DOCSLIB.ORG

Table S3. up Or Down Regulated Genes in Tcof1 Over-Expressed

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Table S3. up Or Down Regulated Genes in Tcof1 Over-Expressed Table S3. Up or down regulated genes in Tcof1 over-expressed neuroblastoma N1E-115 cells involved in differentbiological process analysed by DAVID database P Pop Pop Fold Term Genes Bonferroni Benjamini FDR Value Hits Total Enrichment DBF4, AURKA, AURKB, CDC16, GM8416, APP, GM13337, CDKN2A, CUL7, CASP8AP2, CDKN2C, INCENP, ATF6B, H2AFX, CCNA2, CDCA5, GO:0007049~cell cycle 5.62E-15 ASPM, STAG1, ANAPC1, ANAPC2, GM14176, GM5951, RAN, LIG1, 611 13588 2.088741 1.87E-11 1.87E-11 1.03E-11 MAPK1, MAD2L1, LOC100044742, LOC100047340, RCC2, MAPK3, ARL8B, ANAPC7, AKAP8, MCT MAD1L1, DBF4, AURKA, CDC16, AURKB, GM8416, APP, INCENP, ATF6B, GM5593, CDCA5, CCNA2, ASPM, CABLES1, STAG1, ANAPC1, GO:0000278~mitotic cell 1.12E-13 CDC6, CDK1, ANAPC2, KIF11, GM14176, ANP32B, RAN, DSN1, 244 13588 2.769043 3.70E-10 1.85E-10 2.04E-10 cycle CCNF, UBE2I, HMGA2, CDK2, CCND1, MAD2L1, RCC2, LOC100047340, BUB1B, MAPRE2, AKAP8, HA MAD1L1, GM15452, CDC16, AURKB, GM8416, CCNE2, CCNE1, CDC42, CDC45, CDKN2A, CDCA7, EVI5, INCENP, GM5593, CDCA5, CCNA2, GO:0051301~cell division 2.95E-12 CABLES1, ASPM, STAG1, ANAPC1, CDC7, CDC6, CDK1, ANAPC2, 281 13588 2.518933 9.72E-09 3.24E-09 5.37E-09 KIF11, GM14176, RAN, DSN1, LIG1, CCNF, UBE2I, CDK7, HMGA2, CDK4, CDK2, MCM5, CCND MAD1L1, CDC16, AURKB, GM8416, INCENP, ATF6B, GM5593, CDCA5, CCNA2, ASPM, STAG1, ANAPC1, CDC6, ANAPC2, CDK1, KIF11, GO:0000087~M phase of 4.39E-12 GM14176, RAN, DSN1, CCNF, UBE2I, HMGA2, CDK2, MAD2L1, RCC2, 194 13588 2.874621 1.45E-08 3.62E-09 7.99E-09 mitotic cell cycle LOC100047340, BUB1B, MAPRE2, AKAP8, MAPRE1, ANAPC7, ARL8B, HAUS8, HAUS3, FZR1, H MAD1L1, CDC16, AURKB, GM8416, INCENP, ATF6B, GM5593, CDCA5, GO:0007067~mitosis 2.45E-11 CCNA2, ASPM, STAG1, ANAPC1, CDC6, ANAPC2, CDK1, KIF11, 190 13588 2.822249 8.08E-08 1.62E-08 4.46E-08 GM14176, RAN, DSN1, CCNF, UBE2I, HMGA2, CDK2, MAD2L1, RCC2, LOC100047340, BUB1B, MAPRE2, AKAP8, MAPRE1, ANAPC7, ARL8B, HAUS8, HAUS3, FZR1, H MAD1L1, CDC16, AURKB, GM8416, INCENP, ATF6B, GM5593, CDCA5, CCNA2, ASPM, STAG1, ANAPC1, CDC6, ANAPC2, CDK1, KIF11, GO:0000280~nuclear 2.45E-11 GM14176, RAN, DSN1, CCNF, UBE2I, HMGA2, CDK2, MAD2L1, RCC2, 190 13588 2.822249 8.08E-08 1.62E-08 4.46E-08 division