitro Model of Wound Repair ______14 a. Cell Types Utilized in the Wound Repair Model ______14 b. In vitro Assay for Measuring Wound Closure Rates ______19 II. Inhibition of CFTR Channel Activity Slows Wound Closure______23 III. Silencing CFTR Protein Expression Slows Wound Closure ______26 IV. Time Lapse Imaging of Wound Closure ______29 V. Effect of CFTR Inhibition on Lamellipodia Protrusion ______32 VI. CF Airway Epithelial Cells and Inflammatory Mediators ______35 VII. Conclusions ______39

Chapter 3: Ionic Mechanism of CFTR Regulation of Cell Migration 42 - - I. Role of Cl and HCO3 Transport in Cell Migration ______42 - - II. Cl and HCO3 Transporters that may Cooperate with CFTR ______49 a. Anion Exchangers ______51 - - b. Solute carrier 26 Cl /HCO3 Exchangers ______52 + - c. Na /HCO3 Cotransporters ______52 d. CFTR ______54 III. Measurement of Migration with Inhibition of Multiple Transporters and CFTR ______55 IV. Conclusions ______61

Chapter 4: Discussion______66 I. Model of the Role of CFTR in Airway Epithelial Cell Migration_____66 iv

II. Future Experiments ______70 a. Localization of CFTR and other Transporters Involved in Migration ______71 b. Measurement and Identification of Ions Transported During Migration ______73 c. Migration of CF Airway Epithelial Cells in Vitro and in Vivo _____75 d. Modulation of Airway Epithelial Cell Migration Rates by Cytokines and Infection______78 III. Conclusions ______82

References ______84

Appendix A: Statistical Analyses ______98

List of Tables

Chapter 2 Table 1: Primer Sets Used for qPCR______41

Chapter 3 Table 1: Primers Used for qPCR______65

List of Figures

Chapter 1 1. The Airway Epithelium______1

Chapter 2 1. Expression of Airway Epithelial Cell Type Markers ______18 2. Proliferation of Airway Epithelial Cells ______20 3. Measurement of Wound Closure by CIS ______22 4. Migration with CFTR Inhibited ______24 5. Migration Rates with Inhibition of CFTR ______25 6. Proliferation with Inhibition of CFTR ______26 7. Silencing of CFTR Protein Expression ______28 8. CFTR Silencing Effect on Migration and Proliferation ______29 9. Time Lapse Images of Wound Closure-Calu-3 ______31 10. Time Lapse Images of Wound Closure-NHBE ______32 11. Lamellipodia Protrusion ______34 12. Lamellipodia Area ______35 13. Migration of CF Cells ______37 14. IFNγ and Migration______38

Chapter 3 - 1. Migration in Cl Free Media ______44 - 2. Migration in Low HCO3 Media______47 3. Extracellular pH and Migration ______48 4. Transporter and Exchanger Expression ______50 - - - - 5. Cl and HCO3 Transport in Cl Free and Low HCO3 Media ______55 6. Viability with DIDS Treatment ______56 7. Inhibition of CFTR in Cl- Free Media ______57 - 8. Inhibition of CFTR and Low HCO3 ______59 9. Migration with DIDS ______60

Chapter 4 1. Putative Model of the Role of CFTR in Airway Epithelial Cell Migration 68

vii

Chapter I

Airway Wound Repair and Cystic Fibrosis

I. Function of the Airway Epithelium

Airway surfaces are continuously exposed to noxious inhaled particles, allergens

and pathogens (Mall 2008). The airway epithelium is critical for protection from infection and damage by these agents (Sparrow et al. 1995). The cornerstone of airway defense is mucociliary clearance, a process by which inhaled particles are trapped in mucus lining the airway, and this mucus is propelled out of the airways towards the

mouth by ciliary Airway Lumen movement. The Mucus Layer mucociliary clearance Periciliary Liquid Cilia mechanism is

dependent on three

functional elements

(Fig. 1) that coordinate

b to accomplish Fig. 1 The Airway Epithelium The bronchial airways are lined with a pseudostratified epithelium clearance: (i) ciliated composed of ciliated, mucus secreting (shaded cell) and basal cells (b, arrows). The airway surface liquid epithelial cells that traps inhaled particles has a mucus and periciliary liquid layer. connected by intercellular tight junctions, (ii) airway surface liquid (ASL) which is partitioned into a low viscosity periciliary liquid layer that facilitates ciliary beating, and (iii) a mucus layer that traps inhaled particles (Knight and Holgate 2003; Mall 2008). The bronchial airway

epithelium is composed of multiple cell types that together produce the ASL and perform

mucociliary clearance. Ciliated epithelial cells possess numerous mitochondria and up to

300 cilia per cell for the directional transport of mucus and its entrapped particles (Knight

and Holgate 2003). Mucus secreting cells, or goblet cells, secrete mucin glycoproteins

(Jeffery 1983). Mucins are the major macromolecular component of mucus and give it its

viscoelastic and adhesive properties (Voynow and Rubin 2009). Serous cells in

submucosal glands of the tracheobronchial airways secrete most of the fluid component

of the ASL, the periciliary liquid (PCL) (Coraux et al. 2005; Ballard and Spadafora

2007). The PCL provides a low viscosity environment for efficient cilia movement and

maintains hydration of the overlying mucus layer (R C Boucher 2004; Blouquit-Laye and

Chinet 2007). The intercellular tight junctions that connect airway epithelial cells create a

physical barrier that restricts access of foreign particles and bacteria to the underlying

interstitium (Puchelle et al. 2006).

Ion transport is essential for maintaining the fluid component of the ASL, and

ultimately mucociliary clearance. The depth and viscosity of the PCL is tightly regulated

for optimal cilia movement. This is accomplished largely by the activity of two ion

channels, the epithelial Na+ channel (ENaC) and the cystic fibrosis transmembrane

conductance regulator (CFTR), which control fluid absorption and secretion, respectively

(Boucher 2004). CFTR transports Cl- out of the cell into the periciliary space (lumen)

resulting in an electrical driving force for cations (lumen negative with respect to the

interstitial fluid). Na+ moves in response to this electrical driving force through

paracellular tight junctions into the periciliary space (Ballard and Spadafora 2007). This movement of salt (NaCl) into the periciliary space creates an osmotic gradient that drives

fluid secretion into the periciliary space (Ballard and Spadafora 2007; Chambers et al.

2007). The Cl- transport function of CFTR is therefore essential for secretion of the PCL

(Tarran et al. 2005). In contrast, ENaC transports Na+ into airway epithelial cells resulting in absorption of fluid from the periciliary liquid (Boucher et al. 1986). CFTR regulates the activity of ENaC, acting ultimately as the key regulator of the depth of the

PCL by controlling both fluid secretion and absorption (Boucher 2004; Chambers et al.

2007).

In disease processes in which mucociliary clearance is impaired, airway damage occurs following inhalation of noxious foreign particles (Puchelle 2000). This damage varies from increased permeability of tight junctions to large lesions of shed epithelium

(Coraux et al. 2005). Epithelial wounds allow foreign particles access to the underlying interstitium, and provide access for bacteria to basolateral receptors for adhesion

(Puchelle et al. 2006). Breaches of the airway epithelium must be repaired quickly to restore the critical barrier function of this tissue (Sparrow et al. 1995). The process of wound repair is initiated by cell migration as a means of rapidly restoring the epithelial barrier (Puchelle 2000). The loss of contact inhibition serves as an initiating signal in epithelial cells at the leading edge of the wound (Jacinto et al. 2001). Cells surrounding the wounded area then spread and laterally polarize into a migratory phenotype (Vicente-

Manzanares et al. 2005; Le Clainche and Carlier 2008). Migrating cells undergo a cyclical process of extension of actin based lamellipodia followed by contraction of the actin-myosin cytoskeleton, rearward retraction, and cell body movement (Horwitz and

Webb 2003; Ridley et al. 2003). This process results in a flow of epithelial cells from the surrounding area into the wound to cover the denuded surface (Lu et al. 2001). Following

re-establishment of the epithelial barrier, cell proliferation and differentiation fully

restore the multi-cell type and pseudo-stratification of the airway epithelium (Chrétien

1996).

Bronchial wound repair in vivo is dependent on basal epithelial cells (Hong et al.

2004; Hajj et al. 2007). These cells compose the bottom most layer of the pseudostratified

bronchial epithelium, and anchor the upper epithelial layer to the basement membrane

(Fig. 1). Basal cells are the major bronchial progenitor cell population (Boers et al. 1998;

Barth et al. 2000; Knight and Holgate 2003), and are capable of reconstituting a

pseudostratified mucociliary epithelium in air-liquid interface cultures and in xenografts

(Hong et al. 2004; Hajj et al. 2007). Basal epithelial cells have also been shown to be

critical for both regeneration and renewal of the bronchial airway epithelium (Hong et al.

2004).

The barrier function and mucociliary clearance role of the airway epithelium

make it essential for preventing damage and infection in the lungs. Diseases that impair

these processes result in lung dysfunction. In such diseases, infection, damage and repair

cycles continuously occur. Cystic fibrosis is such a disease, and the impairment of

mucociliary clearance due to the genetic mutation that causes this disease is so profound

that lung failure and patient death typically occur. Therefore, understanding the repair

process of the airways following damage is potentially important in developing new

treatments for this disease.

II. Cystic Fibrosis

Cystic fibrosis (CF) is the most common fatal genetic disease in the Caucasian

population (Bilton 2008). In 1989 the genetic basis for this disease was discovered as a

mutation in a gene that resulted in the failure of an epithelial cell Cl- channel to respond

to cAMP (Kerem et al. 1989). This gene was later shown to be the Cl- channel (Bear et al.

1992) responsible for secretion of the PCL, known as CFTR.

CFTR is a glycoprotein that is expressed at the cell surface (Chmiel and Davis

2003). Glycosylation of CFTR is completed in the Golgi, after which CFTR is trafficked

to the cell membrane where it functions to transport anions (Cheng et al. 1990; Chmiel

and Davis 2003). There are approximately 1600 different mutations in the CFTR gene

that result in cystic fibrosis, however, the vast majority of these mutations result in the

absence of mature, fully glycosylated CFTR expressed at the cell surface (Cheng et al.

1990; Riordan 2008; Buchanan et al. 2009). These mutations result in retention of CFTR

in the endoplasmic reticulum, due to misfolding of the protein (Seibert et al. 1999), where

it is subsequently degraded by endoplasmic reticulum associated degradation (ERAD)

(Wang et al. 2004; Hassink et al. 2009). The most common CFTR mutation is ΔF508.

This mutation is present in at least one allele of as much as 90% of some CF patient

populations (John R Riordan 2008) and is caused by a single codon deletion at position

508 resulting in a phenylalanine deletion (Guggino and Stanton 2006).

The role of CFTR in the epithelia where it is expressed is the transport of Cl- and

- HCO3 to regulate fluid secretion and ion homeostasis (Ramsey 1996; Guggino and

Stanton 2006). In addition to airway epithelia, CFTR is expressed in epithelial cells of the

pancreas, intestine, sweat gland, bile duct and vas deferens, as well as many other sites

(Chmiel and Davis 2003). CF patients suffer numerous disease symptoms in multiple

tissues due to the loss of CFTR function. These include pancreatic insufficiency, diabetes

secondary to pancreatic damage, intestinal malabsorption and decreased motility,

osteoporosis and bleeding disorders secondary to poor absorption of fat soluble vitamins,

male infertility due to the absence of the vas deferens, and respiratory failure due to

airway remodeling and fibrosis (Bilton 2008; O'Sullivan and Freedman 2009). Despite

these many manifestations of CF, airway disease results in the majority of fatalities

(Chmiel and Davis 2003). The loss of CFTR expression in the airways not only results in

failure of periciliary liquid secretion, but also fluid hyperabsorption due to the loss of

CFTR control of ENaC (Song et al. 2009). The result is a dramatic decrease in the depth

of the PCL, dehydration of the mucus layer, collapse of the airway cilia, failure of

mucociliary clearance, and microorganism colonization of the lung (Riordan 2008;

Buchanan et al. 2009).

- The role of HCO3 transport by CFTR in the airways with respect to CF is poorly understood. The pH of fluid secreted from nasal airway submucosal gland biopsies isolated from CF patients was shown to be acidic compared to healthy controls (Song et al. 2006). Acidic pH has been shown to reduce the susceptibility of clinical isolates of the most common bacteria infecting CF airways, Pseudomonas aeruginosa, to some

antibiotics (Moriarty et al. 2007). Additionally, treatment of Staphylococcus aureus (a

common pathogen in airways of CF infants) with carbonate containing media altered cell

wall thickness and gene expression resulting in increased susceptibility to the

- antimicrobial peptide LL-37 (Dorschner et al. 2006). These studies suggest that HCO3

transport may play a role in CF airway infection, however further studies are necessary to

- determine the contribution of HCO3 transport to CF airway disease.

III. The Role of Airway Wound Repair in CF

Airway epithelial cells respond to bacterial infection by increasing cytokine

release, including IL-6, IL-8 and granulocyte macrophage colony stimulating factor (GM-

CSF) (Chmiel and Davis 2003; O'Sullivan and Freedman 2009). IL-8 is a potent neutrophil chemoattractant, and is largely responsible for the neutrophil accumulation found in CF airways (Chmiel and Davis 2003). Bacterial toxins amplify the inflammatory response, and the combination of inflammatory cytokines, proteases and elastases secreted by both neutrophils and bacteria result in tissue damage (O'Sullivan and

Freedman 2009). Studies with xenografts of human fetal CF and normal tracheas revealed infection with Pseudomonas aeruginosa, resulted in rapid intense shedding of epithelium, followed by bacterial infiltration of underlying basal cells and the basement membrane (Tirouvanziam et al. 2000). Additionally, damage to the epithelial barrier exposes the underlying interstitium of collagens and elastins to proteases and elastases produced by the inflammatory response (Chmiel and Davis 2003). Following damage, the epithelium rapidly undergoes repair, initiated by cell migration, to restore barrier function (Chrétien 1996). However, infection in CF becomes chronic and causes cycles of inflammation, airway damage and wound repair, eventually resulting in progressive airway wall damage, bronchiectasis, respiratory failure and patient death (Bilton 2008;

Riordan 2008; O'Sullivan and Freedman 2009).

Preventing chronic infection and airway damage is the ultimate goal for CF

treatment (Ratjen and Döring 2003). The lack of therapeutics that prevent lung failure

and patient death, and the poor correlation between CFTR mutation genotype and

severity of lung disease has led CF research to turn toward better characterizing the role

of CFTR in airway damage and remodeling (Hamosh and Corey 1993; Ratjen and Döring

2003). Recently, a humanized xenograft mouse model of CF was used to demonstrate that epithelial regeneration is impaired even in the absence of airway infection, due to the loss of functional CFTR (Hajj et al. 2007), suggesting CFTR directly regulates airway

regeneration. Therefore, characterizing the role of CFTR in airway wound repair may

shed light on the fatal airway remodeling and fibrosis that occur in CF.

IV. Epithelial Wound Repair and the Role of Ion Channels

Most of what is known about cell migration has come from studies of individual cells migrating on 2-dimensional planar surfaces; however, much less is understood about

the mechanisms that coordinate migration in an intact epithelium (Bindschadler and

McGrath 2007). In vitro studies of epithelial monolayers and in vivo studies of stratified

epithelia revealed that cell-cell contacts are maintained and cells migrate as a collective

sheet to close wounds (Martinez-Arias, and Martin 2001; Zhao et al. 2003; Farooqui and

Fenteany 2005). Time lapse 3-dimensional imaging has further demonstrated the

epithelium surrounding the wound migrates in a smooth sliding fashion, and cells

participating in migration extend well beyond the wound margin (Zhao et al. 2003;

Farooqui and Fenteany 2005). Restoration of the epithelial barrier by cell migration following airway damage in CF likely also occurs in this manner, although it has yet to

be assessed. Additionally, the impairment of epithelial restitution due to the loss of

functional CFTR in CF xenografts suggests the role of CFTR in airway wound repair

should be assessed.

The concept that ion channels play a role in cell migration is not unprecedented.

Several ion channels and transporters have been shown to be play critical roles in

different processes of cell migration. Ion channels are essential for regulating cell

volume, and intra and extracellular pH; processes which are important for cell migration

(Putney et al. 2002; Jakab and Ritter 2006; Schwab et al. 2007).

Control of cell volume is a major contributor to cell migration. Migrating cells undergo dramatic changes in shape including flattening and lamellipodia protrusion, and retraction and contraction of the rear of the cell (Vicente-Manzanares et al. 2005).

Changes in cell volume facilitate changes in cell shape (Verkman 2005; Jakab and Ritter

2006). K+ channels participate in the regulation of cell volume by providing a pathway

for K+ exit at the rear of the cell, creating a localized driving force for water efflux

(Schwab et al. 1999; Schwab et al. 2007). Studies in multiple cell types have shown that

inhibition of certain K+ channel subtypes slows the rate of cell migration (Schwab et al.

1994; Hendriks et al. 1999; Schwab et al. 1999). The Ca+2 activated K+ channel, IK1, for example, appears to be expressed in all migrating cells including many tumor cells (Aiyar

1999; Schneider et al. 2000; Weaver et al. 2006), and when blocked, slows migration

(Schwab et al. 1999; Schilling et al. 2004). The water channels, aquaporins (AQPs),

which allow for the movement of water into and out of cells (Ikeguchi 2009), have also

been shown to be important for migration. The migration rates of renal and corneal

epithelial cells, keratinocytes, fibroblasts, astrocytes and endothelial cells have all been

shown to be reduced due to loss of AQP expression or function (Verkman 2005; Cao et al. 2006; Hara-Chikuma and Verkman 2006; Levin and and Verkman 2006; Hara-

Chikuma and Verkman 2008). The importance of aquaporins and K+ channels in migration presumably necessitates Cl- channel activation as a means of sustaining an

electrical driving force for K+ transport and to provide solute efflux to enhance the

osmotic driving force through aquaporins. However, little is known about the identity of

Cl- channels involved in the process. Thus, CFTR may potentially contribute to volume

decrease that assists cell migration in this manner.

The role of pH regulation in migration has emerged from studies demonstrating

the essential role of the Na+/H+ exchangers (NHEs), particularly NHE1, in this process.

NHE1 is the ubiquitously expressed NHE that regulates intracellular pH (pHi) in virtually

all cells (Slepkov et al. 2007). Most NHEs are activated by acidic pHi, and when

+ + activated, transport H out of the cell in exchange for Na influx, returning pHi to normal

(Slepkov et al. 2007). NHE1 is critical for migration of many cell types including

leukocytes, epithelial and tumor cells (Rosengren et al. 1994; Putney et al. 2002; Stock et

al. 2005; Alexander and Grinstein 2006; Cardone et al. 2007). The role of NHE1 in migration includes establishing migratory polarity (Denker and Barber 2002), and promoting lamellipodia protrusion (Meima et al. 2007; Frantz et al. 2007). NHE1 transports Na+ into the cell, which in conjunction with anion exchangers (AEs) that

transport Cl- into the cell, results in net NaCl uptake and a subsequent increase in cell

volume (Alexander and S Grinstein 2006). Cofilin is an actin regulatory protein

necessary for actin filament assembly at the leading edge of migrating cells (DesMarais

et al. 2005). This protein is pH sensitive and is controlled by NHE1 activity in a pHi

dependent manner (Yonezawa et al. 1985; Meima et al. 2007). Additionally, the activity

of Cdc42, the central determinant of migratory polarity, is enhanced by NHE1 H+ efflux

(Frantz et al. 2007).

The extracellular pH (pHe) also appears to be important for cell migration. Human

melanoma cells reach maximum migration velocity within a narrow pHe range (Stock et

al. 2005). The effect on migration rate of pHe in melanoma cells is on adhesion such that

at acidic pHe cells adhere too tightly to move efficiently, and at alkaline pHe cells adhere

too weakly to efficiently transduce the force of movement to the substrate (Stock et al.

+ 2005; Stock et al. 2008). H efflux by NHE1 at the lamellipodium produces a pHe gradient along the longitudinal axis of the cell (Stock et al. 2007). This pH gradient appears to establish a pH optimum for migration, strengthening adhesion at the lamellipodium and weakening adhesion at the retracting rear of the cell (Stock et al.

2005; Stock et al. 2007).

All of these functions of NHE1 are possible because, like CFTR (Benharouga et al. 2003), NHE1 binds scaffold proteins that link directly to the actin cytoskeleton

(Meima et al. 2007). This allows NHE1 to localize to the lamellipodia and the actin cytoskeleton where its effects on pH and volume regulate cell migration (Denker and

Barber 2002). The similar cytoskeletal binding capabilities, as well as the cell volume and pH regulating capabilities of CFTR suggest that this ion channel may also play an important role in cell migration.

V. Scope, Central Hypothesis and Aims of the Thesis

Cystic fibrosis is a fatal disease resulting from the loss of expression of the ion

channel CFTR. The loss of function of CFTR results in impaired mucociliary clearance,

persistent airway infection, and chronic cycles of airway damage and repair. Repair of

wounds in the epithelium begins with cell migration as a means of rapidly restoring the

epithelial barrier. In CF xenograft model airways, restoration of the airway epithelium

following wounding is impaired even in the absence of infection. This suggests that

CFTR plays a direct role in airway wound healing. Additionally, the process of cell

migration involves ion channels to promote changes in cell volume and pH. CFTR

- - conducts both Cl and HCO3 and by doing so can change pH and cell volume.

Therefore, the overall hypothesis of this thesis project is that CFTR is involved in

airway epithelial cell migration.

