DOCSLIB.ORG

Construction of an Improved Mycoinsecticide Overexpressing a Toxic Protease RAYMOND J

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Construction of an Improved Mycoinsecticide Overexpressing a Toxic Protease RAYMOND J Proc. Natl. Acad. Sci. USA Vol. 93, pp. 6349-6354, June 1996 Agricultural Sciences Construction of an improved mycoinsecticide overexpressing a toxic protease RAYMOND J. ST. LEGER, LOKESH JOSHI, MICHAEL J. BIDOCHKA, AND DONALD W. ROBERTS Boyce Thompson Institute, Cornell University, Tower Road, Ithaca NY 14853 Communicated by John H. Law, University ofArizona, Tucson, AZ, March 1, 1996 (received for review October 31, 1995) ABSTRACT Mycoinsecticides are being used for the con- Until recently, lack of information on the molecular basis of trol of many insect pests as an environmentally acceptable fungal pathogenicity precluded genetic engineering to improve alternative to chemical insecticides. A key aim of much recent control potential. We have developed molecular biology meth- work has been to increase the speed of kill and so improve ods to elucidate pathogenic processes in the commercially commercial efficacy of these biocontrol agents. This might be important entomopathogen Metarhizium anisopliae and have achieved by adding insecticidal genes to the fungus, an ap- cloned several genes that are expressed when the fungus is proach considered to have enormous potential for the im- induced by starvation stress to alter its saprobic growth habit, provement of biological pesticides. We report here the devel- develop a specialized infection structure (i.e., the appressor- opment of a genetically improved entomopathogenic fungus. ium), and attack its insect host (6). One of these genes encodes Additional copies of the gene encoding a regulated cuticle- a subtilisin-like protease (designated Prl) which solubilizes the degrading protease (Prl) from Metarhizium anisopliae were proteinaceous insect cuticle, assisting penetration of fungal inserted into the genome of M. anisopliae such that Prl was hyphae, and providing nutrients for further growth (7, 8). Prl constitutively overproduced in the hemolymph of Manduca production by M. aniosopliae is under dual control of a general sexta, activating the prophenoloxidase system. The combined carbon catabolite repression/derepression mechanism and a toxic effects ofPrl and the reaction products ofphenoloxidase carbon source (cuticle) specific induction mechanism (6-10). caused larvae challenged with the engineered fungus to exhibit As penetration involves the induced expression of Prl, we a 25% reduction in time of death and reduced food consump- hypothesized that constitutive overexpression of this gene tion by 40% compared to infections by the wild-type fungus. In could provide a direct strategy for engineering enhanced addition, infected insects were rapidly melanized, and the virulence. Here we report that the efficacy of M. anisopliae as resulting cadavers were poor substrates for fungal sporula- a biological control agent can be substantially improved by tion. Thus, environmental persistence of the genetically engi- transforming multiple copies of the Prl gene into the genome, neered fungus is reduced, thereby providing biological con- under control of a constitutive promoter, to generate strains tainment. which secrete Prl into the insects hemolymph. We also show that the early cessation of feeding is due, at least in part, to the toxic effects of Prl-induced activation of the hosts prophenol- Current widely publicized problems with synthetic chemical oxidase system. insecticides have given rise to a sense of urgency in the development of biological control agents as supplements or alternatives to these chemicals. Although widely used in some MATERIALS AND METHODS less developed nations, entomopathogenic fungi have only Strains and Media. M. anisopliae strain 1080 (an American recently assumed importance in agriculture