DOCSLIB.ORG

Evolutionary Alteration of ALOX15 Specificity Optimizes The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Evolutionary Alteration of ALOX15 Specificity Optimizes The Correction BIOCHEMISTRY Correction for “Evolutionary alteration of ALOX15 specificity optimizes the biosynthesis of antiinflammatory and proresolving lipoxins,” by Susan Adel, Felix Karst, Àngels González-Lafont, Mária Pekárová, Patricia Saura, Laura Masgrau, José M. Lluch, Sabine Stehling, Thomas Horn, Hartmut Kuhn, and Dagmar Heydeck, which appeared in issue 30, July 26, 2016, of Proc Natl Acad Sci USA (113:E4266–E4275; first published July 13, 2016; 10.1073/pnas.1604029113). The authors note that Table 5 appeared incorrectly. The corrected table appears below. The authors also note that on page E4266, in line 20 of the Abstract, “ratPhe353Ala” should instead appear as “ratLeu353Phe;” and that on page E4270, right column, first full paragraph, line 12, “ratPhe353Leu” should instead appear as “ratLeu353Phe.” These errors do not affect the conclusions of the article. Table 5. Relative lipoxin synthase activity of mammalian ALOX15 orthologs Relative lipoxin synthase activity, % 5-HETE as 5,6-DiHETE as Species 15-/12-ratio substrate substrate 15-lipoxygenating Human 8.1 100.0 100 Chimpanzee 8.1 118.0 145.8 Orangutan 8.1 172.2 105.6 Rabbit 24.0 39.5 108.6 ratL353F 13.3 197.3 262.5 Mean ± SD 12.3 ± 6.9 125.4 ± 62.1* 144.5 ± 68.4† 12-lipoxygenating Macaca 0.01 25.7 19.9 Mouse 0.03 36.1 1.5 Rat 0.26 8.4 0.0 Pig 0.04 35.4 61.1 humI418A 0.11 29.2 2.1 Mean ± SD 0.09 ± 0.10 27.0 ± 11.2* 17.1 ± 25.9† The relative lipoxin synthase activity of the ALOX15 orthologs was quantified as described in Materials and Methods. For 5S-HETE oxygenation, lipoxin A and lipoxin B isomers were quantified. During 5S,6(S/R)-DiHETE, only lipoxin A isomers were formed. *P = 0.008 by Student’s t test. †P = 0.005 by Student’s t test. www.pnas.org/cgi/doi/10.1073/pnas.1618183113 E8006 | PNAS | December 6, 2016 | vol. 113 | no. 49 www.pnas.org Downloaded by guest on September 25, 2021 Evolutionary alteration of ALOX15 specificity optimizes PNAS PLUS the biosynthesis of antiinflammatory and proresolving lipoxins Susan Adela,1, Felix Karsta,1, Àngels González-Lafontb,c, Mária Pekárováa,d, Patricia Saurab,c, Laura Masgrauc, José M. Lluchb,c, Sabine Stehlinga, Thomas Horna,2, Hartmut Kuhna,3, and Dagmar Heydecka aInstitute of Biochemistry, University Medicine Berlin–Charité, D-10117 Berlin, Germany; bDepartament de Química, Universitat Autònoma de Barcelona, 08193 Bellaterra, Spain; cInstitut de Biotecnologia i de Biomedicina, Universitat Autònoma de Barcelona, 08193 Bellaterra, Spain; and dDepartment of Cell and Molecular Biology of Drugs, Faculty of Pharmacy, Comenius University, 832 32 Bratislava, Slovakia Edited by Klaus van Leyen, Harvard Medical School, Charlestown, MA, and accepted by Editorial Board Member Ruslan Medzhitov May 27, 2016 (received for review March 10, 2016) ALOX15 (12/15-lipoxygenase) orthologs have been implicated in Traditionally, mammalian LOXs have been classified according maturational degradation of intracellular organelles and in the to their reaction specificity with arachidonic acid into 5-LOX, 12- biosynthesis of antiinflammatory and proresolving eicosanoids. LOX, and 15-LOX, but this classification has several problems Here we hypothesized that lower mammals (mice, rats, pigs) (18). For those isoforms exhibiting their biological functions via express 12-lipoxygenating ALOX15 orthologs. In contrast, 15- the formation of bioactive mediators, the reaction specificity is of lipoxygenating isoforms are found in higher primates (orangutans, major biological importance. For instance, ALOX5 orthologs men), and these results suggest an evolution of ALOX15 specific- oxygenate arachidonic acid specifically to (6E,8Z,11Z,14Z)-5- ity. To test this hypothesis we first cloned and characterized hydroperoxy-6,8,11,14-eicosatetraenoic acid (5S-HpETE), which ALOX15 orthologs of selected Catarrhini representing different is further converted to various leukotrienes of the 5,6-series (4). stages of late primate evolution and found that higher pri- In contrast, 15-lipoxygenating LOX isoforms are not capable of mates (men, chimpanzees) express 15-lipoxygenating orthologs. In forming leukotrienes of the 5,6-series. Similarly, 12-lipoxygenating contrast, lower primates (baboons, rhesus monkeys) express 12- enzymes have been implicated in hepoxilin biosynthesis (5), but BIOCHEMISTRY lipoxygenating enzymes. Gibbons, which are flanked in evolution ALOX5 orthologs are not involved. by rhesus monkeys (12-lipoxygenating ALOX15) and orangutans Although mammalian ALOX15 orthologs have been known (15-lipoxygenating ALOX15), express an ALOX15 ortholog with for more than 40 y, their biological role is still a matter of dis- pronounced dual specificity. To explore the driving force for this cussion. The enzymes have been implicated in cell differentiation evolutionary alterations, we quantified the lipoxin synthase activity (6, 7) and in the pathogenesis of different diseases (1, 19), but of 12-lipoxygenating (rhesus monkey, mouse, rat, pig, humIle418Ala) there is no unifying concept for their functionality. Compared and 15-lipoxygenating (man, chimpanzee, orangutan, rabbit, with other LOX-isoforms, mammalian ALOX15 orthologs are ratPhe353Ala) ALOX15 variants and found that, when normalized to somewhat special. First, they are capable of oxygenating arachidonic their arachidonic acid oxygenase activities, the lipoxin synthase activities of 15-lipoxygenating ALOX15 variants were more than Significance fivefold higher (P < 0.01). Comparative molecular dynamics simula- tions and quantum mechanics/molecular mechanics calculations in- Lipoxygenases are lipid-peroxidizing enzymes that have been dicated that, for the 15-lipoxygenating rabbit ALOX15, the energy classified according to their reaction specificity. ALOX15 (12/15- barrier for C13-hydrogen abstraction (15-lipoxygenation) was 17 kJ/mol lipoxygenase) has been implicated in inflammatory resolution via lower than for arachidonic acid 12-lipoxygenation. In contrast, for biosynthesis of antiinflammatory and proresolving lipoxins. We the 12-lipoxygenating Ile418Ala mutant, the energy barrier for 15- found that lower mammals including lower primates express ara- lipoxygenation was 10 kJ/mol higher than for 12-lipoxygenation. chidonic acid 12-lipoxygenating ALOX15 orthologs, whereas higher Taken together, our data suggest an evolution of ALOX15 speci- primates express 15-lipoxygenating enzymes. Gibbons constitute ficity, which is aimed at optimizing the biosynthetic capacity for the missing link interconnecting 12- and 15-lipoxygenating ALOX15 antiinflammatory and proresolving lipoxins. orthologs. To explore the evolutionary driving force for this spec- ificity alteration, we quantified the lipoxin synthase activity of 12- eicosanoids | lipoxygenase | evolution | inflammation | protein design and 15-lipoxygenating ALOX15 orthologs and observed that the lipoxin synthase activities of 15-lipoxygenating enzymes were ipoxygenases (LOXs) form a diverse family of lipid-peroxidizing significantly higher. These results suggest an evolution of ALOX15 Lenzymes that catalyze the specific oxygenation of polyenoic specificity, which optimizes the biosynthetic capacity for antiin- fatty acids to their corresponding hydroperoxides (1, 2). Geno- flammatory and proresolving lipoxins. mic LOX sequences occur in two domains (Bacteria, Eukarya) of terrestrial life (3). In mammals, LOXs have been implicated in Author contributions: S.A., F.K., T.H., H.K., and D.H. designed research; S.A., F.K., À.G.