The role of CFTR in airway epithelial cell migration was addressed by three specific aims. The first aim was to characterize the CFTR dependence of airway

epithelial cell migration. The goal of this aim was to determine the extent to which CFTR

contributes to airway epithelial cell migration, and whether the ion transport function or

other protein functions of CFTR are important in cell migration. The second aim was to

identify a functional effect by which CFTR plays a role in cell migration. The goal of this

aim was to determine a functional consequence of CFTR activity on the process of

airway epithelial cell migration that could explain its importance in migration. Finally,

the third aim was to determine the ionic mechanism by which CFTR modulates cell

- - migration. The goal of this aim was to determine the respective roles of Cl and HCO3 transport in the process of migration and to determine the role of CFTR in the transport of

these ions during airway epithelial cell migration. Accomplishing these aims provides insight into the direct role for CFTR in the wound repair occurring in infected airways of

CF patients. Understanding the airway damage and subsequent repair and remodeling process is essential for developing new treatment therapies to alleviate the consequences of chronic infection in CF. Since the airway damage accounts for the majority of fatalities in CF, the value provided by the findings of these aims will contribute to the basic understanding of airway epithelial wound healing.

Chapter II

Airway Epithelia Dependence on CFTR for Wound Closure

The loss of functional CFTR is the genetic basis for cystic fibrosis. CFTR dysfunction results in impaired mucociliary clearance causing recurrent airway infection, which damages the airway epithelium. Wounds in the epithelium must be quickly repaired to restore its barrier function, and cell migration is a critical first step in wound repair. In order to gain insight into the role of CFTR in airway epithelial cell migration, an in vitro model of wound repair was developed. The goals of experiments using this model were twofold: (i) to characterize the CFTR dependence of airway epithelial cell migration, and (ii) to identify a functional effect by which CFTR regulates cell migration.

I. In vitro model of wound repair

a. Cell Types Utilized in the Wound Repair Model

Airway epithelial repair in vivo requires specific proliferative cell populations capable of differentiation into the multiple cell types present within the airways. In the bronchi, basal epithelial cells (Chapter I, Fig. 1) are thought to be the major progenitor cell population for restoration of the epithelium following injury (Hong et al. 2004).

These cells are capable of reconstituting a pseudostratified mucociliary epithelium in air- liquid interface cultures and xenografts (Rodolphe Hajj et al. 2007). Other progenitor-like cell types are important for renewal and repair of the distal airways including Clara cells in the bronchioles and type II pneumocytes in the alveoli (Boers et al. 1998; Tesei et al.

2009).

In patients with CF, chronic persistent infections occur in the bronchi (Boucher

2004). Additionally, CF airway epithelia were shown to have a higher index of proliferating cells compared to healthy epithelia, and these proliferative cells expressed markers indicating a basal cell phenotype (Voynow et al., 2005). Basal cells therefore are an important cell population for bronchial epithelial renewal and repair in diseases such as CF.

Submucosal gland epithelial cells are also relevant in CF since the disease is characterized by severe airway submucosal gland hypertrophy and hyperplasia (Filali et al. 2002). Like basal cells, non-ciliated secretory columnar epithelial cells have proliferative capacity (Zepeda et al. 1995; Voynow et al. 2005). Further, a resident stem

cell population has been identified in airway submucosal glands, and these glands are thought to provide the molecular signals required to maintain and mobilize progenitor cells during normal airway turnover and in response to injury (Engelhardt et al. 1995; Liu

and Engelhardt 2008). Characterizing the role of submucosal gland epithelial cells in

airway wound repair is relevant to understanding how wound repair occurs in CF.

In order to identify appropriate airway epithelial cell types for studying wound

healing in vitro, the expression of multiple airway epithelial cell type markers was

measured by quantitative real-time PCR (qPCR). These markers included the alveolar

type II pneumocyte marker surfactant protein A (SP-A) (Goldmann et al. 2009), basal

cell markers cytokeratin 5 (Purkis et al. 1990; Boers et al. 1998) and tetraspanin CD151

(Hajj et al. 2007), the proliferative/progenitor cell marker epidermal growth factor

receptor (EGFR) (Voynow et al. 2005), and the Clara cell marker Clara cell secretory

protein 10kDa (CC10) (Barth et al. 2000). To perform qPCR, total RNA was extracted

from airway epithelial cells and enriched for messenger RNA using the RNeasy Mini kit

(Qiagen). Messenger RNA was then subjected to DNase treatment followed by reverse transcription (RT) reactions to generate complementary DNA (cDNA). Quantitative PCR was run on an Mx3005P real time PCR machine (Stratagene), with glyceraldehyde 3-

phosphate dehydrogenase (GAPDH) as the internal housekeeping gene. The average

expression levels of the airway epithelial markers was determined by averaging cycle

threshold (CT) values of qPCR reactions of two unique primer sets using cDNA originating from two separate 100mm plates for each epithelial cell line. To normalize

expression, the CT value of GAPDH in each sample was substracted from the

corresponding CT values of the gene of interest (ΔCT). The ΔCT of each treatment

condition was then substracted from the ΔCT of each control condition (ΔΔCT). The fold

change was then calculated using the equation: Fold Change= 2-ΔΔCT. Expression was

considered detectable for all consistently amplified replicates with CT values below 35

cycles. All primers used are shown in Table 1.

Normal human bronchial epithelial cells (NHBE) were found to express abundant levels of both basal cell makers CD151 and cytokeratin 5, as well as the proliferative/progenitor cell marker EGFR (Fig. 1A). These cells lacked expression of

SP-A, and expressed low levels of CC10. This data indicates NHBE cells have a basal cell like phenotype. NHBE cells also function like basal cells in that they are capable of forming a ciliated multi-layer epithelium when cultured with an air-liquid interface

(Klausner et al. 1998). These differentiated NHBE 3D tissues are commercially available for use as an in vitro human airway model (MatTek Corp). In addition to their phenotype,

NHBE cells have other properties that make them useful for an in vitro model of

epithelial wound repair in CF. NHBE cells were passage extended in our laboratory by transfection with the catalytic subunit of human telomerase as previously described

(Palmer et al. 2006), making them useful for longer term cultures. Furthermore, CFTR mRNA expression was measured in NHBE cells (Fig. 1A) and was found to be similar to mRNA levels in native airway epithelia (Trapnell et al. 1991).

Expression of airway epithelial cell markers was also measured in Calu-3 cells

(Fig. 1B), a human lung adenocarcinoma cell line that exhibits a serous glandular phenotype (Shen et al. 1994). Calu-3 cells lacked expression of cytokeratin 5, consistent with a non-basal cell phenotype. However, Calu-3 cells abundantly expressed CD151 and

EGFR. Expression of EGFR is presumably consistent with the proliferative capacity of glandular cells. Additionally, Calu-3 cells have been shown to have a heterogeneous composition of both mucus secreting and CFTR expressing submucosal glandular cells

(Kreda et al. 2007). The expression of CD151 may be consistent with this heterogeneous composition of Calu-3 cells. As in NHBE cells, the Clara cell maker CC10 was expressed at a low level in Calu-3 cells. Clara cells are not found in the human bronchi, but rather the distal airways (Knight and Holgate 2003). However, the presence of CC10 positive non-Clara bronchial epithelial cells has been demonstrated (Nomori et al. 1994; Barth et al. 2000), and these cells make up a small percentage of the bronchial epithelial population (Barth et al. 2000). The observation that NHBE and Calu-3 cells express relatively low amounts of CC10 mRNA is perhaps consistent with the presence of a small population of CC10 positive non-Clara bronchial epithelial cells within these cell lines.

Calu-3 cells also express SP-A in low abundance which may reflect their origin as adenocarcinoma cells, which have been shown to express SP-A (Camilo et al. 2006).

CFTR expression in Calu-3 cells (Fig. 1B) was found to be similar to native human airway epithelia, where the level of expression in submucosal gland epithelial cells is typically much higher than surface epithelial cells (Trapnell et al. 1991; da Paula et al.

2005) . The difference in CFTR expression between Calu-3 and NHBE cells thus reflects their origin. Additionally, the abundant CFTR expression in Calu-3 cells has made them a well characterized model cell for the study of CFTR function (Haws et al. 1994).

A NHBEB Calu-3 30 35

30 25

25 T 20 T C C 20 15 15

10 10 R 0 0 T C1 TR P-A CF C Ker 5 CC1 S EGFR CD151 CF EGFR CD151 Fig. 1 Expression of Airway Epithelial Cell Type Markers Quantitative RT-PCR was used to measure mRNA expression levels of epithelial cell type markers. Mean cycle threshold (CT) values of marker expression in NHBE (A) and Calu-3 (B) cells.

Characterizing the role of submucosal gland epithelial cells in airway wound repair is relevant to understanding airway repair in CF since these cells support and mobilize progenitor cells, and become hyperplastic in CF airways. The submucosal gland origin and well characterized transport properties of the Calu-3 cells make them a useful model cell for investigating the role of CFTR in submucosal gland epithelial wound repair. 18

b. In Vitro Assay for Measuring Wound Closure Rates

In order to gain insight into the role of CFTR in airway epithelial restitution, electric cell surface impedance sensing (Applied Biophysics) was utilized. This technique employed arrays consisting of tissue culture wells containing imbedded electrodes. Cells were grown to form a monolayer, after which wound repair was induced by generating a uniform circular lesion (250μm) by lethal electroporation (6V, 30kHz, 60sec) of cells in contact with the electrode. To track wound repair, alternating current (~1 μA, 15kHz) was continuously applied to the electrodes, and the impedance (Z) of this current by cells as they closed the wounds over the electrodes was continuously recorded (ECIS 1600 software, ver 1.2.8, Applied Biophysics). As wound closure proceeded and more cells covered the electrode, the impedance increased until reaching a plateau when wound closure was complete. This method of continuous impedance sensing (CIS) quantifies both the magnitude and time course of epithelial wound repair. Unlike traditional scratch assays, the wounds produced for CIS experiments are small and uniform, and close over a timescale of hours, reducing variability and the contribution of proliferation. These features of CIS make this assay ideally suited for measuring cell migration.

Before measuring the rates of Calu-3 and NHBE wound closure, it was necessary to determine the potential contribution of proliferation under the experimental conditions that would be used for CIS. Cell proliferation was measured using a bromodeoxyuridine

(BrdU) colorimetric proliferation assay (EMD Biosciences). BrdU was incubated during the final 6 hours of treatment and the relative number of proliferating cells was compared across treatments based on excitation at 450nm. The relative number of proliferating cells was compared under conditions of serum depravation (48 hours) to growth media in

Calu-3 and NHBE cells. Under serum free conditions, only a small reduction (<20%) of

NHBE cell proliferation was measured compared to growth media (Fig. 2). Calu-3 cell

proliferation was not significantly reduced under serum free conditions, in contrast to

treatment with the cell cycle inhibitor hydroxyurea (500μM for 24 hours) which produced

a >40% reduction of NHBE cell proliferation and >60% reduction of Calu-3 cell proliferation (Fig. 2). Although serum depravation did not greatly reduce the number of proliferating cells, the time required for wound closure was much shorter than reported doubling times of human bronchial epithelial cells (Taylor et al. 1993). This strongly indicated that cell migration rather than proliferation was the major component of wound repair under these experimental conditions.

0.8 SF Growth 0.6 a Hydro

0.4 * b 0.2 Absorbance (450nm) 0.0 Calu-3 NHBE Fig. 2 Proliferation of Airway Epithelial Cells The relative number of proliferating cells (as measured by absorbance @ 450nm) after 48 hours of serum free media (SF)(SF),, or after 48 hours in standard growth media (growth). Treatment (24 Hrs) with the proliferation inhibitor hydroxyurea (500μM) included as a negative control (Hydro). Significant differences between means indicated by *, a and b; a is significantly different from b.

To measure wound closure rates of Calu-3 and NHBE cells by CIS, cells were

grown on 8W1E ECIS arrays (Applied Biophysics) in growth media with serum until

fully confluent. Growth media was replaced with serum free media for 48 hours prior to

wounding to limit stimulation of proliferation. After wounding, cells were washed with

phosphate buffered saline using a 23 gauge needle to dislodge any remaining electroporated cells from the electrode, and the treatment media was added. All

- experiments were performed in HCO3 buffered media in a humidified 5% CO2 incubator at 37ºC. Visualizing cells by phase contrast microscopy during wound closure (Fig. 3A) confirmed that impedance increased as cells closed wounds over the electrode surface, and that wound closure coincided with a plateau in impedance.

Utilizing CIS, the wound closure rate of Calu-3 and NHBE cells was measured in response to treatment with epidermal growth factor (EGF), a known motogen (Jacinto et al., 2001). Following wounding, NHBE and Calu-3 cells accomplished complete wound closure in serum free media within 4.3 and 9.7 hours, respectively (Fig. 3,4). Treatment

with 1µg/ml EGF increased the rate of Calu-3 wound closure by 5.9±0.8 hours (2.6-fold),

but had no effect on NHBE cell wound closure (Fig. 3B, and data not shown). As a negative control, the wound closure rate of Calu-3 cells treated with the actin polymerization inhibitor cytochalasin D (25μM) was measured. Disruption of the actin

cytoskeleton with this compound effectively abolished Calu-3 cell wound repair (Fig.

3B,C). Viability of Calu-3 cells was determined by trypan blue exclusion and cell counts

after 24 hours of cytochalasin D or vehicle (ethanol) treatment. Calu-3 cells treated with

cytochalasin D remained over 80% viable (81.8±3.3) for the full 24 hours of treatment,

indicating the inhibition of wound repair was not due to cell death.

Our previous studies using CIS with eosinophils (Bankers-Fulbright et al. 2009) revealed that the increase in impedance was dependent on integrin mediated interactions between cells and the electrode. Treatment of Calu-3 cells with (5μg/ml) β1-integrin blocking antibody during adhesion abolished attachment of these cells to the electrode, as well as a rise in impedance (Fig. 3C). This result confirmed that an increase in impedance is dependent on cells being adherent to the electrode. Therefore, not only does this assay allow for measurements of migration rates, but also gives information on the adherence of cells during the process of wound closure.

AB a t=0 5000

4000

) 3000 

t=1Hr t=3Hr Z ( 2000 1g/ml EGF SF MEM 1000 25M CytoD

0 0 5 10 15 Time (Hrs)

Fig. 3 Measurement of Wound Closure by CIS (A) Images of electrodes in CIS arrays during C 6000 Calu-3 cell wound closure with EGF (1µg/ml): 5000 * before wounding (a), immediately after wounding (t=0), 1 hour after wounding, and at wound

) 4000 closure (t=3Hr). Scale bar = 100μm. (B) 

( Averaged impedance (Z) time course during 3000 wound closure from a representative experiment

Final of Calu-3 cells treated with EGF + vehicle, SF Z 2000 media or cytochalasin D. (C) Calu-3 cell impedance at the time of wound closure with 1000 control media (1µg/ml EGF), and at the same 0 time point with cytochalasin D. Impedance after Control Cyto D 1 24hr treatment of Calu-3 cell suspension with anti-β1 integrin treatment. Significant difference between means indicated by *.

Together these studies demonstrated that CIS is a sensitive, efficient and objective technique for measuring changes in rates of wound closure. Therefore, this technique was utilized to assess the role of CFTR in airway epithelial wound closure. The wound closure rates of NHBE and Calu-3 human bronchial epithelial cell lines were assessed by

CIS to determine the contribution of CFTR to the process of wound closure, and to gain insight into the mechanism by which CFTR participates in wound closure.

II. Inhibition of CFTR Channel Activity Slows Wound Closure

Activation of CFTR channel activity occurs when the regulatory domain of CFTR is phosphorylated by protein kinase A (PKA) (Zhou et al. 2006). CFTR also contains two nucleotide binding domains (NBDs), NBD1 and NBD2 (Zhou et al. 2006; Chen and

Hwang 2008). Following phosphorylation of the regulatory domain, ATP binding dimerizes NBD1 and NBD2 (Muallem and Vergani 2009). This dimerization is coupled to a conformation change that opens the channel gate (Muallem and Vergani 2009). ATP hydrolysis causes dissociation of NBD1 and 2, closing the channel (Chen and Hwang

2008). The CFTR channel inhibitor CFTRinh-172 is highly selective for CFTR and has been shown to reduce CFTR open probability by >90% with Ki≈0.6µM in rat thyroid cells (Taddei et al. 2004). The CFTR binding site of CFTRinh-172 has not been specifically identified; however, the mechanism of inhibition has been shown to involve stabilization of CFTR in the closed state (Taddei et al. 2004). This mechanism is very different from the mechanism of inhibition of the non-specific CFTR inhibitors glibenclamide and diphenylamine-2-carboxylic acid (DPC), which block the ion

transporting pore of CFTR (Taddei et al. 2004). CFTRinh-172 does not affect the open state of CFTR and does not appear to act as a pore blocker (Taddei et al. 2004).

A Control 172 B t=3 t=3

100 Calu-3 NHBE

75 t=4.5 t=4.5 % Viable Cells Viable %

50 l trol 172 ntro M 172 M Con  Co  30 20

Fig. 4 Migration with CFTR Inhibited (A) Images of CFTRinh-172 and control treated Calu-3 (top panels) and NHBE cells (bottom panels) at the time of wound closure for control treatments. Clockwise from top left: Control (1µg/ml EGF+veh) Calu-3 cells at 3 hours, Calu-3 cells with CFTRinh-172 (30µM) at 3 hours, NHBE cells with CFTRinh-172 (20µM) at 4.5 hours, control (veh) NHBE cells at 4.5 hours. (B) Viability of CFTRinh-172 treated Calu-3 and NHBE cells.

A slightly lower CFTRinh-172 concentration was used to treat NHBE cells

(20µM) compared to Calu-3 (30µM) because NHBE cell viability was found to be more sensitive to the CFTRinh-172 vehicle, DMSO, than Calu-3 cells (data not shown).

Inhibition of CFTR channel activity with CFTRinh-172 following wounding delayed wound closure of both Calu-3 and NHBE cells (Fig.4 and 5). Time to wound closure increased significantly for CFTRinh-172 (30μM) treated Calu-3 cells by 6.2 hours (2.7- fold), and for CFTRinh-172 (20μM) treated NHBE cells by 7.9 hours (2.9-fold) (Fig. 5).

The effect of CFTR inhibition on wound closure was also verified visually by imaging 24

electrodes over time following wounding. Very little wound closure had occurred during treatment with CFTRinh-172 for either NHBE or Calu-3 cells (Fig. 4A) at the time point at which wound closure was complete in control treated cells. Assessment of cell viability with CFTRinh-172 treatment revealed no significant change compared to control (DMSO

Veh) after 24 hours (Fig. 4B). Therefore, the effect of CFTR inhibition on wound closure was not due to non-specific toxic effects. Rather, these data demonstrate that CFTR channel activity plays a role in the process of wound healing in airway epithelial cells.

A B 5000 Calu-3 10000 NHBE

4000 8000 ) ) 3000 6000   Z ( Z ( 2000 4000 Control Control 1000 2000 30M 172 20M 172 0 0 0 2 4 6 8 10 0 5 10 15 20 Time (Hrs) Time (Hrs) C 20 Calu-3 NHBE Fig. 5 Migration Rates with Inhibition of CFTR 15 (A) Averaged Z time course during wound * closure of a representative experiment of * Calu-3 cells treated with control media 10 (1µg/ml EGF+DMSO) or CFTRinh-172. (B) Averaged Z time course during wound

Time (Hrs) closure of a representative experiment of 5 NHBE cells treated with control media (SF+DMSO) or CFTRinh-172. (C) Mean 0 time required for wound closure to occur l l 72 72 with treatments described in A and B. 1 ro 1 ntro nt o M o M Significant differences between means C  c  30 20 indicated by *.

Proliferation of CFTRinh-172 treated NHBE and Calu-3 was also assessed using

the BrdU proliferation assay as described above (Section Ib). Treatment with CFTRinh-

172 had a significant effect on proliferation (Fig. 6). Treatment of Calu-3 (30µM) and

NHBE (20µM) cells for 24 hours resulted in a 20.9 and 4.6-fold reduction (respectively) in cell proliferation relative to vehicle treated controls (serum free media+DMSO).

Although the CFTRinh-172 effect on proliferation is significant, it does not appear to be

the basis for the reduced wound closure rates measured for CFTRinh-172 treated cells. As

described below (Section IV) proliferation of cells was not observed during wound closure using video imaging, but rather cells could clearly be seen to migrate. However, ion channel activity of CFTR does appear to be important for cell proliferation.

Control 0.4 172 Fig. 6 Proliferation with Inhibition of CFTR 0.3 The relative number of proliferating Calu-3 and NHBE cells 0.2 (determined by absorbance @ 450nm) under control conditions or after 24 hour treatment with 0.1 CFTRinh-172 (30µM Calu-3, 20µM * NHBE). Significant differences Absorbance at 450nm 0.0 * between means indicated by *. Calu-3 NHBE

III. Silencing CFTR Protein Expression Slows Wound Closure

RNA interference (RNAi) takes advantage of an evolutionarily conserved mechanism to silence targeted gene expression with high specificity and selectivity (Fire et al. 1998; Rao et al. 2009). Delivery of a short hairpin RNA (shRNA) expression vector into a cell allows for constitutive silencing of a gene (Pushparaj et al. 2008). The shRNA 26

primary transcript has a stem-loop structure that resembles a hairpin and gives this type

of interfering RNA its name (Rao et al. 2009). The shRNA is then exported to the

cytoplasm where it is cleaved by the RNAse Dicer to form small interfering RNA

(siRNA) and unwound into single strands by a cytoplasmic helicase (Pushparaj et al.

2008). The RNA-induced silencing complex (RISC) binds the single stranded RNA and

uses it as a template to seek out complementary sites in target mRNA and degrade it

(Hammond et al. 2000). By designing shRNA sequences to be complementary to mRNA

of interest, this mRNA degrading mechanism can be used to silence expression of

individual proteins (Aagaard and Rossi 2007).

To further characterize the role of CFTR in wound repair, CFTR was silenced in

Calu-3 cells by constitutive expression of CFTR specific shRNA (shCFTR). This was

accomplished by transfection with the Sleeping Beauty transposon vectors pT2/si-

PuroV2 as previously described (Palmer et al. 2006). To determine the extent of CFTR

silencing, CFTR expression was quantified by qPCR as described above (Section I (a)).