and household strain held by the Agricultural Research Service Collection of entomology in the United States. This is in spite of the fact that Entompathogenic Fungi (ARSEF) collection, U.S. Depart- entomopathogenic fungi are key regulatory factors in pest ment of Agriculture, Ithaca, N.Y.) was originally isolated from insect populations, are considered very promising biological a lepidopterous larva (Heliothis zea). Media, growth condi- control agents, and provide the only practical microbial control tions, and storage of M. anisopliae have been described (8). of insects that feed by sucking plant or animal juices, and for DNA Manipulations. Standard molecular methods were the many acridid (grasshoppers and locusts) and coleopteran used (11). pAN52-1 vector (obtained from Peter Punt of the pests which have no known viral or bacterial diseases (1-4). Netherlands Central Organization for Applied Scientific Re- However, traditional biopesticides (viruses, bacteria, and search Medical Biology Laboratory, Rijswijk, The Nether- fungi) are commonly perceived to perform poorly compared lands) was used to produce pMAPR-1 (Fig. 1) for the cloning with chemical pesticides. A major deterrent to the develop- and expression of Prl cDNA. pAN52-1 comprises the gpd ment of entomopathogenic fungi has been that it can take 5-10 promoter and the terminator region of the trp C gene (both days after application to kill an insect pest, during which time from Aspergillus nidulans) separated by BamHI and NcoI sites the infected insect can cause serious damage to the crop. A key (12). A full-length cDNA clone of Prl in a Bluescript vector (7) aim of much recent work has been to increase the speed of kill was amplified by reverse transcription-PCR with the forward and so improve commercial efficacy. To date, fungi have been primer 5'-AAGGATCCCGTACTAGAATTTGGAATCA- improved as pathogenic agents by developing the technologies TG-3', containing the ATG codon, and the reverse primer required for optimizing production, stability, and application 5'-GTAAAACGACGGCCAGT-3' (universal M13-20 prim- of the inoculum (1, 2). Improvements to reduce the lag time er). The amplified cDNA was cloned into vector pCRII before feeding cessation might also be achieved by adding (Invitrogen) and subsequently excised by digestion with insecticidal genes to the fungus, an approach considered to BamHI, which cuts at sites incorporated into the forward have enormous potential for the improvement of biological primer and 19 nucleotides downstream of the Prl insert in the pesticides (5). amplified portion of the Bluescript vector. The 1.2-kb BamHI fragment was cloned into BamHI-cut pAN52-1. The resulting The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in Abbreviations: IEF, isoelectric focusing; AFC, 7-amino-4-trifluoro- accordance with 18 U.S.C. §1734 solely to indicate this fact. methyl coumarin. 6349 Downloaded by guest on September 25, 2021 6350 Agricultural Sciences: St. Leger et al. Proc. Natl. Acad. Sci. USA 93 (1996) recorded at 8-h intervals, and the data analyzed by probit analysis with standard software (18). LC50 values and ST50 values were considered significantly different if their 95% fiducial limits did not overlap. The time mortality data was also analyzed by the VISTAT time program (19). All insects were given a preweighed piece of diet 12 h after inoculation. Uneaten food was removed at the time of death and dried to a constant weight at 60°C. A sample of new food was dried in the same way to determine its water content and to allow an estimate of food consumption. Phenoloxidase Activation Studies. Gypsy moth (Lymantria dispar) larvae were kindly provided by Ann Hajek (Cornell University) from a laboratory colony. Larvae were injected -48 h after ecdysis into the 5th instar with affinity-purified preperations of subtilisin-like (Prl) or trypsin-like (Pr2) pro- teases from M. anisopliae (8) in a volume of 10 ,ul of TC-100 (GIBCO) tissue culture medium. Control insects were injected with autoclaved Prl or tissue culture medium only. To inves- tigate the mode of action of Prl on melanization, some insects were injected with Prl (in 10 ,ul of fluid) supplemented with 50 ng ofphenylthiourea (an inhibitor ofphenoloxidase) or 5 ,ug ATCACGATCCCGTACTAGAATTTGGAATCATG of leupeptin (an inhibitor of trypsins). Analysis of Hemolymph Samples. Hemolymph was col- Pgpd 1 Pr1 - *1 lected from a puncture in a proleg and centrifuged (12,000 x FIG. 1. Diagram of pMAPR-1. The cDNA coding for the M. g for 5 min), and proteins in the supernatant were precipitated anisopliae Pri proteinase is inserted 3' to theA. nidulansgpd promoter with trichloroacetic acid (5% final concentration). SDS/ sequence and 5' to terminator sequences from the A. nidulans trp C PAGE of hemolymph proteins (15 ,ug total protein per lane) gene. The sequence preceding the Prl start codon is shown at the was performed under reducing conditions on 4-20% gradient bottom. ApR, ampicillin resistance gene. Details of plasmid construc- gels, and proteins were stained with Coomassie blue or elec- tion are given in the experimental protocol. troblotted. Immunoblots were performed by using Prl-specific antibodies (20) and alkaline phosphatase-conjugated anti- vector was digested with Ncol, blunt ended with Mung bean rabbit secondary antibodies (Promega). nuclease to remove the gpd ATG translation start codon, and Immunoprecipitations were performed at various times up religated. Sequence analysis confirmed the orientation of the to 120 h postinoculation with wild-type or gpd-Prl-4. Hemo- insert in the recombinant vector and that the Prl initiator ATG lymph samples were taken 10 h after insects were injected with was in-frame with the gpd promoter. Isolation of genomic
Load more

Recommended publications
  • Metarhizium Anisopliae
    Biological control of the invasive maize pest Diabrotica virgifera virgifera by the entomopathogenic fungus Metarhizium anisopliae Dissertation zur Erlangung des akademischen Grades Dr. nat. techn. ausgeführt am Institut für Forstentomologie, Forstpathologie und Forstschutz, Departement für Wald- und Bodenwissenschaften eingereicht an der Universiät für Bodenkultur Wien von Dipl. Ing. Christina Pilz Erstgutachter: Ao. Univ. Prof. Dr. phil. Rudolf Wegensteiner Zweitgutachter: Dr. Ing. - AgrarETH Siegfried Keller Wien, September 2008 Preface “........Wir träumen von phantastischen außerirdischen Welten. Millionen Lichtjahre entfernt. Dabei haben wir noch nicht einmal begonnen, die Welt zu entdecken, die sich direkt vor unseren Füßen ausbreitet: Galaxien des Kleinen, ein Mikrokosmos in Zentimetermaßstab, in dem Grasbüschel zu undurchdringlichen Wäldern, Tautropfen zu riesigen Ballons werden, ein Tag zu einem halben Leben. Die Welt der Insekten.........” (aus: Claude Nuridsany & Marie Perennou (1997): “Mikrokosmos - Das Volk in den Gräsern”, Scherz Verlag. This thesis has been submitted to the University of Natural Resources and Applied Life Sciences, Boku, Vienna; in partial fulfilment of the requirements for the degree of Dr. nat. techn. The thesis consists of an introductory chapter and additional five scientific papers. The introductory chapter gives background information on the entomopathogenic fungus Metarhizium anisopliae, the maize pest insect Diabrotica virgifera virgifera as well as on control options and the step-by-step approach followed in this thesis. The scientific papers represent the work of the PhD during three years, of partial laboratory work at the research station ART Agroscope Reckenholz-Tänikon, Switzerland, and fieldwork in maize fields in Hodmezòvasarhely, Hungary, during summer seasons. Paper 1 was published in the journal “BioControl”, paper 2 in the journal “Journal of Applied Entomology”, and paper 3 and paper 4 have not yet been submitted for publications, while paper 5 has been submitted to the journal “BioControl”.
