DOCSLIB.ORG

(12) United States Patent (10) Patent No.: US 8,637,259 B1 Chatelain Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) United States Patent (10) Patent No.: US 8,637,259 B1 Chatelain Et Al USOO8637259B1 (12) United States Patent (10) Patent No.: US 8,637,259 B1 Chatelain et al. (45) Date of Patent: Jan. 28, 2014 (54) METHODS OF DENTIFYING MODULATORS (56) References Cited OF OLFACTORY RECEPTORS INVOLVED IN THE PERCEPTION OF SWEAT U.S. PATENT DOCUMENTS CARBOXYLIC ACDS 2008, 0299586 A1 12/2008 Han et al. (75) Inventors: Pierre Chatelain, Brussels (BE); Alex FOREIGN PATENT DOCUMENTS Veithen, Genappe (BE) WO 2012/O29922 3, 2012 (73) Assignee: ChemCom S.A., Brussels (BE) OTHER PUBLICATIONS Laska M, et al. Chem. Senses 29:101-109, 2004.* (*) Notice: Subject to any disclaimer, the term of this Krautwurst B, Chemistry & Biodiversity. 5:842-852, 2008.* patent is extended or adjusted under 35 Idan Menashe, et al., Genetic Elucidation of Human Hyperosmia to U.S.C. 154(b) by 0 days. Isovaleric Acid, PloS Biology, Nov. 2007, vol. 5, Issue 11, p. 2462. (21) Appl. No.: 13/024.325 * cited by examiner Primary Examiner — Robert Landsman (22) Filed: Feb. 9, 2011 (74) Attorney, Agent, or Firm — Edwards Wildman Palmer LLP. Ralph A. Loren; Daniel W. Clarke (51) Int. C. (57) ABSTRACT GOIN33/53 (2006.01) The invention relates to the identification of carboxylic acids, GOIN33/567 (2006.01) present in human Sweat, as natural ligands of a specific Sub (52) U.S. C. group of seven olfactory receptor (OR) belonging to class 1 USPC ............ 435/7.1:435/7.2:435/7.21: 435/810; within the OR classification. The invention encompasses the 435/975 use of the interaction of OR polypeptides and carboxylic (58) Field of Classification Search acids as the basis of Screening assays for agents that specifi None cally modulate the activity of the seven ORS of the invention. See application file for complete search history. 33 Claims, 13 Drawing Sheets U.S. Patent Jan. 28, 2014 Sheet 4 of 13 US 8,637,259 B1 Figure 2A: concentration dependent activation of OR52L1, measured with luciferase assay O S g O C logEC50 as -3.05 CD D Of O O v O Q CD O c CD O (f) C S C - Log Pentanoic acid (M) U.S. Patent Jan. 28, 2014 Sheet 5 of 13 US 8,637,259 B1 Figure2B: concentration dependent activation of OR52E8, measured with luciferase assay a. O h - O O logEC50 = -3,98 CD 2 f O O H O SS CD CD CD CD f CD C S - -3 -1 Log 3-hydroxy-3-methylhexanoic acid (M) U.S. Patent Jan. 28, 2014 Sheet 6 of 13 US 8,637,259 B1 Figure 2C: concentration dependent activation of OR52E1, measured with luciferase assay s O 2 O c O C CD log EC50 e-4.43 2 co O O w O SS CD c c CD C cf. CD . 8 s - Log butanoic acid (M) U.S. Patent Jan. 28, 2014 Sheet 7 of 13 US 8,637,259 B1 Figure 2D: concentration dependent activation of OR52A5, measured with luciferase assay 2 O C o CD logEC50 as -4,52 e f C C - O SS Y CD C c c f c 1 O 8 - Log4-ethyloctanoic acid) (M) U.S. Patent Jan. 28, 2014 Sheet 8 of 13 US 8,637,259 B1 Figure2E: Concentration dependent activation of OR512, measured with luciferase assay 90 logEC50s -3.61 - logEC50s -4.17 Log butanoic acid(M) Logisovaleric acid) (M) s O . O iogEC50 - -3.73 C logEC50=-3.41 d 2 O O O s d () d O f E - Log 2-methylhexanoic acid) (M) og EC50 = -4.42 logEC50s -4,33 Log trans-3-methyl-2hexenoic ac) (M) Logbenzoic acid) (M) U.S. Patent Jan. 28, 2014 Sheet 9 of 13 US 8,637,259 B1 Figure 2F: concentration dependent activation of OR5112, measured with luciferase assay 120 logEC50= 4.07 100 80 60 40 20 -9 -7 -5 -3 -1 Log (pentanoic acid) (M) 90 80 iogEC50 E-3.08 70 60 50 40 30 20 10 -9 -7 -5 -3 -1 Log (3-methylhexanoic ac) (M) U.S. Patent Jan. 28, 2014 Sheet 10 of 13 US 8,637,259 B1 Figure 2G: concentration dependent activation of OR52B2, measured with luciferase assay 12 --~~~~~~~~~~~~~~~~~~~~~~~~~~~: log EC50 = -3.83. 