Percent decrease in CFTR expression was calculated from fold change using the

equation: Fold Change= 2-ΔΔCT, and represents separate qPCR reactions from two

separate cell isolations. Quantitative PCR revealed CFTR transcript levels were

decreased by 99% in Calu-3 cells expressing CFTR specific shRNA (Fig.7A). Expression

of a control shRNA that lacked target specificity, shALTR (ALTR), did not significantly affect CFTR transcript levels compared to wild type Calu-3 cells (Fig.7A). CFTR protein expression was not detectable by western blot in shCFTR expressing Calu-3 cells, whereas abundant CFTR protein was found in ALTR expressing and wild type cells

(Fig.7B). Short circuit current (Isc) measurements of CFTR silenced Calu-3 cell

monolayers revealed a >97% decrease in 8-cpt-cAMP stimulated Isc compared to wild

type and ALTR expressing Calu-3 cells (Fig. 7C). This result indicates very little

functional CFTR is present following expression of CFTR specific shRNA.

A Real-Time PCR B 1 2 3 4 CFTR CFTR 175

shCFTR ALTR 58 GAPDH WT β-tubulin 46

0 5 10 15 20 25 30 35 C CT Fig. 7 Silencing of CFTR Protein Expression

A) (A) Cycle threshold (CT) values from qPCR of  12 CFTR and GAPDH expression in wild type (WT), CFTR specific shRNA expressing (shCFTR), and 10 control shRNA expressing (ALTR) Calu-3 cells. (B) Western blot of CFTR (top panel) and β-tubulin 8 (bottom panel) protein levels in ALTR (lane 1), wild type (lane 2), and shCFTR (lane 3) Calu-3 cells, 6 and molecular weight markers in kDa (lane 4). (C) Measurements of 8-cpt-cAMP (2.5μM) stimulated 4 short-circuit current (Isc) in monolayers of wild type, ALTR, and shCFTR Calu-3 cells. Significant 2 differences between means indicated by *. 0 * WT ALTR shCFTR 8-cpt cAMP Stimulated Isc (

Loss of CFTR expression in Calu-3 cells delayed wound closure by 9.7 hours

(3.8-fold) compared to wild type and ALTR expressing controls (Fig. 8). The magnitude

of the delay of wound closure was not significantly different in Calu-3 cells whether

CFTR was silenced by shRNA expression, or CFTR activity was inhibited by treatment

with CFTRinh-172 (Fig. 8B). Moreover, CFTRinh-172 treatment had no significant effect

on wound closure of CFTR silenced Calu-3 cells (Fig. 8B), indicating the compound was

selective for CFTR at the concentration used. 28

Proliferation of shCFTR and ALTR expressing Calu-3 cells was also assessed

using the BrdU proliferation assay as described in Section Ib. The relative number of proliferating cells was not reduced in shCFTR expressing Calu-3 cells compared to

ALTR cells; in fact, a small but significant increase in the relative number of proliferating shCFTR cells was found (Fig. 8C). Since a large decrease in wound closure rate was found for shCFTR expressing cells, this data provides further evidence that

proliferation is an insignificant contributor to wound closure in the CIS model.

A B C 15 6000 0.7 shCFTR 5000 0.6 ALTR 0.5 4000 10

) * 0.4  3000

Z( 0.3 5 2000 ALTR Time (Hrs) shCFTR * 0.2 1000 0.1 Absorbance (450nm) 0 0 0.0 0 5 10 15 20 2 SF Growth 7 Time (Hrs) + 1 M 172 ALTR  shCFTR TR F 30 shC Fig. 8 CFTR Silencing Effect on Migration and Proliferation (A) Averaged Z time course during wound closure of representative experiment of ALTR and shCFTR Calu-3 cells treated with control media (1µg/ml EGF+DMSO). (B) Mean time required for wound closure to occur for shCFTR, shCFTR treated with CFTRinh-172 (30µM), Calu-3 WT treated with CFTRinh-172 (30µM), and ALTR Calu-3 cells. (C) The relative number of proliferating shCFTR and ALTR Calu-3 cells (determined by absorbance @ 450nm) after 48 hour treatment with serum free media, or maintained in growth media. Significant differences between means indicated by *.

IV. Time Lapse Imaging of Wound Closure

To confirm that migration was predominantly responsible for wound closure in

CIS experiments, time lapse videos were captured during airway epithelial wound

closure. For these experiments a temperature (37 ̊C) and humidity controlled, 95% O2/5%

CO2 gassed, stage incubator was used. NHBE and Calu-3 cells were grown on ECIS

arrays to confluence, serum starved for 48 hours, wounded by electroporation, washed

with PBS to remove electroporated cells, and mounted into the incubator. Brightfield phase contrast images of closing wounds were captured with a 20X objective once every

minute until wound closure was complete, using a Nikon Diaphot inverted microscope

equipped with a Diagnostic Instruments digital camera. Images were collected and

composed into time lapse image series using Spot Advanced (Version 4.6).

Video imaging of NHBE and Calu-3 cell wound closure revealed migration was

predominantly responsible for wound closure. Cells, propelled by protrusions of their

lamellipodia, could be clearly seen to move from the periphery of the wound into the

wounded space (Fig. 9,10). Cell division was not observed during wound closure.

Interestingly, migrating cells moved together collectively, without opening visible spaces

between cells or detaching visibly from each other. Lamellipodia were also clearly visible

protruding from the leading edge cells throughout the wound closure process (Fig. 9,10).

Previous studies of migration of epithelial monolayers revealed that cell-cell contacts are

maintained and cells migrate as a collective sheet to close wounds (Martinez-Arias, and

Martin 2001; Zhao et al. 2003; Farooqui and Fenteany 2005). Video imaging of Calu-3

and NHBE cells confirms this in another epithelial cell type. Video imaging of Calu-3

and NHBE monolayers also revealed wound closure is a collective process involving

many more cells than those immediately surrounding the wound. Nearly all the cells in

the captured image region (~150% larger than wound area) participate in migration and can be seen to move together to result in wound closure. Time lapse 3-dimensional

imaging of other epithelia has also demonstrated that the epithelium surrounding the wound migrates in a smooth sliding fashion, and cells participating in migration extend well beyond the wound margin (Zhao et al. 2003; Farooqui and Fenteany 2005). Video imaging of Calu-3 and NHBE cells occurs as has been described previously for other epithelia. These time lapse studies also add to the relatively few studies that directly assess wound closure of epithelial monolayers.

30 min 160 min Fig. 9 Time Lapse Images of Wound Closure-Calu-3 Images from time lapse wound closure sequence of Calu-3 cells with control media (1µg/ml EGF). Clockwise from top left: 30 min after wounding,160 min after wounding, 5.5 hours after wounding. Movement of individual cells shown with current position in solid circles, and previous position in dashed circles. Approximate direction of movement indicated by arrows. Scale bar = 5.5 Hr 100µm.

30 min 160 min

Fig. 10 Time Lapse Images of Wound Closure-NHBE Images from time lapse wound closure sequence of NHBE cells with control media (SF). Clockwise from top left: 30 min after wounding,160 min after wounding, 5.5 hours after wounding. Movement of individual cells shown with current position in solid circles, and position from previous image in dashed circles. Approximate direction of movement indicated by arrows. 5.5 Hr Scale bar = 100µm.

V. Effect of CFTR Inhibition on Lamellipodia Protrusion

The short time course of wound closure (<5 hours), and the movement of cells to close wounds during video imaging demonstrated migration is the predominant

mechanism of wound closure in the CIS experiments. Lamellipodia mark the leading edge of migrating cells (Vicente-Manzanares et al. 2005; Small et al. 2008). These structures are flat organelle-free membrane protrusions composed of actin filaments aligned in a network perpendicular to the cell membrane (Abercrombie et al. 1971; Le

Clainche and Carlier 2008). Polymerization of this actin network extends lamellipodia, which adhere tightly to the substrate via integrins (Le Clainche and Carlier 2008). The force of movement during migration is transmitted from substrate adhesions to the cell via the lamellipodial actin array (Horwitz and Webb 2003; Ridley et al. 2003).

Lamellipodia are therefore essential migratory structures (Small et al. 2008).

To investigate the role of CFTR in the process of cell migration, an assay was developed to assess morphometric changes in lamellipodia protrusion during wound closure. For this assay, migrating cells were stained with fluorescent phalloidin, which binds the actin cytoskeleton (Vetter 1998), allows for visualization of the actin array of lamellipodia, and area measurements of individual lamellipodia.

For this assay, Calu-3 cells were cultured on glass chamber slides coated with type I collagen (40µg/ml) to allow adherence to glass. NHBE did not require this treatment and were plated directly onto glass chamber slides. Epithelial cells were maintained on chamber slides in standard growth media until confluent, when media was then changed to serum free conditions for 48 hours. Circular wounds were produced in the monolayers by pressing the ~300 μm blunt end of a surgical micro-forceps against the glass surface. Approximately 10 wounds were made in each well in this manner. Cells were washed with PBS, and treatment media was added. Lamellipodia protrusion was monitored with phase contrast microscopy (data not shown) and maximum protrusion

was observed 1 hour after wounding Calu-3 cells, and 45 min after wounding NHBE cells under control treatment conditions (serum free media with 1µg/ml EGF or serum free media, respectively). The area of lamellipodia protruding into wounds was then measured at these time points in NHBE and Calu-3 cells treated with CFTRinh-172 or

control media, as well as shCFTR expressing Calu-3 cells and ALTR controls. Epithelial

cells were then fixed (3.7% paraformaldehyde) and stained with Texas-Red phalloidin

(5U/ml). Images were taken of cells at wound leading edges at 40X (1024x1024 pixel

area) using a Nikon Diaphot microscope equipped with a Diagnostic Instruments

monochrome digital camera. The area (in pixels) of each lamellipodium per cell was

measured and the average lamellipodium area/cell in each captured image was used for

statistical analysis.

ALTR shCFTR 172

Fig. 11 Lamellipodia Protrusion Images of Calu-3 (top panels) and NHBE (bottom panels) cell lamellipodia (actin cytoskeleton) at the leading edge of wounds. Arrows and brackets indicate lamellipodia. Cells were treated with veh (DMSO) or CFTRinh-172. Scale bar = 20µm. Veh 172

Inhibition of CFTR reduced lamellipodia area by 2.5 and 2.6-fold for both Calu-3

and NHBE cells (respectively) (Fig. 11,12). The area of lamellipodia of CFTR silenced

Calu-3 cells was also reduced by 2.2-fold compared to ALTR control cells (Fig. 11,12).

These data indicate that inhibition of CFTR transport activity reduces lamellipodia

protrusion in Calu-3 and NHBE airway epithelial cells during wound closure. The

reduced lamellipodia area indicated that the onset of lamellipodia protrusion was delayed

in the absence of CFTR activity. This delay in the onset of lamellipodia likely contributed

to the delay in wound closure following inhibition of CFTR activity.

3000 Calu-3 Calu-3 NHBE

2000

(pixels) 1000 * * * Lamellipodium Area 0 l 2 TR trol 7 ntro n M 172 AL CFTR M 1  h  Co 0 s Co 0 3 2

Fig. 12 Lamellipodia Area Mean area measurements of individual lamellipodia of Calu-3 cells treated with control or CFTRinh-172 (30µM), shCFTR and ALTR Calu- 3 cells, and NHBE cells treated with control or CFTRinh-172 (20µM). Significant differences between means indicated by *.

VI. CF Airway Epithelial Cells and Inflammatory Mediators

The ΔF508 CFTR mutation which is the most common mutation in CF patients,

results in the loss of function of this ion channel at the cell membrane (Chapter I). 35

Silencing CFTR and inhibiting ion transport recapitulate the effect of this mutation in

epithelial cells. Since both slow airway epithelial cell migration, it suggests that

expression of the ΔF508 CFTR mutation would also slow airway epithelial cell

migration.

To test whether expression of the ΔF508 CFTR mutation slows airway epithelial cell migration, the migration rate of a human CF patient derived bronchial epithelial cell line (UNCCF1T) was measured by CIS. These cells were isolated from the lungs of homozygous ΔF508 CFTR CF patients at the time of lung transplant and immortalized by expression of Bmi-1 and hTERT (Fulcher et al. 2009). Unfortunately, qPCR revealed the comparable control bronchial epithelial cell line obtained from the investigators that derived both lines did not express CFTR (data not shown). The investigators reported the loss of CFTR expression in the normal (control) cell line as being passage dependent

(Fulcher et al. 2009), and unfortunately the late passage cells made available to us had lost expression of CFTR. Therefore, these controls were an unsuitable comparison with the human CF cell line, UNCCF1T. Instead the migration rate of UNCCF1T cells was compared to NHBE cells. Although these cells are not an ideal comparison because they have been immortalized with different vectors, and have very different basal impedances, the expression of epithelial cell type markers is similar (Fig. 1 and 13A), and the media conditions are identical between the two lines.

A comparison of the migration rate of UNCCF1T to NHBE cells revealed a 1.7- fold slower migration of UNCCF1T cells, and an increase in time required for wound closure of 2.9 hours (Fig. 13B,C). This data suggests the expression of ΔF508 CFTR slows migration. However, further studies are necessary to verify this using a ΔF508

CFTR expressing airway epithelial cell line compared to its wild type CFTR rescued counterpart.

A B 1.00 1.00

0.75 0.75

0.50 Ker 5 0.50 CD151 EGFR NHBE 0.25 CC10 Normalized Z 0.25 UNCCF1T SP-A

0.00 0.00

Normalized Fluorescence Normalized 10 15 20 25 30 35 40 45 0 5 10 15 CT Time (Hrs) C 10 Fig. 13 Migration of CF Cells (A) Amplification plots from qPCR of 8 * epithelial cell type markers in UNCCF1T cells. (B) Averaged Z time course during 6 wound closure of representative experiment of NHBE and UNCCF1T cells in control (SF) 4 media, normalized to the maximum Z of Time (Hrs) each cell line after wound closure. (C) Mean 2 time required for NHBE and UNCCF1T wound closure. Significant difference 0 between means indicated by *. NHBE UNCCF1T

A characteristic of CF lung disease is the presence of early and excessive inflammation (Jacquot et al. 2008). In CF patients, Pseudomonas aeruginosa airway infection determines the progression of lung disease (Campodónico et al. 2008). A Th2 immune response predominates during P. aeruginosa infection, and is associated with poor pulmonary outcome (Hartl et al. 2006). In a mouse model of P. aeruginosa airway

infection, Th1 reacting mice showed enhanced bacterial clearance, milder inflammation

and better survival and disease outcome than Th2 reacting mice (Moser et al. 2002).

Bronchoalveolar lavage fluid from CF patients infected with P. aeruginosa revealed decreased Th1 cytokine IFNγ production compared to non-infected CF patients

(Hartl et al. 2006). Additionally, treatment of Calu-3 cells with IFNγ has been shown to increase wound closure rate in monolayer scratch assays (Ahdieh et al. 2001). Since Th1 cytokines may have a beneficial role in CF airways, the effect of the loss of CFTR

function on airway wound repair may be modulated by IFNγ.

To determine if IFNγ enhances airway epithelial cell migration, Calu-3 and

NHBE cells were treated with IFNγ and migration rates were measured by CIS. For these experiments, Calu-3 and NHBE cells were grown to confluence on ECIS arrays, changed to serum free conditions and treated with IFNγ (50ng/ml) for 48 hours. Cells were then wounded and the migration rates were measured by CIS in the presence of IFNγ.

Control 6 IFN 5

2 Time (Hrs)

0 NHBE Calu-3 Fig. 14 IFNγ and Migration Mean time required for wound closure of NHBE and Calu-3 cells treated with IFNγ.

IFNγ treatment had no significant effect on Calu-3 or NHBE cell migration rates

compared to vehicle controls (Fig. 14). This cytokine therefore, does not appear to play a

direct role in airway epithelial cell migration. The effect of IFNγ treatment on Calu-3 cell

wound closure measured by scratch assay (Ahdieh et al. 2001) may have been

proliferation dependent. In this study wounds were still closing after 3 days, and therefore

proliferation must play a major role in closure. Therefore, the lack of an IFNγ effect on

Calu-3 cells likely reflects a role in proliferation rather than migration. Other chemokines and cytokines that are important for inflammation in CF airways, however may be important in modulating airway epithelial migration rates. Further studies are warranted to address these issues.

VII. Conclusions

Both basal cell like and serous glandular bronchial epithelial cell lines were used in an in vitro model of wound healing to investigate the role of CFTR in the process.

Inhibition of CFTR transport activity slowed the wound closure rates of both cell lines.

Silencing CFTR protein expression in the Calu-3 cell line also slowed the rate of wound

closure. The magnitude of the delay in wound closure was equivalent whether CFTR was

inhibited or silenced, suggesting anion transport underlies the mechanism by which

CFTR regulates wound closure. The CF cell line, UNCCF1T also closed wounds more

slowly than the NHBE cells suggesting wound closure is impaired in CF cells. The short

time course of wound closure suggests that proliferation does not significantly contribute

to wound closure. The movement of Calu-3 and NHBE cells during time lapse video

imaging of wound closure clearly demonstrated wounds close predominantly by

migration. The studies described here also identified delayed protrusion of lamellipodia as a result of CFTR inhibition or silencing. This not only supports a role for CFTR in airway epithelial cell migration, but provides a functional effect of CFTR transport on cell migration.

Inhibition of CFTR greatly reduced the relative number of proliferating Calu-3 and NHBE cells over 24 hours. A dramatic effect of the loss of CFTR expression on airway cell proliferation in vivo would be expected to exacerbate wound repair in CF airways. However, silencing CFTR did not reduce cell proliferation, in fact the relative number of proliferating cells was actually significantly higher in CFTR silenced Calu-3 cells. This suggests that the effect of CFTR inhibition on proliferation is transient, and that over time, airway cells can compensate for the CFTR dependent reduction in proliferation. Further, a xenograft study utilizing human CF cells also found higher numbers of proliferating cells in CF xenografts compared to normal controls (Hajj et al.

2007). Therefore, in the airways of CF patients, a reduction in the rate of airway epithelial cell proliferation is probably not a significant factor during wound repair.

Although treatment with IFNγ did not have an effect on Calu-3 or NHBE cell migration rates, other chemokines and cytokines may have an effect on migration rate.

Since a Th2 response to airway infection is associated with poor pulmonary outcome in

CF patients, Th2 cytokines may slow airway epithelial wound repair. The modulation of cell migration rate by these cytokines should be the subject of future studies.

The studies described here demonstrated that CFTR transport plays a role in cell migration, and identified a functional effect of CFTR inhibition on cell migration. CFTR

- - transports both Cl and HCO3 (Reddy and Quinton 2003), and so the transport of one or

both of these ions likely underlies the mechanism of CFTR in wound repair. An understanding of the role of these ions in airway epithelial migration will be necessary to elucidate the overall mechanism by which CFTR contributes to cell migration.

Primer Sequence (5'-3') CFTR F AGCATTTGCTGATTGCACAG

CFTR R ACTGCCGCACTTTGTTCTCT GAPDH F GGACTCATGACCACAGTCCAT GAPDH R CAGGGATGATGTTCTGGAGAG

CD151 F#1 TGGAGACCTTCATCCAGGAG CD151 R#1&2 GTACAGGCAGCACGTGAAGA CD151 F#2 GAGACCTTCATCCAGGAGCA

EGFR F# 1&2 AACTGTGAGGTGGTCCTTGG EGFR R#1 GTTGAGGGCAATGAGGACAT EGFR R#2 GGAATTCGCTCCACTGTGTT

Cytokeratin 5 F #1/2 CAAGCGTACCACTGCTGAGA Cytokeratin 5 R #1 CATCAGTGCATCAACCTTGG Cytokeratin 5 R #2 CATCCATCAGTGCATCAACC

CC10 F #1 AACCCTCCTCATGGACACAC CC10 R #1 TGATGCTTTCTCTGGGCTTT CC10 F#2 GTCACACTGGCTCTCTGCTG CC10 R #2 TCAGGGCTGAAAAGTTCCAT SP-A F #1 CATTGCTGTCCCAAGGAATC SP-A R #1/2 TCCCATCTGAGTAGCGGAAG SP-A F #2 CTGTCCCAAGGAATCCAGAG Table 1. Primers sets used for qPCR

Chapter III

Ionic Mechanism of CFTR Regulation of Cell Migration

- - I. Role of Cl and HCO3 Transport in Cell Migration

Although the selectivity properties of the CFTR pore give it a permeability ratio

- - for Cl :HCO3 of between 4 and 6 to 1, in intact cells the specific ion that is transported depends on intracellular signaling and ion availability (Poulsen et al. 1994; Illek et al.

- - - 1997). CFTR transports Cl preferentially to HCO3 under specific Cl loading conditions,

- - - and likewise, can transport HCO3 preferentially to Cl under specific HCO3 loading conditions. In Calu-3 cells, treatment with the adenylyl cyclase activator forskolin results

- in a rise in cAMP levels and causes CFTR-dependent HCO3 secretion (Devor et al. 1999;

- Hug et al. 2003). This HCO3 secretion has been shown to be dependent on a basolateral

+ - - electrogenic Na / HCO3 cotransporter (NBC) to load HCO3 into the cell (Hug et al.

