Materials and Methods

Home , Acetyl group, Pantothenate kinase, Pentyl group

STRUCTURAL STUDIES OF

THE KLEBSIELLA PNEUMONIAE PANTOTHENATE KINASE

IN COMPLEX WITH

PANTOTHENAMIDE SUBSTRATE ANALOGUES

Buren Li

A thesis submitted in conformity with the requirements

for the degree of Master of Science.

Graduate Department of Pharmacology and Toxicology

University of Toronto.

pantothenamide substrate analogues

Buren Li

Master of Science 2012

Department of Pharmacology and Toxicology University of Toronto

ABSTRACT

N-substituted pantothenamides are analogues of pantothenate, the precursor of the essential metabolic cofactor coenzyme A (CoA). These compounds are substrates of pantothenate kinase (PanK) in the first step of CoA biosynthesis, possessing antimicrobial activity against multiple pathogenic bacteria. This enzyme is an attractive target for drug discovery due to low sequence homology between bacterial and human

PanKs. In this study, the crystal structure of the PanK from the multidrug-resistant bacterium Klebsiella pneumoniae (KpPanK) was first solved in complex with N- pentylpantothenamide (N5-Pan). The structure reveals that the N5-Pan pentyl tail is located within a highly aromatic pocket, suggesting that an aromatic substituent may enhance binding affinity to the enzyme. This finding led to the design of N-pyridin-3- ylmethylpantothenamide (Np-Pan) and its co-crystal structure with KpPanK was solved.

The structure reveals that the pyridine ring adopts alternative conformations in the aromatic pocket, providing the structural basis for further improvement of pantothenamide-binding to KpPanK.

ACKNOWLEDGEMENTS

First and foremost, I would like to extend my gratitude to my parents and sisters for their unwavering love and support.

My time in the graduate program has been made easier and enjoyable because of generous laboratory colleagues who are always willing to share their expertise and knowledge. I would like to especially thank Dr. BumSoo Hong for all those hours we spent troubleshooting my errors and of course, talking about life. I am also grateful to

Johnny Guan, who was my mentor when I first arrived at the Park lab and has encyclopedic knowledge of all laboratory practices and techniques. It was also a pleasure to have worked alongside fellow students Hanyoul Lee, Cathy Kim, Kathy Mottaghi,

Scott Hughes and Negar Nosrati. I would like to thank former members of the Park group, Drs. Yufeng Tong, Nan Zhong, as well as Lucy Nedyalkova, Slav Dimov and

Limin Shen, who have never hesitated to lend a hand in my times of need.

All work presented in this thesis was performed at the Structural Genomics

Consortium (SGC), a truly ideal environment for structural biology research. I am indebted to Dr. Wolfram Tempel for helping me with crystal screening and Synchrotron data collection, and to Drs. Guillermo Senisterra and Abdellah Al-Hassani for valuable technical assistance in running kinetic assays. I would also like to extend my thanks to

Drs. David Smil and Yuri Bolshan, the chemists at the SGC who generously provided the compounds used in these studies.

I have also benefitted from the kindness and expertise of my co-supervisor Dr.

Peter McPherson and advisor Dr. David Riddick, both of whom agreed to serve in their

iii respective capacities without hesitation. They have my thanks for going above and beyond what I expected whenever I consult with them.

I would also like to thank my defense committee members: Dr. Martin Zack

(chair), Dr. Jeffrey Lee (external appraiser), Dr. Hong-Shuo Sun (internal appraiser) and

Dr. David Riddick (additional voting member). Their careful review of this thesis is greatly appreciated.

Last but definitely not least, I would like to extend my sincerest thanks to my supervisor Dr. Hee-Won Park. I feel extremely fortunate to have met such a bighearted, inspiring and selfless mentor. The rewarding journey wasn’t always smooth, and results didn’t always come readily. But I would always be reassured by Dr. Park that with hard work and strong convictions, things will work out.

TABLE OF CONTENTS

Abstract ii Acknowledgements iii-iv Table of Contents v-vi Lists of Tables and Appendix vii List of Figures viii-ix Abbreviations x-xi

1. INTRODUCTION 1.1 Urgency for antimicrobial drug discovery 1-3 1.2 Pantothenate Essentiality and Uptake Mechanisms 3-5 1.3 Overview of Coenzyme A 5-11 1.4 Synthesis of Coenzyme A 11 1.4.1 De novo Pantothenate Synthesis 12 1.4.2 Coenzyme A Synthesis from Pantothenate 14 1.4.2.1 Conversion of Pantothenate to 4’-phosphopantothenate 16 1.4.2.2 Conversion of 4’-phosphopantothenate to 4’- 16-17 phosphopantetheine 1.4.2.3 Conversion of 4’-phosphopantetheine to coenzyme A 17 1.5 Pantothenate Kinase as point of drug discovery 17-18 1.5.1 Pantoyltaurine 20 1.5.2 N’-pantoyl-substituted amide 20-21 1.5.3 N-substituted pantothenamide 21-22 1.6 Overview of Pantothenate Kinases 24 1.6.1 Type I Pantothenate Kinases 24-27 1.6.2 Type II Pantothenate Kinases 27-31 1.6.3 Type III Pantothenate Kinases 31-32 1.7 Hypothesis and Rationale for Study 38 1.7.1 Aims and Approaches 38-39 1.7.2 Rationale for Experimental Approach 1.7.2.1 Structure Determination of Macromolecules 39 1.7.2.2 X-ray Crystallography 39-40 1.7.2.3 Protein Crystallization 40 1.7.2.4 Data Collection 42 1.7.2.5 Structure Determination 42-43

2. MATERIALS AND METHODS 2.1 Materials 43-44 2.2 Methods 2.2.1 Preparation of Expression Plasmid 46 2.2.2 Protein Expression and Purification 49-50 2.2.3 Protein Crystallization and Data Collection 52-53 2.2.4 Structure Determination, Refinement and Validation 57-59

2.2.5 Spectrophotometric Assessment of Substrate Kinetics 63

3. RESULTS 3.1 Structural Overview of KpPanK 65 3.1.1 Nucleotide-binding site 65-66 3.1.2 N5-Pan binding site of KpPanK 69 3.1.3 Np-Pan binding site of KpPanK 71-72 3.2 KpPanK substrate kinetics 74

4. DISCUSSION 4.1 Comparison with EcPanK 77-78 4.2 Comparison with MtPanK 80-81 4.3 Modeling of a Branched Compound 84-85 4.4 KpPanK Substrate Kinetics 88 4.5 Summary of Findings 88-89 4.6 Recommendations for Future Studies 89-92

References 93-100

LIST OF TABLES

Table I Sequences of primers used to generate each KpPanK construct. 48

Table II Summary of substrates used for KpPanK co-crystallization and the 56 best resolution achieved.

Table III Data collection and refinement statistics for KpPanK crystals. 61

Table IV Characterization of KpPanK substrate kinetics. 76

Table V Summary of polar interactions involving the pantothenate moiety of 82 substrates in KpPanK, EcPanK and MtPanK structures.

vii

LIST OF FIGURES

Figure 1 Chemical structure of coenzyme A. 7

Figure 2 Overview of fatty acid synthesis. 9

Figure 3 De novo pantothenate biosynthesis pathway in bacteria. 13

Figure 4 CoA biosynthesis from pantothenate in bacteria. 15

Figure 5 Chemical structures of pantothenate and related derivatives. 19

Figure 6 Proposed mechanisms of pantothenamide toxicity. 23

Figure 7 Phylogenetic distributions of prokaryotic and eukaryotic 33 pantothenate kinases from notable organisms.

Figure 8 Sequence-based alignments of prokaryotic and eukaryotic PanKs 34-36 from types I (A), II (B), and III (C).

Figure 9 Comparison of the structures and dimer folds of types I, II and III 37 bacterial PanKs.

Figure 10 Phase diagram of crystallization. 41

Figure 11 Overview of the pET28-MHL expression vector. 45

Figure 12 Small scale test of expression of KpPanK constructs. 47

Figure 13 Purification of KpPanK. 51

Figure 14 Crystals of KpPanK co-crystallized with N5-Pan. 54

Figure 15 Crystals of KpPanK co-crystallized with Np-Pan. 55

Figure 16 Diffraction patterns of KpPanK crystals. 60

Figure 17 Matthews Probability calculation of the oligomeric state of the 62 KpPanK asymmetric unit.

Figure 18 Pyruvate kinase (PK)/lactate dehydrogenase (LDH) coupled assay 64 for characterization of kinase activity.

Figure 19 Structure of a KpPanK subunit. 67

viii

Figure 20 Interaction of KpPanK nucleotide-binding residues with ADP. 68

Figure 21 Residues of the KpPanK substrate-binding site. 70

Figure 22 Interactions of the pyridine of Np-Pan with substrate pocket 73 residues.

Figure 23 Michaelis-Menten plot of reaction velocity vs. substrate 75 concentration.

Figure 24 Structural differences between KpPanK and EcPanK substrate 79 binding sites.

Figure 25 Comparison of the substrate-binding sites of KpPanK and MtPanK. 83

Figure 26 Modeling of a branched version of Np-Pan in the KpPanK substrate- 86 binding site.

Figure 27 Modeling of a branched derivative of Np-Pan in human PanK3. 87

ABBREVIATIONS

ACP = acyl carrier protein

ACS = acetyl-CoA synthetase

AnPanK = Aspergillus nidulans pantothenate kinase

ASKHA = acetate and sugar kinase/heat shock protein 70/actin

Baf = Bvg accessory factor

DPC = dephospho-coenzyme A

DPCK = dephospho-coenzyme A kinase

EcPanK = Escherichia coli pantothenate kinase

Ed-CoA = ethyldethia-CoA

ESBL = extended spectrum β-lactamase

FAS = fatty acid synthase hPanK3 = human pantothenate kinase isoform 3

IPTG = isopropyl β-D-1-thiogalactopyranoside

MIC = minimum inhibitory concentration mPanK = Mus musculus pantothenate kinase

MR = molecular replacement

MtPanK = Mycobacterium tuberculosis pantothenate kinase

N5-Pan = N-pentylpantothenamide

N7-Pan = N-heptylpantothenamide

N9-Pan = N-nonylpantothenamide

Np-Pan = N-pyridin-3’-ylmethylpantothenamide

PanF = pantothenate permease

PanK = pantothenate kinase (coaA)

P-Pan = 4’-phosphopantothenate

PP = 4’-phosphopantetheine

PPAT = phosphopantetheine adenyltransferase (coaD)

PPC = phosphopantothenoylcysteine

PPCDC = phosphopantothenoylcysteine decarboxylase (coaC)

PPCS = phosphopantothenoylcysteine synthetase (coaB)

RMSD = root mean square deviation

SVMT = sodium-dependent multi-vitamin transporter

1. INTRODUCTION

1.1 Urgency for antimicrobial drug discovery

Drug-resistant pathogens represent a major challenge to healthcare and drug development. Conventional classes of antibiotics that were once capable of controlling infections are becoming more and more ineffective (Rice 2012). The rate of drug development has not been able to keep up with the increasing number of therapeutic options lost because of drug resistance (Bassetti, Ginocchio et al. 2011). Most antimicrobial agents share conventional cellular targets that include interfering with cell wall formation, membrane function, and DNA and protein synthesis (Neu 1989; Rice

2012). Under selective pressures introduced through excessive use of antibiotics, microorganisms have developed resistance to drugs by: increased efflux, alteration of the drug targets, and enzymatic inactivation (Neu 1989).

Resistance in gram-negative bacterial pathogens is particularly troubling; their lipopolysaccharide outer membrane provide intrinsic resistance against several classes of antibiotics, such as macrolides and cationic peptides (Delcour 2009). As such, there are limited treatment regimens for infection caused by gram-negative bacteria, which in some cases are prompt recipients of resistance genes. A prominent example is the acquisition of extended spectrum β-lactamases (ESBL) in Enterobacteriaceae that hydrolyze a broad range of penicillins, and render numerous members of the drug class ineffective (Paterson and Bonomo 2005). The first ESBL discovered was TEM-1 (named after Temoniera, the source patient) (Bradford 2001). A second related enzyme was discovered and named

TEM-2. A third, unrelated and much less common ESBL is SHV, named so due to the

1 variable effects sulfhydryl compounds had on substrate specificity. The advent of cephalosporins was considered a major breakthrough in countering β-lactamase-mediated drug resistance (Paterson and Bonomo 2005). Soon after, overuse of these drugs led to the emergence of ESBLs capable of hydrolyzing cephalosporins; mutations that promote substrate promiscuity are found in the genes that encode the three ESBLs (Philippon,

Labia et al. 1989). Recently, there has been a rise in bacteria that produce carbapenemases, a β-lactamase-like enzyme that provides resistance to carbapenem drugs

(often considered drugs of last resort) (Daikos and Markogiannakis 2011). Widespread drug resistance can result in treatment failure and increased mortality (Tumbarello, Spanu et al. 2006). Therefore, the development of new drugs with novel mechanisms of action and/or cellular targets is crucial to treat increasingly drug-resistant infections and alleviate a depleted drug pipeline.

Klebsiella pneumoniae is a prominent gram-negative and drug-resistant bacterium. Pathogenic strains are typically expressors of ESBLs (belonging to the TEM and SHV classes) and display resistance to a wide spectrum of beta-lactams including many penicillins and cephalosporins (Paterson, Hujer et al. 2003). Infections caused by multi-drug resistant strains of K. pneumoniae are mainly treated with carbapenems (e.g. imipenem and meropenem) (Yigit, Queenan et al. 2001). This therapeutic option is becoming less viable, with the increasing findings of carbapenem-resistant K. pneumoniae isolates; these strains display lowered drug permeability due to altered porin protein (Ardanuy, Linares et al. 1998) and/or expression of the AmpC carbapenemase

(Bradford, Urban et al. 1997). Carbapenem resistance in gram-negative bacteria

2 underscores the urgent need for novel drug discovery, considering the drugs’ status as

“agents of last resort” (Hirsch and Tam 2010).

1.2 Pantothenate Essentiality and Uptake Mechanisms

Williams et al. first discovered pantothenic acid (vitamin B5, its conjugate base is called pantothenate) as a growth stimulant of Saccharomyces cerevisiae (Williams,

Lyman et al. 1933). Because of the ubiquitous nature of the acidic substance, it was named after the Greek word pantothen, which means “from everywhere” (Williams,

Lyman et al. 1933). Insights into the chemical structure of pantothenic acid followed the discovery of β-alanine as another yeast growth factor (Williams and Rohrman 1936). β- alanine is a cleavage product of pantothenic acid, and yeast excretes excess pantothenic acid only when β-alanine is supplemented in the growth medium (Weinstock, Mitchell et al. 1939).

Snell et al. found that extracts from pig liver and yeast share a growth factor essential for the survival of lactic acid bacteria such as Lactobacillus delbruckii (Snell,

Strong et al. 1937). Purification and chemical characterization of this unknown substance led to its identification as pantothenic acid (Snell, Strong et al. 1938; Snell, Strong et al.

1939). Pantothenic acid can also stimulate the growth of bacterial pathogens such as

Corynebacterium diphtheriae (Evans, Handley et al. 1939); β-alanine is also a growth factor at higher concentrations (Mueller and Cohen 1937). In other bacteria such as

Scenedesmus obliquus, the amino acid precursor cannot be substituted for the essential vitamin (Algeus 1951). The synthetic pathway of pantothenate was first discovered and

3 characterized in Escherichia coli (Merkel and Nichols 1996). Despite disruption of any one of the enzymes in the pantothenate synthesis pathway, E. coli is viable as long as pantothenate is present in the medium (Gerdes, Scholle et al. 2002). A racemic mixture of pantothenic acid possesses 50% activity of the dextrorotatory (D) isomer, while the levorotatory shows none (Stiller, Harris et al. 1940). Pantothenate was later discovered to be the precursor of the essential coenzyme A (CoA) metabolic cofactor (described below)

(Hoagland and Novelli 1954).