10 logEC50 as I -9 -7 -5 -3 -1 -7 -5 -3 Log hexanoic acid (M) Log heptanoic acid (M) is 18 lic s 25 cc 16 logEC50 = -4.08 8 20 iogEC50s -4.28 S 14 9 i 12 C 10 8. o C S$ 8 S. 3 6 9. 9 4 9 f 2 8 5 O I 5 -9 -7 -5 -3 -1 -9 -7 -5 -3 -1 Lognonanoic acid (M) Log decanoic acid (M) U.S. Patent Jan. 28, 2014 Sheet 11 of 13 US 8,637,259 B1 Figure2H: concentration dependent activation of OR52B2, measured with luciferase assay logEC50 = -3.83 -3 -- 9 C O iog ECS{} : -4.47 d 2 O O O V O SSO c) C d c) O d S E - Log undecanoic acid) (M) U.S. Patent Jan. 28, 2014 Sheet 12 of 13 US 8,637,259 B1 Figure 2: concentration dependent activation of OR56A5, measured with luciferase assay 3. 8 12 logEC50 as 2.83 g 8 logEC50 = -3.24 g 10 9. 20 8 8. g w Yrg 6 8 a 10 g 4. ) C 2 E . - -9 -7 -5 -3 - Log hexanoic acid) (M) logEC50= -4.42 og EC50 = -4.4 t Lognonanoic acid (M) Log decanoic acid (M) 50 Fog EC50 -3.2 Log 2-methylheptanoic acid (M) U.S. Patent Jan. 28, 2014 Sheet 13 of 13 US 8,637,259 B1 Figure 2J: concentration dependent activation of OR56A5, measured with luciferase assay 7O ayaayaaaaayaaaayaaaaaaa. 60 log EC50s -4.1 - 50 40 30 20 O Logoctanoic acid) (M) 50 YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY o logEC50= -3.97 8 40 30 1 O Log undecanoic acid (M) US 8,637,259 B1 1. 2 METHODS OF DENTIFYING MODULATORS humans. Class 2 ORs probably represent an adaptation to the OF OLFACTORY RECEPTORS INVOLVED IN terrestrial life where the detection of airborne odorants is THE PERCEPTION OF SWEAT required. CARBOXYLCACDS Mechanisms of Odor Perception Each OR is able to interact with different molecules, and FIELD OF THE INVENTION each odorant molecule can activate more than one OR. Thus, odor perception does not rely on the simple activation of a The present invention relates to the characterization of single OR, but rather on multiple activations of several ORs. olfactory receptors. In particular, the present invention relates An odor (which can be a single molecule or a mixture) is 10 paired with a unique set of activated ORs that are sufficient for to seven class 1 olfactory receptors and the identification of its discrimination and characterization. Odorant concentra their natural ligands corresponding to carboxylic acids tion can dramatically affect the profile of an odor as some present in human Sweat. The present invention provides additional ORS may be recruited (high concentration) or not assays and methods of screening for compounds, particularly activated (low concentration). Therefore, the set of activated antagonists or blockers, modulating the interaction between ORs will differ for different odor concentrations, leading to olfactory receptors and their respective natural ligands. The varying odor perceptions. With a pool of 380 ORs, the num present invention further provides compositions and methods ber of possible combinations is almost infinite, thus explain comprising the above-mentioned compounds to counteract ing the outstanding discrimination properties of the olfactory Sweat malodors. system. Odorant receptors are expressed in specialized olfac tory sensory neurons (OSNs) located at the top of the nasal BACKGROUND OF THE INVENTION cavity in a small area that constitutes the olfactory epithelium. Filiform extensions at one end of these cells contain the ORS Olfactory Receptors on their surface and float in the nasal mucus where the odor The genes coding for olfactory receptors (ORS) represent ants are dissolved. At the opposite end, the OSN extends its the largest family of genes (3% of the whole genome) in the 25 axon across the ethmoid bone at the base of the cranium to human body dedicated to a single physiological function. connect to the olfactory bulb a small region of the brain These ORs belong to the superfamily of G protein coupled dedicated to the integration of the olfactory stimuli. An out receptors (GPCRs). GPCRs are membrane receptors usually standing feature of the tens of millions of OSNs scattered located at the surface of many different cell