2003). Stimulation of Calu-3 cells with agonists that raise intracellular [Ca+2] causes Cl- secretion via CFTR. This is due to activation of basolateral Ca+2 activated K+ channels,

- which hyperpolarize the basolateral membrane voltage preventing HCO3 uptake by electrogenic NBCs, while at the same time activating Na+K+2Cl- cotransport (via PKCδ) and Cl- loading (Liedtke et al. 2003; Hug et al. 2003). Activation of CFTR in response to

Ca+2 mobilization results from phospholipase A2 production of arachidonic acid and subsequent increase in prostaglandin (PG) secretion. Prostaglandins, particularly PGE2, bind PG receptors resulting in activation of PKA to phosphorylate and activate CFTR

- - (Palmer et al. 2006). Therefore, Calu-3 cells can transport HCO3 or Cl preferentially

depending on whether cAMP levels are elevated in addition to or in the absence of a rise

+2 - - in intracellular [Ca ]. Under conditions of Cl transport, CFTR also transports HCO3 , although to a lesser extent than Cl- due to the higher Cl- selectivity of the channel. The

- - intracellular [HCO3 ], perhaps augmented by HCO3 loading via the electroneutral NBC

(which is unaffected by membrane voltage (Pushkin and Kurtz 2006)), results in a portion

- - of the CFTR current being due to HCO3 transport even under preferential Cl transport

conditions.

The data presented in Chapter II clearly demonstrated that inhibition of ion

transport by CFTR reduces airway epithelial cell migration rate. Consequently, the

- - transport of Cl and/or HCO3 by CFTR is expected to play a role in Calu-3 and NHBE

cell migration. Therefore, the third aim of this study was to determine the ionic basis of

CFTR regulation of cell migration.

To assess the role of Cl- transport in cell migration, CIS was used to measure the rate of cell migration of Calu-3 and NHBE cells in Cl- free media, in which Cl- ions were

- replaced by SO4 . This ionic substitution allows the anion/cation balance to be

- - maintained, but SO4 anions are not conducted by CFTR (Illek et al. 1999). The Cl free

media composition was based on the composition of MEM and contained (in mM):

C6H11O7(1/2Ca) 1.8, KMeSO4 5.4, MgSO4 0.8, NaMeSO4 116.4, NaH2PO4 1, NaHCO3

26.2, mannitol 10, glucose 5.6. Media was also supplemented with 1X

penicillin/streptomycin and 1X NEAA (non-essential amino acids). The control (Cl- containing) media contained (in mM): CaCl2 1.8, KCl 5.4, MgSO4 0.8, NaCl 116.4,

NaH2PO4 1, NaHCO3 26.2, glucose 5.6, and 1X penicillin/streptomycin and NEAA. The

pH of both the control and Cl- free media was set to that of standard MEM media (7.2).

Calu-3 and NHBE cells were grown to confluence on ECIS arrays in standard growth media, then serum starved for 48 hours prior to wounding. CIS was then used to monitor

- cell migration rates during wound healing under standard CO2/HCO3 buffering conditions.

Interestingly, cell migration rate and time to wound closure of Calu-3 cells were

- - - unaffected by replacement of Cl with SO4 (Fig. 1A). In contrast, replacement of Cl

significantly slowed the rate of NHBE cell migration and increased the time to wound

closure by 8.4 hours (2.9-fold) (Fig. 1A, 7A). This data suggests a mechanistic difference

in the role of CFTR in cell migration between these two cell lines.

A B Calu-3 NHBE 6000 8000 5000 6000 4000 ) )  3000  4000 Z(

Control Z ( 2000 Cl- Free 2000 Control 1000 Cl Free 0 0 0 2 4 6 8 10 12 0 2 4 6 8 10 12 Time (Hrs) Time (Hrs)

Fig. 1 Migration in Cl- Free Media Averaged Z time course of Calu-3 (A) and NHBE (B) wound closure from representative experiments of cells treated with control media or Cl- free media.

- The role of HCO3 transport in airway epithelial cell migration was then assessed.

- This was accomplished by lowering the HCO3 concentration in the media and

- maintaining pH at 7.2 with 5mM HEPES. Complete removal of HCO3 from the media

can acidify intracellular pH (pHi) (Pastoriza-Munoz et al. 1992). Thus, to determine the 44

- lowest concentration of HCO3 that could be used in the media that still allowed cells to

maintain normal pHi, the pHi was measured in Calu-3 cells using the pH indicator

BCECF. BCECF-AM is a cell permeable pH sensitive carboxyfluorescein whose

fluorescent intensity varies with intracellular pH (Paradiso et al. 1984). The ratio of

fluorescent intensity at two different excitation wavelengths (495nm and 440nm) allows

for a calculation of intracellular pH as described below.

To measure pHi, Calu-3 cells were cultured on glass chamber slides coated with type I collagen (40μg/ml) and grown until 50% confluent, serum starved for 24hrs, then loaded with 10μM BCECF at 37ºC. The 440/495nm ratio was then monitored using a

Nikon Diaphot inverted microscope equipped with Lambda DG-4 (Sutter) high speed filter changer and Cool Snap HQ (Photometrics) camera and recorded using MetaFluor version 6.3r7 (Universal Imaging Corp.). Experiments were performed under 5% CO2

gassing conditions at 37ºC. The 440/495nm fluorescent intensity ratio was recorded while

- cells were perfused with control or lowered HCO3 media until steady state was achieved.

To convert the 440/495nm ratio to pH, the 440/495nm ratio was measured with

the pHi set to pH values of 6.5, 7.0 and 7.5 using calibration media with 20μM nigericin.

Nigericin is a K+/H+ ionophore which permeabilizes the cell membrane to K+ and H+

(Raben et al. 2009). Perfusion of cells with nigericin and a [K+] equivalent to cytosolic equilibrates [H+] across the cell membrane (Nett and Deitmer 1996). The intracellular pH can therefore be set by perfusing cells with high [K+]/nigericin containing solutions with

known pH, and a standard curve of the 440/495nm ratio to intracellular pH can be

generated (Bergman et al. 1991; Liang et al. 2007). Nigericin (20μM) solutions had pH

set to 6.5, 7.0 and 7.5 and contained in mM: 5 NaCl, 145 KCl, 7 HEPES, 1 CaCl2, 1

MgCl2, 0.1 KH2PO4, 0.4 K2HPO4, and 2 glucose. The 440/495nm ratio vs. pH was linear over the pH range used. The slope and y-intercept was used to calculate the intracellular pH using the equation: pH= (R-B)/S, where R is the 440/495 ratio, B is the y-intercept,

and S is the slope of the calibration curve.

- The pHi of Calu-3 cells was then measured using media with the [HCO3 ] lowered

from control (26mM) to 5mM, 3mM and 1mM. In control media, Calu-3 cell pHi was

- 7.4±0.03, and cells maintained this pHi in media with the [HCO3 ] lowered ~5-fold to

- 5mM (Fig. 2D). Further lowering the [HCO3 ] to 1mM significantly acidified cells.

- Therefore migration experiments using CIS were performed with the [HCO3 ] no lower

- than 5mM. This media contained (in mM): HCO3 5, CaCl2 1.8, KCl 5.4, MgSO4 0.8,

NaCl 116.4, NaH2PO4 1, NaMeSO4 21.19, HEPES 5, glucose 5.6. The media was also

supplemented with 1X penicillin/streptomycin and NEAA, and the pH was set to 7.2. The

control media used for these experiments was the same as the control media described

above for Cl- free experiments (serum free MEM media), with the addition of 5mM

- HEPES since it was also included in the low HCO3 media.

In contrast to cell migration in Cl- free media, Calu-3 cells but not NHBE cells,

- migrated at a significantly slower rate in media in which the [HCO3 ] was reduced to

5mM (Fig. 2A,B,C) compared to controls. Calu-3 cell wound closure was delayed in this media by 4.0 hours (~2-fold) (Fig. 2A,C). No significant change in cell viability was

- found after 24 hours of treatment with 5mM HCO3 in Calu-3 or NHBE cells (% Viable

- Cells: Calu-3 Control 96.5±1.4 vs. 5mM HCO3 94.1±2.0; NHBE Control 94.1±3.0 vs.

- - 5mM HCO3 92.4±2.0). This data suggests transport of HCO3 is important for Calu-3 migration, whereas Cl- transport appears to be important for NHBE migration. The results

of these ion replacement experiments suggest a mechanistic difference in the role of

CFTR between Calu-3 and NHBE cells.

A B 5000 Calu-3 10000 NHBE

4000 8000 ) ) 3000 6000   Z ( Z ( 2000 4000 Control - 1000 Control 2000 5mM HCO3 - 5mM HCO3 0 0 0 2 4 6 8 10 0 2 4 6 8 10 12 Time (Hrs) Time (Hrs) C D 7.5 15 NHBE Calu-3 * 10 * 7.0

5 6.5 Time (Hrs) Intracellular pH

0 6.0 - - - - - l l l 3 3 3 3 3 tro tro ntro CO HCO HCO Con Con Co M 5mM HCO 5mM HCO 1m 3mM 5mM H - Fig. 2 Migration in Low HCO3 Media (A) Averaged Z time course from representative experiment of Calu-3 - migration in control and 5mM HCO3 media. (B) Averaged Z time course from representative experiment of NHBE migration in control and 5mM - HCO3 media. (C) Mean time required for wound closure of NHBE and Calu-3 cells treated as in A and B. (D) Intracellular pH in Calu-3 cells - perfused with low HCO3 media. Significant difference between means

The effect of changes of extracellular pH on Calu-3 cell migration rate was then

- assessed since HCO3 transport appears to play a role in Calu-3 cell migration. For these experiments Calu-3 cells were cultured in growth media on ECIS arrays until confluent,

then serum starved for 48 hours. Calu-3 cells were then wounded and the migration rates were measured by CIS for cells treated with serum free MEM at pH 6.5 and 8.0 and compared to control (pH 7.2). EGF (1µg/ml) was included with all treatments.

Changing extracellular pH to either more acidic or more alkaline than control media had no significant effect on Calu-3 migration rate (Fig. 3). This data indicates that either Calu-3 cells are capable of tightly regulating pH at the cell membrane-extracellular matrix interface during migration, or that extracellular pH does not have a significant role in Calu-3 migration.

A B 5000 4

4000 3

) 3000  2 Z ( 2000 Control (7.2)

pH 6.5 Time (Hrs) 1000 1 pH 8.0

0 0 0 2 4 6 8 10 Control pH 6.5 pH 8.0 Time (Hrs) Fig. 3 Extracellular pH and Migration (A) Averaged Z time course of representative experiment of Calu-3 migration with control media, or media with pH 6.5 or 8.0. (B) Mean time required for wound closure of Calu-3 cells treated as in A.

- - II. Cl and HCO3 Transporters that may Cooperate with CFTR

- - Neither removing Cl nor reducing HCO3 necessarily implicates CFTR as the

transport pathway for these anions during cell migration. There are multiple transporters and exchangers that may be expressed in NHBE and Calu-3 cells that could also be

- - affected by altering the availability of Cl and HCO3 . Additionally, these transporters and

- - exchangers may be important for HCO3 and Cl transport during airway epithelial

migration in either a CFTR dependent or independent manner as described below.

+ - Candidate transporters include the anion exchangers (AEs), the Na -coupled HCO3

- - cotransporters (NBCs), and the solute carrier 26 (SLC26) Cl / HCO3 transporters (Mount

and Romero 2004; Romero et al. 2004; Alper 2009). To determine which of these are

present in Calu-3 and NHBE cells, qPCR was performed as previously described

(Chapter II) with detectable expression considered for all consistently amplified replicates with CT values below 35 cycles (specific primers shown in Table 1). The

expression levels of all three AEs, all of the NBCs except the two incompletely

characterized isoforms (Pushkin and Kurtz 2006), and the group 2 SLC26s (SLC26A 3,4 and 6) were determined.

The qPCR results revealed both Calu-3 and NHBE cells expressed multiple

transporters of each family. All three AEs were detected in Calu-3 and NHBE cells (Fig.

4A). All four NBCs were also detected in both cell lines (Fig. 4B). Interestingly, Calu-3

cells expressed a 58.7±10.4 fold higher level of NBCe1 compared to NHBE cells. The

expression level of NBCe2 was also higher in Calu-3 cells compared to NHBE cells,

although less dramatically so, by 5.2±0.1 fold. NBC expression has been previously

reported for Calu-3 cells, and NBCe1 and NBCe2 were shown to be expressed in the

basolateral membrane (Kreindler et al. 2006). SLC26A 3,4 and 6 were all detected in

NHBE cells, and all but SLC26A3 were detected in Calu-3 cells (Fig. 4C). The most abundant transporters (CT values ≤22) were SLC26A6, AE2, and NBCn1 (Fig. 4). The expression levels of these exchangers were found to be very similar between Calu-3 and

NHBE cells.

A 35 B 30 Calu-3 30 NHBE 25 * T 25 T C C * 20 20

15 15 AE1 AE2 AE3 1 E e1 e2 B BC BC BCn DC N N N N 35 C Fig. 4 Transporter and Exchanger Expression 30 Expression of exchangers and cotransporters by qPCR in Calu-3 T 25

C (black) and NHBE (white) cells. (A) Expression of anion exchangers. (B) + - 20 Expression of the Na /HCO3 cotransporters. (C) Expression of - - 15 solute carrier 26 Cl /HCO3 a6 exchangers. Significant differences 6a4 6a3 26 2 2 C in means indicated by *. L S SLC SLC

Cooperation between CFTR and the NBCs, AEs and SLC26s has been demonstrated in multiple cell types and may play a very important role in the mechanism

- - by which CFTR regulates airway epithelial cell migration. SLC26 Cl / HCO3 transporters contain a sulfate transporter and anti-sigma factor antagonist (STAS) domain which has been shown for mouse SLC26a3 and SLC26a6 to interact with the R-domain of CFTR, 50

resulting in mutual activation and increased CFTR transport activity (Ko et al. 2004;

Dorwart et al. 2008). Coupling of CFTR transport of Cl- with SLC26a6 and a3

- exchangers mediates net HCO3 efflux (Stewart et al. 2009; Singh et al. 2010). In this

way, CFTR transport of Cl- increases the availability of this ion at the binding site within

- - SLC26, facilitating Cl /HCO3 exchange (Singh et al. 2010). NBCn1 also has a PDZ

binding motif with which it binds to and is regulated by CFTR (Park et al. 2002). The

- electrogenic NBCs also cooperate with CFTR, although indirectly, by loading HCO3 for

transport by CFTR (Hug et al. 2003).

- - The effects of changes in Cl and HCO3 concentration on the transport activity

the NBCs, AEs, SLC26s and CFTR is not only dependent on the ions each transports, the

stoichiometry of transport, the ion affinity and availability, but is also affected by the

cooperation between these transporters and CFTR. The transport properties of these

exchangers and transporters, as well as how transport is affected by removing Cl- and

- lowering [HCO3 ] is described in the following sections.

a. Anion Exchangers

The AEs are electroneutral transport proteins that mediate Cl- uptake into the cell

- in exchange for HCO3 efflux with a 1:1 stoichiometry (Alper 2009). These exchangers

regulate pHi and cell volume (Romero et al. 2004; Alper 2009). Of the three exchanger

isoforms, AE2 is the most ubiquitously expressed (Pushkin and Kurtz 2006; Alper 2009).

- - Removal of Cl from the media eliminates this ion as an exchange partner for HCO3 efflux, resulting in no net exchange by AEs (Alper 2006). Similarly, since the exchange

- ratio for AEs is 1:1, lowering HCO3 to 5mM limits the availability of this ion as an

exchange partner for Cl- uptake and so would also be expected to reduce AE exchange

activity, however to a lesser extent than removing Cl-, since the inward Cl- gradient

- dominates and is present in low HCO3 media (Romero et al. 2004).

- - b. Solute Carrier 26 Cl /HCO3 exchangers

- - The group 2 SLC26 Cl /HCO3 exchangers are found in the apical membranes of

- - secretory epithelia and mediate inward Cl transport in exchange for HCO3 efflux

(Dorwart et al. 2008). As with AEs, removal of Cl- from the media would eliminate this

- ion as an exchange partner for HCO3 efflux, resulting in no net exchange (Chen and

Hwang 2008). In Cl- free media therefore, SLC26s would be unable to exchange Cl- for

- HCO3 . There is debate as to whether SLC26A6 is electrogenic with an exchange ratio of

- - 1Cl :2HCO3 , or electroneutral with a 1:1 ratio. The source of this controversy is the

inconsistent results between labs, and differences in exchange ratio with SLC26a6

(mouse) expression in oocytes versus native cells (Dorwart et al. 2008; Ohana et al.

2009). However, studies favor electroneutrality of human SLC26A6 (Chernova et al.

2005). If this is indeed the case for SCL26A6 in NHBE and Calu-3 cells, it is expected it

would have no net exchange activity in Cl- free media. SLC26A6, however, is capable of

-2 - transporting SO4 (Mount and Romero 2004) present in Cl free media; therefore it is

possible this exchanger has some activity under Cl- free conditions in Calu-3 and NHBE

- cells. As with AEs, lowering the [HCO3 ] in the media by 5-fold decreases the availability

of this ion as an exchange partner for Cl- uptake, and so would decrease the activity of

these exchangers, although to a lesser extent than removing Cl-.

+ - c. Na / HCO3 Cotransporters

+ - The NBCs are a family of Na -coupled HCO3 transporters expressed in multiple

- tissues where they are important for mediating HCO3 transport and uptake, pHi and

volume (Romero et al. 2004; Pushkin and Kurtz 2006). The NBC family consists of

+ - cotransporters of Na and HCO3 , which transport both ions inward in most cells, and a

+ - - + - Na coupled Cl / HCO3 exchanger which transports Na and HCO3 inward in exchange

for Cl- efflux (Romero et al. 2004; Alper 2006). The electrogenic NBC, NBCe1 has a

+ - - Na / HCO3 transport stoichiometry of 1:3 in the kidney, where it mediates HCO3 efflux,

- but in most other cell types it operates with a 1:2 stoichiometry and mediates HCO3

influx (Soleimani et al. 1987; Boron et al. 2009). The electrogenic NBC, NBCe2 also has

- a similar cell type specific stoichiometry and can likewise mediate HCO3 influx or efflux

(Boron et al. 2009). In Calu-3 cells, NBCe1 and 2 are expressed basolaterally and drive

- - HCO3 secretion by CFTR when Cl loading is inactive (Devor et al. 1999). The

electrogenic transport stoichiometry results in these cotransporters being inactive, or

- perhaps even mediating HCO3 efflux, when Calu-3 cells are hyperpolarized (Hug et al.

2003). Of the NBCs expressed in Calu-3 and NHBE cells, NBCn1 was the most

+ - abundant. This Na / HCO3 cotransporter is electroneutral and its activity is therefore not dependent on membrane voltage (Choi et al. 2000). Neither NBCe1 or 2, nor NBCn1

would be affected by removing Cl- ions from the media since they do not transport Cl-;

+ - - however, Calu-3 and NHBE cells were found to express the Na coupled Cl / HCO3

- - - exchanger NDCBE, which would be unable to exchange Cl for HCO3 in Cl free media.

- The 5-fold lowered [HCO3 ] in the 5mM media would limit the availability of this ion as

- an exchange partner, and since all the NBCs transport HCO3 , the transport activity of all

the expressed isoforms would be reduced in this media.

d. CFTR

- - For CFTR, removing Cl or reducing the [HCO3 ] does not directly affect the open

- - state of the ion channel, but rather forces CFTR to transport HCO3 in the absence of Cl and vice versa (Reddy and Quinton 2001; Reddy and Quinton 2003). The decreased

- activity of the NBCs in 5mM HCO3 media would be expected to exacerbate reduced

- - HCO3 transport by CFTR by reducing intracellular loading of this ion. If HCO3 transport

- by CFTR is important for cell migration, conditions in which the [HCO3 ] is lowered,

particularly in combination with inhibition of CFTR, should have a profound inhibitory effect on migration rate. Removing Cl- allows one to address whether forcing CFTR to

- - conduct solely HCO3 slows migration. Since this also inhibits the activity of the Cl /

- - HCO3 exchangers, assessing migration rate in Cl free media also allows for

- - determination of the contribution of Cl / HCO3 exchangers to the migratory process.

- - - Additionally, removing Cl provides information on the extent to which Cl /HCO3

- exchangers cooperate with CFTR since cooperation would result in net HCO3 efflux

- - which may be partially compensated for by CFTR exclusive transport of HCO3 in Cl free media. Therefore an effect on migration rate of removing Cl- ions that is not additive

- - with inhibition of CFTR would suggest cooperation between CFTR and Cl /HCO3 exchangers for airway cell migration.

Out In Out In

NBC NBC Na+ Na+ - - nHCO3 nHCO3

------HCO3 Cl /HCO3 HCO3 Cl /HCO3 Exchanger Exchanger - XCl Cl-

- - HCO3 Cl - CFTR HCO3 CFTR - - Cl Free Low HCO3

- - - Fig. 5 Cl and HCO3 Transport in Cl Free and Low HCO3 Media Intracellular (In) and extracellular (Out) space represented, with arrows indicating direction of ion movement. Arrows in front of transporter name indicate the result of the ion substitution on the activity of the transporter. Left image: ion transport in - - - - Cl free media. Under these conditions CFTR transports HCO3 , the Cl /HCO3 exchangers with 1:1 stoichiometries are inactive, and the NBCs (except NDCBE) - are unaffected. Right image: ion transport in low HCO3 media. Under these - - - conditions CFTR transports mainly Cl , and the activity of the Cl /HCO3 exchangers and the NBCs is also reduced.

III. Measurement of Migration with Inhibition of Multiple Transporters and CFTR

To clarify the roles of the NBCs, SLC26s, AEs and CFTR in NHBE and Calu-3 cell migration, the migration rates of airway epithelial cells were measured by CIS under

- - Cl free and low [HCO3 ] conditions with CFTR inhibited, with the exchangers and transporters inhibited, or with both inhibited. For these experiments, CFTR was inhibited with the selective inhibitor CFTRinh-172 at the same concentrations used for lamellipodia and other CIS studies: 30µM for Calu-3 cells and 20µM for NHBE cells. To inhibit Cl-

- /HCO3 exchange and NBCs, the selective inhibitor 4,4′-Diisothiocyanato-stilbene-2,2′-

- - disulfonic acid disodium salt hydrate (DIDS) was used. DIDS inhibits Cl /HCO3 55

exchange and the electrogenic NBCs, but does not inhibit CFTR (Mount and Romero

2004; Romero et al. 2004). For these experiments DIDS concentrations of 30µM and

40µM were used in NHBE and Calu-3 cells, respectively. The concentrations used were

the maximum for each cell type that resulted in no significant change in cell viability

compared to controls over the 24 hour treatment period (Fig. 6). Control media was either

- - the normal Cl or normal HCO3 reconstituted MEM described above (Section I), and was

serum free. All Calu-3 treatments additionally contained 1µg/ml EGF.