    [Show full text]
  • Coleoptera: Scarabaeidae: Dynastinae) and the Separation of Dynastini and Oryctini
    Chromosome analyses challenge the taxonomic position of Augosoma centaurus Fabricius, 1775 (Coleoptera: Scarabaeidae: Dynastinae) and the separation of Dynastini and Oryctini Anne-Marie DUTRILLAUX Muséum national d’Histoire naturelle, UMR 7205-OSEB, case postale 39, 57 rue Cuvier, F-75231 Paris cedex 05 (France) Zissis MAMURIS University of Thessaly, Laboratory of Genetics, Comparative and Evolutionary Biology, Department of Biochemistry and Biotechnology, 41221 Larissa (Greece) Bernard DUTRILLAUX Muséum national d’Histoire naturelle, UMR 7205-OSEB, case postale 39, 57 rue Cuvier, F-75231 Paris cedex 05 (France) Dutrillaux A.-M., Mamuris Z. & Dutrillaux B. 2013. — Chromosome analyses challenge the taxonomic position of Augosoma centaurus Fabricius, 1775 (Coleoptera: Scarabaeidae: Dynastinae) and the separation of Dynastini and Oryctini. Zoosystema 35 (4): 537-549. http://dx.doi.org/10.5252/z2013n4a7 ABSTRACT Augosoma centaurus Fabricius, 1775 (Melolonthidae: Dynastinae), one of the largest Scarabaeoid beetles of the Ethiopian Region, is classified in the tribe Dynastini MacLeay, 1819, principally on the basis of morphological characters of the male: large frontal and pronotal horns, and enlargement of fore legs. With the exception of A. centaurus, the 62 species of this tribe belong to ten genera grouped in Oriental plus Australasian and Neotropical regions. We performed cytogenetic studies of A. centaurus and several Asian and Neotropical species of Dynastini, in addition to species belonging to other sub-families of Melolonthidae Leach, 1819 and various tribes of Dynastinae MacLeay, 1819: Oryctini Mulsant, 1842, Phileurini Burmeister, 1842, Pentodontini Mulsant, 1842 and Cyclocephalini Laporte de Castelnau, 1840. The karyotypes of most species were fairly alike, composed of 20 chromosomes, including 18 meta- or sub-metacentric autosomes, one acrocentric or sub-metacentric X-chromosome, and one punctiform Y-chromosome, as that of their presumed common ancestor.
    [Show full text]
  • Field Pests - in Temperate Zone of Europe - Georgikon Kar Növényvédelmi Intézet
    Module of Applied Entomology Field pests - in temperate zone of Europe - Georgikon Kar Növényvédelmi Intézet AZ ELŐADÁS LETÖLTHETŐ: - Main topics •Polyphagous field pests •Wheat pests •Corn pests •Sunflower pests Main topics •Rapeseed pests •Alfalfa and pea pests •Potato pests •Rice pests I. Polyphagous field pests Polyphagous field pests • PHYTOPHAGY: • MONOPHAGOUS SPECIES: • Feed on only one plant taxon • OLIGOPHAGOUS SPECIES: Feed on a few plant taxa (for example: one plant-family) • POLYPHAGOUS SPECIES (generalist): Feed on many plant taxa TÁMOP-4.1.2.A/2-10/1-2010-0012 5 Polyphagous field pests • POLYPHAGOUS PESTS: • Cockchafers’ (Melolonthidae) larvae (grubs) • Click beetles’ (Elateridae) larvae (wireworms) • Noctuid moths’ (Noctuidae) larvae (caterpillars) • Rodents (common vole, gopher, hamster) • Games (rabbit, roe-deer, red-deer, wild boar) TÁMOP-4.1.2.A/2-10/1-2010-0012 6 Polyphagous field pests • COCKCHAFERS: • 12 species living in Hungary • The most importants are the followings: 1. Common cockchafer (Melolontha melolontha) TÁMOP-4.1.2.A/2-10/1-2010-0012 7 Polyphagous field pests 2. Forest cockchafer (Melolontha hippocastani) TÁMOP-4.1.2.A/2-10/1-2010-0012 8 Polyphagous field pests 3. April beetle (Rhizotrogus aequinoctialis) TÁMOP-4.1.2.A/2-10/1-2010-0012 9 Polyphagous field pests 4. Summer chafer (Amphimallon solstitiale) TÁMOP-4.1.2.A/2-10/1-2010-0012 10 Polyphagous field pests 5. June beetle (Polyphylla fullo) TÁMOP-4.1.2.A/2-10/1-2010-0012 11 Polyphagous field pests 6. Vine chafer (Anomala vitis) TÁMOP-4.1.2.A/2-10/1-2010-0012 12 Polyphagous field pests 7.