types. The com throughout the olfactory epithelium is that each one expresses mon features of these receptors consist of seven transmem 30 only one of the about 400 OR genes available in the human brane spans that form a barrel within the cell membrane and genome. The OSNs expressing the matching gene connect in their capacity to interact with heterotrimeric GTPase and their axons to the same subregion of the olfactory bulb form thereby transducing a signal upon binding of their activators. ing a structure called a glomerulus. It is from this organization of OSNs that the coding of an odor by a specific set of In the human genome, about 900 sequences containing activated ORS is translated geographically in the bulb by a characteristic signatures of olfactory receptors have been corresponding pattern of activated glomeruli. This informa found. However, 60% of these appear to encode non-func tion is further transmitted to the olfactory area of the cortex tional pseudogenes, thereby leaving humans with about 380 where it is decoded and analyzed. In OSNs, triggering of the different OR proteins. ORs are characterized by 6 conserved OR promotes the activation of an olfactory-specific G protein amino acid motifs in their sequence.
Load more

Recommended publications
  • Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
    bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity.
    [Show full text]
  • Olfactory Receptors Involved in the Perception
    (19) TZZ¥ZZ__T (11) EP 3 004 157 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C07K 14/705 (2006.01) C07K 14/72 (2006.01) 01.11.2017 Bulletin 2017/44 G01N 33/50 (2006.01) G01N 33/566 (2006.01) G01N 33/68 (2006.01) (21) Application number: 13730138.8 (86) International application number: (22) Date of filing: 31.05.2013 PCT/EP2013/061243 (87) International publication number: WO 2014/191047 (04.12.2014 Gazette 2014/49) (54) OLFACTORY RECEPTORS INVOLVED IN THE PERCEPTION OF SWEAT CARBOXYLIC ACIDS AND THE USE THEREOF AN DER WAHRNEHMUNG VON SCHWEISSCARBONSÄUREN BETEILIGTE GERUCHSREZEPTOREN UND VERWENDUNG DAVON RÉCEPTEURS OLFACTIFS IMPLIQUÉS DANS LA PERCEPTION D’ACIDES CARBOXYLIQUES DE SUEUR ET LEUR UTILISATION (84) Designated Contracting States: • VEITHEN, Alex AL AT BE BG CH CY CZ DE DK EE ES FI FR GB 1476 Genappe (BE) GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR (74) Representative: Vanhalst, Koen et al De Clercq & Partners cvba (43) Date of publication of application: E. Gevaertdreef 10a 13.04.2016 Bulletin 2016/15 9830 Sint-Martens-Latem (BE) (73) Proprietor: ChemCom S.A. (56) References cited: 1070 Brussels (BE) WO-A1-2012/029922 WO-A2-01/27158 WO-A2-2006/094704 US-A1- 2003 207 337 (72) Inventors: • CHATELAIN, Pierre 1150 Brussels (BE) Note: Within nine months of the publication of the mention of the grant of the European patent in the European Patent Bulletin, any person may give notice to the European Patent Office of opposition to that patent, in accordance with the Implementing Regulations.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name olfactory receptor, family 52, subfamily A, member 5 Gene Symbol OR52A5 Organism Human Gene Summary Olfactory receptors interact with odorant molecules in the nose to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. Gene Aliases OR11-33 RefSeq Accession No. NC_000011.9, NT_009237.18 UniGene ID Hs.546593 Ensembl Gene ID ENSG00000171944 Entrez Gene ID 390054 Assay Information Unique Assay ID qHsaCEP0054119 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000307388 Amplicon Context Sequence GCTGCCAACATGGCCAAAAAAATGTACATGGGTATATGGAGGCTGTTTTCATATT TGATTATAACTAAAATTAGGGAATTTCCAATCACACCAATAAGATACATGGCAGAG AAAGGAATCCCAATCCAACACTGC Amplicon Length (bp) 105 Chromosome Location 11:5153664-5153798 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9996 cDNA Cq 29.79 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 77 gDNA
    [Show full text]