The uptake of pantothenate occurs by means of a transporter present in virtually all bacteria (Gerdes, Scholle et al. 2002; Genschel 2004). In E. coli, exogenous pantothenate is readily taken up by a 12-transmembrane transporter called pantothenate permease (PanF), encoded by the PanF gene (Jackowski and Alix 1990). The activity of

PanF relies on a sodium ion gradient and has a Kt (transporter constant, analogous to

Michaelis-Menten constant) of 0.4μM for pantothenate. Over 90% of pantothenate is trapped by phosphorylation within 5 minutes of entry (Jackowski and Alix 1990). While an increase in PanF expression results in increased intracellular pantothenate, there is no corresponding relationship in levels of the final product CoA (Vallari and Rock 1985). In addition, the permease also possesses pantothenate efflux activity (Vallari and Rock

1985). The E. coli PanF shares some similarity in sequence to the E. coli proline symporter as well as mammalian glucose transporters (Reizer, Reizer et al. 1990). These transporters share two conserved tyrosine residues that are proposed to be essential for binding Na+ ions.

In chicks and rats, the discovery that a sodium-dependent, secondary active process was responsible for pantothenate uptake was the first evidence of the vitamin’s uptake in mammals (Fenstermacher and Rose 1986). In humans, pantothenate is transported into the cytosol by the sodium-dependent multi-vitamin transporter (SVMT)

(Prasad, Wang et al. 1999). The water-soluble vitamins biotin and lipoate are also substrates for the SVMT transporter (Prasad, Wang et al. 1998). The transport of the vitamins is dependent on both a sodium gradient and a specific membrane potential

(Prasad and Ganapathy 2000). The vitamin lipoate is capable of inhibiting the uptake of the other two vitamins (Prasad, Wang et al. 1998). The Kt values of this transporter for pantothenate and biotin are 1-3μM, and slightly higher for lipoate at 8-20μM (Prasad,

Wang et al. 1999).

1.3 Overview of Coenzyme A

During the investigation of a detoxification reaction in liver extract, Lipmann discovered a cofactor that is necessary for the acetylation of aromatic amines; the substance was thus termed coenzyme A (CoA, A for acetylation) (Lipmann, Kaplan et al.

1947). CoA is also required for acetylating other substances such as choline, histamine, amino acids and glucosamine (Lipmann 1953). The chemical structure of CoA comprises 3’-adenosine diphosphate, pantothenate and β-mercaptoethylamine moieties

(Fig. 1); the latter two constitute a pantetheine group (Baddiley, Thain et al. 1953). The knowledge that CoA is synthesized from pantothenate and is required for acetylation led to investigations into the effects of pantothenate-deficient conditions in rats; not

5 unexpected, the ability of rats to carry out acetylation was greatly diminished, but rapidly restored when pantothenate is readministered (Snell and Wright 1950). Lipmann also found a correlation between CoA and lipid levels, as lipid contents in rat liver and yeast are lower in CoA-poor conditions (Lipmann 1953).

3’-adenosine pantothenate β-mercapto- diphosphate ethylamine pantetheine

Figure 1. Chemical structure of coenzyme A. CoA is made up of 3’-adenosine diphosphate, pantothenate and β-mercaptoethylamine moieties, the last two of which constitute a pantetheine group.

CoA is a universally conserved acyl group carrier essential in multiple physiological processes that include Claisen condensation reactions and the citric acid cycle (also known as Kreb cycle, and tricarboxylic acid cycle). Claisen condensation is the formation of carbon-carbon bonds between two esters, or one ester and a carbonyl compound, of which fatty acid synthesis is a notable example (Heath and Rock 2002).

The essentiality of CoA to fatty acid synthesis is two-fold. Firstly, CoA is a precursor for acyl carrier protein (ACP), an essential component of the fatty acid synthase

(FAS) complex. Holo-ACP synthase converts apo-ACP to holo-ACP (the active form) by transferring the phosphopantetheine moiety from CoA onto the serine 36 side chain hydroxyl of apo-ACP (Flugel, Hwangbo et al. 2000). Besides synthesizing ACP, acyl groups derived from acyl-CoA are required to activate/prime components of the FAS complex. First, the acetyl group from acetyl-CoA is transferred onto a cysteine residue of the FAS complex. Similarly, the phosphopantetheine of holo-ACP is charged with malonyl from malonyl-CoA. Fatty acid synthesis then proceeds through repeated cycles of condensation, reduction, dehydration and isomerization steps whereby the fatty acid chain is extended two carbon units at a time by malonyl groups delivered by CoA (Fig. 2)

(Lehninger 2004). In conditions of CoA deficiency, decreased levels of saturated and unsaturated fatty acids are observed in E. coli (Jackowski and Rock 1986).

Figure 2. Overview of fatty acid synthesis. The FAS complex first receives acetyl (cysteine) and malonyl (ACP pantetheine) groups that are delivered by CoA. 1. The condensation step involves transfer of the acetyl group to the ACP malonyl group; the CH2 of malonyl nucleophilically attacks the carbonyl carbon of the acetyl group. The reaction is driven by the highly exergonic acyl bond cleavage of decarboxylation. 2. In the reduction step, the β carbonyl is reduced using the electron- donating cofactor NADPH. 3. Water is removed in an elimination reaction between the second and third carbon units. 4. In a second reduction step, the double bond is reduced to yield a saturated bond. 5. To prepare for a new cycle, the newly formed acyl group is transferred to the FAS cysteine, and the ACP pantetheine receives a new malonyl group from malonyl-CoA.

(from Principles of Biochemistry 4e. Lehninger 2004. Figure 21-2)

Acetyl-CoA (synthesized from acetate and CoA), the most common esterified

CoA derivative, is central to cellular metabolism (Lehninger 2004). In the citric acid cycle oxaloacetate is acetylated using acetyl-CoA to generate citrate. Each cycle generates the reduced coenzymes NADH and FADH2 that contribute to oxidative phosphorylation in ATP synthesis, accounting for over 90% of cellular energy requirements. In addition, the citric acid cycle generates precursors of amino acids and nucleotides, such as oxaloacetate and α-ketoglutarate (Lehninger 2004). In E. coli, a consequence of CoA depletion is overall deficiency in protein synthesis; this is likely due in part to a lack of succinyl-CoA suggesting that amino acid precursors generated by the citric acid cycle are insufficient to support amino acid synthesis (Jackowski and Rock

1986).

Acetylation plays diverse regulatory roles in prokaryotes. In E. coli, the RimL acetyltransferase uses acetyl-CoA to acetylate L12 ribosomal stock proteins, which increases the level of interaction within the stock complex to enhance stability in conditions of stress (Tanaka, Matsushita et al. 1989; Gordiyenko, Deroo et al. 2008). It is possible that protein acetylation serves as a signal for degradation, similar to eukaryotic proteolysis (Hwang, Shemorry et al. 2010). Protein lysine acetylation in bacteria is essential for multiple biochemical pathways that include transcription, translation, protein folding, and amino acid and nucleotide biosynthesis (Jones and O'Connor 2011). In E. coli, proteins that are lysine-acetylated catalyze reactions in glycolysis, the citric acid cycle as well as carbohydrate metabolism (Yu, Kim et al. 2008). In Salmonella enterica, acetyl-CoA is a negative feedback regulator of its own synthesis by contributing to the

10 acetylation of an acetyl-CoA synthetase (ACS) lysine residue to block ATP-dependent adenylation of acetate; the sirtuin CobB activates ACS via deacetylation (Starai, Celic et al. 2002). Also in S. enterica, reversible acetylation helps to regulate metabolism by modifying enzymes involved in gluconeogenesis and glycolysis in response to specific carbon sources (Wang, Zhang et al. 2010). As it turns out, approximately 90% of enzymes involved in metabolism are acetylated, and the overall level of acetylation in carbon source-reponsive proteins is significantly higher when cells are grown in glucose versus citrate (Wang, Zhang et al. 2010). These data suggest that acetyl-CoA, a metabolic molecule itself, is used to regulate metabolic homeostasis (Wang, Zhang et al.

2010). Bacteria also possess acetyltransferases that catalyze acetyl-CoA-dependent acetylation and inactivation of aminoglycoside antibiotics, contributing to a significant global rise in aminoglycoside resistance (Vetting, Magnet et al. 2004).

1.4 Synthesis of Coenzyme A

The synthesis of CoA can be separated into two parts: de novo synthesis of pantothenate, and the synthesis of CoA from pantothenate (Begley, Kinsland et al. 2001).

The first pathway is limited to fungi, plants and certain bacteria; mammals, including humans, must depend on diet in obtaining pantothenate (Raman and Rathinasabapathi

2004). The latter pathway is essential and conserved in all living systems (Genschel

2004).

1.4.1 De novo Pantothenate Synthesis

Pantothenate synthesis was first characterized in E. coli, and occurs in 4 enzymatic steps (Fig. 3) (Merkel and Nichols 1996). First, α-ketoisovalerate is hydroxymethylated at the α-carbon position by ketopantoate hydroxymethyltransferase

(KPHMT, encoded by the panB gene) to yield ketopantoate (Merkel and Nichols 1996).

Ketopantoate is then reduced at its carbonyl oxygen to hydroxyl by NADPH-dependent ketopantoate reductase (KPR, encoded by panE gene) to produce pantoate (Frodyma and

Downs 1998). β-alanine, derived from the decarboxylation of L-aspartate by aspartate decarboxylase (ADC, encoded by panD gene), is then combined with pantoate in an

ATP-dependent condensation reaction catalyzed by pantothenate synthetase (PS, encoded by the panC gene) to produce pantothenate (Merkel and Nichols 1996).

Figure 3. De novo pantothenate biosynthesis pathway in bacteria. Enzymes are abbreviated as follows: KPHMT (ketopantoatehydroxymethyl transferase), KPR

(ketopantoate reductase), PS (pantothenate synthetase), ADC (aspirate decarboxylase)

(from Genschel et al., 2004).

1.4.2 Coenzyme A Synthesis from Pantothenate

CoA synthesis from the pantothenate occurs in 5 enzymatic steps (Fig. 4). In the first step, pantothenate kinase (PanK) catalyzes the phosphorylation of pantothenate.

Next, 4’-phosphopantothenate is conjugated with a cysteine residue by 4’- phosphopantothenoyl cysteine synthetase, followed by decarboxylation by 4’- phosphopantothenoyl cysteine decarboxylase to produce 4’-phosphopantetheine. The adenylation of 4’-phosphopantetheine is catalyzed by 4’-phosphopantetheine adenyltransferase to produce dephospho-CoA, which is phosphorylated by dephospho-

CoA kinase to produce CoA.

Figure 4. CoA biosynthesis from pantothenate in bacteria. (from Genschel et al.,

2004).

1.4.2.1 Conversion of Pantothenate to 4’-phosphopantothenate

The first step in CoA synthesis is the ATP-dependent phosphorylation of pantothenate by pantothenate kinase (PanK, also known as coaA, encoded by the coaA gene) to yield 4’-phosphopantothenate (P-Pan) (Jackowski and Rock 1981). This thesis will focus on the structure and kinetic properties of the pantothenate kinase from the bacterium Klebsiella pneumoniae. The kinetic, regulatory and structural properties of the various classes of PanKs will be discussed in detail in a later section.

1.4.2.2 Conversion of 4’-phosphopantothenate to 4’-phosphopantetheine

In bacteria, such as E. coli, the synthesis of 4’-phosphopantetheine (PP) is synthesized in two steps from P-Pan. The two enzymatic reactions are catalyzed by the bifunctional 4’-phosphopantothenoylcysteine (PPC) synthetase/decarboxylase (PPC-

S/DC), encoded by the coaBC gene (Strauss, Kinsland et al. 2001). First, cysteine is combined with P-Pan in a condensation reaction that uses CTP and releases CMP and diphosphate as products. In the second step, the same enzyme then catalyzes the decarboxylation of PPC into 4’-phosphopantetheine (PP) (Strauss and Begley 2001).

PPCDC was first discovered as a product of the dfp gene, whose N-terminal domain shares sequence similarities with EpiD peptidylcysteine decarboxylase proteins

(Kupke, Uebele et al. 2000). It was renamed to coaBC when the C-terminal domain of dfp was found to also possess PPCS activity (Strauss, Kinsland et al. 2001; Kupke 2002).

In humans however, the same reactions are catalyzed by two separate enzymes, PPC-S and PPC-DC (Manoj, Strauss et al. 2003). Another distinction from the bacterial

16 pathway is that the human PPC-S enzyme uses ATP instead of CTP to catalyze cysteine conjugation (Manoj, Strauss et al. 2003).

1.4.2.3 Conversion of 4’-phosphopantetheine to Coenzyme A

The penultimate step in CoA synthesis is the conversion of PP to 3’-dephospho-

CoA (DPC) by phosphopantetheine adenyltransferase (PPAT, encoded by coaD gene)

(Geerlof, Lewendon et al. 1999). This reversible reaction is ATP-dependent, and releases pyrophosphate as a product (Geerlof, Lewendon et al. 1999). Dephospho-coenzyme A kinase (DPCK, also known as CoA synthase, and encoded by coaE gene) catalyzes the

ATP-dependent, final reaction in CoA synthesis by phosphorylating the 3’-hydroxyl group of the ribose moiety to yield CoA (Mishra, Park et al. 2001). In eukaryotes however, these two reactions are catalyzed by a two-domain protein that possesses both catalytic activities (Zhyvoloup, Nemazanyy et al. 2002).

1.5 Pantothenate Kinase as a point of drug discovery

CoA biosynthesis is known to be universally essential, even in pathogenic bacteria and fungi. Within this pathway, PanK is a practical target for drug discovery, given that it catalyzes the rate-determining step in CoA biosynthesis (Vallari, Jackowski et al. 1987). Inhibitor design based on CoA, a negative feedback regulator of its own synthesis, is impractical, since CoA and its analogues cannot freely cross the bacterial cell membrane (Mishra and Drueckhammer 2000). There is low sequence and structural homology between prokaryotic and eukaryotic PanKs (Genschel 2004; Ivey, Zhang et al.

2004; Hong, Yun et al. 2006; Hong, Senisterra et al. 2007). Most currently available antibiotics have an intracellular target and must overcome the obstacles to entry presented by the bacterial cell wall (Delcour 2009). Pantothenate and its derivatives (Fig. 5), from a structural perspective, are virtually indistinguishable and are readily taken up by bacteria via PanF transporters (Vallari and Rock 1985; Strauss and Begley 2002; Zhang,

Frank et al. 2004). The sections below outline pantothenate analogues that possess antimicrobial activity.

A. B. C1 C2 C6 C8 C4 C3 C7 N5

C. D.

Figure 5. Chemical structures of pantothenate and related derivatives. A.

Pantothenate (The atom positions are labeled in the chemical structure). B.

Pantoyltaurine. C. N-pantoyl-substituted amine. D. N-substituted Pantothenamide. The compounds differ in the carboxylic acid terminal (right side).

1.5.1 Pantoyltaurine

The first pantothenate analogue discovered to show antibacterial activity is pantoyltaurine, in which the carboxyl group of pantothenate in the C8 position is replaced with a sulphonate group (Fig. 5B). Snell demonstrated the growth inhibitory effects of pantoyltaurine on the lactic acid bacterium Lactobacillus arabinosus, and the addition of pantothenic acid antagonizes the effect observed (Snell 1941). Pantoyltaurine is also capable of inhibiting the growth of other pathogenic bacteria such as the streptococci S. hemolyticus and S. pneumoniae (McIlwain 1942). Similarly the addition of pantothenate to the growth medium provides some resistance to pantoyltaurine. In Corynebacterium diphtheriae, pantoyltaurine shows differential growth inhibition depending on the specific strain tested (McIlwain and Hawking 1943). In bacteria capable of de novo pantothenate synthesis such as Escherichia coli, Proteus morgani and Staphylococcus aureus, pantoyltaurine has no growth inhibitory effects (McIlwain and Hawking 1943).

Pantoyltaurine can be used to treat mice and rats infected with sulfonamide-resistant strains of S. hemolyticus (McIlwain and Hawking 1943). A proposed mechanism of action of pantoyltaurine is that its structural similarity to pantothenate leads to inhibition of pantothenate-dependent cellular pathways (McIlwain 1942).

1.5.2 N-pantoyl-substituted amides

Pantothenol (Fig. 5C) (the terminal carboxyl of pantothenate is replaced by a hydroxyl), is capable of inhibiting the growth of lactic acid bacteria that are incapable of synthesizing pantothenate (Shive and Snell 1945). Like pantoyltaurine, pantothenol does

20 not have any effect on the growth of either E. coli or S. aureus, and its antimicrobial activity is likely due to its competitive inhibition of pantothenate. Similar to pantothenate, only the dextrorotatory isomer possesses activity. Pantothenol also has comparable potency to pantoyltaurine (Shive and Snell 1945). In contrast to bacteria, pantothenol can promote growth in chicks with nearly equivalent efficacy as pantothenate

(Hegsted 1948).