100 Calu-3 NHBE

90 Fig. 6 Viability with DIDS Treatment 80 Percent viable cells 70 following 24 hour treatment of Calu-3

Percent Viable 60 and NHBE cells with DIDS, or control 50 (DMSO). S S rol ID ID D ontrol D Cont M C M   0 40 3

Results of CIS experiments revealed that Calu-3 cells did not migrate slower in

- - Cl free media, and treatment with CFTRinh-172 in Cl free media slowed the rate of Calu-

3 migration by 4.8 hours (2.4-fold) compared to controls (SF MEM with DMSO+1µg/ml

- EGF) (Fig. 7A). This data indicates CFTR is active in Cl free media since CFTRinh-172

was effective in Cl- free conditions. Further, there was no significant difference in Calu-3

cell migration rate whether CFTR was inhibited in Cl- free media or inhibited in control

- - - media. This suggests that either CFTR compensates for Cl /HCO3 exchange in Cl free

- - media, or that Cl /HCO3 exchange does not significantly contribute to Calu-3 cell

migration.

A BC Calu-3 NHBE 12000 NHBE 12 a 20 10000 10 a 15 8000 8 )

6 10  6000 Z ( 4 4000 Time (Hrs) Time (Hrs) 5 * 2 2000 Control Cl- Free +172 0 0 0 l 2 l 2 2 o 7 o 7 tr 1 tr 17 0 5 10 15 n - Free n Free Co Cl Co Cl Time (Hrs) Free + 1 Cl- Free +172 Cl Fig. 7 Inhibition of CFTR in Cl- Free Media (A) Average time required for wound closure of Calu-3 cells with control media, Cl- free media, 30µM 172, or Cl- free+ 30µM 172. (B) Average time required for wound closure of NHBE cells with control media, Cl- free media, 20µM 172, or Cl- free+ 20µM 172. Significant differences between means indicated by a and *. (C) Averaged time course from representative experiment of NHBE wound closure in control media or Cl- free media+20µM 172.

NHBE cells, however, migrated slower in Cl- free media than control media (Fig.

- 7B,C), but treatment with CFTRinh-172 in Cl free media did not significantly further

slow NHBE migration compared to Cl- free media only. Additionally, inhibition of CFTR

- with CFTRinh-172 slowed migration to the same extent as replacing Cl in the media.

Together these data suggest that CFTR transport of Cl- regulates NHBE cell migration,

- - and that Cl /HCO3 exchange may also play a role.

- Lowering the [HCO3 ] ~5-fold to 5mM only significantly slowed Calu-3 cell

- migration compared to controls (Fig. 2A,C and 8A,B). Although lowering the [HCO3 ] did not significantly affect NHBE cell migration, there was a trend seen for slower

- migration in this media, and in 3 of the 12 wells treated with 5mM HCO3 and CFTRinh-

- 172, wound closure was incomplete over 24 hours. Therefore, HCO3 transport may have

- a minor role in NHBE cell migration as well. The effect of lowering the [HCO3 ] on

Calu-3 cell migration was equal in magnitude to inhibition of CFTR. However, inhibition

- of CFTR with CFTRinh-172 in 5mM HCO3 media abolished wound closure in 11 of 14 wells treated in this manner, and was incomplete in the other 3 wells (Fig. 8A,B). No significant change in viability occurred with this treatment indicating cells were viable but cell migration was inhibited (Fig. 8C). Together, this data suggests that CFTR is

- - active in 5mM HCO3 media, and that lowering the [HCO3 ] has additional effects on cell migration independent of CFTR in Calu-3 cells.

- - Inhibition of Cl /HCO3 exchange and NBC activity with DIDS slowed both Calu-

3 and NHBE cell migration by 3.6 and 3.5 hours (≥1.7-fold) respectively, compared to controls (Fig. 9). Treatment of NHBE cells with DIDS and CFTRinh-172 did not significantly change migration rates compared to CFTRinh-172 treatment alone (Fig.

- - 9B,D. This data suggests that Cl /HCO3 exchange and/or NBC activity plays a role in

NHBE migration in a CFTR dependent manner. In contrast, treatment of Calu-3 cells with DIDS and CFTRinh-172 slowed migration by >2-fold compared to either DIDS or

CFTRinh-172 treatments alone (Fig. 9A,C). This data suggests that while some of the role

- - of CFTR in Calu-3 migration may be Cl /HCO3 exchange and/or NBC activity dependent, that these transporters also have a role in migration independent of CFTR.

A B Control 20 NHBE Calu-3 5mM HCO - 5000 3- 5mM HCO3 +172 15 * 4000 * a 10 a ) 3000  Time (Hrs) Z ( 2000 5 b 1000 NC 0 - - 3 3 0 O 172 O 172 - +172 - +172 0 2 4 6 8 10 HC Control 3 Control O 3 CO Time (Hrs) 5mM HC H 5mM HC M C 5m 5mM Control - 100 Fig. 8 Inhibition of CFTR and Low HCO3 5mM HCO3- +30M 172 (A) Averaged Z time course during wound 90 closure from representative experiment of Calu-3 cells treated with control media, 5mM - - 80 HCO3 , or 5mM HCO3 +CFTRinh-172. (B) Mean time required for wound closure of Calu-3 and NHBE cells treated with control 70 - media, 5mM HCO3 , CFTRinh-172, or both. (C)

Percent Viable Calu-3 cell viability after 24 hours of treatment 60 - with 5mM HCO3 +CFTRinh-172 compared to controls. 50

A B 6000 Calu-3 10000 NHBE

5000 8000 4000 ) ) 6000   3000 Z ( Z ( 4000 Control 2000 Control DIDS +172 DIDS+172 1000 172 2000 172

0 0 0 5 10 15 20 0 5 10 15 20 C Time (Hrs) D 20 20 b b 15 15 b a a 10 a 10 Time (Hrs) Time (Hrs) 5 5

0 0 l S 2 72 72 ro 17 trol 1 1 nt n DIDS o DID Co C DIDS+ DIDS +172 Fig.9 Migration with DIDS (A) Averaged Z time course of Calu-3 cell wound closure from representative experiment of cells treated with control (veh), DIDS (40µM)+172 (30µM) or 172 (30µM). (B) Averaged Z time course of NHBE cell wound closure from representative experiment of cells treated with control (veh), DIDS (30µM)+172 (20µM) or 172. (C) Mean time required for wound closure of Calu-3 cells treated as in A, and with DIDS (40µM). (D) Mean time required for wound closure of NHBE cells treated as in B, and with DIDS (30µM). Significant difference between means indicated by a and b, with a significantly different from b.

IV. Conclusions

The reduction of NHBE cell migration rate in Cl- free media, and the lack of a

- - significant effect of lowering the [HCO3 ] suggest CFTR transport of Cl is important for

migration of these cells. The migration rate of NHBE cells in Cl- free media was not

significantly affected by inhibition of CFTR, and both treatments slowed migration to the

- same extent. This data suggests that both the Cl free and the CFTRinh-172 effect on

NHBE migration are due to inhibition of CFTR transport of Cl-. The finding that

- - treatment with DIDS slows NHBE cell migration supports a role for Cl /HCO3 exchange

in migration. Further, the effect of DIDS on NHBE migration rate was not additive with

- - inhibition of CFTR, suggesting that CFTR and Cl /HCO3 exchange activity are tightly

coupled during NHBE cell migration.

- Although the lack of a significant effect of low [HCO3 ] on NHBE migration

seems to suggest transport of this ion has a minor role in NHBE cell migration, lowering

- - - - HCO3 does not reduce Cl /HCO3 exchange activity to the same extent as removing Cl .

- - - The Cl gradient is unaffected by lowering HCO3 , and by coupling with Cl conducting

- - - CFTR, Cl /HCO3 exchange activity may not be dramatically different in low [HCO3 ]

- media. Further, 3 of the 12 wells treated with 5mM HCO3 and CFTRinh-172 failed to

completely close wounds over the 24 hour treatment period. Together these data suggest

- - - that CFTR conducts Cl during NHBE cell migration, and couples with Cl /HCO3 exchangers. CFTR transport of Cl- seems to be the main ionic basis of CFTR regulation

- of NHBE cell migration. However, the net HCO3 efflux that would result from coupling

- - of CFTR with Cl /HCO3 exchangers also appears to contribute to the ionic mechanism of

CFTR regulation of NHBE migration.

In contrast, the ionic mechanism of CFTR regulation of Calu-3 migration appears

- - to be mainly HCO3 dependent. Lowering the [HCO3 ] to 5mM slowed Calu-3 cell

migration. Calu-3 migration was also unaffected by removing Cl- from the media. This

finding is particularly significant since under these conditions CFTR can only transport

- HCO3 and since this did not slow Calu-3 migration, it is strong evidence that transport of

- HCO3 by CFTR is important for Calu-3 cell migration. Additionally wound closure was

- abolished by inhibition of CFTR in 5mM HCO3 media.

DIDS slowed Calu-3 migration rate to the same extent as inhibition of CFTR.

- + - The DIDS and HCO3 dependence of Calu-3 cell migration suggests that Na / HCO3

cotransport plays a role in Calu-3 cell migration. Further, Calu-3 cells express much

+ - higher levels of the electrogenic Na / HCO3 cotransporters than NHBE cells, especially

- + NBCe1. Since these transporters move multiple HCO3 ions per Na ion, they are very

- efficient for loading intracellular HCO3 . The additive effect of DIDS and CFTR

+ - inhibition suggests that Na /HCO3 cotransport may have both CFTR dependent and

independent roles in Calu-3 cell migration. This difference may reflect different CFTR

coupling between the NBC isoforms. DIDS does not inhibit the electroneutral NBC,

NBCn1 (Romero et al. 2004), which is the most highly expressed NBC in Calu-3 cells.

- Therefore, tight coupling between NBCn1 and CFTR for HCO3 efflux during migration

would still produce an additive effect of DIDS with CFTRinh-172 treatment if the

electrogenic NBCs have both CFTR dependent and independent roles in migration.

Although the Cl- free data appears to indicate Cl- transport is not important for

- - - migration of Calu-3 cells, some role of Cl /HCO3 exchange cannot be ruled out. In Cl

- free media Calu-3 cells can still load HCO3 into the cell since the activity of NBCs is

unaffected by Cl- removal. Also, in this media Cl- ions are not available to compete with

- - HCO3 ions for CFTR, and so CFTR transports HCO3 exclusively and more efficiently than with competing Cl- ions present (especially considering the selectivity ratio of Cl:

- HCO3 of between 4 and 6 to 1). This, coupled with the very high expression of CFTR in

- - Calu-3 cells may be able to compensate for the lack of Cl /HCO3 exchange activity under

- - - Cl free conditions. It is therefore possible that in control media, Cl /HCO3 exchange

- activity contributes to net HCO3 efflux. The DIDS sensitivity of Calu-3 cell migration

- - supports this, and CFTR independent activity of Cl /HCO3 exchange may be an additional reason why inhibition of CFTR is additive with DIDS for reduced Calu-3 migration.

- One argument against a role for HCO3 transport in Calu-3 cell migration is that

- lowering HCO3 may affect other cellular processes unrelated to ion transport. However,

- pHi did not change in Calu-3 cells due to perfusion with 5mM HCO3 media, and all

migration experiments were performed with CO2 gassing so carbonic anhydrase activity

- could generate intracellular HCO3 ions (Boron 2010). More importantly, if the effect of

- lowering HCO3 on migration was due to non-transport specific changes in cell function,

- NHBE should also have displayed HCO3 dependent migration. Additionally, no changes

- in cell viability were found with 5mM HCO3 treatment of either Calu-3 or NHBE cells

over the entire 24 hour treatment period. Therefore, non-transport related effects of the

- low [HCO3 ] treatments are unlikely.

The studies described here demonstrate the ionic dependence of Calu-3 and

NHBE cells for migration. This further supports the findings described in the previous

chapter identifying ion transport as the mechanism by which CFTR regulates airway

epithelial cell migration. Additionally, the ion substitution and selective inhibitor studies described here provide likely ionic mechanisms not only for the role of CFTR in Calu-3 and NHBE cell migration, but also identify possible roles for cooperating transporters and exchangers. These studies do not reveal a mechanism of how ion transport by CFTR regulates airway epithelial cell migration. However, combined with what is known about ion channels in cell migration, a model can be developed that fits the data described here and provides a mechanism for the role of CFTR in airway epithelial cell migration. This model is the subject of the following chapter.

Primer Sequence (5'-3') AE1 F ACTTATTCACGGGCATC AE1 R CACAGTGAGGATGAGGA AE2 F TGTGGAGCTGAATGAGT AE2 R AGTCTCCTCCTCCACGT AE3 F ATAAGCGCTCGTGGTTC AE3 R GCCTTCTGGCTGACGAT SLC26A3 F GGAGTACTGCCCTCTCC SLC26A3 R GGCTAGAACGACAATCA SLC26A4 F TCTCGTATCCAGCAGCA SLC26A4 R CTGCAAGCCACCAAATA SLC26A6 F CAACGTTGAGGACTGCA SLC26A6 R CCTTCAGTGTGGACCCA NBCe1 F CTCAGCTTCCTGGATGA NBCe1 R AGGTTGCTGTTCCATGAT NBCe2 F TACCTCGGCTGTATCAC NBCe2 R GCTGCTGAGAATGATGA NBCn1 F CAGTCTGCTCCTGGAAA NBCn1 R TGCTTCCACCACTTCCAT NDCBE F TTGCCACATAGAACAGG NDCBE R GCTGAGTGCATCTCGGT

Table 1. Primers Used for qPCR Primers of transporters and exchangers used for qPCR.

Chapter IV

Discussion

I. Model of the Role of CFTR in Airway Epithelial Cell Migration

The ion substitution and selective inhibitor studies described in the previous chapter provide likely ionic mechanisms for the role of CFTR in Calu-3 and NHBE cell migration, as well as identify possible roles for cooperating transporters and exchangers.

- In Calu-3 cells migration is largely HCO3 dependent, and DIDS treatment and CFTR

inhibition studies further suggest that the NBCs play a role in migration. NHBE cell

migration is largely Cl- dependent, and the DIDS and CFTR inhibition studies with this

- - - cell line revealed Cl transport by CFTR seems to play a role in migration, and Cl / HCO3

exchange may cooperate with CFTR. For both NHBE and Calu-3 cells, inhibition of

CFTR delayed the onset of lamellipodia protrusion indicating CFTR plays a role in

lamellipodia protrusion.

The putative model (Fig. 1) shows how CFTR may function in NHBE and Calu-3

cells to affect lamellipodia protrusion during cell migration. In Calu-3 cells, transport of

- HCO3 by CFTR localized to the lamellipodium may drive protrusion of this structure by

sustaining the activity of NHE. NHE1 has been shown to be essential for lateral

polarization to the migratory phenotype, and protrusion of the lamellipodium during

migration for multiple cell types (Chapter I-Section IV). Alkaline pHi inactivates NHE

activity (Slepkov et al. 2007); therefore, colocalization of NHE and CFTR at lamellipodia

- and HCO3 efflux there by CFTR may be important for sustaining the activity of NHE

during lamellipodia protrusion. The effect of CFTR on lamellipodia protrusion could also

be indirect. The delay in the onset of lamellipodia protrusion measured with CFTR

inhibition and silencing may reflect a delay in polarization to the migratory phenotype.

- Since NHE1 is critical for both processes, the role of HCO3 transport by CFTR in

migration may also be to sustain NHE activity for polarization to the migratory

phenotype rather than a direct role in protrusion.

- CFTR transport of HCO3 may also play a role in adhesion during migration.

- HCO3 efflux would presumably be an important contributor to the development of an

adhesion gradient that promotes tight adherence of the lamellipodium for effective

transfer of the force of movement to the substrate, and to weaken adhesion at the rear of

the cell facilitating retraction. This pH gradient has been described for melanoma cells

and is dependent on NHE activity (Chapter I -Section IV). CFTR may therefore

cooperate with NHE to modulate pHe during migration for optimal adhesion. If this is

indeed the mechanism by which CFTR exerts its effects on cell migration, the change in pHe would likely be modulated at the cell membrane-substrate interface, since bulk

changes in pHe did not affect migration rate (Chapter III, Fig. 3).

Ion substitution and selective inhibitor studies with Calu-3 cells could not rule out

- - - a potential role for Cl /HCO3 exchangers in these cells. CFTR may transport some Cl

- - even under HCO3 loading conditions due to the higher selectivity of the channel for Cl .

- - - Therefore CFTR may cooperate with Cl /HCO3 exchangers for net HCO3 secretion in

- addition to serving as a direct pathway for HCO3 efflux (Fig. 1).

Protrusion H2O Na+ H+ - Calu-3 HCO3 Cells Actin Cl- Cl- - HCO3 + - Na nHCO3

+ Protrusion K Channel AQP AQP NHE CFTR

- - CFTR Cl /HCO3 Exchanger Retraction NBC

+ + K H2O Na H+ H2O NHBE HCO3

- Cells - Cl Actin Cl Cl- - HCO3 Retraction Protrusion

Fig. 1 Putative Model of the Role of CFTR in Airway Epithelial Cell Migration Middle two panels depict the channels and transporters shown by previous studies to play a role in lamellipodia protrusion (right) and retraction (left) of the rear of the cell. Putative localization of - - CFTR, NBC, and Cl /HCO3 exchangers also shown. Uppermost panel depicts the putative role of CFTR in Calu-3 cells. Bottom 2 panels depict the putative roles of CFTR in NHBE cells. See text for details. 68

In NHBE cells, transport of Cl- by CFTR may be important for retraction of the rear of the cell (Fig. 1). Localization of CFTR mediated Cl- transport to the rear of the

cell, in cooperation with K+ channels and AQPs, would result in a volume decrease

- - facilitating retraction. However, the apparent cooperation between CFTR and Cl /HCO3

exchange suggested by the results of the CFTR inhibition and DIDS treatment

experiments indicate a likely role in lamellipodia protrusion. At the lamellipodium,

- - - - CFTR transport of Cl in cooperation with Cl /HCO3 exchangers results in net HCO3

efflux (Fig. 1) which may be important for maintaining the activity of NHE and/or

modulating pHe for optimal adhesion. This is analogous to the proposed model for CFTR

- - - in Calu-3 cells except that HCO3 efflux by Cl /HCO3 exchange would be dependent on

CFTR recycling of Cl-.

It is also possible that in NHBE cells, CFTR transport of Cl- is inward rather than

outward. A previous study in corneal epithelial cells revealed that following wounding,

migrating cells have a depolarized membrane voltage (Chifflet et. al 2005). If NHBE

cells also depolarize during migration, the transport of Cl- by CFTR would be inward,

and could mediate volume increase at the lamellipodia in cooperation with NHE and

AQPs to facilitate protrusion.

One potential complication to the interpretation of the role of CFTR in cell migration is the mechanism of inhibition by CFTRinh-172. Since this inhibitor stabilizes

the channel in the closed state (Chapter II), it is possible it induces a conformation change in CFTR that interferes with its ability to bind scaffolding proteins, resulting in altered migration. To date, no studies have described changes in CFTR conformation or non-transport related effects of CFTRinh-172 on CFTR. Additionally, the studies with

- - NHBE and Calu-3 cell migration in Cl free and low [HCO3 ] media indicate that ion

transport by CFTR is the mechanism by which CFTR exerts its effects on migration.

- Lowering the [HCO3 ] slowed Calu-3 migration to the same extent as inhibition of CFTR

- with CFTRinh-172, and removing Cl slowed NHBE cell migration to the same extent as

inhibition of CFTR. These data indicate that the effect of CFTRinh-172 on Calu-3 and

NHBE cell migration is through inhibition of ion transport and not by interfering with intracellular signaling by CFTR. Additionally, the effect of CFTRinh-172 treatment on

migration is selective for CFTR at the doses used in these experiments since the

compound had no effect on the migration rate of CFTR silenced Calu-3 cells.

- - The difference in ion transport mechanism by CFTR (Cl versus HCO3 transport)

between Calu-3 and NHBE cells may result from a difference in the way CFTR couples

to cooperating exchangers and transporters in the two cell types. This may be due to

differences in expression of scaffold proteins, such as the Na+/H+ exchanger regulatory

- - factor (NHERF) which scaffolds the SLC26 Cl /HCO3 exchanger to CFTR (Naren et al.

2003), or differences in localization of the scaffold proteins or transporters between the

two cell lines.

II. Future experiments

The putative model depicted in Fig. 1 is supported by the results described here, as well as previous studies using other epithelial cells. However, a number of additional studies are necessary to verify the model. First, NBCe1 and 2 could be silenced in Calu-3 cells by expression of specific shRNA. Measuring migration rates of these cells

compared to control shRNA expressing Calu-3 cells would indicate the contribution of

these cotransporters to Calu-3 cell migration. Silencing of NBCe1 and 2 in NHBE cells would be expected to have little effect on migration rate, a finding which would rule these cotransporters out as potential contributors to NHBE cell migration. Additionally,

CFTR could be silenced in NHBE cells to verify that CFTRinh-172 treatment is equal in

magnitude to the loss of CFTR expression, and also to test the specificity of CFTRinh-172

by treating CFTR silenced NHBE cells. CFTR silenced Calu-3 cells could also be treated

- with low [HCO3 ] media and the migration rate measured. Since inhibition of CFTR in

- low [HCO3 ] media abolished Calu-3 cell wound closure over 24 hours, the same would

- be expected for migration of shCFTR Calu-3 cells in low [HCO3 ] media.

a. Localization of CFTR and Other Transporters Involved in Migration

One experiment in particular would give a lot of information on the verity of the model in Fig.1 and would provide insight into coupling between CFTR and cooperating

- - transporters/exchangers. This experiment is localization of CFTR, NBCs, Cl /HCO3 exchangers and NHE1 in migrating cells by immunocytochemistry. For these experiments Calu-3 and NHBE cells would be cultured to confluence and wounded on glass chamber slides to allow for the use of high magnification fluorescent objectives to visualize localization. Wounding with the blunt end of a microforceps was used for the lamellipodia morphology studies, and after 45 minutes to 1 hour in control SF media,

NHBE and Calu-3 cells (respectively) had polarized to the migratory phenotype indicated by the presence of large broad lamellipodia (Chapter II-Section V).