    [Show full text]
  • Abstracts of the 11Th Arab Congress of Plant Protection
    Under the Patronage of His Royal Highness Prince El Hassan Bin Talal, Jordan Arab Journal of Plant Protection Volume 32, Special Issue, November 2014 Abstracts Book 11th Arab Congress of Plant Protection Organized by Arab Society for Plant Protection and Faculty of Agricultural Technology – Al Balqa AppliedUniversity Meridien Amman Hotel, Amman Jordan 13-9 November, 2014 Edited by Hazem S Hasan, Ahmad Katbeh, Mohmmad Al Alawi, Ibrahim Al-Jboory, Barakat Abu Irmaileh, Safa’a Kumari, Khaled Makkouk, Bassam Bayaa Organizing Committee of the 11th Arab Congress of Plant Protection Samih Abubaker Chairman Faculty of Agricultural Technology, Al Balqa AppliedApplied University, Al Salt, Jordan Hazem S. Hasan Secretary Faculty of Agricultural Technology, Al Balqa AppliedUniversity, Al Salt, Jordan Ali Ebed Allah khresat Treasurer General Secretary, Al Balqa AppliedUniversity, Al Salt, Jordan Mazen Ateyyat Member Faculty of Agricultural Technology, Al Balqa AppliedUniversity, Al Salt, Jordan Ahmad Katbeh Member Faculty of Agriculture, University of Jordan, Amman, Jordan Ibrahim Al-Jboory Member Faculty of Agriculture, Bagdad University, Iraq Barakat Abu Irmaileh Member Faculty of Agriculture, University of Jordan, Amman, Jordan Mohmmad Al Alawi Member Faculty of Agricultural Technology, Al Balqa AppliedUniversity, Al Salt, Jordan Mustafa Meqdadi Member Agricultural Materials Company (MIQDADI), Amman Jordan Scientific Committee of the 11th Arab Congress of Plant Protection • Mohmmad Al Alawi, Al Balqa Applied University, Al Salt, Jordan, President
    [Show full text]
  • Microbial Biopesticides: Opportunities and Challenges
    CAB Reviews: Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources 2011 6, No. 056 Review Microbial biopesticides: opportunities and challenges Opender Koul* Address: Insect Biopesticide Research Centre, 30- Parkash Nagar, Jalandhar 144003, India. *Correspondence: Email: okoul©airtelmail.in; okoul©koulresearch.org Received: 10 October 2011 Accepted: 17 November 2011 doi: 10.1079/PAVSNNR20116056 The electronic version of this article is the definitive one. It is located here: http://www.cabi.org/cabreviews © CAB International 2011 (Online ISSN 1749-8848) Abstract Pesticides based on microorganisms and their products have proven to be highly effective, species specific and eco-friendly in nature, leading to their adoption in pest management strategies around the world. The microbial biopesticide market constitutes about 90% of total biopesticides and there is ample scope for further development in agriculture and public health, although there are challenges as well. This article reviews the various microbial biopesticides that are commercially available, the different approaches for their production and development, the recent technological advances and the challenges faced by the microbial biopesticide field in the future. Keywords: Microbials, Bacteria, Viruses, Fungi, Nematodes, Biopesticides, Pest management, Commercialization Introduction and certain minerals) is increasingly being adopted. North America uses the largest percentage of the biopesticide The damage and destruction inflicted on crops by pests market share at 44%, followed by the EU and Oceania have had a serious impact on farming and agricultural with 20% each, South and Latin American countries with practices for a long time. These pests include insects, 10% and about 6% in India and other Asian countries fungi, weeds, viruses, nematodes, animals and birds.