1.5.3 N’-substituted pantothenamides

Previous pantothenate analogues have been synthesized via substitution of the terminal carboxylic acid group. The addition of chemical moieties beyond the C8 position of pantothenate was explored in the form of pantothenamides. While showing cytotoxicity in various bacteria, these compounds are especially effective against E. coli

(Clifton, Bryant et al. 1970) and S. aureus (Virga, Zhang et al. 2006).

In E. coli, N5-Pan is a substrate of PanK, and its phosphorylated product is processed by most downstream enzymes to produce the CoA analogue ethyldethia-CoA

(Ed-CoA) (Strauss and Begley 2002). Part of the potency of N5-Pan against E. coli is attributed to its rapid conversion to Ed-CoA, approximately 10.5 times faster than the conversion of pantothenate to CoA (Strauss and Begley 2002). As efficient alternate substrates of PanK, pantothenamides are effective competitive inhibitors of pantothenate showing IC50 values below 60μM (Ivey, Zhang et al. 2004). CoA analogues derived from pantothenamides lack the crucial terminal sulfhydryl group required for formation of acyl-CoA thioesters and likely interfere with CoA-utilizing enzymes (Strauss and

Begley 2002). Furthermore, in E. coli analogues of holo-ACP can be made from Ed-

CoA, and the accumulation of the inactive modified ACP molecules can lead to the inhibition of fatty acid synthesis (Zhang, Frank et al. 2004). However, the notion that the accumulation of inactive ACP underlies pantothenamide antimicrobial activity has been challenged since ACP phosphodiesterase can readily hydrolyze the inactive ACP back to apo-ACP (Thomas and Cronan 2010). In addition, exogenously supplementing fatty acids to S. pneumoniae cannot provide full resistance to N5-Pan (Zhang, Frank et al.

2004). Compared with untreated E. coli cells, the pool of intracellular acetyl-CoA is significantly reduced upon treatment with N5-Pan, which points to the inhibition of CoA synthesis as an underlying mechanism of pantothenamide toxicity (Thomas and Cronan

2010). The proposed mechanisms of action of pantothenamides in E. coli are illustrated in Figure 6.

In S. aureus, the mechanism of action of pantothenamides is unclear.

Pantothenamides were reported to inhibit PanK activity in S. aureus in contrast to being pseudosubstrates in E. coli (Choudhry, Mandichak et al. 2003). However, exposing strains of S. aureus to pantothenamides can lead to accumulation of inactivated ACP and deficient fatty acid levels, suggesting that S. aureus and E. coli are probably inhibited by the same mode of action (Virga, Zhang et al. 2006).

First-generation pantothenamides are capable of interfering with the growth of human cells. When tested in human HepG2 cells these compounds showed a significant level of growth inhibition with IC50 (concentration required to inhibit growth by 50%) values as low as 64 and 128μg/mL (Choudhry, Mandichak et al. 2003).

Pan N5-Pan

CoA-utilizing CoA N5-CoA pathways

Fatty Acid ACP N5-ACP Synthesis

Figure 6. Proposed mechanisms of pantothenamide toxicity in E. coli.

The chemical structures of pantothenate, CoA and ACP are shown on the left. The corresponding structures of N5-Pan and its downstream products are shown on the right.

Green and red arrows represent inductive/stimulatory and inhibitory effects, respectively.

The orange arrows indicate the absence of the essential sulfhydryl group essential for the biological function of carrying acyl groups. (adapted from Thomas and Cronan, 2010).

1.6 Overview of Pantothenate Kinases

PanK catalyzes the first step of CoA biosynthesis by catalyzing the ATP- dependent phosphorylation of the precursor pantothenate. PanKs are divided into three classes based on amino acid sequence, structure, regulatory properties and substrate kinetics (Fig 7). Type I PanKs are the first PanKs discovered and characterized, predominantly found in prokaryotes. Type II PanKs are mainly found in eukaryotic species, but interestingly also in select bacteria. Type III PanKs have an even wider distribution within the bacterial kingdom compared with type I enzymes. The sections below outline the properties distinct to each class.

1.6.1 Type I Pantothenate Kinases

The Escherichia coli PanK (EcPanK) is the best characterized type I enzyme.

The enzyme is encoded by the coaA gene, which when translated gives two products of molecular weight 36.4kDa and 35.4 kDa (a difference of 8 N-terminal residues) (Song and Jackowski 1992). In E. coli, a concentration 8μM β-alanine in the extracellular medium results in maximal CoA intracellular concentrations (Jackowski and Rock 1981).

Higher β-alanine concentrations produce an amount of non-phosphorylated pantothenate more than that required to maintain an optimal CoA level, leading to pantothenate excretion (Jackowski and Rock 1981). Furthermore, strains harboring multiple copies of the coaA gene express 76-fold higher levels of EcPanK, but only produce 2.7-fold higher levels of CoA (Song and Jackowski 1992). These findings suggest that EcPanK plays a

24 key regulatory role in CoA biosynthesis (Jackowski and Rock 1981; Song and Jackowski

1992).

EcPanK exists as a homodimer in solution (Song and Jackowski 1994). The enzyme contains the Walker A phosphate-binding motif (GXXXXGKS) and belongs to the P-loop kinase superfamily (Walker, Saraste et al. 1982; Yun, Park et al. 2000).

Kinetic studies have revealed sequential substrate binding in EcPanK; the binding of ATP is required for binding of pantothenate (Song and Jackowski 1994). The binding of ATP to one subunit of an EcPanK dimer promotes positive cooperative ATP-binding to the second subunit (Song and Jackowski 1994). Kinetic characterization reveals that the

Michaelis-Menten constants (Km) for pantothenate and ATP are 36 and 136μM, respectively.

In line with its presumed regulatory role in CoA biosynthesis, EcPanK is negatively regulated by feedback inhibition with CoA (Vallari, Jackowski et al. 1987).

Non-acylated CoA inhibits EcPanK activity approximately five times more potently than esterified derivatives like acetyl-CoA. CoA can also competitively inhibit the binding of

ATP (Vallari, Jackowski et al. 1987). A lysine residue of the P loop is essential for both

CoA and ATP binding; the lysine(101)-methionine mutant cannot not bind either compound (Song and Jackowski 1994).

The structures of EcPanK in complex with non-hydrolyzable ATP analogue

AMPPNP and CoA are available (PDB: 1ESM and PDB: 1ESN) (Yun, Park et al. 2000).

EcPanK is a dimer in the asymmetric unit. Comparison of the two co-crystal structures reveal that the α, β phosphates of CoA and the β, γ phosphates of AMPPNP occupy the

25 same space in the active site, and provides structural basis for CoA inhibition of EcPanK.

Specifically, the biphosphates compete for binding to lysine 101 (Yun, Park et al. 2000).

Interestingly the adenine moiety of CoA does not occupy the same space as that of

AMPPNP, but instead flips to occupy another protein cleft (Yun, Park et al. 2000). The

CoA-bound structure also reveals the basis for more potent inhibition by CoA compared with its thioesters; the terminal thiol group of CoA is located within a confined pocket in which acyl groups of the CoA thioesters cannot optimally fit (Yun, Park et al. 2000).

Comparison of the two co-crystal structures also reveals three key residues involved in

CoA binding, but not ATP binding. This finding is confirmed by mutations of Arg106,

His177 and Phe247 to alanine, which reveal decreased potency of CoA inhibition while retaining catalytic activity (Rock, Park et al. 2003). E. coli strains expressing these mutants show significantly higher intracellular levels of phosphorylated pantothenate derivatives and CoA, providing further evidence of EcPanK’s key regulatory role in CoA synthesis (Rock, Park et al. 2003).

The ternary complex structure of EcPanK bound with ADP and pantothenate is also available (Fig. 9A) (PDB: 1SQ5) (Ivey, Zhang et al. 2004). When superimposed onto the EcPanK-AMPPNP complex, the overall protein fold of the ternary complex is conserved with the exception of significant movement of a loop region containing residues 243-263; this stretch of residues is thought to act as a lid that closes over the active site upon substrate-binding. Superimposition with the EcPanK-CoA complex reveals that pantothenate of the ternary complex and the pantetheine moiety of CoA have the same mode of binding. The ternary complex was also used to simulate binding of

N5-Pan and N7-Pan, placing the alkyl chains within a hydrophobic pocket containing multiple aromatic residues. The two pantothenamides are substrates of EcPanK with Km values of 140 and 128μM, respectively (Ivey, Zhang et al. 2004).

The PanK from Mycobacterium tuberculosis (MtPanK) is another type I enzyme and shares approximately 52% sequence identity with EcPanK. Unlike EcPanK which has a clear preference for ATP, MtPanK can use either ATP or GTP as phosphate donors with equivalent efficiency. The structures of MtPanK in complex with multiple substrate and product combinations lend a unique opportunity for structural comparisons with

EcPanK (Chetnani, Das et al. 2009; Chetnani, Kumar et al. 2010; Chetnani, Kumar et al.

2011). The structural properties of the active site of MtPanK are distinct from those of

EcPanK. While the EcPanK active site conformation has flexibility to accommodate substrates and products, the MtPanK active site conformation is rigid and requires significant substrate movements for product formation. Similar to EcPanK, MtPanK can phosphorylate pantothenamides such as N-nonylpantothenamide (N9-Pan) (Chetnani,

Kumar et al. 2011).

1.6.2 Type II Pantothenate Kinases

Type II PanKs are found primarily in eukaryotic species. The first type II enzyme characterized is the PanK from Aspergillus nidulans (AnPanK) that also has sequence resemblance to the PanK of S. cerevisiae (Calder, Williams et al. 1999). However,

AnPanK has very low sequence homology with the well-characterized EcPanK.

Furthermore, whereas CoA is the strongest inhibitor of EcPanK, AnPanK is more

27 strongly inhibited by acetyl-CoA (Calder, Williams et al. 1999). Differences in amino acid sequence and regulatory properties between AnPanK and EcPanK have justified a separate classification for AnPanK.

The first mammalian PanK discovered and characterized is the PanK from M. musculus (mPanK) that has high sequence homology to AnPanK, but also bares little resemblance to EcPanK (Rock, Calder et al. 2000). The mPanK1 gene encodes for two alternatively spliced gene products; mPanK1α is expressed in the heart and kidney, and mPanK1β is found in the liver and kidney. Like AnPanK, acetyl-CoA inhibits both isoforms of mPanK more strongly than CoA with an IC50 of approximately 20μM (Rock,

Calder et al. 2000). However, CoA shows stimulatory activity that appears to be unique to mPanK1β (Rock, Calder et al. 2000). Malonyl-CoA strongly inhibits the α-isoform, but moderately so for the β-isoform (Rock, Karim et al. 2002). It is possible that differential expression of mPanK1α and mPanK1β serves to regulate free CoA:esterified

CoA levels (Rock, Karim et al. 2002).

There are four subtypes of human PanKs (PANK1, PANK2, PANK3 and

PANK4) that were discovered when PANK2 was mapped out in connection with pantothenate kinase-associated neurodegeneration (PKAN) (Zhou, Westaway et al.

2001). All four human PANK isoforms share a conserved catalytic core, and are products of the differentially spliced PANK gene (Hong, Senisterra et al. 2007). PANK1

(containing isoforms α and β) is expressed in multiple organs including the heart, kidney and liver. PANK2 is exclusively found in the brain (specifically, basal ganglia). PANK3 is expressed primarily in the liver (Zhou, Westaway et al. 2001). PANK4 is found

28 mainly in muscle and has sequence similarity with S. cerevisiae and C. elegans (Zhou,

Westaway et al. 2001). As it lacks the essential glutamate residue required for kinase activity, PANK4 is the only inactive isoform and its function is unknown (Hong,

Senisterra et al. 2007). The involvement of PANK2 mutations in neurodegeneration is unclear though they are correlated with abnormal iron accumulation in the brain (Leoni,

Strittmatter et al. 2012).

Although type II enzymes are widely known to constitute the group to which eukaryotic PanKs belong, some bacterial PanKs are classified into this class. Most notable are the PanKs from staphylococci (S. aureus, S. epidermidis and S. haemolyticus) as well as bacilli (B. cereus and B. subtilis) (Choudhry, Mandichak et al. 2003).

Phylogenetic analysis shows that SaPanK is a distant relative of the PanK from

Drosophila melanogaster (Choudhry, Mandichak et al. 2003). Unlike all previously discovered type I and II PanKs, CoA and its thioesters do not inhibit SaPanK (Leonardi,

Chohnan et al. 2005). The lack of feedback regulation would lead to elevated levels of

CoA; S. aureus lacks glutathione and likely relies on CoA, a component of the CoA/CoA disulfide reductase redox (CoADR) system, to relieve oxidative stress (Leonardi,

Chohnan et al. 2005).

The structure of SaPanK in complex with the ATP analogue AMPPNP is available (Fig. 9B) (PDB: 2EWS) (Hong, Yun et al. 2006). Each subunit of the SaPanK dimer is made up of actin-like domains that place the enzyme within the acetate/sugar kinase/heat shock protein 70/actin (ASKHA) superfamily (Hurley 1996; Hong, Yun et al.

2006). A Mg2+ ion coordinates the AMPPNP β and γ phosphates, which also interact with the P loop and “pseudo-P loop” motifs of the actin domains.

The crystal structures of the human PANK1α and PANK3 in complex with acetyl-CoA have been solved (PDB: 2I7N and 2I7P) (Hong, Senisterra et al. 2007).

Human PANK1α and PANK3 show a high affinity for acetyl-CoA, as extensive dialysis and incubation with the ATP analogue AMPPNP can not dislodge the feedback regulator from the active site (Hong, Senisterra et al. 2007). Like SaPanK, human PanK also contains actin-like domains that resemble motifs of ASKHA family members. The binding site of the pantetheine group of acetyl-CoA is located at the dimer interface; this is in contrast to type I PanKs that do not share subunits for inhibitor/substrate binding

(Hong et al., 2007). The human structures provide the structural basis for stronger inhibition of CoA thioesters versus CoA; the carbonyl group from the acetyl group forms a hydrogen bond with a valine main chain amide nitrogen. Mutagenesis studies involving thermostability assays, in conjunction with structural analysis of the two solved human

PanK isoforms, led to classification of PANK2 mutations (in connection with PKAN) into three categories; mutations are either located at the dimer interface (affecting ability to dimerize), the active site (affecting catalytic activity and/or capacity to bind substrates), or the protein surface (to negatively affect thermostability) (Hong, Senisterra et al. 2007).

No kinetic studies have been published regarding human PANKs using pantothenamides as substrates. However, one study found that the pantothenamides N7-

Pan and N9-Pan showed potent IC50 values of 64 and 128μ/mL respectively when tested

30 in human HepG2 liver cells (Choudhry, Mandichak et al. 2003). In addition, the structure of human PANK3 in complex with N7-Pan (PDB: 3SMS) shows that the compound occupies the pantothenate-binding site of the human enzyme.

1.6.3 Type III Pantothenate Kinases

Type III PanKs (also called coaX) are a recently discovered class with low sequence homology to types I and II PanKs, and also show considerably different structural and kinetic properties. Compared to type I PanKs, this third type has an even wider distribution in the bacterial kingdom (Yang, Eyobo et al. 2006). Despite sharing minimal similarity in sequence to types I and II PanKs, the remaining four enzymes of the five-step CoA synthesis pathway are conserved (Brand and Strauss 2005). Km values of type III PanKs for pantothenate are comparable to those of types I and II PanKs, though Km values for ATP are unusually high in the millimolar range (Brand and Strauss

2005; Hong, Yun et al. 2006; Yang, Eyobo et al. 2006). Some bacteria such as

Mycobacteria express types I and III PanKs, though the latter is non-essential (Awasthy,

Ambady et al. 2010). In addition, unlike prokaryotic type I and eukaryotic type II enzymes, type III PanKs are not feedback-regulated by CoA or its thioesters. Similar to

S. aureus, the lack of feedback regulation in bacilli (such as B. anthracis and B. subtilis) can be justified also by a lack of glutathione and dependence on the CoADR redox system for detoxification of oxidative stress (Nicely, Parsonage et al. 2007). Another distinct feature of type III PanKs is the requirement of a monovalent cation, such as

+ + NH4 , or K , for activity (Hong, Yun et al. 2006).

