Proc. Natl. Acad. Sci. USA Vol. 93, pp. 6349-6354, June 1996 Agricultural Sciences Construction of an improved mycoinsecticide overexpressing a toxic protease RAYMOND J. ST. LEGER, LOKESH JOSHI, MICHAEL J. BIDOCHKA, AND DONALD W. ROBERTS Boyce Thompson Institute, Cornell University, Tower Road, Ithaca NY 14853 Communicated by John H. Law, University ofArizona, Tucson, AZ, March 1, 1996 (received for review October 31, 1995) ABSTRACT Mycoinsecticides are being used for the con- Until recently, lack of information on the molecular basis of trol of many insect pests as an environmentally acceptable fungal pathogenicity precluded genetic engineering to improve alternative to chemical insecticides. A key aim of much recent control potential. We have developed molecular biology meth- work has been to increase the speed of kill and so improve ods to elucidate pathogenic processes in the commercially commercial efficacy of these biocontrol agents. This might be important entomopathogen Metarhizium anisopliae and have achieved by adding insecticidal genes to the fungus, an ap- cloned several genes that are expressed when the fungus is proach considered to have enormous potential for the im- induced by starvation stress to alter its saprobic growth habit, provement of biological pesticides. We report here the devel- develop a specialized infection structure (i.e., the appressor- opment of a genetically improved entomopathogenic fungus. ium), and attack its insect host (6). One of these genes encodes Additional copies of the gene encoding a regulated cuticle- a subtilisin-like protease (designated Prl) which solubilizes the degrading protease (Prl) from Metarhizium anisopliae were proteinaceous insect cuticle, assisting penetration of fungal inserted into the genome of M. anisopliae such that Prl was hyphae, and providing nutrients for further growth (7, 8). Prl constitutively overproduced in the hemolymph of Manduca production by M. aniosopliae is under dual control of a general sexta, activating the prophenoloxidase system. The combined carbon catabolite repression/derepression mechanism and a toxic effects ofPrl and the reaction products ofphenoloxidase carbon source (cuticle) specific induction mechanism (6-10). caused larvae challenged with the engineered fungus to exhibit As penetration involves the induced expression of Prl, we a 25% reduction in time of death and reduced food consump- hypothesized that constitutive overexpression of this gene tion by 40% compared to infections by the wild-type fungus. In could provide a direct strategy for engineering enhanced addition, infected insects were rapidly melanized, and the virulence. Here we report that the efficacy of M. anisopliae as resulting cadavers were poor substrates for fungal sporula- a biological control agent can be substantially improved by tion. Thus, environmental persistence of the genetically engi- transforming multiple copies of the Prl gene into the genome, neered fungus is reduced, thereby providing biological con- under control of a constitutive promoter, to generate strains tainment. which secrete Prl into the insects hemolymph. We also show that the early cessation of feeding is due, at least in part, to the toxic effects of Prl-induced activation of the hosts prophenol- Current widely publicized problems with synthetic chemical oxidase system. insecticides have given rise to a sense of urgency in the development of biological control agents as supplements or alternatives to these chemicals. Although widely used in some MATERIALS AND METHODS less developed nations, entomopathogenic fungi have only Strains and Media. M. anisopliae strain 1080 (an American recently assumed importance in agriculture and household strain held by the Agricultural Research Service Collection of entomology in the United States. This is in spite of the fact that Entompathogenic Fungi (ARSEF) collection, U.S. Depart- entomopathogenic fungi are key regulatory factors in pest ment of Agriculture, Ithaca, N.Y.) was originally isolated from insect populations, are considered very promising biological a lepidopterous larva (Heliothis zea). Media, growth condi- control agents, and provide the only practical microbial control tions, and storage of M. anisopliae have been described (8). of insects that feed by sucking plant or animal juices, and for DNA Manipulations. Standard molecular methods were the many acridid (grasshoppers and locusts) and coleopteran used (11). pAN52-1 vector (obtained from Peter Punt of the pests which have no known viral or bacterial diseases (1-4). Netherlands Central Organization for Applied Scientific Re- However, traditional biopesticides (viruses, bacteria, and search Medical Biology Laboratory, Rijswijk, The