  • Single Cell Derived Clonal Analysis of Human Glioblastoma Links
    SUPPLEMENTARY INFORMATION: Single cell derived clonal analysis of human glioblastoma links functional and genomic heterogeneity ! Mona Meyer*, Jüri Reimand*, Xiaoyang Lan, Renee Head, Xueming Zhu, Michelle Kushida, Jane Bayani, Jessica C. Pressey, Anath Lionel, Ian D. Clarke, Michael Cusimano, Jeremy Squire, Stephen Scherer, Mark Bernstein, Melanie A. Woodin, Gary D. Bader**, and Peter B. Dirks**! ! * These authors contributed equally to this work.! ** Correspondence: [email protected] or [email protected]! ! Supplementary information - Meyer, Reimand et al. Supplementary methods" 4" Patient samples and fluorescence activated cell sorting (FACS)! 4! Differentiation! 4! Immunocytochemistry and EdU Imaging! 4! Proliferation! 5! Western blotting ! 5! Temozolomide treatment! 5! NCI drug library screen! 6! Orthotopic injections! 6! Immunohistochemistry on tumor sections! 6! Promoter methylation of MGMT! 6! Fluorescence in situ Hybridization (FISH)! 7! SNP6 microarray analysis and genome segmentation! 7! Calling copy number alterations! 8! Mapping altered genome segments to genes! 8! Recurrently altered genes with clonal variability! 9! Global analyses of copy number alterations! 9! Phylogenetic analysis of copy number alterations! 10! Microarray analysis! 10! Gene expression differences of TMZ resistant and sensitive clones of GBM-482! 10! Reverse transcription-PCR analyses! 11! Tumor subtype analysis of TMZ-sensitive and resistant clones! 11! Pathway analysis of gene expression in the TMZ-sensitive clone of GBM-482! 11! Supplementary figures and tables" 13" "2 Supplementary information - Meyer, Reimand et al. Table S1: Individual clones from all patient tumors are tumorigenic. ! 14! Fig. S1: clonal tumorigenicity.! 15! Fig. S2: clonal heterogeneity of EGFR and PTEN expression.! 20! Fig. S3: clonal heterogeneity of proliferation.! 21! Fig.
    [Show full text]
  • Genetic Characterization of Greek Population Isolates Reveals Strong Genetic Drift at Missense and Trait-Associated Variants
    ARTICLE Received 22 Apr 2014 | Accepted 22 Sep 2014 | Published 6 Nov 2014 DOI: 10.1038/ncomms6345 OPEN Genetic characterization of Greek population isolates reveals strong genetic drift at missense and trait-associated variants Kalliope Panoutsopoulou1,*, Konstantinos Hatzikotoulas1,*, Dionysia Kiara Xifara2,3, Vincenza Colonna4, Aliki-Eleni Farmaki5, Graham R.S. Ritchie1,6, Lorraine Southam1,2, Arthur Gilly1, Ioanna Tachmazidou1, Segun Fatumo1,7,8, Angela Matchan1, Nigel W. Rayner1,2,9, Ioanna Ntalla5,10, Massimo Mezzavilla1,11, Yuan Chen1, Chrysoula Kiagiadaki12, Eleni Zengini13,14, Vasiliki Mamakou13,15, Antonis Athanasiadis16, Margarita Giannakopoulou17, Vassiliki-Eirini Kariakli5, Rebecca N. Nsubuga18, Alex Karabarinde18, Manjinder Sandhu1,8, Gil McVean2, Chris Tyler-Smith1, Emmanouil Tsafantakis12, Maria Karaleftheri16, Yali Xue1, George Dedoussis5 & Eleftheria Zeggini1 Isolated populations are emerging as a powerful study design in the search for low-frequency and rare variant associations with complex phenotypes. Here we genotype 2,296 samples from two isolated Greek populations, the Pomak villages (HELIC-Pomak) in the North of Greece and the Mylopotamos villages (HELIC-MANOLIS) in Crete. We compare their genomic characteristics to the general Greek population and establish them as genetic isolates. In the MANOLIS cohort, we observe an enrichment of missense variants among the variants that have drifted up in frequency by more than fivefold. In the Pomak cohort, we find novel associations at variants on chr11p15.4 showing large allele frequency increases (from 0.2% in the general Greek population to 4.6% in the isolate) with haematological traits, for example, with mean corpuscular volume (rs7116019, P ¼ 2.3 Â 10 À 26). We replicate this association in a second set of Pomak samples (combined P ¼ 2.0 Â 10 À 36).