Labeling migrating bronchial epithelial cells with antibodies specific for CFTR,

- - NBCs, Cl /HCO3 exchangers and NHE1, followed by detection with fluorescent marker

tagged secondary antibodies may yield valuable information on the role of CFTR- mediated transport in Calu-3 and NHBE cell migration. First, identification of

transporters and exchangers by fluorescent immunocytochemistry in migrating cells

would provide evidence that these proteins are present at the cell surface of migrating

cells, and would support the qPCR data identifying isoforms present based on mRNA

(Chapter III-Section II). Second, localization of these channels and transporters to the

lamellipodium would suggest they are important in the protrusion of this structure. This

would complement the studies demonstrating that inhibition or silencing of CFTR in

airway epithelial cells delays lamellipodia protrusion (Chapter II, Section 5).

Localization of NHE1 and aquaporins to lamellipodia has been identified in multiple cell

types and the importance of these proteins in lamellipodia protrusion has been clearly

identified (Papadopoulos et al. 2008) (Chapter I). Additionally, localization to other cell

structures such as the retracting rear of the cell or focal adhesions would suggest a role in

retraction or adhesion during migration. NHE1 has been shown to colocalize in this way

with focal adhesion complexes (Grinstein et al. 1993), and AE2 has been shown to

localize to the leading edge of migrating kidney epithelial cells (Klein et al. 2000).

- - Finally, colocalization of exchangers such as Cl /HCO3 exchangers with CFTR may

suggest direct coupling, whereas if these exchangers localize to other areas of migrating

cells where CFTR is not significantly present, it would indicate direct coupling is not

likely.

b. Measurement and Identification of Ions Transported During Migration

- - The experiments involving low HCO3 and Cl free media demonstrated the

importance of these ions in cell migration. Studies utilizing selective inhibition of CFTR

and transporters and exchangers involved in transport of these ions supported their role in

migration. However, none of these studies directly measured whether CFTR transports

- - Cl or HCO3 during migration of NHBE and Calu-3 cells. One approach that could be used for these measurements involves the use of ion selective self-referencing microelectrodes.

Self-referencing microelectrodes function to sense the diffusion gradient of ions just outside the cell membrane. Active ion transport and respiration result in shallow gradients of ions and molecules near the cell membrane (Land et al. 1999; Smith et al.

1999). Movement of a self-referencing microelectrode through this gradient while measuring the change in ion concentration at a point near the cell membrane compared to several microns away allows for sensitive measurements of the magnitude and direction of ion transport of single cells (Smith et al. 2007; Smith and Trimarchi 2001). Utilizing an ion selective self-referencing microelectrode allows for these measurements to be made for specific ions of interest, including H+ and Cl- (Smith and Trimarchi 2001).

Further, this technique is non-invasive since it does not require contact with the cell

membrane or alterations of intracellular or extracellular solutions, and allows for repeated

measurements on intact cells (Smith et al. 1999; Smith and Trimarchi 2001).

Measurement of Cl- transport from individual fetal lung epithelial cells has been

demonstrated using a self-referencing Cl- selective microelectrode (Smith et al. 2007).

Using this technique, measurements of Cl- flux were made following treatment with

agonists or channel inhibitors (Land and Collett 2001). Additionally, these measurements

could be made from single cells within a monolayer, and the close positioning of the

microelectrode (within 1µm of the membrane) allowed for localization to specific cell

sites (Land et al. 1999). The activity of V-type H+ pumps was measured using H+ selective microelectrodes in epithelial cells located within sections of human vas deferens

(Breton et al. 1998). This type of microelectrode was also used to determine the role of

- - + - Cl /HCO3 exchange in H transport in these cells (Breton et al. 1996). Therefore the Cl and H+ selective microelectrodes combined with self-referencing technology have ideal

characteristics to measure ion transport by CFTR in migrating airway epithelial cells.

To perform current measurements using self-referencing microelectrodes requires

specialized equipment and expertise. The BioCurrents Research Center in the Marine

Biological Laboratory in Woods Hole, MA, is directed and staffed by the developers of

this technology, and is a national resource of the NIH. This research center is available

for researchers to conduct these experiments. Utilizing self-referencing microelectrodes,

measurements of Cl- flux and pH (using the H+ ion selective microelectrode) could be

performed using migrating NHBE and Calu-3 cells. Although using these electrodes will

- + not measure HCO3 transport directly, by measuring changes in H availability, the

- direction and magnitude of HCO3 transport can be determined.

For these experiments, monolayers of NHBE and Calu-3 cells would be wounded as described for the lamellipodia experiments. Once cells have adopted the migratory

phenotype (indicated by the presence of lamellipodia), measurements of Cl- and pH

would be performed. Treatment of the cells with CFTRinh-172 to inhibit CFTR, and

comparison of shCFTR and ALTR expressing Calu-3 and NHBE cells would allow for a

determination of the CFTR specific contribution to Cl- transport and extracellular pH.

Additionally, the results of the immunocytochemistry localization studies would aid these experiments by identifying where CFTR is localized during migration. For example, if

CFTR localizes to the lamellipodium, the microelectrode would be positioned there, and the ion transported by CFTR during migration could be measured. Similarly, the microelectrode could be positioned away from the lamellipodium, toward the rear of the cell to determine if CFTR transport is playing a role at this structure. Treatment with

- - DIDS would allow for specific measurements of NBC and Cl /HCO3 exchange activity if the localization of these transporters was known from the localization studies.

Utilization of the self-referencing ion selective microelectrodes would reveal the transport activity during migration at specific cell sites such as the lamellipodium or the rear of cells. Few studies of the role of ion channels in cell migration have been performed in such a way that the contribution of ion transport could be directly assessed in migrating cells. Together with the localization study, measurement of transport using microelectrodes would provide novel mechanistic information on the role of CFTR in airway epithelial cell migration.

c. Migration of CF Airway Epithelial Cells in Vitro and in Vivo

Loss of CFTR function in NHBE and Calu-3 airway epithelial cells reduced the rate of migration. Additionally the UNCCF1T airway epithelial cell line isolated from a

CF patient migrated more slowly than NHBE cells under identical treatment conditions.

These studies suggest that expression of the ΔF508 CFTR mutation, which results in the loss of functional CFTR at the cell membrane, slows cell migration. The proliferation

rates of airway epithelial cells from CF patients have been investigated previously but

were not matched for CFTR mutant genotype (Hajj et al. 2007). Additionally, airway

epithelial cells isolated from CF lungs at the time of transplant or patient death have been

exposed to years of inflammatory damage and airway infection and likely express very

different protein expression profiles. Therefore, differences in migration and proliferation

rates between these cells and cells isolated from a healthy human lung could easily be

explained by differences other than expression of mutant CFTR. In order to directly test

the effect of expression of ΔF508 CFTR on airway epithelial cell migration, CFTR (wild

type) expression should be rescued in a regulatable fashion.

For this experiment the ideal cell line would be an immortalized homozygous

ΔF508 CFTR airway epithelial cell line such as CFBE41o-. This cell line was isolated

from the bronchus of a CF patient, and forms high resistance monolayers so it can be

used for direct measurements of ion transport activity (Gruenert et al. 2004). Expression

of wild type CFTR could be restored in these cells by transfection with a vector

containing wild type CFTR driven by a regulatable promoter. The Tet-On expression

system is commercially available (Clonetech) and contains a CMV promoter with a

tetracycline response element (TRE) that drives the expression of a gene of interest when

expressing cells are treated with tetracycline (doxycycline) (Stebbins et al. 2001).

Withdrawal from doxycycline causes repression of expression (Stebbins et al. 2001).

To determine the effect of the ΔF508 CFTR mutation on airway epithelial cell migration, the CFBE41o- CF cells would be transfected with the Tet-on vector containing

wild type CFTR. The migration rate of CFTR transfected (doxycycline treated)

CFBE41o- cells would then be compared to transfected cells not treated with

doxycycline. To ensure doxycycline has no effect on migration, non-transfected

CFBE41o- cells would be treated with doxycycline so the migration rate can be compared

to non-transfected CFBE41o- cells treated with vehicle.

If expression of ΔF508 CFTR slows airway epithelial cell migration, expression

of wild type CFTR should enhance cell migration rate. Treatment of non-transfected cells with doxycycline should not affect migration rates. Further, withdrawal from doxycycline and subsequent loss of wild type CFTR expression should return rescued cells to the slower migration rate of non-transfected ΔF508 CFTR expressing cells.

In order to extend these in vitro studies in vivo, wound repair could be measured

in an animal model of CF. Mice are poor animal models of CF because they lack airway

phenotype, due to expression of alternative Cl- channels and differences in CFTR

expression patterns in murine airways compared to human (Grubb and Boucher 1999).

The expression pattern of CFTR in the porcine lung is similar to the human lung, and

recently a porcine CFTR-/- model was developed (Welsh et al. 2009). This model is promising for CF disease research because animal models, unlike human studies, allow for wound healing to be assessed in the presence of experimentally defined infection, or in the absence of infection by maintaining animals under sterile conditions. Although this model is not available commercially, nor has the extent of the airway disease been characterized, it may be a promising model for future investigations of the role of CFTR in airway wound repair in vivo.

d. Modulation of Airway Epithelial Cell Migration Rates by Cytokines and Infection

In CF, airway colonization and massive neutrophil infiltration lead to elevated

levels of cytokines and chemokines in the airways (Jacquot et al. 2008). Elevated

production of cytokines and chemokines may occur in CF lungs even before infection

(Jacquot et al. 2008). High levels of IL-8 are found in the airways of CF infants prior to

the development of chronic infection (Khan et al. 1995). Numerous studies have also

demonstrated constitutive activation of NF-κB, and enhanced secretion of IL-8 in

multiple CF airway primary and immortalized cell lines (DiMango et al. 1998;

Venkatakrishnan et al. 2000; Eidelman et al. 2001; Kube et al. 2001; Carrabino et al.

2006). The levels of IL-8 were also found to be higher in bronchoalveolar lavage fluid

(BALF) from CF patients (with infected airways) compared to healthy controls (Bonfield

et al. 1995). Airway infection with P. aeruginosa is associated with a predominant Th2

immune response in CF patients (Hartl et al. 2006). The levels of Th2 cytokines IL-4 and

IL-13 are enhanced in BALF of CF patients infected with P. aeruginosa (Hartl et al.

2006). Since wound repair in CF lungs occurs in an environment of inflammatory

mediators, the effect of the loss of CFTR function on wound repair may be modulated by

these chemokines and cytokines.

To investigate the role of cytokines relevant in CF infection, airway epithelial cell

migration rates of Calu-3 and NHBE cells could be measured following pre-treatment

with Th2 cytokines IL-4 and IL-13, as well as IL-8. The viability of epithelial cells would

also be assessed and only cytokine treatments that do not induce apoptosis would be used

for migration studies, since decreased cell viability may extend wound closure time in a migration independent manner. The purpose of utilizing wild type NHBE and Calu-3

cells for investigating the role of these cytokines in migration is to identify whether they

alter the migration rates of airway epithelial cells. The effect of cytokine pretreatment on

CFTR silenced and inhibited NHBE and Calu-3 cells could also be investigated to assess

whether these cytokines modulate the effect of the loss of functional CFTR on migration.

The studies described in Chapter II demonstrated that CFTR plays a role in cell

migration, and that inhibition or silencing of CFTR slows the rate of migration by ≥2.6-

fold. In the airways of a CF patient, the effect of the loss of CFTR expression on migration rates may be exacerbated by the inflammatory mediators present. Therefore,

measuring the migration rates of CFTR silenced and inhibited airway epithelial cells

gives a more complete picture of the wound closure occurring in CF airways.

A previous study demonstrated treatment of Calu-3 cells with the Th2 cytokines

IL-4 and IL-13 slowed wound repair in a scratch assay, and disrupted the integrity of the

epithelial barrier through reduced expression of tight junction proteins ZO-1 and

occludin, resulting in decreased transepithelial resistance (Ahdieh et al. 2001).

Pretreatment of Calu-3 and NHBE cells with these cytokines would be expected to slow

migration rates measured by CIS, and may further lengthen the time required for wound

closure to occur when CFTR is inhibited or silenced. Analysis of changes in gene

expression over time during wound repair of a humanized xenograft airway model

revealed high levels of IL-8 expression during the migration and proliferation phases of

wound repair, which decreased during the later stages of repair (pseudostratification)

(Coraux et al. 2005). This suggests that IL-8 treatment may enhance Calu-3 and NHBE

cell migration rates. Further, if silencing CFTR produces an increase in IL-8 production

by Calu-3 cells, the effect of the loss of CFTR expression of cell migration rate may be somewhat rescued by the increase in IL-8 production.

In addition to promoting the secretion of cytokines, infection of airways by P. aeruginosa causes damage to the airway epithelium (Chapter I). Additionally, binding of P. aeruginosa by migrating and repairing airway epithelium is enhanced compared to non-repairing airway epithelial cells (de Bentzmann et al. 1996; Plotkowski et al. 2001).

In order to test the hypothesis that impairing migration increases the susceptibility of the airway epithelium to damage induced by infection, the susceptibility of airway epithelial cells to cytotoxicity of P. aeruginosa could be assessed.

When corneal and renal epithelial cells are infected in vitro with the P. aeruginosa isolate serogroup O11, 6026, only very small foci of cytotoxicity occur unless tight junctions and cell polarity are altered (Fleiszig et al. 1997). To test whether wounding enhances the cytotoxicity of this P. aeruginosa strain in airway epithelial cells,

Calu-3 and NHBE cells would be grown to confluence on 8W10E ECIS arrays and wounded. These arrays contain 10 electrodes per well and allow for the production of 10 wounds simultaneously per well of the 8-well array. To assess cytotoxicity, the cells would be stained with trypan blue as used in viability assays (Ch. 2 and 3) at multiple time points following wounding and infection with P. aeruginosa. Additionally, the size of the wounds should be measured by monitoring Z, and by phase contrast microscopy at multiple time points following wounding and infection with P. aeruginosa to determine if the wound size is changing.

The susceptibility of wounded airway epithelial cells to cytotoxic P. aeruginosa is expected to be increased compared to non-wounded cells. This is because cells at the

leading edge of the wound have lost their cell contacts and their polarity is altered due to

transition to the migratory phenotype (Chapter I). Therefore, the cells at the leading

edge are expected to be undergoing a cytotoxic response to P. aeruginosa, and wounds

may increase in size over time as leading edge cells die. Additionally, treatments that

result in delayed wound closure are expected to result in larger wounds with more cytotoxicity over time. Treatments that enhance cell migration should result in less cytotoxicity and smaller wounds over time. Treatment of Calu-3 cells with EGF

increased the rate of cell migration compared to serum free media alone (Chapter 2 Fig.

3B). Treatment of Calu-3 cells with EGF following wounding should result in a reduction

in susceptibility to cytotoxicity compared to serum free media treatment, and smaller

wounds compared to serum free treatment. To determine the extent to which cytotoxicity

of P. aeruginosa is affected by slowed migration following the loss of functional CFTR,

CFTR would be inhibited with CFTRinh-172 in Calu-3 and NHBE cells. This treatment is

preferred over the use of CFTR silenced cells since CFTR itself has been shown to bind

P. aeruginosa (Pier et al. 1997). The significance of CFTR binding to the susceptibility of the airway epithelium to P. aeruginosa infection is not entirely clear, and therefore in order to eliminate the loss of CFTR expression at the cell membrane as a compounding effect, only CFTR function inhibited cells should be used. These studies would provide a link between the reduction in airway epithelial cell migration due to the loss of CFTR function and the impact on cytotoxic susceptibility to the major microorganism that results in airway failure and patient death in CF.

III. Conclusions

A better understanding of the airway damage and repair process in CF may be

critical for the development of new therapeutics to prevent lung failure. Our studies are

the first to identify a role for CFTR in airway epithelial cell migration. A major aim of

this study was to characterize the CFTR dependence of migration. Two human bronchial

airway epithelial cell lines were utilized in an in vitro wound repair model that allowed

for the measurement of migration rates using CIS for sensitive, efficient and objective

measurements. Inhibition of CFTR with the selective inhibitor CFTRinh-172 slowed the

rate of wound closure of both cell lines, and silencing CFTR protein expression also

slowed wound closure to the same extent as inhibition of the channel. This data indicated that the role of CFTR in airway epithelial cell migration was dependent on the ion

transport function of CFTR. Time lapse video imaging during wound closure revealed

that Calu-3 and NHBE airway epithelial cells closed wounds by migration as cells could

be seen to move from the areas surrounding wounds into the wounded area, completing

closure.

The second major aim of this study was to identify a functional effect by which

CFTR plays a role in airway epithelial cell migration. Inhibition or silencing of CFTR resulted in reduced lamellipodia area suggesting a delay in the onset of lamellipodia

protrusion. This finding identified a specific location within migrating cells that is affected by the loss of CFTR function, and provided a functional effect by which CFTR promotes airway epithelial cell migration.

Finally, the third major aim was to determine the ionic mechanism by which

CFTR modulates cell migration. Ionic substitution and selective inhibitor studies using

Calu-3 and NHBE cells revealed a mechanistic difference in the role of CFTR in cell

- migration between the two cell lines. For Calu-3 cells, CFTR transport of HCO3 appears

- to mediate migration, and HCO3 loading by the NBCs, especially the electrogenic NBCs

may cooperate with CFTR to accomplish this. For NHBE cells, CFTR transport of Cl-

- appears to mediate migration, and CFTR may also coordinate with Cl /HCO3- exchangers

- for net HCO3 transport.

Future studies to expand these findings will focus on verifying the coordination of

transporters and exchangers with CFTR by localization of the proteins within migrating

cells and direct measurements of ion transport function by migrating cells using ion

selective microelectrodes. Future studies will also expand the measurements of migration

rate of a CF cell line to measuring the migration rate of a CF cell line with regulatable

expression of wild type CFTR. The porcine CF model may also be a valuable future tool

for investigating wound repair in vivo in the presence and absence of airway infection.

The role of inflammatory cytokines present in CF airways in altering migration rates of

airway epithelial cells with CFTR functional, silenced or inhibited will also be measured.

These studies may reveal modulation of the CFTR dependence of airway epithelial cell

migration. Finally, the susceptibility of airway epithelial cells to cytotoxicity by P.

aeruginosa following wounding and with functional or inhibited CFTR will be assessed.

Together the findings of the present and future studies will provide an understanding of

the mechanism by which CFTR regulates airway epithelial cell migration, as well as how

the role of CFTR in migration is altered by inflammatory mediators and contributes to

cytotoxic susceptibility. This understanding may potentially lead to the development of

CF therapeutics that can limit airway damage.

