DOCSLIB.ORG

Genome-Wide Transcriptome Analysis of Laminar Tissue During the Early Stages of Experimentally Induced Equine Laminitis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genome-Wide Transcriptome Analysis of Laminar Tissue During the Early Stages of Experimentally Induced Equine Laminitis GENOME-WIDE TRANSCRIPTOME ANALYSIS OF LAMINAR TISSUE DURING THE EARLY STAGES OF EXPERIMENTALLY INDUCED EQUINE LAMINITIS A Dissertation by JIXIN WANG Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY December 2010 Major Subject: Biomedical Sciences GENOME-WIDE TRANSCRIPTOME ANALYSIS OF LAMINAR TISSUE DURING THE EARLY STAGES OF EXPERIMENTALLY INDUCED EQUINE LAMINITIS A Dissertation by JIXIN WANG Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Approved by: Chair of Committee, Bhanu P. Chowdhary Committee Members, Terje Raudsepp Paul B. Samollow Loren C. Skow Penny K. Riggs Head of Department, Evelyn Tiffany-Castiglioni December 2010 Major Subject: Biomedical Sciences iii ABSTRACT Genome-wide Transcriptome Analysis of Laminar Tissue During the Early Stages of Experimentally Induced Equine Laminitis. (December 2010) Jixin Wang, B.S., Tarim University of Agricultural Reclamation; M.S., South China Agricultural University; M.S., Texas A&M University Chair of Advisory Committee: Dr. Bhanu P. Chowdhary Equine laminitis is a debilitating disease that causes extreme sufferring in afflicted horses and often results in a lifetime of chronic pain. The exact sequence of pathophysiological events culminating in laminitis has not yet been characterized, and this is reflected in the lack of any consistently effective therapeutic strategy. For these reasons, we used a newly developed 21,000 element equine-specific whole-genome oligoarray to perform transcriptomic analysis on laminar tissue from horses with experimentally induced models of laminitis: carbohydrate overload (CHO), hyperinsulinaemia (HI), and oligofructose (OF). Samples were collected during the developmental (DEV) and Obel grade 1 (OG1) stages of laminitis for the CHO model. For the HI model, samples were collected at the Obel grade 2 (OG2) stage. For the OF model, samples were collected at the 12 h and 24 h time points. Appropriate control samples were obtained for all models. This is the first genome-wide transcriptome analysis of laminar tissue using an equine 21,000 70-mer long oligoarray approach in CHO, HI and OF induced laminitis. iv Overall, we identified the differential expression of genes encoding S100 calcium binding proteins, extracellular matrix proteins, glycoproteins, transporters, olfactory receptors, genes involved in signal transduction, body‟s homeostasis, apoptosis, and immune response. Between CHO and OF models of laminitis, there were more shared genes. We discovered several common differentially expressed genes (i.e., ADAMTS1, CYCS and CXCL14) among all three models that are likely important to the pathogenesis of equine laminitis. We also discovered what appear to be central roles of apoptosis, inflammatory response, and intracellular ion homeostasis molecular processes in CHO and OF models of laminitis. Pathway analysis detected the NOD-like receptor signaling pathway, which is involved in recognition of intracellular bacteria in both the CHO and OF models of laminitis. Genetic network analysis indicated convergent pathway core molecules present in equine acute laminitis: p38 MAPK and NF-κB. Most importantly, our results of overexpression of anti-microbial genes (i.e., DEFB4, PI3, and CXCL14) suggest the central involvement of these genes in the progression of early equine laminitis and will allow refinement of current hypotheses of disease pathogenesis. v DEDICATION This work is dedicated to my parents who have supported me so many years for my education. vi ACKNOWLEDGEMENTS I would like to thank my advisor, Dr. Bhanu