LOC100047340, BUB1B, MAPRE2, AKAP8, MAPRE1, ANAPC7, ARL8B, HAUS8, HAUS3, FZR1, H MAD1L1, DBF4, GM15452, CDC16, AURKB, GM8416, APP, INCENP, ATF6B, GM5593, H2AFX, CDCA5, FANCA, CCNA2, CABLES1, ASPM, GO:0022403~cell cycle 6.45E-11 STAG1, ANAPC1, CDC6, CDK1, ANAPC2, KIF11, GM14176, ANP32B, 328 13588 2.288775 2.13E-07 3.54E-08 1.17E-07 phase RAN, DSN1, CCNF, UBE2I, HMGA2, CDK2, KLHDC3, CCND1, MAD2L1, RCC2, LOC100047340, MAD1L1, CDC16, AURKB, GM8416, INCENP, ATF6B, GM5593, CDCA5, CCNA2, ASPM, STAG1, ANAPC1, CDC6, ANAPC2, CDK1, KIF11, GO:0048285~organelle 9.86E-11 GM14176, RAN, DSN1, CCNF, UBE2I, HMGA2, CDK2, MAD2L1, RCC2, 197 13588 2.721966 3.25E-07 4.64E-08 1.79E-07 fission LOC100047340, BUB1B, MAPRE2, AKAP8, MAPRE1, ANAPC7, ARL8B, HAUS8, HAUS3, FZR1, H LOC630896, MAD1L1, DBF4, GM15452, CDC16, AURKB, GM8416, GM8096, APP, CGREF1, GM13337, CDKN2A, INCENP, ATF6B, GO:0022402~cell cycle 1.83E-10 GM5593, H2AFX, CCNA2, CDCA5, FANCA, CABLES1, ASPM, STAG1, 393 13588 2.128536 6.03E-07 7.54E-08 3.33E-07 process ANAPC1, CDC6, ANAPC2, CDK1, KIF11, GM14176, ANP32B, DSN1, RAN, CCNF, UBE2I, HMGA2, CDK2, MAD1L1, GM15452, CDC16, AURKB, GM8416, INCENP, ATF6B, GM5593, H2AFX, CDCA5, FANCA, CCNA2, ASPM, STAG1, ANAPC1, GO:0000279~M phase 2.29E-09 283 13588 2.273755 7.55E-06 8.39E-07 4.17E-06 CDC6, CDK1, ANAPC2, KIF11, GM14176, RAN, DSN1, CCNF, UBE2I, HMGA2, CDK2, KLHDC3, MAD2L1, RCC2, LOC100047340, BUB1B, MAPRE2, AKAP8, HAUS8, ARL8B, HMGN1, MORF4L1, KIF22, MORF4L2, HNRPLL, FANCM, GPX1, ANKRD17, CASP3, CASP9, MAP1LC3A, ATG5, COL4A3BP, HMOX1, GO:0033554~cellular 1.03E-07 AEN, GPX4, GPX3, GM2992, H2AFX, FANCG, MAPKBP1, MAP2K7, 404 13588 1.911305 3.38E-04 3.38E-05 1.87E-04 response to stress FANCA, FANCC, CLN3, CDK1, DDB1, LIG1, AARS, CCDC47, GM5806, GTF2H2, MAPK1, CCND1, BTG2, LO DBF4, CITED2, CDT1, CSNK2A2, CCNE2, CDC42, CCNE1, APP, CASP3, CDKN2A, CUL7, ATF6B, CDK5RAP3, H2AFX, LTB, CABLES1, GO:0051726~regulation of 1.40E-07 CDK1, GTPBP4, GM7334, CCNI, LOC100046019, HERC2, CDK4, 214 13588 2.305276 4.62E-04 4.20E-05 2.55E-04 cell cycle HRAS1, PURA, CCND1, MAD2L1, HMG1L1, BTG3, GM5853, LOC637733, CDK11B, GM7468, BAT2, LOC GO:0006270~DNA 2.11E-07 CCNE2, CCNE1, CDC45, MCM7, MCM2, MCM3, MCM4, MCM5, MCM6 10 13588 9.652092 6.95E-04 5.79E-05 3.84E-04 replication initiation MORF4L1, HMGN1, MORF4L2, CBX4, GM13646, INO80, CBX1, CBX8, CBX6, CBX5, HIST1H2BP, HIST1H2BM, HIST1H2BN, H2AFV, GO:0006325~chromatin 