REFERENCES

Aagaard, Lars, and John J Rossi. 2007. RNAi therapeutics: principles, prospects and challenges. Advanced Drug Delivery Reviews 59, no. 2-3 (March 30): 75-86. Abercrombie, M, J E Heaysman, and S M Pegrum. 1971. The locomotion of fibroblasts in culture. IV. Electron microscopy of the leading lamella. Experimental Cell Research 67, no. 2 (August): 359-367. Ahdieh, M, T Vandenbos, and A Youakim. 2001. Lung epithelial barrier function and wound healing are decreased by IL-4 and IL-13 and enhanced by IFN-gamma. American Journal of Physiology. Cell Physiology 281, no. 6 (December): C2029- 2038. Aiyar, Jayashree. 1999. Potassium channels in leukocytes and toxins that block them: Structure, function and therapeutic implications. Perspectives in Drug Discovery and Design 15-16, no. 0 (January 1): 257-280. doi:10.1023/A:1017049114837. Alexander, R T, and S Grinstein. 2006. Na+/H+ exchangers and the regulation of volume. Acta Physiologica (Oxford, England) 187, no. 1-2 (June): 159-167. Alper, Seth L. 2006. Molecular physiology of SLC4 anion exchangers. Experimental Physiology 91, no. 1 (January): 153-161. doi:10.1113/expphysiol.2005.031765. ———. 2009. Molecular physiology and genetics of Na+-independent SLC4 anion exchangers. The Journal of Experimental Biology 212, no. Pt 11 (June): 1672- 1683. Anon. 1993. Correlation between genotype and phenotype in patients with cystic fibrosis. The Cystic Fibrosis Genotype-Phenotype Consortium. The New England Journal of Medicine 329, no. 18 (October 28): 1308-1313. Ballard, Stephen T, and Domenico Spadafora. 2007. Fluid secretion by submucosal glands of the tracheobronchial airways. Respiratory Physiology & Neurobiology 159, no. 3 (December 15): 271-277. Bankers-Fulbright, Jennifer L, Kathleen R Bartemes, Gail M Kephart, Hirohito Kita, and Scott M O'Grady. 2009. Beta2-integrin-mediated adhesion and intracellular Ca2+ release in human eosinophils. The Journal of Membrane Biology 228, no. 2 (March): 99-109. Barth, P J, S Koch, B Müller, F Unterstab, P von Wichert, and R Moll. 2000. Proliferation and number of Clara cell 10-kDa protein (CC10)-reactive epithelial cells and basal cells in normal, hyperplastic and metaplastic bronchial mucosa. Virchows Archiv: An International Journal of Pathology 437, no. 6 (December): 648-655. Bear, C E, C H Li, N Kartner, R J Bridges, T J Jensen, M Ramjeesingh, and J R Riordan. 1992. Purification and functional reconstitution of the cystic fibrosis transmembrane conductance regulator (CFTR). Cell 68, no. 4 (February 21): 809- 818. Benharouga, Mohamed, Manu Sharma, Jeffry So, Martin Haardt, Luke Drzymala, Milka Popov, Blanche Schwapach, Sergio Grinstein, Kai Du, and Gergely L Lukacs. 2003. The role of the C terminus and Na+/H+ exchanger regulatory factor in the functional expression of cystic fibrosis transmembrane conductance regulator in nonpolarized cells and epithelia. The Journal of Biological Chemistry 278, no. 24 84

(June 13): 22079-22089. de Bentzmann, S, C Plotkowski, and E Puchelle. 1996. Receptors in the Pseudomonas aeruginosa adherence to injured and repairing airway epithelium. American Journal of Respiratory and Critical Care Medicine 154, no. 4 Pt 2 (October): S155-162. Bergman, J., J. McAteer, A. Evan, and M. Soleimani. 1991. Use of the pH-sensitive dye BCECF to study pH regulation in cultured human kidney proximal tubule cells. Methods in Cell Science 13, no. 3: 205-209. Bilton, Diana. 2008. What did we learn from the North American Cystic Fibrosis Conference? Journal of the Royal Society of Medicine 101 Suppl 1 (July): S6-9. Bindschadler, Michael, and James L McGrath. 2007. Sheet migration by wounded monolayers as an emergent property of single-cell dynamics. Journal of Cell Science 120, no. Pt 5 (March 1): 876-884. doi:10.1242/jcs.03395. Blouquit-Laye, Sabine, and Thierry Chinet. 2007. Ion and liquid transport across the bronchiolar epithelium. Respiratory Physiology & Neurobiology 159, no. 3 (December 15): 278-282. Boers, J E, A W Ambergen, and F B Thunnissen. 1998. Number and proliferation of basal and parabasal cells in normal human airway epithelium. American Journal of Respiratory and Critical Care Medicine 157, no. 6 Pt 1 (June): 2000-2006. Bonfield, T L, J R Panuska, M W Konstan, K A Hilliard, J B Hilliard, H Ghnaim, and M Berger. 1995. Inflammatory cytokines in cystic fibrosis lungs. American Journal of Respiratory and Critical Care Medicine 152, no. 6 Pt 1 (December): 2111- 2118. Boron, Walter F. 2010. Evaluating the role of carbonic anhydrases in the transport of HCO3--related species. Biochimica Et Biophysica Acta 1804, no. 2 (February): 410-421. Boron, Walter F., Liming Chen, and Mark D. Parker. 2009. Modular structure of sodium- coupled bicarbonate transporters. J Exp Biol 212, no. 11 (June 1): 1697-1706. Boucher, R C. 2004. New concepts of the pathogenesis of cystic fibrosis lung disease. The European Respiratory Journal: Official Journal of the European Society for Clinical Respiratory Physiology 23, no. 1 (January): 146-158. Boucher, R C, M J Stutts, M R Knowles, L Cantley, and J T Gatzy. 1986. Na+ transport in cystic fibrosis respiratory epithelia. Abnormal basal rate and response to adenylate cyclase activation. The Journal of Clinical Investigation 78, no. 5 (November): 1245-1252. doi:10.1172/JCI112708. Breton, S, K Hammar, P J Smith, and D Brown. 1998. Proton secretion in the male reproductive tract: involvement of Cl--independent HCO-3 transport. The American Journal of Physiology 275, no. 4 Pt 1 (October): C1134-1142. Breton, S, P J Smith, B Lui, and D Brown. 1996. Acidification of the male reproductive tract by a proton pumping (H+)-ATPase. Nature Medicine 2, no. 4 (April): 470- 472. Buchanan, Paul J, Robert K Ernst, J Stuart Elborn, and Bettina Schock. 2009. Role of CFTR, Pseudomonas aeruginosa and Toll-like receptors in cystic fibrosis lung inflammation. Biochemical Society Transactions 37, no. Pt 4 (August): 863-867. Camilo, Ricardo, Vera Luíza Capelozzi, Sheila Aparecida Coelho Siqueira, and Fabíola 85

Del Carlo Bernardi. 2006. Expression of p63, keratin 5/6, keratin 7, and surfactant-A in non-small cell lung carcinomas. Human Pathology 37, no. 5 (May): 542-546. Campodónico, Victoria L, Mihaela Gadjeva, Catherine Paradis-Bleau, Ahmet Uluer, and Gerald B Pier. 2008. Airway epithelial control of Pseudomonas aeruginosa infection in cystic fibrosis. Trends in Molecular Medicine 14, no. 3 (March): 120- 133. Cao, Cong, Yun Sun, Sarah Healey, Zhigang Bi, Gang Hu, Shu Wan, Nicola Kouttab, Wenming Chu, and Yinsheng Wan. 2006. EGFR-mediated expression of aquaporin-3 is involved in human skin fibroblast migration. The Biochemical Journal 400, no. 2 (December 1): 225-234. Cardone, Rosa A, Antonia Bellizzi, Giovanni Busco, Edward J Weinman, Maria E Dell'Aquila, Valeria Casavola, Amalia Azzariti, Anita Mangia, Angelo Paradiso, and Stephan J Reshkin. 2007. The NHERF1 PDZ2 domain regulates PKA-RhoA- p38-mediated NHE1 activation and invasion in breast tumor cells. Molecular Biology of the Cell 18, no. 5 (May): 1768-1780. Carrabino, Salvatore, Daniela Carpani, Alessandra Livraghi, Maurizio Di Cicco, Diana Costantini, Elena Copreni, Carla Colombo, and Massimo Conese. 2006. Dysregulated interleukin-8 secretion and NF-kappaB activity in human cystic fibrosis nasal epithelial cells. Journal of Cystic Fibrosis: Official Journal of the European Cystic Fibrosis Society 5, no. 2 (May): 113-119. Chambers, Lucy A, Brett M Rollins, and Robert Tarran. 2007. Liquid movement across the surface epithelium of large airways. Respiratory Physiology & Neurobiology 159, no. 3 (December 15): 256-270. Chen, Tsung-Yu, and Tzyh-Chang Hwang. 2008. CLC-0 and CFTR: chloride channels evolved from transporters. Physiological Reviews 88, no. 2 (April): 351-387. Cheng, S H, R J Gregory, J Marshall, S Paul, D W Souza, G A White, C R O'Riordan, and A E Smith. 1990. Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis. Cell 63, no. 4 (November 16): 827- 834. Chernova, Marina N, Lianwei Jiang, David J Friedman, Rachel B Darman, Hannes Lohi, Juha Kere, David H Vandorpe, and Seth L Alper. 2005. Functional comparison of mouse slc26a6 anion exchanger with human SLC26A6 polypeptide variants: differences in anion selectivity, regulation, and electrogenicity. The Journal of Biological Chemistry 280, no. 9 (March 4): 8564-8580. Chifflet, Silvia, Julio A Hernández, and Silvina Grasso. 2005. A possible role for membrane depolarization in epithelial wound healing. American Journal of Physiology. Cell Physiology 288, no. 6 (June): C1420-1430. Chmiel, James F, and Pamela B Davis. 2003. State of the art: why do the lungs of patients with cystic fibrosis become infected and why can't they clear the infection? Respiratory Research 4: 8. doi:10.1186/1465-9921-4-8. Choi, I, C Aalkjaer, E L Boulpaep, and W F Boron. 2000. An electroneutral sodium/bicarbonate cotransporter NBCn1 and associated sodium channel. Nature 405, no. 6786 (June 1): 571-575. Chrétien, Jacques. 1996. Environmental impact on the airways. Informa Health Care. 86

Coraux, C., R. Hajj, P. Lesimple, and E. Puchelle. 2005. In vivo models of human airway epithelium repair and regeneration. EUROPEAN RESPIRATORY REVIEW 14, no. 97 (December 1): 131-136. Coraux, Christelle, Corinne Martinella-Catusse, Béatrice Nawrocki-Raby, Rodolphe Hajj, Henriette Burlet, Sandie Escotte, Véronique Laplace, Philippe Birembaut, and Edith Puchelle. 2005. Differential expression of matrix metalloproteinases and interleukin-8 during regeneration of human airway epithelium in vivo. The Journal of Pathology 206, no. 2 (June): 160-169. Denker, Sheryl P, and Diane L Barber. 2002. Cell migration requires both ion translocation and cytoskeletal anchoring by the Na-H exchanger NHE1. The Journal of Cell Biology 159, no. 6 (December 23): 1087-1096. DesMarais, Vera, Mousumi Ghosh, Robert Eddy, and John Condeelis. 2005. Cofilin takes the lead. Journal of Cell Science 118, no. Pt 1 (January 1): 19-26. Devor, D C, A K Singh, L C Lambert, A DeLuca, R A Frizzell, and R J Bridges. 1999. Bicarbonate and chloride secretion in Calu-3 human airway epithelial cells. The Journal of General Physiology 113, no. 5 (May): 743-760. DiMango, E, A J Ratner, R Bryan, S Tabibi, and A Prince. 1998. Activation of NF- kappaB by adherent Pseudomonas aeruginosa in normal and cystic fibrosis respiratory epithelial cells. The Journal of Clinical Investigation 101, no. 11 (June 1): 2598-2605. Dorschner, Robert A, Belen Lopez-Garcia, Andreas Peschel, Dirk Kraus, Kazuya Morikawa, Victor Nizet, and Richard L Gallo. 2006. The mammalian ionic environment dictates microbial susceptibility to antimicrobial defense peptides. The FASEB Journal: Official Publication of the Federation of American Societies for Experimental Biology 20, no. 1 (January): 35-42. Dorwart, Michael R, Nikolay Shcheynikov, Dongki Yang, and Shmuel Muallem. 2008. The solute carrier 26 family of proteins in epithelial ion transport. Physiology (Bethesda, Md.) 23 (April): 104-114. Eidelman, O, M Srivastava, J Zhang, X Leighton, J Murtie, C Jozwik, K Jacobson, D L Weinstein, E L Metcalf, and H B Pollard. 2001. Control of the proinflammatory state in cystic fibrosis lung epithelial cells by genes from the TNF- alphaR/NFkappaB pathway. Molecular Medicine (Cambridge, Mass.) 7, no. 8 (August): 523-534. Engelhardt, J F, H Schlossberg, J R Yankaskas, and L Dudus. 1995. Progenitor cells of the adult human airway involved in submucosal gland development. Development (Cambridge, England) 121, no. 7 (July): 2031-2046. Farooqui, Rizwan, and Gabriel Fenteany. 2005. Multiple rows of cells behind an epithelial wound edge extend cryptic lamellipodia to collectively drive cell-sheet movement. Journal of Cell Science 118, no. Pt 1 (January 1): 51-63. Filali, Mohammed, Xiaoming Liu, Ningli Cheng, Duane Abbott, Vladimir Leontiev, and John F Engelhardt. 2002. Mechanisms of submucosal gland morphogenesis in the airway. Novartis Foundation Symposium 248: 38-45; discussion 45-50, 277-282. Fire, A, S Xu, M K Montgomery, S A Kostas, S E Driver, and C C Mello. 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, no. 6669 (February 19): 806-811. 87

Fleiszig, S M, D J Evans, N Do, V Vallas, S Shin, and K E Mostov. 1997. Epithelial cell polarity affects susceptibility to Pseudomonas aeruginosa invasion and cytotoxicity. Infection and Immunity 65, no. 7 (July): 2861-2867. Frantz, Christian, Anastasios Karydis, Perihan Nalbant, Klaus M Hahn, and Diane L Barber. 2007. Positive feedback between Cdc42 activity and H+ efflux by the Na- H exchanger NHE1 for polarity of migrating cells. The Journal of Cell Biology 179, no. 3 (November 5): 403-410. Fulcher, M L, S E Gabriel, J C Olsen, J R Tatreau, M Gentzsch, E Livanos, M T Saavedra, P Salmon, and S H Randell. 2009. Novel human bronchial epithelial cell lines for cystic fibrosis research. American Journal of Physiology. Lung Cellular and Molecular Physiology 296, no. 1 (January): L82-91. Goldmann, Torsten, Daniel Kähler, Holger Schultz, Mahdi Abdullah, Dagmar S Lang, Florian Stellmacher, and Ekkehard Vollmer. 2009. On the significance of Surfactant Protein-A within the human lungs. Diagnostic Pathology 4: 8. Grinstein, S, M Woodside, T K Waddell, G P Downey, J Orlowski, J Pouyssegur, D C Wong, and J K Foskett. 1993. Focal localization of the NHE-1 isoform of the Na+/H+ antiport: assessment of effects on intracellular pH. The EMBO Journal 12, no. 13 (December 15): 5209-5218. Grubb, B R, and R C Boucher. 1999. Pathophysiology of gene-targeted mouse models for cystic fibrosis. Physiological Reviews 79, no. 1 Suppl (January): S193-214. Gruenert, D C, M Willems, J J Cassiman, and R A Frizzell. 2004. Established cell lines used in cystic fibrosis research. Journal of Cystic Fibrosis: Official Journal of the European Cystic Fibrosis Society 3 Suppl 2 (August): 191-196. Guggino, William B, and Bruce A Stanton. 2006. New insights into cystic fibrosis: molecular switches that regulate CFTR. Nature Reviews. Molecular Cell Biology 7, no. 6 (June): 426-436. Hajj, R, P Lesimple, B Nawrocki-Raby, P Birembaut, E Puchelle, and C Coraux. 2007. Human airway surface epithelial regeneration is delayed and abnormal in cystic fibrosis. The Journal of Pathology 211, no. 3 (February): 340-350. Hajj, Rodolphe, Thomas Baranek, Richard Le Naour, Pierre Lesimple, Edith Puchelle, and Christelle Coraux. 2007. Basal cells of the human adult airway surface epithelium retain transit-amplifying cell properties. Stem Cells (Dayton, Ohio) 25, no. 1 (January): 139-148. Hammond, S M, E Bernstein, D Beach, and G J Hannon. 2000. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404, no. 6775 (March 16): 293-296. doi:10.1038/35005107. Hara-Chikuma, Mariko, and A S Verkman. 2006. Aquaporin-1 facilitates epithelial cell migration in kidney proximal tubule. Journal of the American Society of Nephrology: JASN 17, no. 1 (January): 39-45. doi:10.1681/ASN.2005080846. ———. 2008. Aquaporin-3 facilitates epidermal cell migration and proliferation during wound healing. Journal of Molecular Medicine (Berlin, Germany) 86, no. 2 (February): 221-231. Hartl, Dominik, Matthias Griese, Matthias Kappler, Gernot Zissel, Dietrich Reinhardt, Christian Rebhan, Dolores J Schendel, and Susanne Krauss-Etschmann. 2006. Pulmonary T(H)2 response in Pseudomonas aeruginosa-infected patients with 88

cystic fibrosis. The Journal of Allergy and Clinical Immunology 117, no. 1 (January): 204-211. Hassink, Gerco C, Bin Zhao, Ramakrishna Sompallae, Mikael Altun, Stefano Gastaldello, Nikolay V Zinin, Maria G Masucci, and Kristina Lindsten. 2009. The ER-resident ubiquitin-specific protease 19 participates in the UPR and rescues ERAD substrates. EMBO Reports 10, no. 7 (July): 755-761. Haws, C, W E Finkbeiner, J H Widdicombe, and J J Wine. 1994. CFTR in Calu-3 human airway cells: channel properties and role in cAMP-activated Cl- conductance. The American Journal of Physiology 266, no. 5 Pt 1 (May): L502-512. Hendriks, R, D K Morest, and L K Kaczmarek. 1999. Role in neuronal cell migration for high-threshold potassium currents in the chicken hindbrain. Journal of Neuroscience Research 58, no. 6 (December 15): 805-814. Hong, Kyung U, Susan D Reynolds, Simon Watkins, Elaine Fuchs, and Barry R Stripp. 2004. Basal cells are a multipotent progenitor capable of renewing the bronchial epithelium. The American Journal of Pathology 164, no. 2 (February): 577-588. Horwitz, Rick, and Donna Webb. 2003. Cell migration. Current Biology: CB 13, no. 19 (September 30): R756-759. Hug, Martin J, Tsutomu Tamada, and Robert J Bridges. 2003. CFTR and bicarbonate secretion by [correction of to] epithelial cells. News in Physiological Sciences: An International Journal of Physiology Produced Jointly by the International Union of Physiological Sciences and the American Physiological Society 18 (February): 38-42. Ikeguchi, Mitsunori. 2009. Water transport in aquaporins: molecular dynamics simulations. Frontiers in Bioscience: A Journal and Virtual Library 14: 1283- 1291. Illek, B, A W Tam, H Fischer, and T E Machen. 1999. Anion selectivity of apical membrane conductance of Calu 3 human airway epithelium. Pflügers Archiv: European Journal of Physiology 437, no. 6 (May): 812-822. Illek, B, J R Yankaskas, and T E Machen. 1997. cAMP and genistein stimulate HCO3- conductance through CFTR in human airway epithelia. The American Journal of Physiology 272, no. 4 Pt 1 (April): L752-761. Jacinto, A, A Martinez-Arias, and P Martin. 2001. Mechanisms of epithelial fusion and repair. Nature Cell Biology 3, no. 5 (May): E117-123. Jacquot, Jacky, Olivier Tabary, Philippe Le Rouzic, and Annick Clement. 2008. Airway epithelial cell inflammatory signalling in cystic fibrosis. The International Journal of Biochemistry & Cell Biology 40, no. 9: 1703-1715. Jakab, M, and M Ritter. 2006. Cell volume regulatory ion transport in the regulation of cell migration. Contributions to Nephrology 152: 161-180. Jeffery, P K. 1983. Morphologic features of airway surface epithelial cells and glands. The American Review of Respiratory Disease 128, no. 2 Pt 2 (August): S14-20. Kerem, B, J M Rommens, J A Buchanan, D Markiewicz, T K Cox, A Chakravarti, M Buchwald, and L C Tsui. 1989. Identification of the cystic fibrosis gene: genetic analysis. Science (New York, N.Y.) 245, no. 4922 (September 8): 1073-1080. Khan, T Z, J S Wagener, T Bost, J Martinez, F J Accurso, and D W Riches. 1995. Early pulmonary inflammation in infants with cystic fibrosis. American Journal of 89

Respiratory and Critical Care Medicine 151, no. 4 (April): 1075-1082. Klausner, M, J Kubilus, P Ogle, JE Adamou, and S Langermann. 1998. Reconstructed, differentiated airway epithelial cultures to model respiratory infection. http://www.mattek.com/pages/abstracts/156. Klein, M, P Seeger, B Schuricht, S L Alper, and A Schwab. 2000. Polarization of Na(+)/H(+) and Cl(-)/HCO (3)(-) exchangers in migrating renal epithelial cells. The Journal of General Physiology 115, no. 5 (May): 599-608. Knight, Darryl A, and Stephen T Holgate. 2003. The airway epithelium: structural and functional properties in health and disease. Respirology (Carlton, Vic.) 8, no. 4 (December): 432-446. Ko, Shigeru B H, Weizhong Zeng, Michael R Dorwart, Xiang Luo, Kil Hwan Kim, Linda Millen, Hidemi Goto, et al. 2004. Gating of CFTR by the STAS domain of SLC26 transporters. Nature Cell Biology 6, no. 4 (April): 343-350. Kreda, Silvia M, Seiko F Okada, Catharina A van Heusden, Wanda O'Neal, Sherif Gabriel, Lubna Abdullah, C William Davis, Richard C Boucher, and Eduardo R Lazarowski. 2007. Coordinated release of nucleotides and mucin from human airway epithelial Calu-3 cells. The Journal of Physiology 584, no. Pt 1 (October 1): 245-259. Kreindler, James L, Kathryn W Peters, Raymond A Frizzell, and Robert J Bridges. 2006. Identification and membrane localization of electrogenic sodium bicarbonate cotransporters in Calu-3 cells. Biochimica Et Biophysica Acta 1762, no. 7 (July): 704-710. Kube, D, U Sontich, D Fletcher, and P B Davis. 2001. Proinflammatory cytokine responses to P. aeruginosa infection in human airway epithelial cell lines. American Journal of Physiology. Lung Cellular and Molecular Physiology 280, no. 3 (March): L493-502. Land, S C, and A Collett. 2001. Detection of Cl- flux in the apical microenvironment of cultured foetal distal lung epithelial cells. The Journal of Experimental Biology 204, no. Pt 4 (February): 785-795. Land, S C, D M Porterfield, R H Sanger, and P J Smith. 1999. The self-referencing oxygen-selective microelectrode: detection of transmembrane oxygen flux from single cells. The Journal of Experimental Biology 202, no. Pt 2 (January): 211- 218. Le Clainche, Christophe, and Marie-France Carlier. 2008. Regulation of actin assembly associated with protrusion and adhesion in cell migration. Physiological Reviews 88, no. 2 (April): 489-513. Levin, Marc H, and A S Verkman. 2006. Aquaporin-3-dependent cell migration and proliferation during corneal re-epithelialization. Investigative Ophthalmology & Visual Science 47, no. 10 (October): 4365-4372. Liang, Earvin, Puchun Liu, and Steven Dinh. 2007. Use of a pH-sensitive fluorescent probe for measuring intracellular pH of Caco-2 cells. International Journal of Pharmaceutics 338, no. 1-2 (June 29): 104-109. Liedtke, Carole M, Melinda Hubbard, and Xiangyun Wang. 2003. Stability of actin cytoskeleton and PKC-delta binding to actin regulate NKCC1 function in airway epithelial cells. American Journal of Physiology. Cell Physiology 284, no. 2 90