The structures of the type III PanKs from Pseudomonas aeruginosa (PaPanK)

(Fig. 9C) (PDB: 2F9T) (Hong, Yun et al. 2006) and Thermotoga maritima (TmPanK)

(PDB: 3BEX) (Yang, Eyobo et al. 2006) are available. These enzymes contain actin-like folds, like SaPanK, placing them in the ASKHA superfamily. However, they cannot use pantothenamides as substrates. The PaPanK-pantothenate binary complex provides the structural basis for resistance of type III-expressing bacteria to pantothenamides; the portion of the substrate-binding site that interacts with the pantothenate carboxyl end does not have additional space to fit any N-substitutions on pantothenamides (Hong, Yun et al. 2006). The TmPanK-ADP-Pan ternary complex structure (PDB: 3BF1) (Yang,

Strauss et al. 2008) reveals the substrate-binding site to be at the dimerization interface; like type II PanKs, the substrate is stabilized by binding to both subunits of the dimer.

Interestingly, some type III PanKs (such as those from P. aeruginosa and H. pylori) have high sequence homology to the Bordetella pertussis Bvg accessory factor

(Baf) (Brand and Strauss 2005). Baf is a transcriptional regulatory protein that interacts with the transcription factor Bvg to enhance the expression of the ADP-ribosylating pertussis toxin (DeShazer, Wood et al. 1995; Wood and Friedman 2000; Williams,

Boucher et al. 2005).

Type 3

Type 2

Type 1

Figure 7. Phylogenetic distributions of prokaryotic and eukaryotic pantothenate kinases from notable organisms. The phylogenetic tree shows the distribution of the three types of PanKs. The human and murine PanKs are both of isoform 3, the subtype containing only the conserved catalytic core. The tree was generated using the software on www.phylogeny.fr, following alignment of sequences by ClustalW.

Figure 8. Sequence-based alignments of prokaryotic and eukaryotic PanKs from types I (A), II (B), and III (C). Conserved (red) and similar (yellow) residues are indicated.

Figure 9. Comparison of the structures and dimer folds of types I, II and III bacterial PanKs. A. EcPanK (PDB: 1SQ5). B. SaPanK (PDB: 2EWS). C. PaPanK

(PDB: 2F9T). Each colour denotes a single subunit.

1.7 Hypothesis and Rationale for Study

Our working hypothesis is that structural characterization of the KpPanK substrate-binding site will provide basis for design of specific KpPanK pantothenate analogues to treat klebsiella infections.

KpPanK has high sequence homology with EcPanK (90.3% identity), which contains an aromatic pocket towards the carboxyl end of the pantothenate substrate; it is likely that KpPanK has a similar pocket that was proposed to accommodate pantothenamide N-substitutions for EcPanK (Ivey, Zhang et al. 2004). This pocket represents an empty space that can be occupied with N-substitutions for enhanced binding affinity; we propose that chemical groups can be introduced to optimize interactions with pocket residues. High sequence homology with EcPanK also suggests that pantothenamides can also be phosphorylated as substrates by KpPanK. Next, a K. pneumoniae contains a PanF similar to that found in E. coli. Moreover, the four downstream enzymes involved in CoA biosynthesis are present in K. pneumoniae, suggesting that these substrate analogues, as in E. coli, can lead to accumulation of CoA derivatives, covalent inactivation of ACP and subsequent inhibition of fatty acid synthesis.

1.7.1 Aims and Approaches

The primary objective of these studies is to solve the three-dimensional structure of KpPanK by X-ray crystallography, an important technique that can allow us to elucidate the architecture of its substrate-binding site at atomic resolution. Structural

38 characteristics of the pantothenate-binding site can then be exploited for the design of pantothenate derivatives that bind to KpPanK with high affinity.

1.7.2 Rationale for Experimiental Approach

1.7.2.1 Structure Determination of Macromolecules

Nuclear magnetic resonance (NMR) spectroscopy and X-ray crystallography represent the two principal methods for structure determination of biological macromolecules at the atomic level. Each method has its strengths and weaknesses.

NMR spectroscopy enables elucidation of atomic details of a protein in its solution state, but is limited by the extensive amount of time required for solving one structure

(Gronwald and Kalbitzer 2010) as well as the size of the protein of interest; the technique is ideally suited for proteins under 40 kDa in size (Doerr 2006). X-ray crystallography is the method of choice for solving structures. This technique represents an efficient method of macromolecular structure determination at atomic resolution without the limitations of protein size and time restraints imposed by NMR (Feng, Pan et al. 2010).

To date, nearly 90% of over 80,000 structures deposited to the Protein Data Bank (PDB) were solved by crystallography.

1.7.2.2 X-ray Crystallography

X-ray crystallography takes advantage of a protein crystal’s ability to scatter X- ray beams (Bragg 1915). X-rays are diffracted by the electron cloud surrounding each atom. Subsequently, diffraction patterns recorded by a detector can be used to recreate

39 the electron density into which a model of the target protein can be built (Bragg 1915;

Rupp 2009).

1.7.2.3 Protein Crystallization

Protein overexpression and purification are necessary for providing a protein sample of adequately high concentration and purity required for crystallization. A common method for crystallization is vapour diffusion. Purified protein is first mixed with a solution of precipitant (for example, ammonium sulfate or polyethylene glycol), within a closed container over a large reservoir that holds the same solution. The concentrations of both components are initially below that necessary to precipitate the protein out of solution (Rhodes 2006). The water content of the mixture gradually diffuses to the reservoir, thereby raising the concentrations of protein and precipitant to cause precipitation; a crystal is the result of protein precipitated out of solution in an ordered manner (Rhodes 2006). Crystal formation takes place in two stages: nucleation and growth (Fig. 10A). First, protein molecules cluster together to “nucleate”, or to form a seed. This is followed by the addition of protein molecules in solution to the seed during crystal growth (Fig 10B).

Factors that can affect crystallization include pH, type of precipitant, concentrations of protein and precipitant, protein purity and temperature (Rhodes 2006).

The use of screening kits is a practical method for determining an initial crystallization condition. The fine-tuning of these factors may be necessary to produce optimally diffracting protein crystals (this is commonly referred to as optimization).

A. B.

Figure 10. Phase diagram of protein crystallization. A. Sufficiently high concentrations of protein and precipitant are necessary for nucleation and crystal growth

(blue); only crystal growth can be attained at lower concentrations (green). The red zone indicates low concentrations that cannot support nucleation or growth. B. Large crystals are ideally grown when peak protein and precipitant concentrations achieved are just enough to achieve nucleation, followed by a shift to the green zone for crystal growth.

(from Crystallography Made Crystal Clear. Rhodes 2006, Figure 3.5).

1.7.2.4 Data Collection

Two key components of structure factors used to calculate an electron density map are amplitude and phase (Rhodes 2006). The former can be acquired through data collection, which involves obtaining information on the intensities of reflections (or spots), the square roots of which are amplitudes of the structure factors. Data collection consists of obtaining the diffraction patterns of the protein crystal in one-degree increments; usually a total rotation of 180º (to obtain 180 frames) is sufficient to achieve a complete data set.

The collection of x-ray diffraction data at extremely low temperatures (known as cryocrystallography) such as in liquid nitrogen, is beneficial as it protects the crystal against radiation damage (Rhodes 2006). A single crystal could then be used to collect a complete data set, which otherwise would require several crystals if data collection took place at room temperature. Ice crystals can form when protein crystals are frozen, requiring the use of cryoprotectants (substances that prevent ice crystal formation).

1.7.2.5 Structure Determination

Following data collection, the first step in processing the data is indexing, which involves finding the correct crystal symmetry space group based on the geometric arrangement of reflections (ie. spots in a diffraction pattern) (Rupp 2009). In the integration step, intensities are assigned to the reflections for all frames. Next, the scaling of data merges all corresponding reflections between each frame into a single set

42 of unique reflections (after removal of all outliers), and finds a consistent intensity scale for all reflections.

Data collection can only provide information on structure factor amplitudes, whereas phase information is lost. Molecular replacement (MR) is a common method employed to solve this “phase problem” by using a similar structure as a search model.

MR searches for a correct solution by orienting the model such that it corresponds with the observed amplitudes (Rossmann 1962; Evans and McCoy 2008). Next, the phases of the model are “borrowed” and used to estimate phases of the unknown structure, which are combined with experimentally determined amplitudes to calculate an electron density map for the target protein.

2 MATERIALS AND METHODS

2.1 Materials

The KpPanK template gene (1-316) was synthesized by GenScript. The expression vector pET28-MHL was developed in-house by the Structural Genomics

Consortium (Fig 11). Pfu UltraII DNA polymerase was purchased from Agilent

Technologies. Restriction enzymes for plasmid digestion were purchased from New

England Biolabs. Primers were synthesized by Eurofins Operon. PCR purification and miniprep kits were purchased from Qiagen. Growth media (Luria-Bertani, and Terrific

Broth) were purchased from Sigma-Aldrich. Benzonase nuclease was purchased from

Novagen. DE52 anion exchange resin was purchased from Whatman. Nickel-

43 nitrilotriacetic acid (Ni-NTA) resin beads were purchased from Qiagen. SDS-PAGE gels

(TGX 4-20%) were purchased from Biorad.

Adenosine diphosphate (ADP) was purchased from Sigma. The pantothenamides used for structural and kinetic studies, N5-Pan, Np-Pan and compound 349, were generously provided by our in-house chemists, Drs. David Smil and Yuri Bolshan. D- pantothenic acid was purchased from Sigma-Aldrich. Crystallization screening kits were developed and made in-house. 96-well plates (Art Robbins Intelliplates) used for crystallization trials were purchased from Hampton Research. Proteases used for in situ proteolytic treatment were purchased from Sigma. For crystal optimization, the Additive

Screen kit from Hampton Research was used.

For the kinase activity assay, the following were purchased from Sigma: pyruvate kinase and lactate dehydrogenase enzymes, adenosine triphosphate (ATP), phosphoenolpyruvate (PEP), and reduced β-nicotinamide adenine dinucleotide (NADH).

Figure 11. Overview of the pET28-MHL expression vector. The vector encodes a kanamycin resistance marker and a hexahistidine tag located N-terminal to the gene of interest. The vector is first linearized by restriction enzyme digestion (at sites flanking the SacB gene), and the SacB gene is replaced with the gene of interest upon ligation. A powerful promoter, the T7 promoter, mediates rapid transcription of the inserted gene by the T7 polymerase.

2.2 Methods

2.2.1 Preparation of Expression Plasmid

KpPanK constructs were designed based on previously solved structures in the

PDB (specifically, EcPanK and MtPanK) as well as secondary structure predictions.

Gene inserts for each construct were amplified by polymerase chain reaction; primers corresponding to each construct contain sequences that are complementary to BseRI restriction enzyme recognition sites (Table I). A small amount of PCR products was analyzed by electrophoresis on a 1% agarose gel to confirm the presence and size of amplified gene inserts. For ligation of gene to vector, 1μL of PCR product was mixed with 2µL of Infusion HD EcoDry pellet (Clontech) dissolved in linearized pET28-MHL vector (pre-digested with BseRI enzyme). The mixture was incubated at 37ºC for 20 minutes, room temperature for 10 minutes and put on ice. The ligated mixture was then transformed to E. coli DH5α cells, and plated onto LB agar plates (containing kanamycin) and incubated overnight at 37ºC. Colonies confirmed with a positive gene insert were chosen for growth, and the plasmid DNA was extracted by miniprep (Qiagen

Miniprep kit).

250 kD

150 kD

100 kD 75 kD

50 kD

37 kD

25 kD 20 kD 15 kD 10 kD K1 K2 K3 K4 K5 K6 K7

Figure 12. Small scale test of expression of KpPanK constructs. The soluble portion

(left) and whole cell lysates (right) for each construct are shown. The arrow indicates the protein bands corresponding to solubly-expressed KpPanK. The sizes of the standard protein ladder markers on the left are indicated.

Construct Forward Primer Reverse Primer Start End

K1 ttgtatttccagggcATGAGCCAAAAAGAGCAGACG caagcttcgtcatca TTTACGTAAGCGTACTTGATTCAC 1 316

K2 ttgtatttccagggcCAGACGTTAATGACACCGTAC caagcttcgtcatca TTTACGTAAGCGTACTTGATTCAC 6 316

K3 ttgtatttccagggcCAGACGTTAATGACACCGTAC caagcttcgtcatcaACGTAAGCGTACTTGATTCACAG 6 315

K4 ttgtatttccagggcATGACACCGTACCTACAATTTAAC caagcttcgtcatcaTTTACGTAAGCGTACTTGATTCAC 9 316

K5 ttgtatttccagggcATGACACCGTACCTACAATTTAAC caagcttcgtcatcaACGTAAGCGTACTTGATTCACAG 9 315

K6 ttgtatttccagggcTACCTACAATTTAACCGCCACC caagcttcgtcatcaTTTACGTAAGCGTACTTGATTCAC 12 316

K7 ttgtatttccagggcTACCTACAATTTAACCGCCACC caagcttcgtcatcaACGTAAGCGTACTTGATTCACAG 12 315

Table I. Sequences of primers used to generate KpPanK constructs of variable truncation. The forward (ttgtatttccagggc) and reverse (caagcttcgtcatca) tail additions correspond to the BseRI recognition sites. The start and end positions of each construct are also indicated.

2.2.2 Protein Expression and Purification

KpPanK plasmids were transformed into E. coli BL21(DE3) competent cells

(BL21 refers to a strain deficient in lon and ompT proteases, and DE3 designates an

IPTG-inducible T7 polymerase – explained below) by heat shock, and plated onto LB agar and incubated at 37ºC overnight. The next day, Luria-Bertani (LB) broth (Sigma) was inoculated with transformants and grown at 37ºC for 16 hours. Next morning, the overnight LB broth culture was transferred into Terrific Broth (TB) (Sigma) and further grown at 37 ºC to achieve an OD600 of ~0.7 before overnight induction with 1mM isopropyl β-D-thiogalactopyranoside (IPTG) at 18 ºC for 16 hours (T7 polymerase expression in BL21(DE3) cells is under the control of the lac operon, whereby the allolactose analogue IPTG binds to and inactivates the lac repressor to induce T7 expression, leading to excess gene transcription). The cells were harvested next morning by centrifugation, flash frozen with liquid nitrogen and stored at -80 ºC until purification.

Prior to the start of protein purification, cell pellet was thawed and resuspended in buffer A (50mM Tris-HCl pH 8.0, 5% [v/v] glycerol, 300mM NaCl), and supplemented with 5mM imidazole, 0.5% 3-[(3-cholamidopropyl)dimethylammonio]-1- propanesulfonate, 5 units/mL benzonase, 1mM phenylmethylsulfonyl fluoride and 1mM benzamidine. The cells were lysed by sonication using a Misonix Sonicator 3000 (10s

ON, 10s OFF, for a total of 20 minutes at power output ~120W). The lysate was then clarified by centrifugation (16000rpm for 90 minutes using a Beckman Coulter J-20 XPI

Centrifuge fitted with a JLA 16.250 rotor) and the supernatant was loaded into an open column (Biorad Econo) containing DE52 resin (pre-charged with 2.5M NaCl) (DE52 is

49 an ionic exchange resin that is used both to capture anionic molecules such as nucleic acids, and to filter the lysate). The flow-through from the first column drips onto a second open column containing nickel nitrilotriacetic (Ni-NTA) resin beads to which hexahistidine tagged proteins bind with high affinity. Once the lysate had passed through, the Ni-NTA beads were washed with 50mL buffer A containing 30mM imidazole. The protein was then eluted using 10mL of buffer A containing 500mM imidazole (Fig. 13A).

The protein sample was further purified by size exclusion chromatography (SEC) using Superdex 75 resin that was pre-equilibrated with gel filtration buffer (20mM Tris-

HCl pH 8.0, 5% glycerol, 200mM NaCl). The purity of each fraction was assessed using

SDS-PAGE gels (Fig. 13B); fractions of the highest purity were pooled together. The molecular weight of the protein was verified by mass spectrometry.

Types I and II PanKs are known to bind with high affinity to CoA and its thioesters, which show up in the crystal structures despite extensive dialysis (Hong,

Senisterra et al. 2007; Chetnani, Das et al. 2009). To remove co-purified substrates or inhibitors, the protein was dialyzed for 3 days in 20mM Tris-HCl pH 8.0. The protein was then concentrated to 35mg/mL using centrifugal filter units (Amicon 15mL size with

10kDa cutoff). Protein concentration was verified by triplicate measurements using the

NanoDrop 1000 Spectrophotometer (this instrument measures UV absorbance at 280nm, which is due mainly to tryptophan and tyrosine residues).