3.12E-07 HIST1H2BL, HIST1H2BJ, H2AFZ, H2AFX, MTA2, LOC100045490, 315 13588 2.008725 0.001026 7.90E-05 5.67E-04 organization HMG20A, HDAC11, H2AFJ, KDM2B, A730008H23RIK, GM11277, GM11276, ASF1B, DNMT3B, ASF1A, GM1 HMGN1, MORF4L1, MORF4L2, CBX4, GM13646, INO80, CBX1, CBX8, CBX6, CBX5, HIST1H2BP, HIST1H2BM, HIST1H2BN, H2AFV, GO:0051276~chromosome 4.72E-07 HIST1H2BL, ATF6B, HIST1H2BJ, H2AFZ, H2AFX, ACIN1, CDCA5, 404 13588 1.858213 0.001553 1.11E-04 8.59E-04 organization MTA2, LOC100045490, HMG20A, HDAC11, H2AFJ, KDM2B, MAD2L1, AKAP8, BLM, A730008H23RIK, GM MORF4L1, CBX4, GM13646, CBX1, CBX8, CBX6, CBX5, HIST1H2BP, GO:0006333~chromatin 4.97E-07 LOC100047898, HIST1H2BM, HIST1H2BN, H2AFV, HIST1H2BL, 109 13588 2.85332 0.001636 1.09E-04 9.04E-04 assembly or disassembly GM9531, HIST1H2BJ, H2AFZ, H2AFX, LOC100045490, MCM2, H2AFJ, NPTXR, HIST1H2AB, HIST1H2AC, HIST1H2AG, HIST1H2AD, A730008H23RIK, HIST1H2AE, HIST2 AURKA, LPAR2, AURKB, GM8416, MAP3K7, CSNK2A2, APP, MAP3K5, MAP2K7, EGFR, TYRO3, MAPKSP1, CSNK1G1, LOC100046344, GO:0016310~phosphorylat 8.22E-06 MAP4K3, MAP4K4, MAPK1, NME1, MAPK3, CARTPT, MST1R, EIF2AK3, 718 13588 1.538479 0.026717 0.001691 0.014957 ion GNAI2, ERBB3, CHEK1, ADRBK1, ATP6V1B2, ATP6V0B, CD74, FGD4, MDFI, ATR, HGF, GLYCTK, ATP5D, FIGNL1, ATP10A, ATP5G2, ATP6V1B2, PNP, ATP5G3, ATP6V0B, CANT1, ATP2B2, DHODH, ENTPD2, IMPDH2, GO:0009259~ribonucleoti 9.03E-06 LOC100045567, GM5081, ATP1A3, ATP1A1, AMPD2, ATP13A2, 125 13588 2.488095 0.029301 0.001748 0.016425 de metabolic process AMPD3, LOC100046344, ATP6V1D, GART, ATP6V1A, ATP2C2, ATP6V0E2, NME1, ATP8A2, ADSL, ATP5A1, ATP6V0A2, STYX, LPAR2, AURKA, AURKB, GM8416, CSNK2A2, MAP3K7, APP, MAP3K5, MAP2K7, EGFR, TYRO3, MAPKSP1, CSNK1G1, GM5951, GO:0006796~phosphate 1.20E-05 LOC100046344, MAP4K3, MAPK1, MAP4K4, LOC100044742, NME1, 866 13588 1.473696 0.038636 0.002187 0.021761 metabolic process MAPK3, CARTPT, MST1R, EIF2AK3, GM8783, GNAI2, ERBB3, DUSP10, CHEK1, ADRBK1, ATP6V1B2, STYX, LPAR2, AURKA, AURKB, GM8416, CSNK2A2, MAP3K7, APP, MAP3K5, MAP2K7, EGFR, TYRO3, MAPKSP1, CSNK1G1, GM5951, GO:0006793~phosphorus 1.20E-05 LOC100046344, MAP4K3, MAPK1, MAP4K4, LOC100044742, NME1, 866 13588 1.473696 0.038636 0.002187 0.021761 metabolic process MAPK3, CARTPT, MST1R, EIF2AK3, GM8783, GNAI2, ERBB3, DUSP10, CHEK1, ADRBK1, ATP6V1B2, GO:0034404~nucleobase, ATP5D, CTPS, G6PDX, ATP10A, DTYMK, ATP5G2, CTPS2, CAD, nucleoside