-L., M.P., P.S., L.M., J.M.L., S.S., H.K., and D.H. performed research; S.A., F.K., À.G.-L., M.P., P.S., the biosynthesis of lipid mediators (4, 5), but they may also play a L.M., J.M.L., S.S., H.K., and D.H. analyzed data; and S.A., À.G.-L., T.H., H.K., and D.H. wrote role in cell differentiation (6, 7), apoptosis (8) and pathogenesis the paper. of inflammatory (9), hyperproliferative (10), and neurological (11) The authors declare no conflict of interest. disorders. Targeted gene inactivation in mice provided useful in- This article is a PNAS Direct Submission. K.v.L. is a guest editor invited by the Editorial formation on the functionality of Alox12B (12R-lipoxygenase) Board. 1 (12) and Aloxe3 (epidermal lipoxygenase-3) (13), but Alox5 (5- S.A. and F.K. contributed equally to this work. 2Present address: Institute of Biotechnology, RWTH Aachen University, 52074 Aachen, lipoxygenase)- (14), Alox15- (15), and Alox12-deficient mice (16) Germany. do not show major defects unless challenged otherwise. In the 3To whom correspondence should be addressed. Email: [email protected]. human genome, six functional LOX genes have been identified, This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. which encode for six distinct LOX isoforms (17). 1073/pnas.1604029113/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1604029113 PNAS Early Edition | 1of10 acid to 12-HpETE and 15-HpETE in variable amounts (20–22). logs of men (24), extinct human subspecies (25), various non- The molecular basis for this dual specificity has been explored human primates (22), rabbits (26), mice (27), rats (28), and pigs (23), and three critical amino acids have been identified (i.e., (29). Second, ALOX15 orthologs are capable of oxygenating “triad concept”). Alterations in the side-chain geometry of the phospholipids and cholesterol esters (30, 31), and thus, these LOX triad determinants impacted the specificity of ALOX15 ortho- isoforms can modify biomembranes and lipoproteins. Third, highly Fig. 1. Triad determinants of mammalian
Load more

Recommended publications
  • Epigenetic Regulations of Ahr in the Aspect of Immunomodulation
    International Journal of Molecular Sciences Review Epigenetic Regulations of AhR in the Aspect of Immunomodulation Anna Wajda 1,* , Joanna Łapczuk-Roma ´nska 2 and Agnieszka Paradowska-Gorycka 1 1 Department of Molecular Biology, National Institute of Geriatrics, Rheumatology and Rehabilitation, 02-637 Warsaw, Poland; [email protected] 2 Department of Experimental and Clinical Pharmacology, Pomeranian Medical University, 70-111 Szczecin, Poland; [email protected] * Correspondence: [email protected] Received: 31 July 2020; Accepted: 28 August 2020; Published: 3 September 2020 Abstract: Environmental factors contribute to autoimmune disease manifestation, and as regarded today, AhR has become an important factor in studies of immunomodulation. Besides immunological aspects, AhR also plays a role in pharmacological, toxicological and many other physiological processes such as adaptive metabolism. In recent years, epigenetic mechanisms have provided new insight into gene regulation and reveal a new contribution to autoimmune disease pathogenesis. DNA methylation, histone modifications, chromatin alterations, microRNA and consequently non-genetic changes in phenotypes connect with environmental factors. Increasing data reveals AhR cross-roads with the most significant in immunology pathways. Although study on epigenetic modulations in autoimmune diseases is still not well understood, therefore future research will help us understand their pathophysiology and help to find new therapeutic strategies. Present literature review
    [Show full text]
  • Environmental Pollution 275 (2021) 116665
