Human Olfactory Receptors
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity. -
Database Tool the Systematic Annotation of the Three Main GPCR
Database, Vol. 2010, Article ID baq018, doi:10.1093/database/baq018 ............................................................................................................................................................................................................................................................................................. Database tool The systematic annotation of the three main Downloaded from https://academic.oup.com/database/article-abstract/doi/10.1093/database/baq018/406672 by guest on 15 January 2019 GPCR families in Reactome Bijay Jassal1, Steven Jupe1, Michael Caudy2, Ewan Birney1, Lincoln Stein2, Henning Hermjakob1 and Peter D’Eustachio3,* 1European Bioinformatics Institute, Hinxton, Cambridge, CB10 1SD, UK, 2Ontario Institute for Cancer Research, Toronto, ON M5G 0A3, Canada and 3New York University School of Medicine, New York, NY 10016, USA *Corresponding author: Tel: +212 263 5779; Fax: +212 263 8166; Email: [email protected] Submitted 14 April 2010; Revised 14 June 2010; Accepted 13 July 2010 ............................................................................................................................................................................................................................................................................................. Reactome is an open-source, freely available database of human biological pathways and processes. A major goal of our work is to provide an integrated view of cellular signalling processes that spans from ligand–receptor -
OR2AG1 (NM 001004489) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC214778 OR2AG1 (NM_001004489) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: OR2AG1 (NM_001004489) Human Tagged ORF Clone Tag: Myc-DDK Symbol: OR2AG1 Synonyms: OR2AG3; OR11-79 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC214778 representing NM_001004489 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCTCTGGAACTTCACCTTGGGAAGTGGCTTCATTTTGGTGGGGATTCTGAATGACAGTGGGTCTC CTGAACTGCTCTGTGCTACAATTACAATCCTATACTTGTTGGCCCTGATCAGCAATGGCCTACTGCTCCT GGCTATCACCATGGAAGCCCGGCTCCACATGCCCATGTACCTCCTGCTTGGGCAGCTCTCTCTCATGGAC CTCCTGTTCACATCTGTTGTCACTCCCAAGGCCCTTGCGGACTTTCTGCGCAGAGAAAACACCATCTCCT TTGGAGGCTGTGCCCTTCAGATGTTCCTGGCACTGACAATGGGTGGTGCTGAGGACCTCCTACTGGCCTT CATGGCCTATGACAGGTATGTGGCCATTTGTCATCCTCTGACATACATGACCCTCATGAGCTCAAGAGCC TGCTGGCTCATGGTGGCCACGTCCTGGATCCTGGCATCCCTAAGTGCCCTAATATATACCGTGTATACCA TGCACTATCCCTTCTGCAGGGCCCAGGAGATCAGGCATCTTCTCTGTGAGATCCCACACTTGCTGAAGGT GGCCTGTGCTGATACCTCCAGATATGAGCTCATGGTATATGTGATGGGTGTGACCTTCCTGATTCCCTCT CTTGCTGCTATACTGGCCTCCTATACACAAATTCTACTCACTGTGCTCCATATGCCATCAAATGAGGGGA GGAAGAAAGCCCTTGTCACCTGCTCTTCCCACCTGACTGTGGTTGGGATGTTCTATGGAGCTGCCACATT CATGTATGTCTTGCCCAGTTCCTTCCACAGCACCAGACAAGACAACATCATCTCTGTTTTCTACACAATT GTCACTCCAGCCCTGAATCCACTCATCTACAGCCTGAGGAATAAGGAGGTCATGCGGGCCTTGAGGAGGG -
Olfactory Receptors Involved in the Perception
(19) TZZ¥ZZ__T (11) EP 3 004 157 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C07K 14/705 (2006.01) C07K 14/72 (2006.01) 01.11.2017 Bulletin 2017/44 G01N 33/50 (2006.01) G01N 33/566 (2006.01) G01N 33/68 (2006.01) (21) Application number: 13730138.8 (86) International application number: (22) Date of filing: 31.05.2013 PCT/EP2013/061243 (87) International publication number: WO 2014/191047 (04.12.2014 Gazette 2014/49) (54) OLFACTORY RECEPTORS INVOLVED IN THE PERCEPTION OF SWEAT CARBOXYLIC ACIDS AND THE USE THEREOF AN DER WAHRNEHMUNG VON SCHWEISSCARBONSÄUREN BETEILIGTE GERUCHSREZEPTOREN UND VERWENDUNG DAVON RÉCEPTEURS OLFACTIFS IMPLIQUÉS DANS LA PERCEPTION D’ACIDES CARBOXYLIQUES DE SUEUR ET LEUR UTILISATION (84) Designated Contracting States: • VEITHEN, Alex AL AT BE BG CH CY CZ DE DK EE ES FI FR GB 1476 Genappe (BE) GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR (74) Representative: Vanhalst, Koen et al De Clercq & Partners cvba (43) Date of publication of application: E. Gevaertdreef 10a 13.04.2016 Bulletin 2016/15 9830 Sint-Martens-Latem (BE) (73) Proprietor: ChemCom S.A. (56) References cited: 1070 Brussels (BE) WO-A1-2012/029922 WO-A2-01/27158 WO-A2-2006/094704 US-A1- 2003 207 337 (72) Inventors: • CHATELAIN, Pierre 1150 Brussels (BE) Note: Within nine months of the publication of the mention of the grant of the European patent in the European Patent Bulletin, any person may give notice to the European Patent Office of opposition to that patent, in accordance with the Implementing Regulations. -