and ATP6V1B2, ATP5G3, PNP, ATP6V0B, ATP2B2, DHODH, GUCY1A3, 1.81E-05 179 13588 2.156892 0.05785 0.003131 0.032909 nucleotide biosynthetic IMPDH2, ADSSL1, LOC100045567, GM5081, ATP1A3, ATP1A1, process AMPD2, ATP13A2, AMPD3, ATP6V1D, LOC100046344, GART, ATP6V1A, ATP2C2, DHFR, ATP6V0E2, NME1, ATP5D, CTPS, G6PDX, ATP10A, DTYMK, ATP5G2, CTPS2, CAD, GO:0034654~nucleobase, ATP6V1B2, ATP5G3, PNP, ATP6V0B, ATP2B2, DHODH, GUCY1A3, nucleoside, nucleotide 1.81E-05 IMPDH2, ADSSL1, LOC100045567, GM5081, ATP1A3, ATP1A1, 179 13588 2.156892 0.05785 0.003131 0.032909 and nucleic acid AMPD2, ATP13A2, AMPD3, ATP6V1D, LOC100046344, GART, biosynthetic process ATP6V1A, ATP2C2, DHFR, ATP6V0E2, NME1, ATP5D, LOC630896, CTPS, DTYMK, ATP10A, G6PDX, CAD, PNP, GO:0044271~nitrogen GM8096, GOT2, ATP2B2, GM13337, GATA3, GUCY1A3, CHRNA7, compound biosynthetic 2.01E-05 GM6742, ENOPH1, IMPDH2, HSP90AA1, ATP6V1D, LOC100046344, 302 13588 1.846611 0.0641 0.003307 0.036584 process ATP6V1A, ATP2C2, NME1, ADK, ADSL, FLAD1, SMS, PRPS1, GM7669, ATP5G2, AZIN1, CTPS2, ATP6 ATP5D, CTPS, G6PDX, ATP10A, DTYMK, ATP5G2, CTPS2, ATP6V1B2, ATP5G3, PNP, ATP6V0B, ATP2B2, DHODH, GUCY1A3, IMPDH2, GO:0009165~nucleotide 2.40E-05 ADSSL1, LOC100045567, GM5081, ATP1A3, ATP1A1, AMPD2, 174 13588 2.157236 0.076163 0.003765 0.043747 biosynthetic process ATP13A2, AMPD3, ATP6V1D, LOC100046344, GART, ATP6V1A, ATP2C2, DHFR, ATP6V0E2, NME1, ADK, ATP5D, ATP10A, ATP5G2, ATP6V1B2, PNP, ATP5G3, ATP6V0B, ATP2B2, DHODH, IMPDH2, LOC100045567, GM5081, ATP1A3, GO:0009260~ribonucleoti 2.43E-05 ATP1A1, AMPD2, LOC100046344, ATP6V1D, AMPD3, ATP13A2, 111 13588 2.512056 0.076987 0.003635 0.04424 de biosynthetic process GART, ATP6V1A, ATP2C2, ATP6V0E2, NME1, ATP8A2, ADSL, ATP5A1, ATP6V0A2, PRPS1 GO:0007033~vacuole CLN3, HEXB, ACP2, FIG4, HOOK2, MAN2A1, MAP1LC3A, AKTIP, 3.19E-05 34 13588 4.100562 0.09964 0.004553 0.057957 organization ATG5, LYST, GAA, CLN5, GBA GM13646, HIST1H2BP, LOC100047898, HIST1H2BM, HIST1H2BN, GO:0006323~DNA packaging 4.22E-05 H2AFV, HIST1H2BL, GM9531, HIST1H2BJ, ATF6B, H2AFZ, H2AFX, 101 13588 2.548407 0.129828 0.005778 0.076782 ACIN1, CDCA5, MTA2, LOC100045490, H2AFJ, MCM2, AKAP8, HIST1H2AB, HIST1H2AC, HIST1H2AG, HIST1H2AD, HIST1H2AE, A730008H23RIK, HIST2H3C1, GM1127 ATP5D, FIGNL1, ATP10A, ATP5G2, ATP6V1B2, PNP, ATP5G3, GO:0009150~purine ATP6V0B, ATP2B2, ENTPD2, IMPDH2, LOC100045567, ATP1A3, ribonucleotide metabolic 8.28E-05 ATP1A1, AMPD2, LOC100046344, ATP6V1D, AMPD3, ATP13A2, 119 13588 2.343178 0.238639 0.010847 0.150482 process GART, ATP6V1A, ATP2C2, ATP6V0E2, NME1, ATP8A2, ADSL, ATP5A1, ATP6V0A2 HMGN1, MORF4L1, KIF22, FHIT, LOC100044969,