    [Show full text]
  • Real-Time Acoustic Identification of Invasive Wood-Boring Beetles
    Real-time Acoustic Identification of Invasive Wood-boring Beetles James Schofield Submitted for the degree of Doctor of Philosophy University of York Department of Electronics July 2011 Abstract Wood-boring beetles are a cause of significant economic and environmental cost across the world. A number of species which are not currently found in the United King- dom are constantly at risk of being accidentally imported due to the volume of global trade in trees and timber. The species which are of particular concern are the Asian Longhorn (Anoplophora glabripennis), Citrus Longhorn (A. chinensis) and Emerald Ash Borer (Agrilus planipennis). The Food and Environment Research Agency’s plant health inspectors currently manually inspect high risk material at the point of import. The de- velopment of methods which will enable them to increase the probability of detection of infestation in imported material are therefore highly sought after. This thesis describes research into improving acoustic larvae detection and species identification methods, and the development of a real-time system incorporating them. The detection algorithm is based upon fractal dimension analysis and has been shown to outperform previously used short-time energy based detection. This is the first time such a detection method has been applied to the analysis of insect sourced sounds. The species identification method combines a time domain feature extraction technique based upon the relational tree representation of discrete waveforms and classification using arti- ficial neural networks. Classification between two species, A. glabripennis and H. bajulus, can be performed with 92% accuracy using Multilayer Perceptron and 96.5% accuracy using Linear Vector Quantisation networks.
    [Show full text]
  • Phytophagous Arthropod Species Associated with Oil Bearing Rose, Rosa Damascena Miller, in Isparta Province with Distributional Remarks
    SDU Journal of Science (E-Journal), 2011, 6 (1): 9-25 _____________________________________________________________ Phytophagous Arthropod Species Associated with Oil Bearing Rose, Rosa damascena Miller, in Isparta Province with Distributional Remarks Ozan Demirözer*, İsmail Karaca Süleyman Demirel University, Agricultural Faculty, Plant Protection Department, 32260, Isparta, Turkey *Corresponding author e-mail: [email protected] Received: 05 January 2011, Accepted: 02 March 2011 Abstract: The study is based on field researches made in 2006–2007 in order to determine the phytophagous arthropod species and the deployment of those species that are economically important in the oil-bearing rose production fields in the province of Isparta. As a result, 62 species were determined, 60 of which belongs to 24 families of 6 orders in Insecta and 2 of which belongs to 2 families of 1 order in Arachnida. In the study, 57 species were identified up to species level and 5 species were identified up to genus level. It is seen that 20 species of them are previously identified as pests in Rosa damascena Miller in production fields in the literature. Ten of the species determined in the study are recorded as new for the oil-bearing rose pest fauna in the province of Isparta. Key words: Oil Bearing Rose, Rosa damascena, pest, phytophagous, Isparta Isparta İli Yağ Gülü, Rosa damascena Miller, Alanlarında Bulunan Fitofag Arthropod Türleri ve Önemlilerinin Yayılışları Özet: Bu çalışma, Isparta ili yağ gülü üretim alanlarında bulunan fitofag türlerin belirlenmesi ve ekonomik açıdan önemlilerinin yayılışlarının ortaya çıkarılması amacıyla 2006-2007 yılları arasında yürütülmüştür. Çalışma sonucunda, Insecta sınıfının 6 takımına ait 24 familyadan toplam 60, Arachnida sınıfına ait 1 takıma bağlı 2 familyadan 2 olmak üzere toplamda 62 türün varlığı belirlenmiştir.