Chowdhary, for his great supervision, guidance, patience, and support throughout my graduate studies. He not only cares about his students‟ professional development but also their personal growth. He also told us to learn things well, to do our best and keep the hunger for learning. These teachings have made a great impact on my academic life. Also, I would like to thank my committee members, Dr. Terje Raudsepp, Dr. Loren Skow, Dr. Paul Samollow, and Dr. Penny Riggs for their insightful suggestions and guidance throughout my graduate project. I gratefully acknowledge Dr. Hannah L. Galantino-Homer and Dr. Rebecca Carter at the Laminitis Institute at the University of Pennsylvania, Dr. Christopher C. Pollitt, Dr. Andrew Van Eps and Ms. Melody De Laat at the Australian Equine Laminitis Research Unit, University of Queensland and Dr. James Belknap and Ms. Mauria Watts at the Department of Veterinary Clinical Sciences at Ohio State University for kindly providing the laminar tissue samples for the study. I also want to extend my gratitude to Dr. Ashley Seabury, Dr. Samantha Steelman, Dr. Xianyao Li, Dr. Huaijun Zhou, Dr. Ivan Ivanov, Dr. Pranab Jyoti Das, Dr. Nandina Paria, Dr. Dhruva Kumar Mishra, Dr. Monika Vishnoi, Dr. Jan Janecka, and fellow graduate students Priyanka Kachroo, Jana Caldwell and Felipe Avila for their help. Finally, thanks to my parents for their love. vii NOMENCLATURE AAEP American Association of Equine Practitioners ACTB Beta Actin ADAM A Disintegrin and Metalloproteinase ADAMDEC1 ADAM-like, decysin 1 ADAMTS A Disintegrin and Metalloproteinase with Thrombospondin AGTPBP1 ATP/GTP Binding Protein 1 ANOVA Analysis of Variance AP-1 Activator Protein 1 BAX BCL2-associated X Protein BCP Bromochloropropane BEX2 Brain Expressed X-linked 2 B2M Beta-2-Microglobulin BM Basement Membrane BP Biological Process BPV-1 Bovine Papillomavirus-1 BWE Black Walnut Extract CACYBP Calcyclin Binding Protein CADS A Common Array Dye-swap CC Cellular Component CCL Chemokine (C-C motif) Ligand viii CCR Chemokine (C-C motif) Receptor CD14 Cluster of Differentiation 14 CD69 Cluster of Differentiation 69 CEBPB CCAAT/enhancer Binding Protein (C/EBP), beta CFB Complement Factor B CHO Carbohydrate Overload CIB1 Calcium and Integrin Binding 1 CILP2 Cartilage Intermediate Layer Protein 2 CITED1 Cbp/p300-interacting Transactivator CNRQ Calibrated Normalized Relative Quantity COX Cyclooxygenase CPA6 Carboxypeptidase A6 CPXM Carboxypeptidase X (M14 Family), Member 2 CRTAC1 Cartilage Acidic Protein 1 CRYAB Crystallin, Alpha B CSH Cross-species Hybridization CXCL Chemokine (C-X-C motif) Ligand Cp Crossing Point DAMP Damage-associated Molecular Pattern DAPP1 Dual Adaptor of Phosphotyrosine and 3-phosphoinositides DAVID Database for Annotation, Visualization and Integrated Discovery DDB2 Damage-specific DNA Binding Protein 2 ix DDF Deep Digital Flexor DE Differentially Expressed DEFB4 Defensin, Beta 4 DMSO Dimethylsufoxide ECD Equine Cushing‟s Disease ECEL1 Endothelin Converting Enzyme-like 1 ECM Extracellular Matrix EEF1A1 Eukaryotic Translation Elongation Factor 1 Alpha 1 EHC Euglycemic-hyperinsulinemic Clamp EHSS Equine Hindgut Streptococcal Species EMS Equine Metabolic Syndrome ERK Extracellular Signal-regulated Kinase ET-1 Endothelin-1 FAP Fibroblast Activation Protein, Alpha FGR Gardner-Rasheed Feline Sarcoma Viral Oncogene Homolog FIBIN Fin Bud Initiation Factor FOSL1 FOS-like Antigen 1 FWER Family Wise Error Rate GAPDH Glyceraldhyde-3-phosphate Dehydrogenase GI Gastrointestinal GLMN Glomulin GLUT Glucose Transporter x GNB2L1 Guanine Nucleotide Binding Protein, Beta Polypeptide 2-like 1 GO Gene Ontology GPCR G-protein Coupled Receptor GRB7 Growth Factor Receptor-bound Protein 7 GSN Gelsolin GWAS Genome Wide Association Study HMGB2 High-mobility Group Box 2 HPRT1 Hypoxanthine Phosphoribosyltransferase 1 HD Hemidesmosome HI