    Environmental Pollution 275 (2021) 116665 Contents lists available at ScienceDirect Environmental Pollution journal homepage: www.elsevier.com/locate/envpol Metabolomics reveals the reproductive abnormality in female zebrafish exposed to environmentally relevant levels of climbazole* Ting Zou a, 1, Yan-Qiu Liang b, 1, Xiaoliang Liao a, Xiao-Fan Chen a, Tao Wang c, * Yuanyuan Song c, Zhi-Cheng Lin a, Zenghua Qi a, Zhi-Feng Chen a, d, , Zongwei Cai a, c a Guangdong Key Laboratory of Environmental Catalysis and Health Risk Control, School of Environmental Science and Engineering, Institute of Environmental Health and Pollution Control, Guangdong University of Technology, Guangzhou, 510006, China b Faculty of Chemistry and Environmental Science, Guangdong Ocean University, Zhanjiang, 524088, China c State Key Laboratory of Environmental and Biological Analysis, Department of Chemistry, Hong Kong Baptist University, Hong Kong Special Administrative Region, China d Guangdong Provincial Key Laboratory of Chemical Pollution and Environmental Safety, South China Normal University, Guangzhou, 510006, China article info abstract Article history: Climbazole (CBZ) ubiquitously detected in the aquatic environment may disrupt fish reproductive Received 15 November 2020 function. Thus far, the previous study has focused on its transcriptional impact of steroidogenesis-related Received in revised form genes on zebrafish, but the underlying toxic mechanism still needs further investigation at the metabolic 10 January 2021 level. In this study, adult zebrafish were chronically exposed to CBZ at concentrations of 0.1 (corre- Accepted 2 February 2021 sponding to the real concentration in surface water), 10, and 1000 mg/L and evaluated for reproductive Available online 5 February 2021 function by egg production, with subsequent ovarian tissue samples taken for histology, metabolomics, and other biochemical analysis.
    [Show full text]
  • Interactions Between the Parasite Philasterides Dicentrarchi and the Immune System of the Turbot Scophthalmus Maximus.A Transcriptomic Analysis
    biology Article Interactions between the Parasite Philasterides dicentrarchi and the Immune System of the Turbot Scophthalmus maximus.A Transcriptomic Analysis Alejandra Valle 1 , José Manuel Leiro 2 , Patricia Pereiro 3 , Antonio Figueras 3 , Beatriz Novoa 3, Ron P. H. Dirks 4 and Jesús Lamas 1,* 1 Department of Fundamental Biology, Institute of Aquaculture, Campus Vida, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain; [email protected] 2 Department of Microbiology and Parasitology, Laboratory of Parasitology, Institute of Research on Chemical and Biological Analysis, Campus Vida, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain; [email protected] 3 Institute of Marine Research, Consejo Superior de Investigaciones Científicas-CSIC, 36208 Vigo, Spain; [email protected] (P.P.); antoniofi[email protected] (A.F.); [email protected] (B.N.) 4 Future Genomics Technologies, Leiden BioScience Park, 2333 BE Leiden, The Netherlands; [email protected] * Correspondence: [email protected]; Tel.: +34-88-181-6951; Fax: +34-88-159-6904 Received: 4 September 2020; Accepted: 14 October 2020; Published: 15 October 2020 Simple Summary: Philasterides dicentrarchi is a free-living ciliate that causes high mortality in marine cultured fish, particularly flatfish, and in fish kept in aquaria. At present, there is still no clear picture of what makes this ciliate a fish pathogen and what makes fish resistant to this ciliate. In the present study, we used transcriptomic techniques to evaluate the interactions between P. dicentrarchi and turbot leucocytes during the early stages of infection. The findings enabled us to identify some parasite genes/proteins that may be involved in virulence and host resistance, some of which may be good candidates for inclusion in fish vaccines.