Load more

Recommended publications
  • Astrin-SKAP Complex Reconstitution Reveals Its Kinetochore
    RESEARCH ARTICLE Astrin-SKAP complex reconstitution reveals its kinetochore interaction with microtubule-bound Ndc80 David M Kern1,2, Julie K Monda1,2†, Kuan-Chung Su1†, Elizabeth M Wilson-Kubalek3, Iain M Cheeseman1,2* 1Whitehead Institute for Biomedical Research, Cambridge, United States; 2Department of Biology, Massachusetts Institute of Technology, Cambridge, United States; 3Department of Cell Biology, The Scripps Research Institute, La Jolla, United States Abstract Chromosome segregation requires robust interactions between the macromolecular kinetochore structure and dynamic microtubule polymers. A key outstanding question is how kinetochore-microtubule attachments are modulated to ensure that bi-oriented attachments are selectively stabilized and maintained. The Astrin-SKAP complex localizes preferentially to properly bi-oriented sister kinetochores, representing the final outer kinetochore component recruited prior to anaphase onset. Here, we reconstitute the 4-subunit Astrin-SKAP complex, including a novel MYCBP subunit. Our work demonstrates that the Astrin-SKAP complex contains separable kinetochore localization and microtubule binding domains. In addition, through cross-linking analysis in human cells and biochemical reconstitution, we show that the Astrin-SKAP complex binds synergistically to microtubules with the Ndc80 complex to form an integrated interface. We propose a model in which the Astrin-SKAP complex acts together with the Ndc80 complex to stabilize correctly formed kinetochore-microtubule interactions. *For correspondence: DOI: https://doi.org/10.7554/eLife.26866.001 [email protected] †These authors contributed equally to this work Introduction Competing interests: The The macromolecular kinetochore complex links chromosomes to dynamic microtubule polymers and authors declare that no harnesses the forces generated by microtubule growth and depolymerization to facilitate accurate competing interests exist.