Hyperinsulinaemia HR Heart Rate ICAM-1 Intercellular Adhesion Molecule 1 IGFBP Insulin-like Growth Factor Binding Protein IL Interleukin IL10RB Interleukin 10 Receptor, beta ING5 Inhibitor of Growth Family, Member 5 IR Insulin Resistance KRT17 Keratin 17 LFS Lavender Foal Syndrome LIMMA Linear Models for Microarray Data LOC554251 Hypothetical Protein LOC554251 LOXL1 Lysyl Oxidase-like 1 xi LOWESS Locally Weighted Scatter Plot Smoothing Regression LPS Lipopolysacccharide LTB4R Leukotriene B4 Receptor MAF V-maf Musculoaponeurotic Fibrosarcoma Oncogene Homolog MAIL Molecule Possessing Ankyrin-repeats Induced by LPS MAPK Mitogen Activated Protein Kinase MAQC Microarray Quality Control MATN2 Matrilin 2 MCP Monocyte Chemotactic Protein MF Molecular Function MIF Macrophage Migration Inhibitory Factor MMP Matrix Metalloproteinase MMPI Matrix Metalloproteinase Inhibitor MNAT1 Menage A Trois Homolog 1 MSS Musculoskeletal Syndrome MYBPC2 Myosin Binding Protein C, Fast Type MYOD Maturity Onset Diabetes of Young NDEL1 NudE Nuclear Distribution Gene E Homolog-like 1 NDUFB3 NADH Dehydrogenase (ubiquinone) 1 Beta Subcomplex, 3 NF Normalization Factor NF-κB Nuclear Factor κB NFAT Nuclear Factor of Activated T Cells xii NRQ Normalized Relative Quantity NSAID Nonsteroidal Anti-inflammatory Drug OA Osteoarthritis OF Oligofructose OR7A10 Olfactory Receptor, Family 7, Subfamily A, Member 10 PAMP Pathogen Associated Molecule Pattern P4HA3 Proline 4-hydroxylase, alpha polypeptide III PI3 Peptidase Inhibitor 3 PI3K Phosphoinositide 3-kinase PCA Principle Component Analysis PDL Primary Dermal Laminae PEL Primary Epidermal Laminae PMT Photomultiplier Tube PPA1 Pyrophosphatase 1 PPIA Peptidylprolyl Isomerase A PROM2 Prominin 2 qRT-PCR Quantitative Reverse Transcriptase PCR QSOX1 Quiescin Q6 Sulfhydryl Oxidase 1 RA Rheumatoid Arthritis RAD23B RAD23 Homolog B RAO Recurrent Airway Obstruction REEP3 Receptor Accessory Protein 3 xiii RNF144B Ring Finger 144B ROS Reactive
Load more

Recommended publications
  • Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
    bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity.
    [Show full text]
  • Responses of Bats to White-Nose Syndrome and Implications for Conservation
    University of New Hampshire University of New Hampshire Scholars' Repository Doctoral Dissertations Student Scholarship Spring 2020 Responses of Bats to White-Nose Syndrome and Implications for Conservation Meghan Stark University of New Hampshire, Durham Follow this and additional works at: https://scholars.unh.edu/dissertation Recommended Citation Stark, Meghan, "Responses of Bats to White-Nose Syndrome and Implications for Conservation" (2020). Doctoral Dissertations. 2518. https://scholars.unh.edu/dissertation/2518 This Dissertation is brought to you for free and open access by the Student Scholarship at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. RESPONSES OF BATS TO WHITE-NOSE SYNDROME AND IMPLICATIONS FOR CONSERVATION BY MEGHAN A. STARK B.S., University of Alabama at Birmingham, 2013 DISSERTATION Submitted to the University of New Hampshire in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy In Genetics May 2020 i This dissertation was examined and approved in partial fulfillment of the requirements for the degree of Ph.D. in Genetics by: Dissertation Director, Matthew MacManes, Assoc. Prof. UNH MCBS Jeffrey T. Foster, Associate Professor, NAU PMI W. Kelley Thomas, Professor, UNH MCBS Rebecca Rowe, Associate Professor, UNH NREN Thomas Lee, Associate Professor Emeritus, UNH NREN On April 6, 2020 Approval signatures are on file with the University of New Hampshire Graduate School. ii DEDICATION I dedicate this work to all of the strong women in my life: Myra Michele Ange Heather Michelle Coons Kaitlyn Danielle Cagle Brindlee Michelle Coons Patricia Gail Miller Sarah Jean Lane “Here’s to strong women.