    [Show full text]
  • Genome-Wide Screening Identifies Genes and Biological Processes
    Louisiana State University LSU Digital Commons LSU Doctoral Dissertations Graduate School 10-12-2018 Genome-Wide Screening Identifies Genes and Biological Processes Implicated in Chemoresistance and Oncogene-Induced Apoptosis Tengyu Ko Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations Part of the Cancer Biology Commons, Cell Biology Commons, and the Genomics Commons Recommended Citation Ko, Tengyu, "Genome-Wide Screening Identifies Genes and Biological Processes Implicated in Chemoresistance and Oncogene- Induced Apoptosis" (2018). LSU Doctoral Dissertations. 4715. https://digitalcommons.lsu.edu/gradschool_dissertations/4715 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. GENOME-WIDE SCREENING IDENTIFIES GENES AND BIOLOGICAL PROCESSES IMPLICATED IN CHEMORESISTANCE AND ONCOGENE- INDUCED APOPTOSIS A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical and Veterinary Medical Sciences through the Department of Comparative Biomedical Sciences by Tengyu Ko B.S., University of California, Santa Barbara 2010 December 2018 ACKNOWLEDGEMENTS I would like to express my sincerest gratitude to my major supervisor Dr. Shisheng Li for giving me the opportunity to join his team and the freedom to pursue projects. I appreciate all of his thoughts and efforts. Truly, none of these findings would be possible without his supervisions, supports, insightful discussions, and patience.
    [Show full text]
  • Human Olfactory Receptors
    Human Olfactory Receptors: A journey from cell engineering for efficient in vitro functional assays to effective antagonists in human sensory assay Huysseune Sandra, Philippeau Magali, Moreau Cédric, Veithen Alex, Chatelain Pierre, Quesnel Yannick. ChemCom S.A., Route de Lennik 802, 1070 Anderlecht, Belgium. Cell lines Introduction: ChemCom's Entry ORs Literature data HEK293T HANA3 proprietary Many odorant compounds are perceived as unpleasant. They can be present in different contexts such as body-, home-, factory-, material-, or fabric-emitted 1 OR56A1 Adipietro et al., 2012 odors, so that humans are daily exposed to this olfactory pollution. In addition, odorant compounds can also taint food or beverages. Malodor and off-note 2 OR10J5 Saito et al., 2009 counteraction is a daily challenge for many different industries. 3 ORX116 - The first step of the odor perception corresponds to the interaction of olfactory receptors (ORs) with odorant molecules. Therefore, a selective inhibition of the 4 ORX069 - ORs by weakly odorant or odorless antagonists represents an innovative solution to malodor issues. The identification of such odor blockers requires an 5 OR10H5 - efficient technological platform to first fish out the receptors that interact with a malodor of interest and second, to screen libraries of potential antagonists of 6 OR8B3 Mainland et al., 2013 7 OR6P1 Mainland et al., 2013 these ORs. 8 ORX074B - 9 ORX126 - Materials and Methods: 10 ORX189 - 11 ORX081 - In vitro functional assay 12 ORX213 - Dilution-response analysis were performed in HEK293T, HANA3 and HEK293T-hRTP1S/hRTP2 cells using the CRE-luciferase reporter assay system. Briefly, each 13 OR1D2 Spehr et al., 2003 cell plated one day before was transfected with deorphanized ORs (identified at Chemcom S.A.) or empty vector plasmids using TransIT®-LT1 (Mirus) 14 OR7C1 Mainland et al., 2013 according to the manufacturer’s protocol.