    [Show full text]
  • Role of Arachidonic Acid and Its Metabolites in the Biological and Clinical Manifestations of Idiopathic Nephrotic Syndrome
    International Journal of Molecular Sciences Review Role of Arachidonic Acid and Its Metabolites in the Biological and Clinical Manifestations of Idiopathic Nephrotic Syndrome Stefano Turolo 1,* , Alberto Edefonti 1 , Alessandra Mazzocchi 2, Marie Louise Syren 2, William Morello 1, Carlo Agostoni 2,3 and Giovanni Montini 1,2 1 Fondazione IRCCS Ca’ Granda-Ospedale Maggiore Policlinico, Pediatric Nephrology, Dialysis and Transplant Unit, Via della Commenda 9, 20122 Milan, Italy; [email protected] (A.E.); [email protected] (W.M.); [email protected] (G.M.) 2 Department of Clinical Sciences and Community Health, University of Milan, 20122 Milan, Italy; [email protected] (A.M.); [email protected] (M.L.S.); [email protected] (C.A.) 3 Fondazione IRCCS Ca’ Granda Ospedale Maggiore Policlinico, Pediatric Intermediate Care Unit, 20122 Milan, Italy * Correspondence: [email protected] Abstract: Studies concerning the role of arachidonic acid (AA) and its metabolites in kidney disease are scarce, and this applies in particular to idiopathic nephrotic syndrome (INS). INS is one of the most frequent glomerular diseases in childhood; it is characterized by T-lymphocyte dysfunction, alterations of pro- and anti-coagulant factor levels, and increased platelet count and aggregation, leading to thrombophilia. AA and its metabolites are involved in several biological processes. Herein, Citation: Turolo, S.; Edefonti, A.; we describe the main fields where they may play a significant role, particularly as it pertains to their Mazzocchi, A.; Syren, M.L.; effects on the kidney and the mechanisms underlying INS. AA and its metabolites influence cell Morello, W.; Agostoni, C.; Montini, G.
    [Show full text]
  • The Role of Ferroptosis in Breast Cancer Patients: a Comprehensive Analysis Zeng-Hong Wu1,2, Yun Tang3,Hongyu1 and Hua-Dong Li4
    Wu et al. Cell Death Discovery (2021) 7:93 https://doi.org/10.1038/s41420-021-00473-5 Cell Death Discovery ARTICLE Open Access The role of ferroptosis in breast cancer patients: a comprehensive analysis Zeng-Hong Wu1,2, Yun Tang3,HongYu1 and Hua-Dong Li4 Abstract Breast cancer (BC) affects the breast tissue and is the second most common cause of mortalities among women. Ferroptosis is an iron-dependent cell death mode that is characterized by intracellular accumulation of reactive oxygenspecies(ROS).Weconstructed a prognostic multigene signature based on ferroptosis-associated differentially expressed genes (DEGs). Moreover, we comprehensively analyzed the role of ferroptosis-associated miRNAs, lncRNAs, and immune responses. A total of 259 ferroptosis-related genes wereextracted.KEGGfunction analysis of these genes revealed that they were mainly enriched in the HIF-1 signaling pathway, NOD-like receptor signaling pathway, central carbon metabolism in cancer, and PPAR signaling pathway. Fifteen differentially expressed genes (ALOX15, ALOX15B, ANO6, BRD4, CISD1, DRD5, FLT3, G6PD, IFNG, NGB, NOS2, PROM2, SLC1A4, SLC38A1,andTP63) were selected as independent prognostic factors for BC patients. Moreover, T cell functions, including the CCR score, immune checkpoint, cytolytic activity, HLA, inflammation promotion, para-inflammation, T cell co-stimulation, T cell co-inhibition, and type II INF responses were significantly different between the low- risk and high-risk groups of the TCGA cohort. Immune checkpoints between the two groups revealed that the expressions of PDCD-1 (PD-1), CTLA4, LAG3, TNFSF4/14, TNFRSF4/8/9/14/18/25,andIDO1/2 among others were significantly different. A total of 1185 ferroptosis-related lncRNAs and 219 ferroptosis-related miRNAs were also included in this study.