    [Show full text]
  • Supplemental Figure 1. Vimentin
    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
    [Show full text]
  • Transcriptomic Analysis of the Aquaporin (AQP) Gene Family
    Pancreatology 19 (2019) 436e442 Contents lists available at ScienceDirect Pancreatology journal homepage: www.elsevier.com/locate/pan Transcriptomic analysis of the Aquaporin (AQP) gene family interactome identifies a molecular panel of four prognostic markers in patients with pancreatic ductal adenocarcinoma Dimitrios E. Magouliotis a, b, Vasiliki S. Tasiopoulou c, Konstantinos Dimas d, * Nikos Sakellaridis d, Konstantina A. Svokos e, Alexis A. Svokos f, Dimitris Zacharoulis b, a Division of Surgery and Interventional Science, Faculty of Medical Sciences, UCL, London, UK b Department of Surgery, University of Thessaly, Biopolis, Larissa, Greece c Faculty of Medicine, School of Health Sciences, University of Thessaly, Biopolis, Larissa, Greece d Department of Pharmacology, Faculty of Medicine, School of Health Sciences, University of Thessaly, Biopolis, Larissa, Greece e The Warren Alpert Medical School of Brown University, Providence, RI, USA f Riverside Regional Medical Center, Newport News, VA, USA article info abstract Article history: Background: This study aimed to assess the differential gene expression of aquaporin (AQP) gene family Received 14 October 2018 interactome in pancreatic ductal adenocarcinoma (PDAC) using data mining techniques to identify novel Received in revised form candidate genes intervening in the pathogenicity of PDAC. 29 January 2019 Method: Transcriptome data mining techniques were used in order to construct the interactome of the Accepted 9 February 2019 AQP gene family and to determine which genes members are differentially expressed in PDAC as Available online 11 February 2019 compared to controls. The same techniques were used in order to evaluate the potential prognostic role of the differentially expressed genes. Keywords: PDAC Results: Transcriptome microarray data of four GEO datasets were incorporated, including 142 primary Aquaporin tumor samples and 104 normal pancreatic tissue samples.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • Palmitoyl-Protein Thioesterase 1 Deficiency in Drosophila Melanogaster Causes Accumulation
    Genetics: Published Articles Ahead of Print, published on February 1, 2006 as 10.1534/genetics.105.053306 Palmitoyl-protein thioesterase 1 deficiency in Drosophila melanogaster causes accumulation of abnormal storage material and reduced lifespan Anthony J. Hickey*,†,1, Heather L. Chotkowski*, Navjot Singh*, Jeffrey G. Ault*, Christopher A. Korey‡,2, Marcy E. MacDonald‡, and Robert L. Glaser*,†,3 * Wadsworth Center, New York State Department of Health, Albany, NY 12201-2002 † Department of Biomedical Sciences, State University of New York, Albany, NY 12201-0509 ‡ Molecular Neurogenetics Unit, Center for Human Genetic Research, Massachusetts General Hospital, Boston, MA 02114 1 current address: Albany Medical College, Albany, NY 12208 2 current address: Department of Biology, College of Charleston, Charleston, SC 294243 3 corresponding author: Wadsworth Center, NYS Dept. Health, P. O. Box 22002, Albany, NY 12201-2002 E-mail: [email protected] 1 running title: Phenotypes of Ppt1-deficient Drosophila key words: Batten disease infantile neuronal ceroid lipofuscinosis palmitoyl-protein thioesterase CLN1 Drosophila corresponding author: Robert L. Glaser Wadsworth Center, NYS Dept. Health P. O. Box 22002 Albany, NY 12201-2002 E-mail: [email protected] phone: 518-473-4201 fax: 518-474-3181 2 ABSTRACT Human neuronal ceroid lipofuscinoses (NCLs) are a group of genetic neurodegenerative diseases characterized by progressive death of neurons in the central nervous system (CNS) and accumulation of abnormal lysosomal storage material. Infantile NCL (INCL), the most severe form of NCL, is caused by mutations in the Ppt1 gene, which encodes the lysosomal enzyme palmitoyl-protein thioesterase 1 (Ppt1). We generated mutations in the Ppt1 ortholog of Drosophila melanogaster in order to characterize phenotypes caused by Ppt1-deficiency in flies.
    [Show full text]
  • Yeast Genome Gazetteer P35-65
    gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • The Cardiomyocyte Cell Cycle," Novartis Found Symposium 274 (2006): 196-276
    DePauw University Scholarly and Creative Work from DePauw University Biology Faculty publications Biology 2006 The ac rdiomyocyte cell cycle Pascal J. Lafontant DePauw University, [email protected] Follow this and additional works at: http://scholarship.depauw.edu/bio_facpubs Part of the Biology Commons Recommended Citation Lafontant, Pascal J. E. and Loren J. Field. "The cardiomyocyte cell cycle," Novartis Found Symposium 274 (2006): 196-276. This Article is brought to you for free and open access by the Biology at Scholarly and Creative Work from DePauw University. It has been accepted for inclusion in Biology Faculty publications by an authorized administrator of Scholarly and Creative Work from DePauw University. For more information, please contact [email protected]. NIH Public Access Author Manuscript Novartis Found Symp. Author manuscript; available in PMC 2009 January 20. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Novartis Found Symp. 2006 ; 274: 196±276. The cardiomyocyte cell cycle Pascal J. E. Lafontant and Loren J. Field From the Wells Center for Pediatric Research and Krannert Institute of Cardiology, Indiana University School of Medicine, Indianapolis, IN 46202-5225. Abstract Many forms of cardiac disease are characterized by cardiomyocyte death due to necrosis, apoptosis and/or oncosis. Recently, the notion of promoting cardiac regeneration as a means to replace damaged heart tissue has engendered considerable interest. One approach to accomplish heart muscle regeneration entails promoting cardiomyocyte cell cycle activity in the surviving myocardium. Genetically modified mice have provided useful model systems to test the efficacy of specific pathways to promote cardiomyocyte proliferation in normal and diseased hearts.