    [Show full text]
  • Clinical, Molecular, and Immune Analysis of Dabrafenib-Trametinib
    Supplementary Online Content Chen G, McQuade JL, Panka DJ, et al. Clinical, molecular and immune analysis of dabrafenib-trametinib combination treatment for metastatic melanoma that progressed during BRAF inhibitor monotherapy: a phase 2 clinical trial. JAMA Oncology. Published online April 28, 2016. doi:10.1001/jamaoncol.2016.0509. eMethods. eReferences. eTable 1. Clinical efficacy eTable 2. Adverse events eTable 3. Correlation of baseline patient characteristics with treatment outcomes eTable 4. Patient responses and baseline IHC results eFigure 1. Kaplan-Meier analysis of overall survival eFigure 2. Correlation between IHC and RNAseq results eFigure 3. pPRAS40 expression and PFS eFigure 4. Baseline and treatment-induced changes in immune infiltrates eFigure 5. PD-L1 expression eTable 5. Nonsynonymous mutations detected by WES in baseline tumors This supplementary material has been provided by the authors to give readers additional information about their work. © 2016 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/30/2021 eMethods Whole exome sequencing Whole exome capture libraries for both tumor and normal samples were constructed using 100ng genomic DNA input and following the protocol as described by Fisher et al.,3 with the following adapter modification: Illumina paired end adapters were replaced with palindromic forked adapters with unique 8 base index sequences embedded within the adapter. In-solution hybrid selection was performed using the Illumina Rapid Capture Exome enrichment kit with 38Mb target territory (29Mb baited). The targeted region includes 98.3% of the intervals in the Refseq exome database. Dual-indexed libraries were pooled into groups of up to 96 samples prior to hybridization.
    [Show full text]
  • A Multi-Cancer Gene Signature Associated with Stromal Activation
    A multi-cancer gene signature associated with stromal activation Sandra Orsulic, PhD Professor of OB/GYN Women’s Cancer Program Samuel Oschin Comprehensive Cancer Institute I Cedars-Sinai Medical Center 1100011010 1001000101 0101001011 Stroma/ECM Prevents Tumor Invasion Stroma/ECM Promotes Tumor Invasion Tumor Growth and Stroma Remodeling Ki67-positive dividing cells cancer cells stroma Tumor Growth and Stroma Remodeling Ki67-positive dividing cells cancer • proliferative cells • targeted by chemotherapy • genetically unstable stroma Tumor Growth and Stroma Remodeling Ki67-positive dividing cells cancer • proliferating cells • targeted by chemotherapy • genetically unstable • slow proliferating • not targeted by chemotherapy stroma • genetically stable • enhanced remodeling predicts poor outcome Expression of COL11A1 in Intratumoral Stroma COL11A1 + Fat 0% Peritumoral ~1% stroma Tumor ~50% Intratumoral 100µm stroma COL11A1 Expression in Cancers and Corresponding Normal Tissues Smooth Muscle Actin Expression in Cancers and Corresponding Normal Tissues COL11A1 Expression in Cancers and Corresponding Normal Tissues BREAST COLORECTAL 1 2 1 2 3 1. Breast (61) 1. Colon (19) 2. Invasive ductal breast 2. Rectum (3) carcinoma (389) 3. Colon adenocarcinoma (101) Overexpression gene rank: 1 Overexpression gene rank: 3 (in top 1%) (in top 1%) p-value: 1.15E-73 p-value: 2.19E-44 t-test: 33.769 t-test: 27.871 fold change: 40.542 fold change: 32.796 Increase in COL11A1 Levels During Cancer Progression Breast Cancer Ductal Invasive Carcinoma Ductal In
    [Show full text]
  • The Hypothalamus As a Hub for SARS-Cov-2 Brain Infection and Pathogenesis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.08.139329; this version posted June 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The hypothalamus as a hub for SARS-CoV-2 brain infection and pathogenesis Sreekala Nampoothiri1,2#, Florent Sauve1,2#, Gaëtan Ternier1,2ƒ, Daniela Fernandois1,2 ƒ, Caio Coelho1,2, Monica ImBernon1,2, Eleonora Deligia1,2, Romain PerBet1, Vincent Florent1,2,3, Marc Baroncini1,2, Florence Pasquier1,4, François Trottein5, Claude-Alain Maurage1,2, Virginie Mattot1,2‡, Paolo GiacoBini1,2‡, S. Rasika1,2‡*, Vincent Prevot1,2‡* 1 Univ. Lille, Inserm, CHU Lille, Lille Neuroscience & Cognition, DistAlz, UMR-S 1172, Lille, France 2 LaBoratorY of Development and PlasticitY of the