    [Show full text]
  • Quantitative Proteomics Analysis of Young and Elderly Skin with DIA Mass Spectrometry Reveals New Skin Aging-Related Proteins
    www.aging-us.com AGING 2020, Vol. 12, No. 13 Research Paper Quantitative proteomics analysis of young and elderly skin with DIA mass spectrometry reveals new skin aging-related proteins Jing Ma1,2, Mengting Liu1,2, Yaochi Wang1,2, Cong Xin1,2, Hui Zhang1,2, Shirui Chen1,2, Xiaodong Zheng1,2, Xuejun Zhang1,2, Fengli Xiao1,2,3, Sen Yang1,2 1Department of Dermatology of First Affiliated Hospital, and Institute of Dermatology, Anhui Medical University, Hefei, Anhui, China 2Key Laboratory of Dermatology, Anhui Medical University, Ministry of Education, Hefei, Anhui, China 3The Center for Scientific Research of Anhui Medical University, Hefei, Anhui, China Correspondence to: Fengli Xiao, Sen Yang; email: [email protected], [email protected] Keywords: aging, epidermal proteins, skin rejuvenation and aging, proteome, mass spectrometer Received: February 25, 2020 Accepted: May 27, 2020 Published: June 29, 2020 Copyright: Ma et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Skin aging is a specific manifestation of the physiological aging process that occurs in virtually all organisms. In this study, we used data independent acquisition mass spectrometry to perform a comparative analysis of protein expression in volar forearm skin samples from of 20 healthy young and elderly Chinese individuals. Our quantitative proteomic analysis identified a total of 95 differentially expressed proteins (DEPs) in aged skin compared to young skin. Enrichment analyses of these DEPs (57 upregulated and 38 downregulated proteins) based on the GO, KEGG, and KOG databases revealed functional clusters associated with immunity and inflammation, oxidative stress, biosynthesis and metabolism, proteases, cell proliferation, cell differentiation, and apoptosis.
    [Show full text]
  • Lipoxin A4: a Novel Anti-Inflammatory Molecule? Thorax: First Published As 10.1136/Thx.50.2.111 on 1 February 1995
    Thorax 1995;50:111-112 illl Lipoxin A4: a novel anti-inflammatory molecule? Thorax: first published as 10.1136/thx.50.2.111 on 1 February 1995. Downloaded from Arachidonic acid is metabolised by the cyclooxygenase contractions.22 These studies support the view that LXA4 pathway to the prostaglandins and thromboxane A2 or via may act as a partial agonist at the same or similar site as one of the lipoxygenase pathways.' Three major lip- the sulphidopeptide leukotrienes. oxygenase pathways have been identified in mammalian The fact that 1 5-lipoxygenase is abundant in lung tissue tissue - namely, the 5-, 12-, and 15-lipoxygenases.2A The and that LXA4 has been recovered in the bronchoalveolar 5-lipoxygenase pathway metabolises arachidonic acid lavage fluid ofpatients with asthma and other lung diseases through two intermediates, 5-hydroperoxyeicosatetranoic suggests that LXA4 may be a potential mediator or mod- acid (5-HPETE) and leukotriene A4 (LTA4), to LTB4 and ulator of inflammation in the lung. In a recent study eight the sulphidopeptide leukotrienes LTC4, LTD4, and LTE4.5 subjects underwent inhalation challenge with LXA4,23 but The sulphidopeptide leukotrienes are potent spasmogens6 no effect was seen on specific conductance, rate of airflow for non-vascular smooth muscle and may play a part in at 25% vital capacity (V25), blood pressure, pulse, or the pathogenesis of bronchial asthma.7`10 asthmatic symptoms. There was, however, a significant The interactions between 5-lipoxygenase and 15-lip- shift of the specific conductance and V25 dose-response oxygenase on arachidonic acid metabolism have recently curve to the right after inhalation challenge with LTC4 been studied and a new series of biologically active me- combined with LXA4 compared with that after inhalation tabolites described." 12 These molecules have been termed challenge with LTC4 alone.