Genomic Selection Signatures in Sheep from the Western Pyrenees Otsanda Ruiz-Larrañaga, Jorge Langa, Fernando Rendo, Carmen Manzano, Mikel Iriondo, Andone Estonba
Genomic selection signatures in sheep from the Western Pyrenees Otsanda Ruiz-Larrañaga, Jorge Langa, Fernando Rendo, Carmen Manzano, Mikel Iriondo, Andone Estonba To cite this version: Otsanda Ruiz-Larrañaga, Jorge Langa, Fernando Rendo, Carmen Manzano, Mikel Iriondo, et al.. Genomic selection signatures in sheep from the Western Pyrenees. Genetics Selection Evolution, BioMed Central, 2018, 50 (1), pp.9. 10.1186/s12711-018-0378-x. hal-02405217 HAL Id: hal-02405217 https://hal.archives-ouvertes.fr/hal-02405217 Submitted on 11 Dec 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License Ruiz-Larrañaga et al. Genet Sel Evol (2018) 50:9 https://doi.org/10.1186/s12711-018-0378-x Genetics Selection Evolution RESEARCH ARTICLE Open Access Genomic selection signatures in sheep from the Western Pyrenees Otsanda Ruiz‑Larrañaga1* , Jorge Langa1, Fernando Rendo2, Carmen Manzano1, Mikel Iriondo1 and Andone Estonba1 Abstract Background: The current large spectrum of sheep phenotypic diversity -
Supplementary Table 9. Functional Annotation Clustering Results for the Union (GS3) of the Top Genes from the SNP-Level and Gene-Based Analyses (See ST4)
Supplementary Table 9. Functional Annotation Clustering Results for the union (GS3) of the top genes from the SNP-level and Gene-based analyses (see ST4) Column Header Key Annotation Cluster Name of cluster, sorted by descending Enrichment score Enrichment Score EASE enrichment score for functional annotation cluster Category Pathway Database Term Pathway name/Identifier Count Number of genes in the submitted list in the specified term % Percentage of identified genes in the submitted list associated with the specified term PValue Significance level associated with the EASE enrichment score for the term Genes List of genes present in the term List Total Number of genes from the submitted list present in the category Pop Hits Number of genes involved in the specified term (category-specific) Pop Total Number of genes in the human genome background (category-specific) Fold Enrichment Ratio of the proportion of count to list total and population hits to population total Bonferroni Bonferroni adjustment of p-value Benjamini Benjamini adjustment of p-value FDR False Discovery Rate of p-value (percent form) Annotation Cluster 1 Enrichment Score: 3.8978262119731335 Category Term Count % PValue Genes List Total Pop Hits Pop Total Fold Enrichment Bonferroni Benjamini FDR GOTERM_CC_DIRECT GO:0005886~plasma membrane 383 24.33290978 5.74E-05 SLC9A9, XRCC5, HRAS, CHMP3, ATP1B2, EFNA1, OSMR, SLC9A3, EFNA3, UTRN, SYT6, ZNRF2, APP, AT1425 4121 18224 1.18857065 0.038655922 0.038655922 0.086284383 UP_KEYWORDS Membrane 626 39.77128335 1.53E-04 SLC9A9, HRAS, -
Genome-Wide Transcriptome Analysis of Laminar Tissue During the Early Stages of Experimentally Induced Equine Laminitis
GENOME-WIDE TRANSCRIPTOME ANALYSIS OF LAMINAR TISSUE DURING THE EARLY STAGES OF EXPERIMENTALLY INDUCED EQUINE LAMINITIS A Dissertation by JIXIN WANG Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY December 2010 Major Subject: Biomedical Sciences GENOME-WIDE TRANSCRIPTOME ANALYSIS OF LAMINAR TISSUE DURING THE EARLY STAGES OF EXPERIMENTALLY INDUCED EQUINE LAMINITIS A Dissertation by JIXIN WANG Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Approved by: Chair of Committee, Bhanu P. Chowdhary Committee Members, Terje Raudsepp Paul B. Samollow Loren C. Skow Penny K. Riggs Head of Department, Evelyn Tiffany-Castiglioni December 2010 Major Subject: Biomedical Sciences iii ABSTRACT Genome-wide Transcriptome Analysis of Laminar Tissue During the Early Stages of Experimentally Induced Equine Laminitis. (December 2010) Jixin Wang, B.S., Tarim University of Agricultural Reclamation; M.S., South China Agricultural University; M.S., Texas A&M University Chair of Advisory Committee: Dr. Bhanu P. Chowdhary Equine laminitis is a debilitating disease that causes extreme sufferring in afflicted horses and often results in a lifetime of chronic pain. The exact sequence of pathophysiological events culminating in laminitis has not yet been characterized, and this is reflected in the lack of any consistently effective therapeutic strategy. For these reasons, we used a newly developed 21,000 element equine-specific whole-genome oligoarray to perform transcriptomic analysis on laminar tissue from horses with experimentally induced models of laminitis: carbohydrate overload (CHO), hyperinsulinaemia (HI), and oligofructose (OF). -