    [Show full text]
  • Ccnf (NM 007634) Mouse Tagged ORF Clone – MR210593 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR210593 Ccnf (NM_007634) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccnf (NM_007634) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Ccnf Synonyms: CycF; Fbxo1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Ccnf (NM_007634) Mouse Tagged ORF Clone – MR210593 ORF Nucleotide >MR210593 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAGCGGCGGTGTGATCCATTGTAGGTGTGCCAAGTGTTTCTGTTATCCTACTAAACGAAGAATCA AAAGAAGACCCAGAAACTTAACCATCTTGAGTCTCCCAGAAGATGTACTCTTTCATATCCTGAAATGGCT TTCTGTTGGGGACATCCTTGCTGTCCGAGCTGTCCACTCCCACCTCAAGTACCTGGTGGACAACCATGCC AGTGTGTGGGCATCCGCCAGCTTCCAGGAGCTGTGGCCTTCTCCACAGAACCTGAAGCTCTTTGAAAGGG CTGCTGAAAAGGGAAATTTTGAAGCTGCTGTGAAGTTGGGGATTGCCTACCTCTACAATGAAGGCCTGTC TGTGTCAGATGAGGCCTGCGCAGAAGTGAACGGCTTGAAGGCCTCTCGCTTCTTCAGCATGGCTGAGAGA CTGAATACGGGTTCTGAGCCCTTCATTTGGCTCTTCATCCGCCCACCGTGGTCAGTGTCCGGAAGCTGCT GCAAGGCTGTGGTTCATGACAGCCTCCGAGCGGAGTGTCAGTTACAGAGAAGTCATAAAGCTTCCATACT ACACTGCTTGGGAAGGGTGCTAAATCTTTTTGAGGACGAAGAGAAAAGGAAGCAGGCGCGTAGCCTTTTG
    [Show full text]
  • The Alternative Role of DNA Methylation in Splicing Regulation
    TIGS-1191; No. of Pages 7 Review The alternative role of DNA methylation in splicing regulation Galit Lev Maor, Ahuvi Yearim, and Gil Ast Department of Human Molecular Genetics and Biochemistry, Sackler Medical School, Tel Aviv University, Tel Aviv, Israel Although DNA methylation was originally thought to only Alternative splicing is an evolutionarily conserved mech- affect transcription, emerging evidence shows that it also anism that increases transcriptome and proteome diversity regulates alternative splicing. Exons, and especially splice by allowing the generation of multiple mRNA products from sites, have higher levels of DNA methylation than flanking a single gene [10]. More than 90% of human genes were introns, and the splicing of about 22% of alternative exons shown to undergo alternative splicing [11,12]. Furthermore, is regulated by DNA methylation. Two different mecha- the average number of spliced isoforms per gene is higher in nisms convey DNA methylation information into the vertebrates [13], implying that the prevalence of alternative regulation of alternative splicing. The first involves mod- splicing in these organisms is important for their greater ulation of the elongation rate of RNA polymerase II (Pol II) complexity. The splicing reaction is regulated by various by CCCTC-binding factor (CTCF) and methyl-CpG binding activating and repressing elements such as cis-acting se- protein 2 (MeCP2); the second involves the formation of a quence signals and RNA-binding proteins [13–15]. Its regu- protein bridge by heterochromatin protein 1 (HP1) that lation is essential for providing cells and tissues their recruits splicing factors onto transcribed alternative specific features, and for their response to environmental exons.
    [Show full text]