(February): C487-496. Liu, Xiaoming, and John F Engelhardt. 2008. The glandular stem/progenitor cell niche in airway development and repair. Proceedings of the American Thoracic Society 5, no. 6 (August 15): 682-688. Lu, L, P S Reinach, and W W Kao. 2001. Corneal epithelial wound healing. Experimental Biology and Medicine (Maywood, N.J.) 226, no. 7 (July): 653-664. Mall, Marcus A. 2008. Role of cilia, mucus, and airway surface liquid in mucociliary dysfunction: lessons from mouse models. Journal of Aerosol Medicine and Pulmonary Drug Delivery 21, no. 1 (March): 13-24. Meima, Marcel E, Jennifer R Mackley, and Diane L Barber. 2007. Beyond ion translocation: structural functions of the sodium-hydrogen exchanger isoform-1. Current Opinion in Nephrology and Hypertension 16, no. 4 (July): 365-372. Moriarty, T F, J S Elborn, and M M Tunney. 2007. Effect of pH on the antimicrobial susceptibility of planktonic and biofilm-grown clinical Pseudomonas aeruginosa isolates. British Journal of Biomedical Science 64, no. 3: 101-104. Moser, C, P O Jensen, O Kobayashi, H P Hougen, Z Song, J Rygaard, A Kharazmi, and N H by. 2002. Improved outcome of chronic Pseudomonas aeruginosa lung infection is associated with induction of a Th1-dominated cytokine response. Clinical and Experimental Immunology 127, no. 2 (February): 206-213. Mount, David B, and Michael F Romero. 2004. The SLC26 gene family of multifunctional anion exchangers. Pflügers Archiv: European Journal of Physiology 447, no. 5 (February): 710-721. doi:10.1007/s00424-003-1090-3. Muallem, Daniella, and Paola Vergani. 2009. Review. ATP hydrolysis-driven gating in cystic fibrosis transmembrane conductance regulator. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 364, no. 1514 (January 27): 247-255. Naren, Anjaparavanda P, Bryan Cobb, Chunying Li, Koushik Roy, David Nelson, Ghanshyam D Heda, Jie Liao, et al. 2003. A macromolecular complex of beta 2 adrenergic receptor, CFTR, and ezrin/radixin/moesin-binding phosphoprotein 50 is regulated by PKA. Proceedings of the National Academy of Sciences of the United States of America 100, no. 1 (January 7): 342-346. Nett, W, and J W Deitmer. 1996. Simultaneous measurements of intracellular pH in the leech giant glial cell using 2',7'-bis-(2-carboxyethyl)-5,6-carboxyfluorescein and ion-sensitive microelectrodes. Biophysical Journal 71, no. 1 (July): 394-402. Nomori, H, S Morinaga, R Kobayashi, and C Torikata. 1994. Protein 1 and Clara cell 10- kDa protein distribution in normal and neoplastic tissues with emphasis on the respiratory system. Virchows Archiv: An International Journal of Pathology 424, no. 5: 517-523. Ohana, Ehud, Dongki Yang, Nikolay Shcheynikov, and Shmuel Muallem. 2009. Diverse transport modes by the solute carrier 26 family of anion transporters. The Journal of Physiology 587, no. Pt 10 (May 15): 2179-2185. O'Sullivan, Brian P, and Steven D Freedman. 2009. Cystic fibrosis. Lancet 373, no. 9678 (May 30): 1891-1904. Palmer, Melissa L, So Yeong Lee, Dan Carlson, Scott Fahrenkrug, and Scott M O'Grady. 2006. Stable knockdown of CFTR establishes a role for the channel in P2Y 91

receptor-stimulated anion secretion. Journal of Cellular Physiology 206, no. 3 (March): 759-770. Palmer, Melissa L, So Yeong Lee, Peter J Maniak, Dan Carlson, Scott C Fahrenkrug, and Scott M O'Grady. 2006. Protease-activated receptor regulation of Cl- secretion in Calu-3 cells requires prostaglandin release and CFTR activation. American Journal of Physiology. Cell Physiology 290, no. 4 (April): C1189-1198. Papadopoulos, M C, S Saadoun, and A S Verkman. 2008. Aquaporins and cell migration. Pflügers Archiv: European Journal of Physiology 456, no. 4 (July): 693-700. Paradiso, AM, Tsien, RY, and Machen, TE. 1984. Na+-H+ exchange in gastric glands as measured with... [Proc Natl Acad Sci U S A. 1984] - PubMed result. http://www.ncbi.nlm.nih.gov/pubmed/6095295. Park, Meeyoung, Shigeru B H Ko, Joo Young Choi, Gaia Muallem, Philip J Thomas, Alexander Pushkin, Myeong-Sok Lee, et al. 2002. The cystic fibrosis transmembrane conductance regulator interacts with and regulates the activity of the HCO3- salvage transporter human Na+-HCO3- cotransport isoform 3. The Journal of Biological Chemistry 277, no. 52 (December 27): 50503-50509. Pastoriza-Munoz, E, R M Harrington, and M L Graber. 1992. Parathyroid hormone decreases HCO3 reabsorption in the rat proximal tubule by stimulating phosphatidylinositol metabolism and inhibiting base exit. The Journal of Clinical Investigation 89, no. 5 (May): 1485-1495. da Paula, Ana Carina, Anabela S Ramalho, Carlos M Farinha, Judy Cheung, Rosalie Maurisse, Dieter C Gruenert, Jiraporn Ousingsawat, Karl Kunzelmann, and Margarida D Amaral. 2005. Characterization of novel airway submucosal gland cell models for cystic fibrosis studies. Cellular Physiology and Biochemistry: International Journal of Experimental Cellular Physiology, Biochemistry, and Pharmacology 15, no. 6: 251-262. Pier, G B, M Grout, and T S Zaidi. 1997. Cystic fibrosis transmembrane conductance regulator is an epithelial cell receptor for clearance of Pseudomonas aeruginosa from the lung. Proceedings of the National Academy of Sciences of the United States of America 94, no. 22 (October 28): 12088-12093. Plotkowski, M C, A O Costa, V Morandi, H S Barbosa, H B Nader, S de Bentzmann, and E Puchelle. 2001. Role of heparan sulphate proteoglycans as potential receptors for non-piliated Pseudomonas aeruginosa adherence to non-polarised airway epithelial cells. Journal of Medical Microbiology 50, no. 2 (February): 183-190. Poulsen, J H, H Fischer, B Illek, and T E Machen. 1994. Bicarbonate conductance and pH regulatory capability of cystic fibrosis transmembrane conductance regulator. Proceedings of the National Academy of Sciences of the United States of America 91, no. 12 (June 7): 5340-5344. Puchelle, E. 2000. Airway epithelium wound repair and regeneration after injury. Acta Oto-Rhino-Laryngologica Belgica 54, no. 3: 263-270. Puchelle, Edith, Jean-Marie Zahm, Jean-Marie Tournier, and Christelle Coraux. 2006. Airway epithelial repair, regeneration, and remodeling after injury in chronic obstructive pulmonary disease. Proceedings of the American Thoracic Society 3, no. 8 (November): 726-733. Purkis, P E, J B Steel, I C Mackenzie, W B Nathrath, I M Leigh, and E B Lane. 1990. 92

Antibody markers of basal cells in complex epithelia. Journal of Cell Science 97 ( Pt 1) (September): 39-50. Pushkin, Alexander, and Ira Kurtz. 2006. SLC4 base (HCO3 -, CO3 2-) transporters: classification, function, structure, genetic diseases, and knockout models. American Journal of Physiology. Renal Physiology 290, no. 3 (March): F580-599. Pushparaj, P N, J J Aarthi, J Manikandan, and S D Kumar. 2008. siRNA, miRNA, and shRNA: in vivo applications. Journal of Dental Research 87, no. 11 (November): 992-1003. Putney, L K, S P Denker, and D L Barber. 2002. The changing face of the Na+/H+ exchanger, NHE1: structure, regulation, and cellular actions. Annual Review of Pharmacology and Toxicology 42: 527-552. Raben, Nina, Lauren Shea, Victoria Hill, and Paul Plotz. 2009. Monitoring Autophagy in Lysosomal Storage Disorders. Methods in enzymology 453: 417-449. Ramsey, B W. 1996. Management of pulmonary disease in patients with cystic fibrosis. The New England Journal of Medicine 335, no. 3 (July 18): 179-188. Rao, Donald D, John S Vorhies, Neil Senzer, and John Nemunaitis. 2009. siRNA vs. shRNA: similarities and differences. Advanced Drug Delivery Reviews 61, no. 9 (July 25): 746-759. Ratjen, Felix, and Gerd Döring. 2003. Cystic fibrosis. Lancet 361, no. 9358 (February 22): 681-689. Reddy, M M, and P M Quinton. 2001. Selective activation of cystic fibrosis transmembrane conductance regulator Cl- and HCO3- conductances. JOP: Journal of the Pancreas 2, no. 4 Suppl (July): 212-218. ———. 2003. Control of dynamic CFTR selectivity by glutamate and ATP in epithelial cells. Nature 423, no. 6941 (June 12): 756-760. Ridley, Anne J, Martin A Schwartz, Keith Burridge, Richard A Firtel, Mark H Ginsberg, Gary Borisy, J Thomas Parsons, and Alan Rick Horwitz. 2003. Cell migration: integrating signals from front to back. Science (New York, N.Y.) 302, no. 5651 (December 5): 1704-1709. Riordan, John R. 2008. CFTR function and prospects for therapy. Annual Review of Biochemistry 77: 701-726. doi:10.1146/annurev.biochem.75.103004.142532. Romero, Michael F, Christiaan M Fulton, and Walter F Boron. 2004. The SLC4 family of HCO 3 - transporters. Pflügers Archiv: European Journal of Physiology 447, no. 5 (February): 495-509. Rosengren, S, P M Henson, and G S Worthen. 1994. Migration-associated volume changes in neutrophils facilitate the migratory process in vitro. The American Journal of Physiology 267, no. 6 Pt 1 (December): C1623-1632. Schilling, Tom, Christian Stock, Albrecht Schwab, and Claudia Eder. 2004. Functional importance of Ca2+-activated K+ channels for lysophosphatidic acid-induced microglial migration. The European Journal of Neuroscience 19, no. 6 (March): 1469-1474. Schneider, S W, P Pagel, C Rotsch, T Danker, H Oberleithner, M Radmacher, and A Schwab. 2000. Volume dynamics in migrating epithelial cells measured with atomic force microscopy. Pflügers Archiv: European Journal of Physiology 439, no. 3 (January): 297-303. 93

Schwab, A, J Reinhardt, S W Schneider, B Gassner, and B Schuricht. 1999. K(+) channel-dependent migration of fibroblasts and human melanoma cells. Cellular Physiology and Biochemistry: International Journal of Experimental Cellular Physiology, Biochemistry, and Pharmacology 9, no. 3: 126-132. Schwab, A, B Schuricht, P Seeger, J Reinhardt, and P C Dartsch. 1999. Migration of transformed renal epithelial cells is regulated by K+ channel modulation of actin cytoskeleton and cell volume. Pflügers Archiv: European Journal of Physiology 438, no. 3 (August): 330-337. Schwab, A, L Wojnowski, K Gabriel, and H Oberleithner. 1994. Oscillating activity of a Ca(2+)-sensitive K+ channel. A prerequisite for migration of transformed Madin- Darby canine kidney focus cells. The Journal of Clinical Investigation 93, no. 4 (April): 1631-1636. Schwab, Albrecht, Volodymyr Nechyporuk-Zloy, Anke Fabian, and Christian Stock. 2007. Cells move when ions and water flow. Pflügers Archiv: European Journal of Physiology 453, no. 4 (January): 421-432. Seibert, F S, X B Chang, A A Aleksandrov, D M Clarke, J W Hanrahan, and J R Riordan. 1999. Influence of phosphorylation by protein kinase A on CFTR at the cell surface and endoplasmic reticulum. Biochimica Et Biophysica Acta 1461, no. 2 (December 6): 275-283. Shen, B Q, W E Finkbeiner, J J Wine, R J Mrsny, and J H Widdicombe. 1994. Calu-3: a human airway epithelial cell line that shows cAMP-dependent Cl- secretion. The American Journal of Physiology 266, no. 5 Pt 1 (May): L493-501. Singh, Anurag Kumar, Brigitte Riederer, Mingmin Chen, Fang Xiao, Anja Krabbenhöft, Regina Engelhardt, Olof Nylander, Manoocher Soleimani, and Ursula E Seidler. 2010. The switch of intestinal Slc26 exchangers from anion absorptive to HCO3- secretory mode is dependent on CFTR anion channel function. American Journal of Physiology. Cell Physiology (February 17). Slepkov, Emily R, Jan K Rainey, Brian D Sykes, and Larry Fliegel. 2007. Structural and functional analysis of the Na+/H+ exchanger. The Biochemical Journal 401, no. 3 (February 1): 623-633. Small, J V, S Auinger, M Nemethova, S Koestler, K N Goldie, A Hoenger, and G P Resch. 2008. Unravelling the structure of the lamellipodium. Journal of Microscopy 231, no. 3 (September): 479-485. Smith, Sanger, and Messerli. 2007. Principles, Development and Applications of Self- Referencing Electrochemical Microelectrodes to the Determination of Fluxes at Cell Membranes -- Electrochemical Methods for Neuroscience -- NCBI Bookshelf. http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=frelchem&part=ch18. Smith, P J, K Hammar, D M Porterfield, R H Sanger, and J R Trimarchi. 1999. Self- referencing, non-invasive, ion selective electrode for single cell detection of trans- plasma membrane calcium flux. Microscopy Research and Technique 46, no. 6 (September 15): 398-417. Smith, P J, and J Trimarchi. 2001. Noninvasive measurement of hydrogen and potassium ion flux from single cells and epithelial structures. American Journal of Physiology. Cell Physiology 280, no. 1 (January): C1-11. 94

Soleimani, M, S M Grassi, and P S Aronson. 1987. Stoichiometry of Na+-HCO-3 cotransport in basolateral membrane vesicles isolated from rabbit renal cortex. The Journal of Clinical Investigation 79, no. 4 (April): 1276-1280. Song, Yuanlin, Wan Namkung, Dennis W Nielson, Jae-Woo Lee, Walter E Finkbeiner, and A S Verkman. 2009. Airway surface liquid depth measured in ex vivo fragments of pig and human trachea: dependence on Na+ and Cl- channel function. American Journal of Physiology. Lung Cellular and Molecular Physiology 297, no. 6 (December): L1131-1140. Song, Yuanlin, Danieli Salinas, Dennis W Nielson, and A S Verkman. 2006. Hyperacidity of secreted fluid from submucosal glands in early cystic fibrosis. American Journal of Physiology. Cell Physiology 290, no. 3 (March): C741-749. Sparrow, M P, T I Omari, and H W Mitchell. 1995. The epithelial barrier and airway responsiveness. Canadian Journal of Physiology and Pharmacology 73, no. 2 (February): 180-190. Stebbins, M J, S Urlinger, G Byrne, B Bello, W Hillen, and J C Yin. 2001. Tetracycline- inducible systems for Drosophila. Proceedings of the National Academy of Sciences of the United States of America 98, no. 19 (September 11): 10775- 10780. Stewart, A K, A Yamamoto, M Nakakuki, T Kondo, S L Alper, and H Ishiguro. 2009. Functional coupling of apical Cl-/HCO3- exchange with CFTR in stimulated HCO3- secretion by guinea pig interlobular pancreatic duct. American Journal of Physiology. Gastrointestinal and Liver Physiology 296, no. 6 (June): G1307- 1317. Stock, Christian, Rosa Angela Cardone, Giovanni Busco, Hermann Krähling, Albrecht Schwab, and Stephan J Reshkin. 2008. Protons extruded by NHE1: digestive or glue? European Journal of Cell Biology 87, no. 8-9 (September): 591-599. Stock, Christian, Birgit Gassner, Christof R Hauck, Hannelore Arnold, Sabine Mally, Johannes A Eble, Peter Dieterich, and Albrecht Schwab. 2005. Migration of human melanoma cells depends on extracellular pH and Na+/H+ exchange. The Journal of Physiology 567, no. Pt 1 (August 15): 225-238. Stock, Christian, Markus Mueller, Hermann Kraehling, Sabine Mally, Josette Noël, Claudia Eder, and Albrecht Schwab. 2007. pH nanoenvironment at the surface of single melanoma cells. Cellular Physiology and Biochemistry: International Journal of Experimental Cellular Physiology, Biochemistry, and Pharmacology 20, no. 5: 679-686. Taddei, Alessandro, Chiara Folli, Olga Zegarra-Moran, Pascale Fanen, A S Verkman, and Luis J V Galietta. 2004. Altered channel gating mechanism for CFTR inhibition by a high-affinity thiazolidinone blocker. FEBS Letters 558, no. 1-3 (January 30): 52-56. Tarran, Robert, Brian Button, Maryse Picher, Anthony M Paradiso, Carla M Ribeiro, Eduardo R Lazarowski, Liqun Zhang, et al. 2005. Normal and cystic fibrosis airway surface liquid homeostasis. The effects of phasic shear stress and viral infections. The Journal of Biological Chemistry 280, no. 42 (October 21): 35751- 35759. Taylor, G W, D P Chopra, and P A Mathieu. 1993. Differences in secretory profiles of 95

epithelial cell cultures derived from human tracheal and bronchial mucosa and submucosal glands. Epithelial Cell Biology 2, no. 4 (October): 163-169. Tesei, A, W Zoli, C Arienti, G Storci, A M Granato, G Pasquinelli, S Valente, et al. 2009. Isolation of stem/progenitor cells from normal lung tissue of adult humans. Cell Proliferation 42, no. 3 (June): 298-308. doi:10.1111/j.1365-2184.2009.00594.x. Tirouvanziam, R, S de Bentzmann, C Hubeau, J Hinnrasky, J Jacquot, B Péault, and E Puchelle. 2000. Inflammation and infection in naive human cystic fibrosis airway grafts. American Journal of Respiratory Cell and Molecular Biology 23, no. 2 (August): 121-127. Trapnell, B C, C S Chu, P K Paakko, T C Banks, K Yoshimura, V J Ferrans, M S Chernick, and R G Crystal. 1991. Expression of the cystic fibrosis transmembrane conductance regulator gene in the respiratory tract of normal individuals and individuals with cystic fibrosis. Proceedings of the National Academy of Sciences of the United States of America 88, no. 15 (August 1): 6565-6569. Venkatakrishnan, A, A A Stecenko, G King, T R Blackwell, K L Brigham, J W Christman, and T S Blackwell. 2000. Exaggerated activation of nuclear factor- kappaB and altered IkappaB-beta processing in cystic fibrosis bronchial epithelial cells. American Journal of Respiratory Cell and Molecular Biology 23, no. 3 (September): 396-403. Verkman, A S. 2005. More than just water channels: unexpected cellular roles of aquaporins. Journal of Cell Science 118, no. Pt 15 (August 1): 3225-3232. Vetter, J. 1998. Toxins of Amanita phalloides. Toxicon: Official Journal of the International Society on Toxinology 36, no. 1 (January): 13-24. Vicente-Manzanares, Miguel, Donna J Webb, and A Rick Horwitz. 2005. Cell migration at a glance. Journal of Cell Science 118, no. Pt 21 (November 1): 4917-4919. Voynow, Judith A, Bernard M Fischer, Bruce C Roberts, and Alan D Proia. 2005. Basal- like cells constitute the proliferating cell population in cystic fibrosis airways. American Journal of Respiratory and Critical Care Medicine 172, no. 8 (October 15): 1013-1018. Voynow, Judith A, and Bruce K Rubin. 2009. Mucins, mucus, and sputum. Chest 135, no. 2 (February): 505-512. Wang, Xiaodong, Jeanne Matteson, Yu An, Bryan Moyer, Jin-San Yoo, Sergei Bannykh, Ian A Wilson, John R Riordan, and William E Balch. 2004. COPII-dependent export of cystic fibrosis transmembrane conductance regulator from the ER uses a di-acidic exit code. The Journal of Cell Biology 167, no. 1 (October 11): 65-74. Weaver, Amy K, Valerie C Bomben, and Harald Sontheimer. 2006. Expression and function of calcium-activated potassium channels in human glioma cells. Glia 54, no. 3 (August 15): 223-233. Welsh, Michael J, Christopher S Rogers, David A Stoltz, David K Meyerholz, and Randall S Prather. 2009. Development of a porcine model of cystic fibrosis. Transactions of the American Clinical and Climatological Association 120: 149- 162. Yonezawa, N, E Nishida, and H Sakai. 1985. pH control of actin polymerization by cofilin. The Journal of Biological Chemistry 260, no. 27 (November 25): 14410- 14412. 96

Zepeda, M L, M R Chinoy, and J M Wilson. 1995. Characterization of stem cells in human airway capable of reconstituting a fully differentiated bronchial epithelium. Somatic Cell and Molecular Genetics 21, no. 1 (January): 61-73. Zhao, Min, Bing Song, Jin Pu, John V Forrester, and Colin D McCaig. 2003. Direct visualization of a stratified epithelium reveals that wounds heal by unified sliding of cell sheets. The FASEB Journal: Official Publication of the Federation of American Societies for Experimental Biology 17, no. 3 (March): 397-406. Zhou, Zhen, Xiaohui Wang, Hao-Yang Liu, Xiaoqin Zou, Min Li, and Tzyh-Chang Hwang. 2006. The two ATP binding sites of cystic fibrosis transmembrane conductance regulator (CFTR) play distinct roles in gating kinetics and energetics. The Journal of General Physiology 128, no. 4 (October): 413-422.

Appendix A: Statistical Analyses

Statistical analyses were applied to determine if differences between means were significant. Two-tailed unpaired T-tests were used when single comparisons were made

(i.e. treatment vs. control). One way ANOVA followed by Bonferroni post tests were utilized for multiple comparisons between treatments. Welch’s correction was applied to

T-tests when comparisons were made between two data sets with significantly different variances. Significance was considered for all p<0.05. At least three independent experiments were performed, with a total n of six or greater per treatment condition.