A. 250 kD 150 kD 100 kD 75 kD 50 kD 37 kD 25 kD 20 kD 15 kD 10 kD

Wash Elution

HiLoad 26 60 S75001:10_UV HiLoad 26 60 S75001:10_Fractions

mAU B. 250 kD

2000 150 kD

100 kD 75 kD

1500 50 kD 37 kD

25 kD

1000 20 kD 15 kD A10 A11 A12 B12 B11 B10 10 kD

500

0 A1 A2 A3 A4 A5 A6 A7 A8 A9 A10 A11 A12 B12 B11 B10 B9 B8 B7 B6 B5 B4 B3 B2 B1 120 140 160 180 200 220 ml

Figure 13. Purification of KpPanK. A). SDS-PAGE gel of the wash flowthrough (left) and eluted protein (right) during Ni-NTA affinity purification. (Note: The protein was purified by splitting the sample into two open columns.) B). SDS-PAGE gel of gel filtration peak fractions.

2.2.3 Protein Crystallization and Data Collection

KpPanK protein was incubated with 5mM MgCl2, 30mM ADP and 30mM substrate (pantothenate, N5-Pan, N7-Pan, Np-Pan or compound 349) overnight at 4ºC.

The inclusion of ADP is due to sequential substrate binding observed in the type I E. coli

PanK (ie. nucleotide binds first, followed by substrate) (Song and Jackowski 1994). The diphosphate form was chosen over the triphosphate form to prevent formation of a phosphorylated product which can be released easily. The protein was then mixed at 1:1

(0.5μL) ratio with solutions from two in-house screening kits (containing 96 conditions each) using a Rigaku Phoenix-HT liquid-handling robot, and crystallized using the sitting drop vapour diffusion method in 96-well Intelliplates. In situ proteolysis was also used to increase the success rate of crystallization (Dong, Xu et al. 2007). Briefly, this method involves the addition of trace amounts of protease to the buffer:protein mixture for the purpose of truncating flexible polypeptides to yield more globularly shaped proteins

(favourable for crystallization). In these studies, 1:500 ratio by weight of protease to protein was added (e.g. 1mg of protease per 500 mg of protein). The proteases used include: α-chymotrypsin, trypsin, elastase, subtilisin, endoproteinase Glu-C V8, papaya proteinase I, dispase I and thermolysin.

Within a week, crystals appeared in a condition containing 20% (w/v) PEG3350 and 0.2M tri-lithium citrate in drops that did not contain proteases (Fig 14A, 15A).

Though crystals also appeared when proteases were supplemented, initial attempts at optimization omitted proteases. Crystals were transferred to a cryoprotectant solution

52 containing 1:1 mixture of paratone-N and mineral oil, and stored in liquid nitrogen for screening/data collection.

Dr. Wolfram Tempel (SGC, Toronto) generously provided technicial assistance in screening crystals using the in-house X-ray generator (Rigaku Rotating Copper Anode) in the Structural Genomics Consortium (SGC). Among crystals from the original condition and several initial rounds of optimization (altering PEG3350 and tri-lithium citrate concentrations), the best resolution was 3.5Å. The diffraction quality of the crystals was significantly improved by growing them in the mixture mentioned previously and supplementing 0.2 μL of additives from the Hampton Research Additive

Screen kit (96 additives): (±)-1,3-butanediol helped improve N5-Pan bound crystal diffraction to 2.1Å (Fig. 14B); 2,5-hexanediol improved the resolution of crystals from protein incubated with Np-Pan (Fig. 15B).

Data used to solve the final structures were collected at the Advanced Photon

Source (Argonne National Laboratory, IL, USA). Diffraction data for KpPanK complexed with N5-Pan were collected using 19-ID beamline. Data for KpPanK complexed with Np-Pan were collected using the 23-IDB beamline. Dr. Wolfram

Tempel and ANL staff generously provided assistance in collecting X-ray diffraction data.

Diffraction data were indexed and integrated by using the program XDS (Kabsch

2010), and processed and scaled by Pointless and Scala (Evans 2006) in the CCP4 suite

(Collaborative Computational Project 1994).

Figure 14. Crystals of KpPanK co-crystallized with N5-Pan. A. Initial crystals of

N5-Pan bound KpPanK, grown by mixing 0.5μL protein (35mg/mL incubated with

30mM N5-Pan, 30mM ADP and 5mM MgCl2) and 0.5μL reservoir buffer (20% w/v

PEG3350, 0.2M tri-lithium citrate). These crystals diffracted with an average resolution of 3.5Å. B. Optimized crystals of KpPanK incubated with N5-Pan grown by adding

0.2μL 40% (±)-1,3-butanediol to the mixture mentioned. The best crystal diffracted to

2.1Å resolution.

Figure 15. Crystals of KpPanK co-crystallized with Np-Pan. A. Initial crystals of

Np-Pan bound KpPanK, grown by mixing 0.5μL protein (35mg/mL incubated with

30mM Np-Pan, 30mM ADP and 5mM MgCl2) and 0.5μL reservoir buffer (20% w/v

PEG3350, 0.2M tri-lithium citrate). B. Optimized crystals of Np-Pan bound KpPanK

grown by adding 0.2μL 2,5-hexanediol to the mixture mentioned. The best crystal

diffracted to 1.95Å resolution.

Compound Chemical Successful Best Resolution Structure crystallization

Pantothenate yes >10.0Å

N-pentylpantothenamide yes 2.1Å (N5-Pan)

N-heptylpantothenamide yes >10.0Å (N7-Pan)

N-pyridin-3- yes 1.95 Å ylmethylpantothenamide (Np-Pan) Compound 349 yes 4.0Å

Table II. Summary of substrates used for KpPanK co-crystallization and the best resolution achieved.

2.2.4 Structure Determination, Refinement and Validation

The structure of KpPanK complexed with N5-Pan was solved by molecular replacement using the program PHASER-MR (Read 2001) and one monomer of the E. coli PanK (PDB: 1SQ5) as a search model (EcPanK is a suitable model because it shares

90% sequence identity with KpPanK). The output from XDS following indexing and integration provided the unit cell dimensions of the KpPanK crystals, and indicated the lattice with the highest symmetry space group to be primitive orthorhombic (P222) (a crystal lattice in the form of a rectangular prism defined by 90º crystallographic axes).

The number of molecules in the asymmetric unit could be predicted using the Matthews coefficient (volume of the unit cell divided by the product of the protein’s molecular weight, number of asymmetric units per unit cell and the number of molecules per asymmetric unit). Matthews probability calculation (Matthews 1968; Kantardjieff and

Rupp 2003) indicated that there are most likely eight or nine monomers per asymmetric unit (Fig. 17), based on empirically observed Matthews coefficients from structures deposited in the PDB. However, since the known functional unit of type I PanKs is a homodimer (Song and Jackowski 1994), eight subunits were entered as a search parameter in molecular replacement. The high resolution limit was set to 4Å in

PHASER-MR to allow for possible conformational differences in the side chains between the KpPanK structure and the search model. The space groups belonging to the primitive orthorhombic class (P222, P2221, P21212 and P212121) were tested to find the correct molecular replacement solution. Of the tested space groups, the group P212121 showed the best solution (ie. no clashes were observed between the subunits when the model was

57 displayed on screen). After one round of model refinement, the working and free R factors were 28% and 32%, respectively.

Manual model building was done using the program Coot (Emsley and Cowtan

2004; Emsley, Lohkamp et al. 2010). Water molecules were built in Coot with the following restrictions with the following requirements: visible density with hydrogen bond distances between 2.2 and 3.2Å. Uninterpretable density was modeled as unknown

(UNX) atoms. The model was refined using Refmac5 (Murshudov, Skubak et al. 2011) in the CCP4 suite. Hydrogen atoms were generated for refinement in Refmac5, but were excluded in the coordinate output.

For KpPanK in complex with Np-Pan, the diffraction data were integrated, indexed and scaled as with the N5-Pan structure. Indexing by XDS also indicated nearly identical unit cell dimensions and space group as the N5-Pan structure. As such, the coordinates of the KpPanK·N5-Pan structure were used to refine against the newly scaled data of the KpPanK·Np-Pan complex after removing all water molecules and bound N5-

Pan. The working and free R factors from an initial round of refinement were 24% and

28% respectively. Water molecules were added using Coot, as mentioned in model building of the KpPanK·N5-Pan complex.

The restraints for the chemical structures of ligands (N5-Pan and Np-Pan) used in refinement were generated using the PRODRG server (Schuttelkopf and van Aalten

2004). The Molprobity server was used to validate both structures for bond angle and length variations, Ramachandran outliers and proper amino acid rotamers (or conformation of side chains) (Chen, Arendall et al. 2011). All figures were generated

58 using PyMOL (The PyMOL Molecular Graphics System, Version 1.5.0.3, Schrödinger,

LLC).

Statistics for data collection and refinement are shown in Table III. The KpPanK structures in complex with N5-Pan and Np-Pan have been deposited to the PDB with accession codes 4F7W and 4GI7, respectively.

Figure 16. Diffraction patterns of KpPanK crystals. A. Diffraction pattern of a crystal when screened with the SGC in-house X-ray generator Rigaku (model FR-E) containing a rotating copper anode. B. Diffraction pattern of obtained during data collection using the 19-ID beamline (Advanced Photon Source, Argonne National

Laboratory, IL).

Ligand N5-Pan Np-Pan

PDB ID 4F7W 4GI7 Data Collection Beamline 19-ID Advanced Photon Source 23-IDB (APS) (APS) Wavelength (Å) 0.97931 1.03321 Resolution (Å) 48.04-2.05 40-1.95 Space Group P212121 P212121 No. of molecules in asymmetric 8 8 unit Unit Cell Parameters (Å) a = 127.8, b = 130.8, a = 127.9, b = 130.9, c = 190.2 c = 193.0 (degrees) α = β = γ = 90 α = β = γ = 90 No. of measured reflectionsa 1327648 (181294) 1668077 (214666) No. of unique reflections 187519(27124) 234904 (33760) Completeness (%) 99.7(99.3) 99.9 (99.1) Friedel Redundancy 7.1(6.7) 7.1 (6.4) /σ 13.7(3.0) 9.3 (2.1) b Rmerge (%) 14.8(89.8) 12.9(85.2)

Refinement Resolution (Å) 40.0-2.1 40-2.0 c Rwork/Rfree (%) 18.7/22.7 22.2/25.7 No. of atoms protein 19392 19896 ligand/ion 389 372 water 988 1023 Average B-factors (Å2) protein 26.3 33.4 ligand/ion 24.4 32.8 water 25.9 32.8 RMSD bond length (Å) 0.013 0.010 RMSD bond angle (degrees) 1.4 1.4 Ramachandran Analysisd Favored (%) 91.6 91.9 Additionally allowed (%) 8 7.7 Generously allowed (%) 0.2 0.4 Disallowed (%) None None

Table III. Data collection and refinement statistics for KpPanK crystals. a Numbers in parentheses are for the outer shell. b Rmerge = Σ[(I − I )]/Σ(I), where I is the observed intensity and is the average intensity. c Rwork = Σ[|Fobs| − |Fcalc|]/Σ|Fobs|, where |Fobs| and |Fcalc| are magnitudes of observed and calculated structure factors respectively. Rfree was calculated as Rwork using 5.0% of the data, which was set aside for an unbiased test of the progress of refinement. d The program PROCHECK(Laskowski 1993) was used.

Figure 17. Matthews Probability calculation of the oligomeric state of the KpPanK asymmetric unit. The probabilities for the oligomeric state of the KpPanK asymmetric unit were calculated based on the crystal’s diffracting resolution, unit cell dimensions, space group, as well as the protein’s molecular weight. The highest probable oligomeric states are located near the top of each peak.

2.2.5 Spectrophotometric assessment of substrate kinetics

KpPanK substrate kinetics were examined based on an adapted protocol of the pyruvate kinase/lactate dehydrogenase (PK/LDH) coupled assay published previously

(Awasthy, Ambady et al. 2010). Briefly, each reaction volume of 50μL contained

100mM Tris-HCl pH 7.5, 20mM KCl, 20mM MgCl2, 0.5mM phosphoenolpyruvate

(PEP), 0.25mM NADH, 12units/mL PK, 8units/mL LDH and 4mM ATP. The stock solution of ATP at 100mM concentration was prepared by dissolving in 20mM Tris-HCl pH 7.5 supplemented with 15µL/mL of 10N NaOH to achieve a pH 7.0. Included in the mixture are substrates (pantothenate, N5-Pan, Np-Pan or compound 349) that are two- fold serial diluted starting from 2mM. All components were first mixed in 96-well round bottom plates. The reaction mixtures were transferred into a Nunc 384-well clear bottom plate. In total, eight concentrations of substrates were tested; the eighth well was a negative control containing no substrate. The reactions were carried out at 30ºC and initiated by the addition of KpPanK enzyme (20μM final) to the reaction mixture. The plate was monitored for NADH absorbance at 340nm using a BioTek Synergy 4 microplate reader. The assay measures the disappearance of NADH, which is coupled to the production of ADP as a measure of kinase activity (Fig. 18). Non-linear regression analysis of the data was performed using GraphPad Prism 5 software.

Kinase SLOW Substrate + ATP P-Substrate + ADP

PK FAST ADP + PEP ATP + Pyruvate

LDH FAST Pyruvate + NADH Lactate + NAD+

Absorbs at 340nm

Figure 18. Pyruvate kinase (PK)/lactate dehydrogenase (LDH) coupled assay for characterization of kinase activity. The production of ADP (as a result of kinase activity) is coupled with the consumption of NADH, which is monitored for changes in absorbance at 340nm (Belda, Carmona et al. 1982). The first step is the rate-limiting step, whereas the latter two steps are instantaneous; the rates at which NADH disappears correlates with the rate of phosphorylation, and are used to determine apparent Michaelis-

Menten constants.

3. RESULTS

3.1 Structural Overview of KpPanK

The structures of KpPanK in complex with N5-Pan and Np-Pan were solved at

2.1Å and 1.95 Å resolution, respectively. Both structures belong to the primitive orthorhombic space group P212121 and contain eight molecules in the asymmetric unit that correspond to four homodimers. The final models for KpPanK complexed with N5-

Pan and Np-Pan contains residues 9-316. Each subunit is made up of eight α-helices and ten β-strands, and the secondary structure elements are ordered as follows: β1, α1, α2, α3,

β2, α4, β3, α5, α6, β4, β5, β6, β7, β8, α7, α8, β9, β10 (Fig. 19). The dimer interface has a surface area of 1863Å2 (using the PDBsum server at www.ebi.ac.uk) and contains mostly hydrophobic contacts; helices 1 and 3 of one subunit interact extensively with helix 3 in the second subunit.

3.1.1 Nucleotide-binding site

Both the structures of KpPanK contain the nucleotide ADP. The adenine ring of

ADP is stabilized by water-mediated hydrogen bonds and a π – π stacking interaction with the imidazole of His307 (Fig. 20C). The ribose moiety has direct and water- mediated hydrogen bonds with Asn43. Although MgCl2 was included in crystallization,

2+ the Fo–Fc map indicates the absence of divalent Mg coordinating the phosphate groups in both KpPanK structures. (A Fo–Fc map is calculated from the difference of observed and calculated structure factors Fo and Fc; the map shows positive density for where the model requires more atoms, and negative density for where the model should have fewer atoms.) This is similar to that of the EcPanK-ADP-Pan ternary complex, in which the

Mg2+ ion is absent (Ivey, Zhang et al. 2004) (PDB: 1SQ5). KpPanK is a P-loop kinase, containing a Walker A P-loop (GXXXXGKS) (located between strand 2 and helix 4) that stabilizes the ADP α and β phosphates. The non-bridging oxygens of ADP phosphates are mainly stabilized by main chain amino groups of the P-loop (Fig. 20B) and a polar contact with Arg243. Lys101, the residue found to be essential for binding of ATP and the feedback regulator CoA (Song and Jackowski 1994), has polar contacts with the

Ser96 carbonyl group and the terminal oxygen atom of the β phosphate.

S1 H3

H4 S6 S10 H6 S2 S3 S7 H2 S9 S8 S4

H7 H5 S5

Figure 19. Structure of a KpPanK subunit. The subunit is coloured based on secondary structure elements: helices (cyan), strands (magenta) and loops (pink).