Nether- fungi) are commonly perceived to perform poorly compared lands) was used to produce pMAPR-1 (Fig. 1) for the cloning with chemical pesticides. A major deterrent to the develop- and expression of Prl cDNA. pAN52-1 comprises the gpd ment of entomopathogenic fungi has been that it can take 5-10 promoter and the terminator region of the trp C gene (both days after application to kill an insect pest, during which time from Aspergillus nidulans) separated by BamHI and NcoI sites the infected insect can cause serious damage to the crop. A key (12). A full-length cDNA clone of Prl in a Bluescript vector (7) aim of much recent work has been to increase the speed of kill was amplified by reverse transcription-PCR with the forward and so improve commercial efficacy. To date, fungi have been primer 5'-AAGGATCCCGTACTAGAATTTGGAATCA- improved as pathogenic agents by developing the technologies TG-3', containing the ATG codon, and the reverse primer required for optimizing production, stability, and application 5'-GTAAAACGACGGCCAGT-3' (universal M13-20 prim- of the inoculum (1, 2). Improvements to reduce the lag time er). The amplified cDNA was cloned into vector pCRII before feeding cessation might also be achieved by adding (Invitrogen) and subsequently excised by digestion with insecticidal genes to the fungus, an approach considered to BamHI, which cuts at sites incorporated into the forward have enormous potential for the improvement of biological primer and 19 nucleotides downstream of the Prl insert in the pesticides (5). amplified portion of the Bluescript vector. The 1.2-kb BamHI fragment was cloned into BamHI-cut pAN52-1. The resulting The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in Abbreviations: IEF, isoelectric focusing; AFC, 7-amino-4-trifluoro- accordance with 18 U.S.C. §1734 solely to indicate this fact. methyl coumarin. 6349 Downloaded by guest on September 25, 2021 6350 Agricultural Sciences: St. Leger et al. Proc. Natl. Acad. Sci. USA 93 (1996) recorded at 8-h intervals, and the data analyzed by probit analysis with standard software (18). LC50 values and ST50 values were considered significantly different if their 95% fiducial limits did not overlap. The time mortality data was also analyzed by the VISTAT time program (19). All insects were given a preweighed piece of diet 12 h after inoculation. Uneaten food was removed at the time of death and dried to a constant weight at 60°C. A sample of new food was dried in the same way to determine its water content and to allow an estimate of food consumption. Phenoloxidase Activation Studies. Gypsy moth (Lymantria dispar) larvae were kindly provided by Ann Hajek (Cornell University) from a laboratory colony. Larvae were injected -48 h after ecdysis into the 5th instar with affinity-purified preperations of subtilisin-like (Prl) or trypsin-like (Pr2) pro- teases from M. anisopliae (8) in a volume of 10 ,ul of TC-100 (GIBCO) tissue culture medium. Control insects were injected with autoclaved Prl or tissue culture medium only. To inves- tigate the mode of action of Prl on melanization, some insects were injected with Prl (in 10 ,ul of fluid) supplemented with 50 ng ofphenylthiourea (an inhibitor ofphenoloxidase) or 5 ,ug ATCACGATCCCGTACTAGAATTTGGAATCATG of leupeptin (an inhibitor of trypsins). Analysis of Hemolymph Samples. Hemolymph was col- Pgpd 1 Pr1 - *1 lected from a puncture in a proleg and centrifuged (12,000 x FIG. 1. Diagram of pMAPR-1. The cDNA coding for the M. g for 5 min), and proteins in the supernatant were precipitated anisopliae Pri proteinase is inserted 3' to theA. nidulansgpd promoter with trichloroacetic acid (5% final concentration). SDS/ sequence and 5' to terminator sequences from the A. nidulans trp C PAGE of hemolymph proteins (15 ,ug total protein per lane) gene. The sequence preceding the Prl start codon is shown at the was performed under reducing conditions on 4-20% gradient bottom. ApR, ampicillin resistance gene. Details of plasmid construc- gels, and proteins were stained with Coomassie blue or elec- tion are given in the experimental protocol. troblotted. Immunoblots were performed by using Prl-specific antibodies (20) and alkaline phosphatase-conjugated anti- vector was digested with Ncol, blunt ended with Mung bean rabbit secondary antibodies (Promega). nuclease to remove the gpd ATG translation start codon, and Immunoprecipitations were performed at various times up religated. Sequence analysis confirmed the orientation of the to 120 h postinoculation with wild-type or gpd-Prl-4. Hemo- insert in the recombinant vector and that the Prl initiator ATG lymph samples were taken 10 h after insects were injected with was in-frame with the gpd promoter. Isolation of genomic