    [Show full text]
  • Fungal Entomopathogens: a Systematic Review Rajat Sharma1* and Priyanka Sharma2
    Sharma and Sharma Egyptian Journal of Biological Pest Control (2021) 31:57 Egyptian Journal of https://doi.org/10.1186/s41938-021-00404-7 Biological Pest Control REVIEW ARTICLE Open Access Fungal entomopathogens: a systematic review Rajat Sharma1* and Priyanka Sharma2 Abstract Background: Apprehensions about the safety and the environment regarding the insecticidal application against insect infestations have directed our attention toward advancement of biological mediators so that they are assimilated into the concept of integrated pest management stratagems to develop a more practical approach for the management of insect pests. Management of insect pests by making use of biological approaches (such as fungal entomopathogens (EPF) or others which are antagonistic to insect population) provides a substitute approach which reduces the continuous use of chemical amalgams against insect pests. Main body: The present review provides a framework of the present status of information on EPF as it identifies with their current use as biological control of pest infestations. To utilize a variety of biological control methodologies against insect hosts, it is essential to improve our comprehension of the ecology of EPF and also their role in nature. This article may assist us with understanding the virulence and the virulence factors related with EPF and present the latest developments and accomplishments in the significant field. We focus on recent instances of studies that show the overall patterns in interactions among insect pests and EPF prompting
    [Show full text]
  • Pest Control: Insects and Other Arthropods - Divender Gupta
    AGRICULTURAL SCIENCES – Vol. II - Pest Control: Insects and Other Arthropods - Divender Gupta PEST CONTROL: INSECTS AND OTHER ARTHROPODS Divender Gupta Department of Entomology, Dr. Y.S. Parmar University of Horticulture & Forestry, Nauni (Solan), India Keywords: Pest, insecticides, natural enemies, biological control, insect growth regulators (IGR’s), semiochemicals, allelochemicals, fumigants, neonicotinoids, avermectins, economic threshold (ET), economic injury level (EIL), regulatory control. Contents 1. Introduction 2. Insecticidal control 3. Biological control 3.1. Microbial control 3.1.1. Protozoa 3.1.2. Fungi 3.1.3. Bacteria 3.1.4. Viruses 4. Insect growth regulators 5. Sterilants 6. Semiochemicals 6.1. Pheromones 6.1.1. Sex pheromones 6.2. Allelochemicals 6.2.1 Allomones 6.2.2. Kairomones 6.2.3. Synomone 7. Plant resistance 8. Mechanical and physical control 8.1. Mechanical control 8.1.1. Mechanical exclusion 8.2. Physical control 9. Cultural control 9.1. Crop rotation 9.2. TrapUNESCO crops – EOLSS 9.3. Strip cutting 9.4. Time of plantingSAMPLE and harvest CHAPTERS 9.5. Clean cultivation 9.6. Non-host or banker plants 10. Plant products 11. Fumigants 12. Novel insecticides 12.1. Avermectins 12.1.1. Emamectin benzoate 12.2. Spinosad 12.3 Neonicotinoids ©Encyclopedia of Life Support Systems (EOLSS) AGRICULTURAL SCIENCES – Vol. II - Pest Control: Insects and Other Arthropods - Divender Gupta 12.4. Nereistoxin related insecticides 12.5 Formamidines 12.6 Phloroglucinol 13. Regulatory control 14. Conclusion Acknowledgements Glossary Bibliography Biographical Sketch Summary Insect pests and mites account for 15% loss of our agricultural produce out of a total of 40% caused by various pests.