    [Show full text]
  • (ALOX15B) (NM 001039130) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC214018 15 Lipoxygenase 2 (ALOX15B) (NM_001039130) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: 15 Lipoxygenase 2 (ALOX15B) (NM_001039130) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ALOX15B Synonyms: 15-LOX-2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 15 Lipoxygenase 2 (ALOX15B) (NM_001039130) Human Tagged ORF Clone – RC214018 ORF Nucleotide >RC214018 representing NM_001039130 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGAGTTCAGGGTCAGGGTGTCCACCGGAGAAGCCTTCGGGGCTGGCACATGGGACAAAGTGTCTG TCAGCATCGTGGGGACCCGGGGAGAGAGCCCCCCACTGCCCCTGGACAATCTCGGCAAGGAGTTCACTGC GGGCGCTGAGGAGGACTTCCAGGTGACGCTCCCGGAGGACGTAGGCCGAGTGCTGCTGCTGCGCGTGCAC AAGGCGCCCCCAGTGCTGCCCCTGCTGGGGCCCCTGGCCCCGGATGCCTGGTTCTGCCGCTGGTTCCAGC TGACACCGCCGCGGGGCGGCCACCTCCTCTTCCCCTGCTACCAGTGGCTGGAGGGGGCGGGGACCCTGGT GCTGCAGGAGGGTACAGCCAAGGTGTCCTGGGCAGACCACCACCCTGTGCTCCAGCAACAGCGCCAGGAG GAGCTTCAGGCCCGGCAGGAGATGTACCAGTGGAAGGCTTACAACCCAGGTTGGCCTCACTGCCTGGATG AAAAGACAGTGGAAGACTTGGAGCTCAATATCAAATACTCCACAGCCAAGAATGCCAACTTTTATCTACA
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Electronic Supplementary Material (ESI) for Metallomics
    Electronic Supplementary Material (ESI) for Metallomics. This journal is © The Royal Society of Chemistry 2018 Uniprot Entry name Gene names Protein names Predicted Pattern Number of Iron role EC number Subcellular Membrane Involvement in disease Gene ontology (biological process) Id iron ions location associated 1 P46952 3HAO_HUMAN HAAO 3-hydroxyanthranilate 3,4- H47-E53-H91 1 Fe cation Catalytic 1.13.11.6 Cytoplasm No NAD biosynthetic process [GO:0009435]; neuron cellular homeostasis dioxygenase (EC 1.13.11.6) (3- [GO:0070050]; quinolinate biosynthetic process [GO:0019805]; response to hydroxyanthranilate oxygenase) cadmium ion [GO:0046686]; response to zinc ion [GO:0010043]; tryptophan (3-HAO) (3-hydroxyanthranilic catabolic process [GO:0006569] acid dioxygenase) (HAD) 2 O00767 ACOD_HUMAN SCD Acyl-CoA desaturase (EC H120-H125-H157-H161; 2 Fe cations Catalytic 1.14.19.1 Endoplasmic Yes long-chain fatty-acyl-CoA biosynthetic process [GO:0035338]; unsaturated fatty 1.14.19.1) (Delta(9)-desaturase) H160-H269-H298-H302 reticulum acid biosynthetic process [GO:0006636] (Delta-9 desaturase) (Fatty acid desaturase) (Stearoyl-CoA desaturase) (hSCD1) 3 Q6ZNF0 ACP7_HUMAN ACP7 PAPL PAPL1 Acid phosphatase type 7 (EC D141-D170-Y173-H335 1 Fe cation Catalytic 3.1.3.2 Extracellular No 3.1.3.2) (Purple acid space phosphatase long form) 4 Q96SZ5 AEDO_HUMAN ADO C10orf22 2-aminoethanethiol dioxygenase H112-H114-H193 1 Fe cation Catalytic 1.13.11.19 Unknown No oxidation-reduction process [GO:0055114]; sulfur amino acid catabolic process (EC 1.13.11.19) (Cysteamine
    [Show full text]
  • Reduced 15-Lipoxygenase 2 and Lipoxin A4/Leukotriene B4 Ratio in Children with Cystic Fibrosis