Neuroendocrine Brain, FHU 1000 daYs for health, EGID, School of Medicine, Lille, France 3 Nutrition, Arras General Hospital, Arras, France 4 Centre mémoire ressources et recherche, CHU Lille, LiCEND, Lille, France 5 Univ. Lille, CNRS, INSERM, CHU Lille, Institut Pasteur de Lille, U1019 - UMR 8204 - CIIL - Center for Infection and ImmunitY of Lille (CIIL), Lille, France. # and ƒ These authors contriButed equallY to this work. ‡ These authors directed this work *Correspondence to: [email protected] and [email protected] Short title: Covid-19: the hypothalamic hypothesis 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.08.139329; this version posted June 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Supplementary Data
    SUPPLEMENTARY METHODS 1) Characterisation of OCCC cell line gene expression profiles using Prediction Analysis for Microarrays (PAM) The ovarian cancer dataset from Hendrix et al (25) was used to predict the phenotypes of the cell lines used in this study. Hendrix et al (25) analysed a series of 103 ovarian samples using the Affymetrix U133A array platform (GEO: GSE6008). This dataset comprises clear cell (n=8), endometrioid (n=37), mucinous (n=13) and serous epithelial (n=41) primary ovarian carcinomas and samples from 4 normal ovaries. To build the predictor, the Prediction Analysis of Microarrays (PAM) package in R environment was employed (http://rss.acs.unt.edu/Rdoc/library/pamr/html/00Index.html). When more than one probe described the expression of a given gene, we used the probe with the highest median absolute deviation across the samples. The dataset from Hendrix et al. (25) and the dataset of OCCC cell lines described in this manuscript were then overlaid on the basis of 11536 common unique HGNC gene symbols. Only the 99 primary ovarian cancers samples and the four normal ovary samples were used to build the predictor. Following leave one out cross-validation, a predictor based upon 126 genes was able to identify correctly the four distinct phenotypes of primary ovarian tumour samples with a misclassification rate of 18.3%. This predictor was subsequently applied to the expression data from the 12 OCCC cell lines to determine the likeliest phenotype of the OCCC cell lines compared to primary ovarian cancers. Posterior probabilities were estimated for each cell line in comparison to the following phenotypes: clear cell, endometrioid, mucinous and serous epithelial.
    [Show full text]
  • Us 2018 / 0305689 A1
    US 20180305689A1 ( 19 ) United States (12 ) Patent Application Publication ( 10) Pub . No. : US 2018 /0305689 A1 Sætrom et al. ( 43 ) Pub . Date: Oct. 25 , 2018 ( 54 ) SARNA COMPOSITIONS AND METHODS OF plication No . 62 /150 , 895 , filed on Apr. 22 , 2015 , USE provisional application No . 62/ 150 ,904 , filed on Apr. 22 , 2015 , provisional application No. 62 / 150 , 908 , (71 ) Applicant: MINA THERAPEUTICS LIMITED , filed on Apr. 22 , 2015 , provisional application No. LONDON (GB ) 62 / 150 , 900 , filed on Apr. 22 , 2015 . (72 ) Inventors : Pål Sætrom , Trondheim (NO ) ; Endre Publication Classification Bakken Stovner , Trondheim (NO ) (51 ) Int . CI. C12N 15 / 113 (2006 .01 ) (21 ) Appl. No. : 15 /568 , 046 (52 ) U . S . CI. (22 ) PCT Filed : Apr. 21 , 2016 CPC .. .. .. C12N 15 / 113 ( 2013 .01 ) ; C12N 2310 / 34 ( 2013. 01 ) ; C12N 2310 /14 (2013 . 01 ) ; C12N ( 86 ) PCT No .: PCT/ GB2016 /051116 2310 / 11 (2013 .01 ) $ 371 ( c ) ( 1 ) , ( 2 ) Date : Oct . 20 , 2017 (57 ) ABSTRACT The invention relates to oligonucleotides , e . g . , saRNAS Related U . S . Application Data useful in upregulating the expression of a target gene and (60 ) Provisional application No . 62 / 150 ,892 , filed on Apr. therapeutic compositions comprising such oligonucleotides . 22 , 2015 , provisional application No . 62 / 150 ,893 , Methods of using the oligonucleotides and the therapeutic filed on Apr. 22 , 2015 , provisional application No . compositions are also provided . 62 / 150 ,897 , filed on Apr. 22 , 2015 , provisional ap Specification includes a Sequence Listing . SARNA sense strand (Fessenger 3 ' SARNA antisense strand (Guide ) Mathew, Si Target antisense RNA transcript, e . g . NAT Target Coding strand Gene Transcription start site ( T55 ) TY{ { ? ? Targeted Target transcript , e .
    [Show full text]