    [Show full text]
  • Coleoptera: Scarabaeoidea: Rutelidae: Anomalinae
    Eur. J. Entorno?. 98: 311-320, 2001 ISSN 1210-5759 Larval morphology of some Anisopliini grain beetles with a key to their larvae (Coleóptera: Scarabaeoidea: Rutelidae: Anomalinae) Estefanía MICÓ, José R. VERDÚ and E duardo GALANTE Centro Iberoamericano de la Biodiversidad (CIBIO), Universidad de Alicante, 03080-Alicante, Spain Key words. Scarabaeoidea, Rutelidae, Anomalinae, Anisopliini, Anisoplia, larvae, morphology, description, taxonomy, key Abstract. The third instar larvae of three Anisoplia species, Anisoplia baetica Erichson, 1847,Anisoplia depressa Erichson, 1847 and Anisoplia remota Reitter, 1889 are described and illustrated to show the diagnostic characters of the species. The third instar larva of the monospecific genus Anthoplia, represented by Anthoplia floricola (F., 1787) is also described and illustrated. These four species are included in a revised key to the larvae of Anisopliini, which now includes four genera, and ten species. The taxonomic status of Anthoplia based on the larval morphology, is discussed. INTRODUCTION agricola (Poda, 1761). However, none of these contribu­ The tribe Anisopliini includes a total of five genera in tions constituted a detailed description and no more new the Paleartic Region (Baraud, 1986): Chaetopteroplia descriptions have been published. Medvedev, 1949, Hemichaetoplia Baraud, 1986, Bran- Studies of larvae suggested that larval mophology coplia Baraud, 1986, Anthoplia Medvedev, 1949, and could be very useful in the systematic analysis of the Anisoplia Schonherr, 1817. The first three
    [Show full text]
  • Exploitation of Synergistic Effects Between Semiochemicals and Metarhizium Brunneum Against Soil Pests
    Exploitation of synergistic effects between semiochemicals and Metarhizium brunneum against soil pests Dissertation zur Erlangung des Doktorgrades der Fakultät für Agrarwissenschaften der Georg-August-Universität Göttingen vorgelegt von Michael Albert Brandl geboren in Kempten (Allgäu) Göttingen, Mai 2016 _________________________________________________________________ __________ D7 1. Referent: Prof. Dr. Stefan Vidal 2. Referent: Prof. Dr. Anant Patel Tag der mündlichen Prüfung: 13. Mai 2015 Ich danke dir, Herr, mein Gott, von ganzem Herzen und ehre deinen Namen ewiglich. Psalm 86,12 Table of contents Summary ................................................................................................................ 1 General introduction ............................................................................................... 3 Objectives............................................................................................................... 8 Chapter 1 ............................................................................................................... 9 Screening of botanical extracts for repellence against western corn rootworm larvae ..................................................................................................... Chapter 2 ............................................................................................................. 10 A stress-and-kill approach using a combination of turmeric and Metarhizium brunneum for western corn rootworm larval control .........................................
    [Show full text]
  • Scarabaeidae)
    Hellenic Plant Protection Journal 10: 84-90, 2017 DOI 10.1515/hppj-2017-0010 SHORT COMMUNICATION A catalogue of the Coleoptera of the G.P. Moazzo Collection in the Goulandris Natural History Museum. Part III (Scarabaeidae) J. Tylianakis1, M. Dimaki2* and V. Perdiou2 Summary This is a detailed list of 223 species (727 specimens) of the family Scarabaeidae, the subfam- ilies Dynastinae (21 species), Melolonthinae (11 species), Rutelinae (29 species), Aphodiinae (104 spe- cies), Cetoniinae (59 species), represented in G.P. Moazzo’s collection at the Goulandris Natural History Museum. All label data for each specimen are given. The aim of this paper is to present this collection as reference data for comparison with recent entomological material. Additional keywords: Scarabaeidae, Dynastinae, Melolonthinae, Rutelinae, Aphodiinae, Cetoniinae Introduction erence information regarding insect speci- mens of Scarabaeidae. The Entomological Collection of the Gou- The material is of historical importance, landris Natural History Museum (GNHM) was with some specimens over 100 years old established in 1973. One particularly signifi - with a wide geographical distribution across cant collection is that of Georgi Polychronis 5 continents (Europe, Africa, Asia, America, Moazzo, which contains insects (Coleoptera Australia). It is published with the informa- in their majority) collected since 1910 (Gou- tion given exactly as it appears on the in- landris, 1977). Moazzo‘s entomological col- dividual labels. In some cases data may be lection of GNHM includes 5500 specimens. missing such as collection date and exact lo- Among them there are 1312 beetle species cality. An eff ort has been made to provide belonging to 58 families (Dimaki and Tyli- the current nomenclature, where possible.
    [Show full text]