Identification of Candidate Biomarkers and Pathways Associated with Type 1 Diabetes Mellitus Using Bioinformatics Analysis
bioRxiv preprint doi: https://doi.org/10.1101/2021.06.08.447531; this version posted June 9, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Identification of candidate biomarkers and pathways associated with type 1 diabetes mellitus using bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karnataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2021.06.08.447531; this version posted June 9, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Type 1 diabetes mellitus (T1DM) is a metabolic disorder for which the underlying molecular mechanisms remain largely unclear. This investigation aimed to elucidate essential candidate genes and pathways in T1DM by integrated bioinformatics analysis. In this study, differentially expressed genes (DEGs) were analyzed using DESeq2 of R package from GSE162689 of the Gene Expression Omnibus (GEO). Gene ontology (GO) enrichment analysis, REACTOME pathway enrichment analysis, and construction and analysis of protein-protein interaction (PPI) network, modules, miRNA-hub gene regulatory network and TF-hub gene regulatory network, and validation of hub genes were then performed. A total of 952 DEGs (477 up regulated and 475 down regulated genes) were identified in T1DM. GO and REACTOME enrichment result results showed that DEGs mainly enriched in multicellular organism development, detection of stimulus, diseases of signal transduction by growth factor receptors and second messengers, and olfactory signaling pathway. -
Single Cell Derived Clonal Analysis of Human Glioblastoma Links
SUPPLEMENTARY INFORMATION: Single cell derived clonal analysis of human glioblastoma links functional and genomic heterogeneity ! Mona Meyer*, Jüri Reimand*, Xiaoyang Lan, Renee Head, Xueming Zhu, Michelle Kushida, Jane Bayani, Jessica C. Pressey, Anath Lionel, Ian D. Clarke, Michael Cusimano, Jeremy Squire, Stephen Scherer, Mark Bernstein, Melanie A. Woodin, Gary D. Bader**, and Peter B. Dirks**! ! * These authors contributed equally to this work.! ** Correspondence: [email protected] or [email protected]! ! Supplementary information - Meyer, Reimand et al. Supplementary methods" 4" Patient samples and fluorescence activated cell sorting (FACS)! 4! Differentiation! 4! Immunocytochemistry and EdU Imaging! 4! Proliferation! 5! Western blotting ! 5! Temozolomide treatment! 5! NCI drug library screen! 6! Orthotopic injections! 6! Immunohistochemistry on tumor sections! 6! Promoter methylation of MGMT! 6! Fluorescence in situ Hybridization (FISH)! 7! SNP6 microarray analysis and genome segmentation! 7! Calling copy number alterations! 8! Mapping altered genome segments to genes! 8! Recurrently altered genes with clonal variability! 9! Global analyses of copy number alterations! 9! Phylogenetic analysis of copy number alterations! 10! Microarray analysis! 10! Gene expression differences of TMZ resistant and sensitive clones of GBM-482! 10! Reverse transcription-PCR analyses! 11! Tumor subtype analysis of TMZ-sensitive and resistant clones! 11! Pathway analysis of gene expression in the TMZ-sensitive clone of GBM-482! 11! Supplementary figures and tables" 13" "2 Supplementary information - Meyer, Reimand et al. Table S1: Individual clones from all patient tumors are tumorigenic. ! 14! Fig. S1: clonal tumorigenicity.! 15! Fig. S2: clonal heterogeneity of EGFR and PTEN expression.! 20! Fig. S3: clonal heterogeneity of proliferation.! 21! Fig. -
The Potential Druggability of Chemosensory G Protein-Coupled Receptors