The substrate N5-Pan and nucleotide ADP are coloured green.

V97 B. A98

S96 V99 G95 G100 K101

T103 S102

C. N43

R243

H307

Figure 20. Interaction of KpPanK nucleotide-binding residues with ADP. A. Fo-Fc difference map for ADP contoured at sigma level 2.5σ. B. The interaction between residues P-loop residues (purple) and the ADP. C. The interaction of non-P loop residues (yellow) and ADP.

3.1.2 N5-Pan binding site of KpPanK

The N5-Pan·KpPanK complex shows the mode of binding of N5-Pan to KpPanK.

After modeling water molecules and several rounds of refinement, the Fo – Fc map showed clear density for the pantothenate moiety up to the third carbon atom of the pentyl tail for most molecules (Fig. 21B). The subunit (molecule C) in which N5-Pan and its binding site are best defined by electron density was chosen for structural analysis. N5-Pan fits into a pocket lined by parts of helices 5, 7 and 8 and strands 4 and

5. Several loop regions also contribute to the binding site, including the P loop (between strand 2 and helix 4), the loop between helices 5 and 6, and the loop region between helices 7 and 8. The pantothenate moiety is stabilized primarily by polar contacts (Fig.

21C). The C1-hydroxyl group of N5-Pan forms a hydrogen bond with the Asp127 side chain. An unknown atom is modeled between the C1 and C3 hydroxyl groups, Arg243 and three water molecules. There is a water-mediated hydrogen bond between the C4 carbonyl and His 177. Asn 282 has a hydrogen bond with the amide nitrogen of position

5 and the C8 carbonyl oxygen, which also hydrogen bonds with Tyr 240. The pentyl tail bends away from L277 and the surface of the protein, towards a hydrophobic pocket lined with multiple aromatic residues including Tyr 180, Tyr 240, Phe 244, Phe 247, Tyr

258, Phe 259, and Tyr 262 (Fig. 21D). The pentyl tail for all molecules show an elevated

B temperature factor (approaching 40Å2), which suggests slight disorder due to lack of contact and/or a degree of freedom to move around. Based on these data, a pantothenamide containing an aromatic substitution was designed and synthesized.

C3 N5 C7 N9 A. C1 B. C2 C4 C6 C8

H177 C. R243 Y240

D127

Y180

N282

D. F247

F244 F259 Y240

L277

Y262

Y180 Y258

Figure 21. Residues of the KpPanK substrate-binding site. A. Chemical structure of N5-

Pan. Atom positions along the pantothenate portion are labeled in red. B). Electron density map of N5-Pan calculated using the structure factors Fo-Fc, contoured at 2.5σ. C). Residues involved in polar interactions with the pantothenate moiety of N5-Pan. The unknown atom (UNX) is modeled as a grey sphere. D).

Residues of the hydrophobic pocket that surround the pentyl tail.

3.1.3 Np-Pan binding site of KpPanK

The discovery of multiple aromatic residues in the hydrophobic pocket occupied by the pentyl group of N5-Pan led to synthesis of a pantothenamide containing an aromatic group, which would form non-covalent, attractive π-π interactions. A pyridine ring was chosen in favour of a benzene ring to offset a potential solubility issue (ie. a pyridine ring contains a nitrogen atom that is conducive to hydrogen bonding).

After successful co-crystallization with Np-Pan followed by data collection, structure determination and several rounds of refinement, the Fo-Fc map showed electron density corresponding to the pantothenate moiety that extends past the C8 carboxyl position, indicating appreciable occupancy of the pocket by Np-Pan. However, all eight molecules in the asymmetric unit show incomplete electron density corresponding to the pyridine ring, indicating that atoms of the pyridine ring are disordered possibly due to inadequate stabilizing contacts (Fig. 22B, 22C). The best-defined density for the ring could be found in molecules A and C, which allowed for modeling of Np-Pan including the pyridine ring. In molecule A, the pyridine extends in the direction similar to that of the N5-Pan pentyl tail and forms a “sandwich” π-π stacking interaction with Tyr 180 and a Van der Waal’s contact with Leu 277 (Fig. 22B). In molecule C, the ring instead bends to form a “T-shaped” π-π herringbone interaction with Phe 259 (Fig. 22C). There is also a water-mediated hydrogen bond between the pyridine nitrogen and the Arg243 guanidinium, Tyr240 carbonyl oxygen and Phe 244 amide nitrogen. The substituent pocket residues of molecule A overlaps very well with those of the N5-bound pocket. In molecule C, most residues line up with those surrounding N5-Pan pentyl moiety except

71 for Y258, which is likely sterically shifted away from the pyridine ring. The shape of the hydrophobic pocket therefore offers an explanation for the ring’s disorder; the ring likely swings back and forth in the Y-shaped cleft and lacks a fixed preference for a single conformation. The observed alternative conformations of Np-Pan suggest that a branched molecule containing two rings could have an improved binding affinity to

KpPanK.

“sandwich” π-π Y180

C. R243 F259

Y240 F244

“T-shaped” π-π

Figure 22. Interactions of the pyridine of Np-Pan with KpPanK residues. A).

Chemical structure of Np-Pan. B). Conformation and interactions of the Np-Pan pyridine in molecule A. C). Conformation and interactions of the Np-Pan pyridine in molecule C.

Difference Fo-Fc maps for Np-Pan are contoured at 2.5σ, and the electron density in green is displayed. KpPanK residues are grey. Np-Pan is coloured orange. N5-Pan is colored magenta. The π-π interactions are indicated in red. The block arrows indicate the difference in conformation for the pyridine ring.

3.2 KpPanK substrate kinetics

As negative controls, reactions were performed in the absence of either substrate or enzyme. A low level of intrinsic ATPase activity was observed in the absence of substrate whereas maximal NADH absorbance was maintained in the exclusion of

KpPanK enzyme. All reaction rates were corrected for intrinsic ATPase activity by subtracting the mean rate at zero substrate from the maximum velocity rates (Vmax) measured. The fastest rates were observed within the first minute after initiating the reactions by adding KpPanK enzyme; the 17 second mark was chosen to determine the initial reaction velocity at each substrate concentration since this timepoint clearly fell within the linear phase of the reaction progress curve.

The Michaelis-Menten plot confirms that the purified enzyme is active, and therefore properly folded during recombinant protein overexpression. In general, all tested substrates showed similar kinetics. Based on the curves, pantothenamides potentially yield higher rates of enzymatic activity compared with the native substrate pantothenate. This is also in agreement with the higher average kcat values (defined as the number of substrate molecules that can be processed by the enzyme per unit time) for pantothenamides. However, apparent Km values were determined to be higher for pantothenamides.

Compound 349, which contains branched phenyl groups (Table II) was also tested to determine whether KpPanK could use a branched molecule as a substrate. Since it was verified as a substrate, co-crystallization trials were attempted with this compound. The best diffraction resolution was approximately 4Å and crystal optimization is in progress.

Figure 23. Michaelis-Menten plot of reaction velocity vs. substrate concentration.

The curves represent the mean of triplicate determination. Error bars represent standard

-1 deviation. Vmax values were originally measured in mOD · min , and were converted

(using the extinction coefficient of 1.7nmol NADH per 1OD) to nmol NADH · min-1.

-1 Substrate Apparent Km (μM) kcat (min )

Pantothenate 193.3 ± 55.7 40.1 ± 9.1

N5-Pan 583.1 ± 126.8 80.1 ± 16.4

Np-Pan 447.1 ± 283.3 77.9 ± 26.4

Compound 349 633.1 ± 138.4 65.4 ± 9.9

Table IV. Characterization of KpPanK substrate kinetics. Standard deviations for apparent Km (Michaelis-Menten constant) values are calculated by non-linear regression analysis of individual trials. kcat is calculated by fitting substrate concentrations to reaction velocity using the formula V = Their/(Km + [S]) where V is reaction velocity, [E] is enzyme concentration and [S] is substrate concentration.

4. DISCUSSION

4.1 Comparison with EcPanK

Comparison of the KpPanK-N5-Pan complex to the EcPanK-Pan complex

(PDB:1SQ5) (Ivey, Zhang et al. 2004) reveal an overall conserved fold, with a root mean square deviation (RMSD) of 0.75Å2 for 291 overlapped Cα atoms. The only secondary structure element that deviates significantly in position is helix 1, which is located in the periphery away from the enzyme’s core.

Pantothenate and N5-Pan have similar binding modes in the two enzymes but differ with respect to several polar interactions (Fig. 24A). In EcPanK, His177 thought to contribute to the preference for the D-isomer of pantothenate (Ivey, Zhang et al. 2004), directly hydrogen bonds with the substrate’s C3 hydroxyl group through its epsilon nitrogen. In KpPanK however, the imidazole exists as an alternative rotamer that has delta and epsilon nitrogens forming hydrogen bonds with water molecules and Asp 127 instead; one of these waters mediates contact between His177 and the C4 carbonyl. If

His177 of KpPanK has the same rotamer as in EcPanK, however, the nitrogen would be

3.8Å away from the C3 hydroxyl, which is outside the range of forming a hydrogen bond.

Furthermore, the amide nitrogen of N5-Pan in KpPanK forms a hydrogen bond with the

Y180 hydroxyl, while the corresponding carboxyl oxygen of pantothenate in EcPanK is

4.2Å away, thus out of range of forming a hydrogen bond.

Comparison of the substrate-binding sites of KpPanK (bound with N5-Pan) and

EcPanK (bound with pantothenate) also reveals that presence of the pentyl tail of N5-Pan induces structural changes of the hydrophobic pocket made up of α7-α8 loop residues

254-266. The residues Tyr258 and Asn261 show the most significant shifts in position compared with those in EcPanK (Fig. 24B) Tyr258 is rotated approximately 50º with its hydroxyl experiencing movement of 5Å, and Asn261 is shifted 2.6Å away. These movements that open up space for the pentyl tail are an indication of flexibility in the hydrophobic pocket. In addition, most residues of the hydrophobic pocket show elevated

(40-50Å2) B temperature factors when compared to residues in other parts of the enzyme

(15-25Å2), a further indication of flexibility and disorder. Consistent with this finding is that the corresponding loop in EcPanK was proposed to be a mobile “lid” that closes over the active site following substrate binding (Ivey, Zhang et al. 2004). The flexibility of the loop, combined with the opening up of space (ie. movement of residues) induced by N- substituted moieties, explain why pantothenamides are used as substrates. Further, the specific residues of the flexible loop may be exploited in the design of new N-substituted compounds with enhanced binding affinities.

A. Y180

H177

Y258 B. Y180 N261

F262

F244 F259 F244 L277 Y240

Figure 24. Structural differences between KpPanK and EcPanK substrate binding sites. KpPanK residues (pink) and EcPanK residues (cyan) are overlapped. The substrates N5-Pan (magenta) and pantothenate (dark green) are also superimposed. A).

Differences in polar interactions of the pantothenate moities moieties. Black dotted lines represent hydrogen bonds. Brown dotted lines represent distances between two atoms outside the length of a hydrogen bond. B). Differences in the residues surround the pentyl tail of N5-Pan. Grey arrows indicate significant position shift of residues induced by the pentyl tail.

4.2 Comparison with MtPanK

The structure of Mycobacterium tuberculosis PanK in complex with N- nonylpantothenamide (N9-Pan) is available (PDB: 3AVQ) (Chetnani, Kumar et al. 2011).

As KpPanK shares a 54% sequence identity with MtPanK, they are similar to each other in the overall protein fold (the RMSD of 280 overlapped Cα atoms is 1.65Å). All residues involved in binding to the pantothenate moiety are conserved. The α7-α8 loop residues that make up the hydrophobic pocket (in which N-substituents are located) are mostly conserved with a few exceptions (residues in parentheses indicate the residues in

KpPanK): Met242(Phe247), His253(Tyr258), His256 (Asn261) and Ile272 (Leu277).

Despite sharing highly similar amino acid sequences in the substrate-binding site, the conformations of N5-Pan and N9-Pan are markedly different. For interactions involving the N9-Pan pantothenate moiety, the C1 hydroxyl is hydrogen bonded to Asp 129 (Asp

127 in KpPanK). However, the pantothenate moiety of N9-Pan is rotated such that the

C3 hydroxyl is not interacting with any residue (in contrast with an unknown atom that contacts the N5-Pan C1 and C3 hydroxyls in KpPanK) (Fig. 25A-C). The C4 carbonyl interacts with Lys 147 and Asn 277 (instead of a water-mediated hydrogen bond with a histidine residue in KpPanK). The C8 carbonyl interacts with Asn277 (as does Asn282 in KpPanK). The amide nitrogen at the ninth position also does not interact with any residue. Polar interactions between EcPanK, KpPanK and MtPanK and the corresponding substrates from their co-crystal structures are listed in Table V. Another difference to note is the degree of order of N5-Pan and N9-Pan in their respective enzymes; the B temperature factors for the pantothenate moiety atoms of N5-Pan are

80 between 20 and 30Å2, whereas those of N9-Pan are above 60Å2, indicating a higher degree of disorder.

Overall, N9-Pan exhibits a sigmoidal conformation, likely the consequence of the long molecule having to be bent in order to fit into a small pocket. The nonyl tail conformation mirrors that of Np-Pan in KpPanK molecule C in that it approaches R238

(R243 in KpPanK) instead of extending towards to protein surface, as the N5-Pan pentyl tail does (Fig. 25A). With respect to the hydrophobic pocket residues, the residues

His253 and Phe254 of MtPanK (corresponding to Tyr258 and Phe259 in KpPanK) show the most significant changes in postions (Fig. 25D).

KpPanK EcPanK MtPanK

Substrate N5-Pan Pantothenate N9-Pan

C1 hydroxyl Asp 127 Asp 127 Asp 129 C3 hydroxyl Unknown atom His 177 none mediates contact with Arg 243 C4 carbonyl Water-mediated with Water-mediated with Lys 147, Asn 277 His 177 Tyr 175 N5 nitrogen Asn 282 Asn 282 Tyr 182 C8 carbonyl Asn 282, Tyr 240 Asn 282, Tyr 240 Tyr 235, Asn 277 N9 nitrogen Tyr 180 None (carboxyl none oxygen at 9th position)

Table V. Summary of polar interactions involving the pantothenate moiety of substrates in KpPanK, EcPanK and MtPanK structures.

A. B. Y240 N282

D127

Y180

C. Y235 Figure 25. Comparison of the substrate-binding sites of N277 KpPanK and MtPanK. D129 A. The pantothenamides N5-Pan (magenta), Np-Pan (orange) and N9-Pan are superimposed. B. Polar interactions between KpPanK residues (pink) and N5- Pan. K147 C. Polar interactions between Y182 MtPanK residues (yellow) and N9-Pan. D. The most significant differences (amino acid type and conformation) in the α7-α8 loop H256(N261 D. between KpPanK and MtPanK H253(Y258) ) are shown. Residues of KpPanK are in parentheses. Hydrogen bonds are indicated by black dotted lines. F254(F259)

M242(F247)

4.3 Modeling of a branched aromatic molecule

Alternate conformations of the Np-Pan pyridine moiety suggest a branched compound may bind with higher affinity as a result of introducing multiple π- π interactions. We decided to model a branched analogue of Np-Pan using the atomic coordinates of two observed conformations of the pyridyl group (Fig. 26). Measuring from the two distal para positions, the two rings span a length of 7.3Å. We predict that the affinity can be further improved by making slight modifications to the rings. The strength of π-π stacking interactions is enhanced when one aromatic ring contains an electron donating group, and the other contains an electron-withdrawing group (Wheeler

2012). This would be relevant for the pyridine ring that forms a “sandwich” π-π interaction with Tyr 180 (containing an electron-withdrawing hydroxyl group). A small electron-donating alkyl group, such as a methyl would be ideal since its small size would minimize steric clashes. Placing a methyl at the ortho position opposite the position of the pyridine nitrogen may be favorable for hydrophobic interactions with the Leu 277 sidechain; a substitution on the other ortho position however, may cause steric clash with

Phe 259. Introducing a methyl in the para position may be undesirable due to its close proximity with the hydroxyls of Tyr 258 and Tyr 262.

With respect to the second pyridine ring, there are several nitrogen atoms of protein residues nearby that can be exploited for improving the binding affinity. A hydroxyl substitution at the meta position of the pyridine ring facing His177 can introduce a new hydrogen bond between the substituted hydroxyl group and the His177 side chain. Additionally, a hydroxyl group in the para position of the pyridine ring can

84 introduce dual interactions with nitrogen atoms of the Arg 243 guanidinium group (Fig.