    ORIGINAL ARTICLE CYSTIC FIBROSIS Reduced 15-lipoxygenase 2 and lipoxin A4/leukotriene B4 ratio in children with cystic fibrosis Fiona C. Ringholz1, Paul J. Buchanan1, Donna T. Clarke1, Roisin G. Millar1, Michael McDermott2, Barry Linnane1,3,4, Brian J. Harvey5, Paul McNally1,2 and Valerie Urbach1,6 Affiliations: 1National Children’s Research Centre, Crumlin, Dublin, Ireland. 2Our Lady’s Children’s Hospital, Crumlin, Dublin, Ireland. 3Midwestern Regional Hospital, Limerick, Ireland. 4Centre for Interventions in Infection, Inflammation and Immunity (4i), Graduate Entry Medical School, University of Limerick, Limerick, Ireland. 5Molecular Medicine Laboratories, Royal College of Surgeons in Ireland, Beaumont Hospital, Dublin, Ireland. 6Institut National de la Sante´ et de la Recherche Me´dicale, U845, Faculte´ de Me´decine Paris Descartes, Paris, France. Correspondence: Valerie Urbach, National Children’s Research Centre, Crumlin, Dublin 12, Ireland. E-mail: [email protected] ABSTRACT Airway disease in cystic fibrosis (CF) is characterised by impaired mucociliary clearance, persistent bacterial infection and neutrophilic inflammation. Lipoxin A4 (LXA4) initiates the active resolution of inflammation and promotes airway surface hydration in CF models. 15-Lipoxygenase (LO) plays a central role in the ‘‘class switch’’ of eicosanoid mediator biosynthesis from leukotrienes to lipoxins, initiating the active resolution of inflammation. We hypothesised that defective eicosanoid mediator class switching contributes to the failure to resolve inflammation in CF lung disease. Using bronchoalveolar lavage (BAL) samples from 46 children with CF and 19 paediatric controls we demonstrate that the ratio of LXA4 to leukotriene B4 (LTB4) is depressed in CF BAL (p,0.01), even in the absence of infection (p,0.001).
    [Show full text]
  • Strict Regio-Specificity of Human Epithelial 15-Lipoxygenase-2
    Strict Regio-specificity of Human Epithelial 15-Lipoxygenase-2 Delineates its Transcellular Synthesis Potential Abigail R. Green, Shannon Barbour, Thomas Horn, Jose Carlos, Jevgenij A. Raskatov, Theodore R. Holman* Department Chemistry and Biochemistry, University of California Santa Cruz, 1156 High Street, Santa Cruz CA 95064, USA *Corresponding author: Tel: 831-459-5884. Email: [email protected] FUNDING: This work was supported by the NIH NS081180 and GM56062. Abbreviations: LOX, lipoxygenase; h15-LOX-2, human epithelial 15-lipoxygenase-2; h15-LOX-1, human reticulocyte 15-lipoxygenase-1; sLO-1, soybean lipoxygenase-1; 5-LOX, leukocyte 5-lipoxygenase; 12-LOX, human platelet 12-lipoxygenase; GP, glutathione peroxidase; AA, arachidonic acid; HETE, hydoxy-eicosatetraenoic acid; HPETE, hydroperoxy-eicosatetraenoic acid; diHETEs, dihydroxy-eicosatetraenoic acids; 5-HETE, 5-hydroxy-6E,8Z,11Z,14Z-eicosatetraenoic acid; 5-HPETE, 5-hydro peroxy-6E,8Z,11Z,14Z-eicosatetraenoic acid; 12-HPETE, 12-hydroperoxy-5Z,8Z,10E, 14Z-eicosatetraenoic acid; 15-HPETE, 15-hydroperoxy-5Z,8Z,10Z,13E- eicosatetraenoic acid; 5,15-HETE, 5S,15S-dihydroxy-6E,8Z,10Z,13E-eicosatetraenoic acid; 5,15-diHPETE, 5,15-dihydroperoxy-6E,8Z,10Z,13E-eicosatetraenoic acid; 5,6- diHETE, 5S,6R-dihydroxy-7E,9E,11Z,14Z-eicosatetraenoic acid; LTA4, 5S-trans-5,6- oxido-7E,9E,11Z,14Z-eicosatetraenoic acid; LTB4, 5S,12R-dihydroxy-6Z,8E,10E,14Z- eicosatetraenoic acid; LipoxinA4 (LxA4), 5S,6R,15S-trihydroxy-7E,9E,11Z,13E- eicosatetraenoic acid; LipoxinB4 (LxB4), 5S,14R,15S-trihydroxy-6E,8Z,10E,12E- eicosatetraenoic acid. Abstract Lipoxins are an important class of lipid mediators that induce the resolution of inflammation, and arise from transcellular exchange of arachidonic acid (AA)- derived lipoxygenase products.
    [Show full text]