International Journal of Molecular Sciences Review Beyond the Flavour: The Potential Druggability of Chemosensory G Protein-Coupled Receptors Antonella Di Pizio * , Maik Behrens and Dietmar Krautwurst Leibniz-Institute for Food Systems Biology at the Technical University of Munich, Freising, 85354, Germany; [email protected] (M.B.); [email protected] (D.K.) * Correspondence: [email protected]; Tel.: +49-8161-71-2904; Fax: +49-8161-71-2970 Received: 13 February 2019; Accepted: 12 March 2019; Published: 20 March 2019 Abstract: G protein-coupled receptors (GPCRs) belong to the largest class of drug targets. Approximately half of the members of the human GPCR superfamily are chemosensory receptors, including odorant receptors (ORs), trace amine-associated receptors (TAARs), bitter taste receptors (TAS2Rs), sweet and umami taste receptors (TAS1Rs). Interestingly, these chemosensory GPCRs (csGPCRs) are expressed in several tissues of the body where they are supposed to play a role in biological functions other than chemosensation. Despite their abundance and physiological/pathological relevance, the druggability of csGPCRs has been suggested but not fully characterized. Here, we aim to explore the potential of targeting csGPCRs to treat diseases by reviewing the current knowledge of csGPCRs expressed throughout the body and by analysing the chemical space and the drug-likeness of flavour molecules. Keywords: smell; taste; flavour molecules; drugs; chemosensory receptors; ecnomotopic expression 1. Introduction Thirty-five percent of approved drugs act by modulating G protein-coupled receptors (GPCRs) [1,2]. GPCRs, also named 7-transmembrane (7TM) receptors, based on their canonical structure, are the largest family of membrane receptors in the human genome. -
WO 2019/068007 Al Figure 2
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/068007 Al 04 April 2019 (04.04.2019) W 1P O PCT (51) International Patent Classification: (72) Inventors; and C12N 15/10 (2006.01) C07K 16/28 (2006.01) (71) Applicants: GROSS, Gideon [EVIL]; IE-1-5 Address C12N 5/10 (2006.0 1) C12Q 1/6809 (20 18.0 1) M.P. Korazim, 1292200 Moshav Almagor (IL). GIBSON, C07K 14/705 (2006.01) A61P 35/00 (2006.01) Will [US/US]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., C07K 14/725 (2006.01) P.O. Box 4044, 7403635 Ness Ziona (TL). DAHARY, Dvir [EilL]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., P.O. (21) International Application Number: Box 4044, 7403635 Ness Ziona (IL). BEIMAN, Merav PCT/US2018/053583 [EilL]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., P.O. (22) International Filing Date: Box 4044, 7403635 Ness Ziona (E.). 28 September 2018 (28.09.2018) (74) Agent: MACDOUGALL, Christina, A. et al; Morgan, (25) Filing Language: English Lewis & Bockius LLP, One Market, Spear Tower, SanFran- cisco, CA 94105 (US). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of national protection available): AE, AG, AL, AM, 62/564,454 28 September 2017 (28.09.2017) US AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, 62/649,429 28 March 2018 (28.03.2018) US CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (71) Applicant: IMMP ACT-BIO LTD. -
Predicting Human Olfactory Perception from Activities of Odorant Receptors
iScience ll OPEN ACCESS Article Predicting Human Olfactory Perception from Activities of Odorant Receptors Joel Kowalewski, Anandasankar Ray [email protected] odor perception HIGHLIGHTS Machine learning predicted activity of 34 human ORs for ~0.5 million chemicals chemical structure Activities of human ORs predicts OR activity could predict odor character using machine learning Few OR activities were needed to optimize r predictions of each odor e t c percept a AI r a odorant activates mul- h Behavior predictions in c Drosophila also need few r tiple ORs o olfactory receptor d o activities ts ic ed pr ity tiv ac OR Kowalewski & Ray, iScience 23, 101361 August 21, 2020 ª 2020 The Author(s). https://doi.org/10.1016/ j.isci.2020.101361 iScience ll OPEN ACCESS Article Predicting Human Olfactory Perception from Activities of Odorant Receptors Joel Kowalewski1 and Anandasankar Ray1,2,3,* SUMMARY Odor perception in humans is initiated by activation of odorant receptors (ORs) in the nose. However, the ORs linked to specific olfactory percepts are unknown, unlike in vision or taste where receptors are linked to perception of different colors and tastes. The large family of ORs (~400) and multiple receptors activated by an odorant present serious challenges. Here, we first use machine learning to screen ~0.5 million compounds for new ligands and identify enriched structural motifs for ligands of 34 human ORs. We next demonstrate that the activity of ORs successfully predicts many of the 146 different perceptual qualities of chem- icals. Although chemical features have been used to model odor percepts, we show that biologically relevant OR activity is often superior.