26).

The structure of human PanK isoform 3 (hPanK3) in complex with N- heptylpantothenamide (N7-Pan) (PDB: 3SMS) is available. Unlike type I PanKs, both the subunits of the hPanK3 dimer are involved in binding the pantothenamide; the heptyl tail extends across the dimer interface and interacts with residues of the second subunit.

Acetyl-CoA is also known to interact with both subunits of a dimer such that the pantetheine moiety extends across the dimer interface (Hong, Senisterra et al. 2007). We have also performed modeling of the branched derivative of Np-Pan into the substrate- binding site of hPanK3 (Fig. 27). If the heptyl tail of N7-Pan was replaced by a bivalent aromatic group, one ring would likely clash with Trp341. By extension, a larger cyclic substitutent can exaggerate this steric clash further. The second ring of the branched compound would likely fit in a pocket lined with multiple polar residues that include Thr

211, Ser 212 and Asn 300 from the first subunit, and Ser 271 Thr 296, Asn 299 and Asn

300 from the second subunit. The large number of water molecules located in this pocket is indicative of its hydrophilicity, which may not be favourable for a relatively non-polar aromatic group. The modeling of a branched compound in the substrate-binding site of hPanK3 therefore provides insights into the potential binding mode of a branched aromatic compound in the substrate-binding site of human PanKs. Steric clash, as well as the hydrophilic nature of amino acid residues that surround N-substitutions in the human enzyme may be antagonistic factors for binding of a branched aromatic substrate analogue.

H177 Y180

L277 R243

hydroxyl methyl

Figure 26. Modeling of a branched version of Np-Pan in the KpPanK substrate- binding site. The green marks indicate locations of aromatic substitutions that could enhance the affinity with binding site residues.

T296(B) N300(B) N300(A) N299(B)

S271(B)

T211(A)

S212(A)

Highly W341(B) polar pocket Potential clash

Figure 27. Modeling of a branched derivative of Np-Pan in human PanK3. PanK3 dimer interface residues (blue and cyan) are shown. The pantothenate moieties of the branched Np-Pan (orange) and N7-Pan (dark blue) are superimposed.

4.4 KpPanK Substrate Kinetics

The results of the kinetic assays indicate the apparent Km values pantothenamides are higher when compared to pantothenate. Moreover, the data also suggest that “bulkier” compounds are worse as substrates, which would indicate a disagreement with our structural data. It is important to note that these data are preliminary; the high errors obtained, such as the Km of Np-Pan, necessitate further investigations to yield more conclusive and definitive data. Although the data (ie. high Km values) can also suggest that bulkier compounds may possess less antimicrobial activity, a previous study found that alkyl- and benzyl-containing pantothenamides are similarly potent in E. coli (whose

EcPanK is highly similar to KpPanK) (Clifton, Bryant et al. 1970).

4.5 Summary of Findings

We have solved the structure of KpPanK in complex with N5-Pan using the

EcPanK structure as a search model. Structural analysis of the substrate-binding site has revealed that the N-substituent of N5-Pan, the pentyl tail, is located within a hydrophobic pocket lined with multiple aromatic residues. Thus, we synthesized a pantothenamide containing an aromatic ring to introduce favourable π-π interactions with the binding pocket residues. We have crystallized and solved KpPanK in complex with the new compound Np-Pan, which contains an aromatic pyridine substitution. The pyridine adopts at least two different conformations, suggesting that a branched molecule containing two rings would bind more efficiently. Kinetic assays (which included compounds used in crystallization trials, and a two-ring analogue) provided preliminary

88 data on KpPanK substrate kinetics, and confirmed that a branched compound containing two rings can be used as a substrate. Finally we modeled a hypothetical, branched derivative of Np-Pan to KpPanK and hPanK3 to give insight into the improvement of specificity and binding affinity. Taken together, these results provide a blueprint for the design of pantothenate analogues that bind with greater affinity to KpPanK and less specificity for human PanKs.

4.6 Recommendations for Future Studies

The list of compounds used in the crystallization trials of these studies is by no means exhaustive. Virtual screening using chemical libraries is essential to finding undiscovered compounds that can bind with higher affinity than the compounds already used. Various readily accessible chemical libraries are at our disposal. The two major non-commercial chemical libraries are from ZINC and NCI. The ZINC (“ZINC Is Not

Commercial”) database contains over 20 million compounds, all of which are commercially available (Shoichet 2004). The National Cancer Institute has a library of over 140,000 compounds, some of which they are willing to provide for experimental testing. Another widely used database is the Available Chemicals Directory (ACD) from

Molecular Design Limited (MDL) that contains over 400,000 commercially available, research-grade compounds. The search for novel compounds can be based on the chemical structures of the compounds we’ve used to co-crystallize KpPanK. The conformations of the pantothenamides in the KpPanK crystal structures can serve as structural restraints for molecular docking. Molecular docking programs, such as DOCK,

GLIDE, ICM and PhDOCK can be used to predict the orientation of compounds in

KpPanK and estimate the thermodynamics of interactions in the enzyme (Cross,

Thompson et al. 2009). Candidate compounds would be those that maintain the pantothenate moiety, while showing the lowest calculated energies of binding obtained by docking. The top candidate compounds would then need to undergo crystallization trials to verify mode of binding, and analysis of the binding sites will provide structural basis for further improvements in binding. Besides virtual screening, another practical next step would be to design branched aromatic compounds based on the structural data presented in these studies.

Determination of binding affinity to KpPanK is important for assessing the progress of compound design. A common method for measuring ligand binding affinity is isothermal titration calorimetry (ITC) (Duff, Grubbs et al. 2011). In ITC, the protein is placed in a cell and the ligand in a syringe. The cell continually equilibrates against a standard cell to maintain a fixed thermodynamic state. Enthalpy changes would result in the case of an interaction; as a result of equilibration, the amount of heat required to revert to a standard thermodynamic state can be determined. This information can then be used to calculate the dissociation constant (Kd), which is inversely proportional to binding affinity.

The substrate kinetics of future compounds need to be determined. Preliminary tests can be run using the PK/LDH coupled assay to verify the substrate status of the compounds. However, this assay would not be suitable for determining the degree of competitive inhibition with pantothenate, since the assay can only indicate overall kinase

90 activity and not discriminate between the substrates (pantothenate or pantothenamide) that are phosphorylated. Competitive inhibition assays would have to involve 14C- labelled pantothenate, based on a previously published protocol (Ivey, Zhang et al. 2004).

14 Briefly, a mixture of KpPanK enzyme is incubated with ATP, MgCl2, C-pantothenate and also various concentrations of the pantothenamide compounds. The reaction is terminated with the addition of acetic acid, and transferred onto Whatman anion exchange disks to capture phosphorylated pantothenate. Quantitation of the level of phosphorylated 14C-pantothenate by scintillation would indicate the extent to which the substrate analogues competitively inhibit phosphorylation of the regular substrate.

An important milestone for these studies is confirming antimicrobial activity in K. pneumoniae. An initial assessment of antibiotic potential can be done using the agar diffusion method (also known as disk diffusion) (Guess, Rosenbluth et al. 1965), whereby paper disks are soaked with compounds, and placed onto agar plates containing

K. pneumoniae cells; an area of growth inhibition surrounding the disks would indicate a positive result. The broth dilution method would also be required for accurate determination of minimal inhibitory concentrations (MIC) (Stalons and Thornsberry

1975). Briefly, the assay involves measuring the optical density of bacterial cells (an indicator of cell viability) against serially diluted concentrations of antibiotics.

Assessment of cytotoxicity should not be limited to K. pneumoniae. It would be desirable to achieve more narrow-spectrum antimicrobial agents that primarily target K. pneumoniae while having minimal affects in gut floral bacteria. The two assays

91 mentioned should also be used to ascertain the effects these compounds may have on intestinal bacteria.

Once antimicrobial activity is verified, cytotoxicity assays using human cell lines are necessary to determine potential side effects in humans. A common model used for the testing toxicity of xenobiotics is the hepatocellular carcinoma HepG2 cell line. Since

K. pneumoniae infections of the lungs are the most clinically significant, assessing toxicity in a human pulmonary cell line, such as the adenocarcinomic alveolar basal epithelial A549 cell line, would also be important.

REFERENCES

Algeus, S. (1951). "Effect of beta-alanine and pantothenic acid on growth of Scenedesmus obliquus." Physiologia Plantarum 4(3): 495-497. Ardanuy, C., J. Linares, et al. (1998). "Outer membrane profiles of clonally related Klebsiella pneumoniae isolates from clinical samples and activities of cephalosporins and carbapenems." Antimicrob Agents Chemother 42(7): 1636-40. Awasthy, D., A. Ambady, et al. (2010). "Essentiality and functional analysis of type I and type III pantothenate kinases of Mycobacterium tuberculosis." Microbiology 156(Pt 9): 2691-701. Baddiley, J., E. M. Thain, et al. (1953). "Structure of coenzyme A." Nature 171(4341): 76. Bassetti, M., F. Ginocchio, et al. (2011). "Will new antimicrobials overcome resistance among Gram-negatives?" Expert Rev Anti Infect Ther 9(10): 909-22. Begley, T. P., C. Kinsland, et al. (2001). "The biosynthesis of coenzyme A in bacteria." Vitam Horm 61: 157-71. Belda, F. F., F. G. Carmona, et al. (1982). "Enzymatic assays: optimization of systems by using pyruvate kinase and lactate dehydrogenase as auxiliary enzymes." Rev Esp Fisiol 38(3): 327-32. Bradford, P. A. (2001). "Extended-spectrum beta-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat." Clin Microbiol Rev 14(4): 933-51, table of contents. Bradford, P. A., C. Urban, et al. (1997). "Imipenem resistance in Klebsiella pneumoniae is associated with the combination of ACT-1, a plasmid-mediated AmpC beta- lactamase, and the foss of an outer membrane protein." Antimicrob Agents Chemother 41(3): 563-9. Bragg, W. H., Bragg, W.L. (1915). X Rays and Crystal Structure, Bell and Sons. Brand, L. A. and E. Strauss (2005). "Characterization of a new pantothenate kinase isoform from Helicobacter pylori." J Biol Chem 280(21): 20185-8. Calder, R. B., R. S. Williams, et al. (1999). "Cloning and characterization of a eukaryotic pantothenate kinase gene (panK) from Aspergillus nidulans." J Biol Chem 274(4): 2014-20. Chen, V. B., W. B. Arendall, 3rd, et al. (2011). "MolProbity: all-atom structure validation for macromolecular crystallography." Acta Crystallogr D Biol Crystallogr 66(Pt 1): 12-21. Chetnani, B., S. Das, et al. (2009). "Mycobacterium tuberculosis pantothenate kinase: possible changes in location of ligands during enzyme action." Acta Crystallogr D Biol Crystallogr 65(Pt 4): 312-25. Chetnani, B., P. Kumar, et al. (2011). "Location and conformation of pantothenate and its derivatives in Mycobacterium tuberculosis pantothenate kinase: insights into enzyme action." Acta Crystallogr D Biol Crystallogr 67(Pt 9): 774-83. Chetnani, B., P. Kumar, et al. (2010). "M. tuberculosis pantothenate kinase: dual substrate specificity and unusual changes in ligand locations." J Mol Biol 400(2): 171-85.

Choudhry, A. E., T. L. Mandichak, et al. (2003). "Inhibitors of pantothenate kinase: novel antibiotics for staphylococcal infections." Antimicrob Agents Chemother 47(6): 2051-5. Clifton, G., S. R. Bryant, et al. (1970). "N'-(substituted) pantothenamides, antimetabolites of pantothenic acid." Arch Biochem Biophys 137(2): 523-8. Collaborative Computational Project, N. (1994). "The CCP4 suite: programs for protein crystallography." Acta Crystallogr D Biol Crystallogr 50(Pt 5): 760-3. Cross, J. B., D. C. Thompson, et al. (2009). "Comparison of several molecular docking programs: pose prediction and virtual screening accuracy." J Chem Inf Model 49(6): 1455-74. Daikos, G. L. and A. Markogiannakis (2011). "Carbapenemase-producing Klebsiella pneumoniae: (when) might we still consider treating with carbapenems?" Clin Microbiol Infect 17(8): 1135-41. Delcour, A. H. (2009). "Outer membrane permeability and antibiotic resistance." Biochim Biophys Acta 1794(5): 808-16. DeShazer, D., G. E. Wood, et al. (1995). "Identification of a Bordetella pertussis regulatory factor required for transcription of the pertussis toxin operon in Escherichia coli." J Bacteriol 177(13): 3801-7. Doerr, A. (2006). "Together at last: crystallography and NMR." Nat Method 3(6): 106. Dong, A., X. Xu, et al. (2007). "In situ proteolysis for protein crystallization and structure determination." Nat Methods 4(12): 1019-21. Duff, M. R., Jr., J. Grubbs, et al. (2011). "Isothermal titration calorimetry for measuring macromolecule-ligand affinity." J Vis Exp(55). Emsley, P. and K. Cowtan (2004). "Coot: model-building tools for molecular graphics." Acta Crystallogr D Biol Crystallogr 60(Pt 12 Pt 1): 2126-32. Emsley, P., B. Lohkamp, et al. (2010). "Features and development of Coot." Acta Crystallogr D Biol Crystallogr 66(Pt 4): 486-501. Evans, P. (2006). "Scaling and assessment of data quality." Acta Crystallogr D Biol Crystallogr 62(Pt 1): 72-82. Evans, P. and A. McCoy (2008). "An introduction to molecular replacement." Acta Crystallogr D Biol Crystallogr 64(Pt 1): 1-10. Evans, W. C., W. Handley, et al. (1939). "The Nutrition of C. diphtheriæ. Pantothenic Acid as an Essential Growth Factor for Certain Strains of C. diphtheriæ gravis: the Synthesis of some Physiologically Active Compounds by C. diphtheriæ Cultures in Synthetic Media." Br J Exp Pathol. 20(5): 396-408. Feng, W., L. Pan, et al. (2010). "Combination of NMR spectroscopy and X-ray crystallography offers unique advantages for elucidation of the structural basis of protein complex assembly." Sci China Life Sci 54(2): 101-11. Fenstermacher, D. K. and R. C. Rose (1986). "Absorption of pantothenic acid in rat and chick intestine." Am J Physiol 250(2 Pt 1): G155-60. Flugel, R. S., Y. Hwangbo, et al. (2000). "Holo-(acyl carrier protein) synthase and phosphopantetheinyl transfer in Escherichia coli." J Biol Chem 275(2): 959-68.

Frodyma, M. E. and D. Downs (1998). "ApbA, the ketopantoate reductase enzyme of Salmonella typhimurium is required for the synthesis of thiamine via the alternative pyrimidine biosynthetic pathway." J Biol Chem 273(10): 5572-6. Geerlof, A., A. Lewendon, et al. (1999). "Purification and characterization of phosphopantetheine adenylyltransferase from Escherichia coli." J Biol Chem 274(38): 27105-11. Genschel, U. (2004). "Coenzyme A biosynthesis: reconstruction of the pathway in archaea and an evolutionary scenario based on comparative genomics." Mol Biol Evol 21(7): 1242-51. Gerdes, S. Y., M. D. Scholle, et al. (2002). "From genetic footprinting to antimicrobial drug targets: examples in cofactor biosynthetic pathways." J Bacteriol 184(16): 4555-72. Gordiyenko, Y., S. Deroo, et al. (2008). "Acetylation of L12 increases interactions in the Escherichia coli ribosomal stalk complex." J Mol Biol 380(2): 404-14. Gronwald, W. and H. R. Kalbitzer (2010). "Automated protein NMR structure determination in solution." Methods Mol Biol 673: 95-127. Guess, W. L., S. A. Rosenbluth, et al. (1965). "Agar diffusion method for toxicity screening of plastics on cultured cell monolayers." J Pharm Sci 54(10): 1545-7. Heath, R. J. and C. O. Rock (2002). "The Claisen condensation in biology." Nat Prod Rep 19(5): 581-96. Hegsted, D. M. (1948). "Activity of pantothenol as pantothenic acid in promoting chick growth." Proc Soc Exp Biol Med 69(3): 571. Hirsch, E. B. and V. H. Tam (2010). "Detection and treatment options for Klebsiella pneumoniae carbapenemases (KPCs): an emerging cause of multidrug-resistant infection." J Antimicrob Chemother 65(6): 1119-25. Hoagland, M. B. and G. D. Novelli (1954). "Biosynthesis of coenzyme A from phosphopantetheine and of pantetheine from pantothenate." J Biol Chem 207(2): 767-73. Hong, B. S., G. Senisterra, et al. (2007). "Crystal structures of human pantothenate kinases. Insights into allosteric regulation and mutations linked to a neurodegeneration disorder." J Biol Chem 282(38): 27984-93. Hong, B. S., M. K. Yun, et al. (2006). "Prokaryotic type II and type III pantothenate kinases: The same monomer fold creates dimers with distinct catalytic properties." Structure 14(8): 1251-61. Hurley, J. H. (1996). "The sugar kinase/heat shock protein 70/actin superfamily: implications of conserved structure for mechanism." Annu Rev Biophys Biomol Struct 25: 137-62. Hwang, C. S., A. Shemorry, et al. (2010). "N-terminal acetylation of cellular proteins creates specific degradation signals." Science 327(5968): 973-7. Ivey, R. A., Y. M. Zhang, et al. (2004). "The structure of the pantothenate kinase.ADP.pantothenate ternary complex reveals the relationship between the binding sites for substrate, allosteric regulator, and antimetabolites." J Biol Chem 279(34): 35622-9.

Jackowski, S. and J. H. Alix (1990). "Cloning, sequence, and expression of the pantothenate permease (panF) gene of Escherichia coli." J Bacteriol 172(7): 3842- 8. Jackowski, S. and C. O. Rock (1981). "Regulation of coenzyme A biosynthesis." J Bacteriol 148(3): 926-32. Jackowski, S. and C. O. Rock (1986). "Consequences of reduced intracellular coenzyme A content in Escherichia coli." J Bacteriol 166(3): 866-71. Jones, J. D. and C. D. O'Connor (2011). "Protein acetylation in prokaryotes." Proteomics 11(15): 3012-22. Kabsch, W. (2010). "Xds." Acta Crystallogr D Biol Crystallogr 66(Pt 2): 125-32. Kantardjieff, K. A. and B. Rupp (2003). "Matthews coefficient probabilities: Improved estimates for unit cell contents of proteins, DNA, and protein-nucleic acid complex crystals." Protein Sci 12(9): 1865-71. Kupke, T. (2002). "Molecular characterization of the 4'-phosphopantothenoylcysteine synthetase domain of bacterial dfp flavoproteins." J Biol Chem 277(39): 36137- 45. Kupke, T., M. Uebele, et al. (2000). "Molecular characterization of lantibiotic- synthesizing enzyme EpiD reveals a function for bacterial Dfp proteins in coenzyme A biosynthesis." J Biol Chem 275(41): 31838-46. Laskowski, R. A., Macarthur, M.W., Moss, D.S., Thornton, J.M. (1993). "PROCHECK: a program to check the stereochemical quality of protein structures." Journal of Applied Crystallography 26: 283-291. Lehninger, A., Cox, M., Nelson, D.L. (2004). Principles of Biochemistry, W. H. Freeman. Leonardi, R., S. Chohnan, et al. (2005). "A pantothenate kinase from Staphylococcus aureus refractory to feedback regulation by coenzyme A." J Biol Chem 280(5): 3314-22. Leoni, V., L. Strittmatter, et al. (2012). "Metabolic consequences of mitochondrial coenzyme A deficiency in patients with PANK2 mutations." Mol Genet Metab 105(3): 463-71. Lipmann, F. (1953). "On chemistry and function of coenzyme A." Bacteriol Rev 17(1): 1-16. Lipmann, F., N. O. Kaplan, et al. (1947). "Chemistry and distribution of the coenzyme for acetylation (coenzyme A)." Fed Proc 6(1 Pt 2): 272. Manoj, N., E. Strauss, et al. (2003). "Structure of human phosphopantothenoylcysteine synthetase at 2.3 A resolution." Structure 11(8): 927-36. Matthews, B. W. (1968). "Solvent content of protein crystals." J Mol Biol 33(2): 491-7. McIlwain, H. (1942). "Bacterial Inhibition by Metabolite Analogues. 3. Pantoyltaurine. The Antibacterial Index of Inhibitors." British Journal of Experimental Pathology 23(2): 95-102. McIlwain, H. and F. Hawking (1943). "Chemotherapy by blocking bacterial nutrients: antibacterial activity of pantoyltaurine." The Lancet 241(6241): 449-451. Merkel, W. K. and B. P. Nichols (1996). "Characterization and sequence of the Escherichia coli panBCD gene cluster." FEMS Microbiol Lett 143(2-3): 247-52.

Mishra, P., P. K. Park, et al. (2001). "Identification of yacE (coaE) as the structural gene for dephosphocoenzyme A kinase in Escherichia coli K-12." J Bacteriol 183(9): 2774-8. Mishra, P. K. and D. G. Drueckhammer (2000). "Coenzyme A Analogues and Derivatives: Synthesis and Applications as Mechanistic Probes of Coenzyme A Ester-Utilizing Enzymes." Chem Rev 100(9): 3283-3310. Mueller, J. H. and S. Cohen (1937). "Beta Alanine as a Growth Accessory for the Diphtheria Bacillus." Journal of Bacteriology 34(4): 381-386. Murshudov, G. N., P. Skubak, et al. (2011). "REFMAC5 for the refinement of macromolecular crystal structures." Acta Crystallogr D Biol Crystallogr 67(Pt 4): 355-67. Neu, H. C. (1989). "Overview of mechanisms of bacterial resistance." Diagn Microbiol Infect Dis 12(4 Suppl): 109S-116S. Nicely, N. I., D. Parsonage, et al. (2007). "Structure of the type III pantothenate kinase from Bacillus anthracis at 2.0 A resolution: implications for coenzyme A- dependent redox biology." Biochemistry 46(11): 3234-45. Paterson, D. L. and R. A. Bonomo (2005). "Extended-spectrum beta-lactamases: a clinical update." Clin Microbiol Rev 18(4): 657-86. Paterson, D. L., K. M. Hujer, et al. (2003). "Extended-spectrum beta-lactamases in Klebsiella pneumoniae bloodstream isolates from seven countries: dominance and widespread prevalence of SHV- and CTX-M-type beta-lactamases." Antimicrob Agents Chemother 47(11): 3554-60. Philippon, A., R. Labia, et al. (1989). "Extended-spectrum beta-lactamases." Antimicrob Agents Chemother 33(8): 1131-6. Prasad, P. D. and V. Ganapathy (2000). "Structure and function of mammalian sodium- dependent multivitamin transporter." Curr Opin Clin Nutr Metab Care 3(4): 263- 6. Prasad, P. D., H. Wang, et al. (1999). "Molecular and functional characterization of the intestinal Na+-dependent multivitamin transporter." Arch Biochem Biophys 366(1): 95-106. Prasad, P. D., H. Wang, et al. (1998). "Cloning and functional expression of a cDNA encoding a mammalian sodium-dependent vitamin transporter mediating the uptake of pantothenate, biotin, and lipoate." J Biol Chem 273(13): 7501-6. Raman, S. B. and B. Rathinasabapathi (2004). "Pantothenate synthesis in plants." Plant Science 167(5): 961-968. Read, R. J. (2001). "Pushing the boundaries of molecular replacement with maximum likelihood." Acta Crystallogr D Biol Crystallogr 57(Pt 10): 1373-82. Reizer, J., A. Reizer, et al. (1990). "The Na+/pantothenate symporter (PanF) of Escherichia coli is homologous to the Na+/proline symporter (PutP) of E. coli and the Na+/glucose symporters of mammals." Res Microbiol 141(9): 1069-72. Rhodes, G. (2006). Crystallography made crystal clear. Oxford, Academic Press. Rice, L. B. (2012). "Mechanisms of resistance and clinical relevance of resistance to beta-lactams, glycopeptides, and fluoroquinolones." Mayo Clin Proc 87(2): 198- 208.

Rock, C. O., R. B. Calder, et al. (2000). "Pantothenate kinase regulation of the intracellular concentration of coenzyme A." J Biol Chem 275(2): 1377-83. Rock, C. O., M. A. Karim, et al. (2002). "The murine pantothenate kinase (Pank1) gene encodes two differentially regulated pantothenate kinase isozymes." Gene 291(1- 2): 35-43. Rock, C. O., H. W. Park, et al. (2003). "Role of feedback regulation of pantothenate kinase (CoaA) in control of coenzyme A levels in Escherichia coli." J Bacteriol 185(11): 3410-5. Rossmann, M. G., Blow, D.M. (1962). "The Detection of Sub-Units Within the Crystallographic Asymmetric Unit." Acta Cryst. 15: 24-31. Rupp, B. (2009). Biomolecular Crystallography: Principles, Practice, and Application to Structural Biology. New York, Garland Science. Schuttelkopf, A. W. and D. M. van Aalten (2004). "PRODRG: a tool for high-throughput crystallography of protein-ligand complexes." Acta Crystallogr D Biol Crystallogr 60(Pt 8): 1355-63. Shive, W. and E. E. Snell (1945). "Growth inhibition by analogues of pantothenic acid. II. α- and β-substituted pantothenic acids and related compounds." Science 102(2651): 401-3. Shoichet, B. K. (2004). "Virtual screening of chemical libraries." Nature 432(7019): 862- 5. Snell, E. E. (1941). "Growth inhibition by N-(α,γ-dihydroxy-β,β-dimethylbutyryl)taurine and its reversal by pantothenic acid." J Biol Chem 141: 121-128. Snell, E. E., F. M. Strong, et al. (1937). "Growth factors for bacteria: Fractionation and properties of an accessory factor for lactic acid bacteria." Biochem J 31(10): 1789-99. Snell, E. E., F. M. Strong, et al. (1938). "PANTOTHENIC AND NICOTINIC ACIDS AS GROWTH FACTORS FOR LACTIC ACID BACTERIA." Journal of the American Chemical Society 60(11): 2825. Snell, E. E., F. M. Strong, et al. (1939). "Growth Factors for Bacteria: VIII. Pantothenic and Nicotinic Acids as Essential Growth Factors for Lactic and Propionic Acid Bacteria." J Bacteriol 38(3): 293-308. Snell, E. E. and L. D. Wright (1950). "The Water-Soluble Vitamins." Ann Rev Biochem 19: 277-318. Song, W. J. and S. Jackowski (1992). "Cloning, sequencing, and expression of the pantothenate kinase (coaA) gene of Escherichia coli." J Bacteriol 174(20): 6411- 7. Song, W. J. and S. Jackowski (1994). "Kinetics and regulation of pantothenate kinase from Escherichia coli." J Biol Chem 269(43): 27051-8. Stalons, D. R. and C. Thornsberry (1975). "Broth-dilution method for determining the antibiotic susceptibility of anaerobic bacteria." Antimicrob Agents Chemother 7(1): 15-21. Starai, V. J., I. Celic, et al. (2002). "Sir2-dependent activation of acetyl-CoA synthetase by deacetylation of active lysine." Science 298(5602): 2390-2.

Stiller, E. T., S. A. Harris, et al. (1940). "Pantothenic Acid. VIII. The Total Synthesis of Pure Pantothenic Acid." J Am Chem Soc 62(7): 1785-1790. Strauss, E. and T. P. Begley (2001). "Mechanistic studies on phosphopantothenoylcysteine decarboxylase." J Am Chem Soc 123(26): 6449-50. Strauss, E. and T. P. Begley (2002). "The antibiotic activity of N-pentylpantothenamide results from its conversion to ethyldethia-coenzyme a, a coenzyme a antimetabolite." J Biol Chem 277(50): 48205-9. Strauss, E., C. Kinsland, et al. (2001). "Phosphopantothenoylcysteine synthetase from Escherichia coli. Identification and characterization of the last unidentified coenzyme A biosynthetic enzyme in bacteria." J Biol Chem 276(17): 13513-6. Tanaka, S., Y. Matsushita, et al. (1989). "Cloning and molecular characterization of the gene rimL which encodes an enzyme acetylating ribosomal protein L12 of Escherichia coli K12." Mol Gen Genet 217(2-3): 289-93. Thomas, J. and J. E. Cronan (2010). "Antibacterial activity of N-pentylpantothenamide is due to inhibition of coenzyme a synthesis." Antimicrob Agents Chemother 54(3): 1374-7. Tumbarello, M., T. Spanu, et al. (2006). "Bloodstream infections caused by extended- spectrum-beta-lactamase-producing Klebsiella pneumoniae: risk factors, molecular epidemiology, and clinical outcome." Antimicrob Agents Chemother 50(2): 498-504. Vallari, D. S., S. Jackowski, et al. (1987). "Regulation of pantothenate kinase by coenzyme A and its thioesters." J Biol Chem 262(6): 2468-71. Vallari, D. S. and C. O. Rock (1985). "Isolation and characterization of Escherichia coli pantothenate permease (panF) mutants." J Bacteriol 164(1): 136-42. Vallari, D. S. and C. O. Rock (1985). "Pantothenate transport in Escherichia coli." J Bacteriol 162(3): 1156-61. Vetting, M. W., S. Magnet, et al. (2004). "A bacterial acetyltransferase capable of regioselective N-acetylation of antibiotics and histones." Chem Biol 11(4): 565- 73. Virga, K. G., Y. M. Zhang, et al. (2006). "Structure-activity relationships and enzyme inhibition of pantothenamide-type pantothenate kinase inhibitors." Bioorg Med Chem 14(4): 1007-20. Walker, J. E., M. Saraste, et al. (1982). "Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold." Embo J 1(8): 945-51. Wang, Q., Y. Zhang, et al. (2010). "Acetylation of metabolic enzymes coordinates carbon source utilization and metabolic flux." Science 327(5968): 1004-7. Weinstock, H. H., H. K. Mitchell, et al. (1939). "Pantothenic Acid. IV. Formation of β- Alanine by Cleavage." J Am Chem Soc 61: 1421. Wheeler, S. E. (2012). "Understanding Substituent Effects in Noncovalent Interactions Involving Aromatic Rings." Acc Chem Res (epub ahead of print). Williams, C. L., P. E. Boucher, et al. (2005). "BvgA functions as both an activator and a repressor to control Bvg phase expression of bipA in Bordetella pertussis." Mol Microbiol 56(1): 175-88.

Williams, R. J., C. M. Lyman, et al. (1933). "“Pantothenic Acid,” A Growth Determinant of Universal Biological Occurrence." J Am Chem Soc 55(7): 2912-2927. Williams, R. J. and E. J. Rohrman (1936). "β-ALANINE AND “BIOS”." J Am Chem Soc 58: 695. Wood, G. E. and R. L. Friedman (2000). "The Bvg accessory factor (Baf) enhances pertussis toxin expression in Escherichia coli and is essential for Bordetella pertussis viability." FEMS Microbiol Lett 193(1): 25-30. Yang, K., Y. Eyobo, et al. (2006). "Crystal structure of a type III pantothenate kinase: insight into the mechanism of an essential coenzyme A biosynthetic enzyme universally distributed in bacteria." J Bacteriol 188(15): 5532-40. Yang, K., E. Strauss, et al. (2008). "Structural basis for substrate binding and the catalytic mechanism of type III pantothenate kinase." Biochemistry 47(5): 1369-80. Yigit, H., A. M. Queenan, et al. (2001). "Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae." Antimicrob Agents Chemother 45(4): 1151-61. Yu, B. J., J. A. Kim, et al. (2008). "The diversity of lysine-acetylated proteins in Escherichia coli." J Microbiol Biotechnol 18(9): 1529-36. Yun, M., C. G. Park, et al. (2000). "Structural basis for the feedback regulation of Escherichia coli pantothenate kinase by coenzyme A." J Biol Chem 275(36): 28093-9. Zhang, Y. M., M. W. Frank, et al. (2004). "Acyl carrier protein is a cellular target for the antibacterial action of the pantothenamide class of pantothenate antimetabolites." J Biol Chem 279(49): 50969-75. Zhou, B., S. K. Westaway, et al. (2001). "A novel pantothenate kinase gene (PANK2) is defective in Hallervorden-Spatz syndrome." Nat Genet 28(4): 345-9. Zhyvoloup, A., I. Nemazanyy, et al. (2002). "Molecular cloning of CoA Synthase. The missing link in CoA biosynthesis." J Biol Chem 277(25): 22107-10.

100