    [Show full text]
  • Efficacy and Mechanistic Evaluation of Tic10, a Novel Antitumor Agent
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2012 Efficacy and Mechanisticv E aluation of Tic10, A Novel Antitumor Agent Joshua Edward Allen University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Oncology Commons Recommended Citation Allen, Joshua Edward, "Efficacy and Mechanisticv E aluation of Tic10, A Novel Antitumor Agent" (2012). Publicly Accessible Penn Dissertations. 488. https://repository.upenn.edu/edissertations/488 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/488 For more information, please contact [email protected]. Efficacy and Mechanisticv E aluation of Tic10, A Novel Antitumor Agent Abstract TNF-related apoptosis-inducing ligand (TRAIL; Apo2L) is an endogenous protein that selectively induces apoptosis in cancer cells and is a critical effector in the immune surveillance of cancer. Recombinant TRAIL and TRAIL-agonist antibodies are in clinical trials for the treatment of solid malignancies due to the cancer-specific cytotoxicity of TRAIL. Recombinant TRAIL has a short serum half-life and both recombinant TRAIL and TRAIL receptor agonist antibodies have a limited capacity to perfuse to tissue compartments such as the brain, limiting their efficacy in certain malignancies. To overcome such limitations, we searched for small molecules capable of inducing the TRAIL gene using a high throughput luciferase reporter gene assay. We selected TRAIL-inducing compound 10 (TIC10) for further study based on its induction of TRAIL at the cell surface and its promising therapeutic index. TIC10 is a potent, stable, and orally active antitumor agent that crosses the blood-brain barrier and transcriptionally induces TRAIL and TRAIL-mediated cell death in a p53-independent manner.
    [Show full text]
  • OR2AG1 (NM 001004489) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC214778 OR2AG1 (NM_001004489) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: OR2AG1 (NM_001004489) Human Tagged ORF Clone Tag: Myc-DDK Symbol: OR2AG1 Synonyms: OR2AG3; OR11-79 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC214778 representing NM_001004489 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCTCTGGAACTTCACCTTGGGAAGTGGCTTCATTTTGGTGGGGATTCTGAATGACAGTGGGTCTC CTGAACTGCTCTGTGCTACAATTACAATCCTATACTTGTTGGCCCTGATCAGCAATGGCCTACTGCTCCT GGCTATCACCATGGAAGCCCGGCTCCACATGCCCATGTACCTCCTGCTTGGGCAGCTCTCTCTCATGGAC CTCCTGTTCACATCTGTTGTCACTCCCAAGGCCCTTGCGGACTTTCTGCGCAGAGAAAACACCATCTCCT TTGGAGGCTGTGCCCTTCAGATGTTCCTGGCACTGACAATGGGTGGTGCTGAGGACCTCCTACTGGCCTT CATGGCCTATGACAGGTATGTGGCCATTTGTCATCCTCTGACATACATGACCCTCATGAGCTCAAGAGCC TGCTGGCTCATGGTGGCCACGTCCTGGATCCTGGCATCCCTAAGTGCCCTAATATATACCGTGTATACCA TGCACTATCCCTTCTGCAGGGCCCAGGAGATCAGGCATCTTCTCTGTGAGATCCCACACTTGCTGAAGGT GGCCTGTGCTGATACCTCCAGATATGAGCTCATGGTATATGTGATGGGTGTGACCTTCCTGATTCCCTCT CTTGCTGCTATACTGGCCTCCTATACACAAATTCTACTCACTGTGCTCCATATGCCATCAAATGAGGGGA GGAAGAAAGCCCTTGTCACCTGCTCTTCCCACCTGACTGTGGTTGGGATGTTCTATGGAGCTGCCACATT CATGTATGTCTTGCCCAGTTCCTTCCACAGCACCAGACAAGACAACATCATCTCTGTTTTCTACACAATT GTCACTCCAGCCCTGAATCCACTCATCTACAGCCTGAGGAATAAGGAGGTCATGCGGGCCTTGAGGAGGG
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • To Study Mutant P53 Gain of Function, Various Tumor-Derived P53 Mutants
    Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By Shama K Khokhar M.Sc., Bilaspur University, 2004 B.Sc., Bhopal University, 2002 2007 1 COPYRIGHT SHAMA K KHOKHAR 2007 2 WRIGHT STATE UNIVERSITY SCHOOL OF GRADUATE STUDIES Date of Defense: 12-03-07 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY SHAMA KHAN KHOKHAR ENTITLED Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science Madhavi P. Kadakia, Ph.D. Thesis Director Daniel Organisciak , Ph.D. Department Chair Committee on Final Examination Madhavi P. Kadakia, Ph.D. Steven J. Berberich, Ph.D. Michael Leffak, Ph.D. Joseph F. Thomas, Jr., Ph.D. Dean, School of Graduate Studies 3 Abstract Khokhar, Shama K. M.S., Department of Biochemistry and Molecular Biology, Wright State University, 2007 Differential effect of TAp63γ mutants on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. p63, a member of the p53 gene family, known to play a role in development, has more recently also been implicated in cancer progression. Mice lacking p63 exhibit severe developmental defects such as limb truncations, abnormal skin, and absence of hair follicles, teeth, and mammary glands. Germline missense mutations of p63 have been shown to be responsible for several human developmental syndromes including SHFM, EEC and ADULT syndromes and are associated with anomalies in the development of organs of epithelial origin.
    [Show full text]
  • UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By
    UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii
    [Show full text]
  • EFEMP1 Expression Promotes in Vivo Tumor Growth in Human Pancreatic Adenocarcinoma
    Published OnlineFirst February 10, 2009; DOI: 10.1158/1541-7786.MCR-08-0132 EFEMP1 Expression Promotes In vivo Tumor Growth in Human Pancreatic Adenocarcinoma Hendrik Seeliger,1 Peter Camaj,1 Ivan Ischenko,1 Axel Kleespies,1 Enrico N. De Toni,2 Susanne E. Thieme,4 Helmut Blum,4 Gerald Assmann,3 Karl-Walter Jauch,1 and Christiane J. Bruns1 Departments of 1Surgery and 2Gastroenterology and 3Institute of Pathology, Munich University Medical Center; 4Gene Center, Munich University, Munich, Germany Abstract VEGF-driven angiogenesis and antiapoptotic mechanisms. The progression of pancreatic cancer is dependent on Hence, EFEMP1 is a promising candidate for assessing local tumor growth, angiogenesis, and metastasis. prognosis and individualizing therapy in a clinical tumor EFEMP1, a recently discovered member of the fibulin setting. (Mol Cancer Res 2009;7(2):189–98) family, was characterized with regard to these key elements of pancreatic cancer progression. Differential gene expression was assessed Introduction by mRNA microarray hybridization in FG human Pancreatic cancer is one of the leading causes of cancer- pancreatic adenocarcinoma cells and L3.6pl cells, related deaths in western countries. Despite improved multi- a highly metastatic variant of FG. In vivo orthotopic modal therapeutic regimens, its prognosis has improved only tumor growth of EFEMP1-transfected FG cells was marginally, resulting in a total 5-year survival rate, which is examined in nude mice. To assess the angiogenic still as low as 5% (1). More recently, agents targeted against properties of EFEMP1, vascular endothelial growth molecular determinants of cancer cells or tumor vessels, or factor (VEGF) production of tumor cells, both, have been tested successfully in clinical trials to expand endothelial cell proliferation and migration, and the therapeutic spectrum (2-4).
    [Show full text]
  • Supplementary Figure S4
    18DCIS 18IDC Supplementary FigureS4 22DCIS 22IDC C D B A E (0.77) (0.78) 16DCIS 14DCIS 28DCIS 16IDC 28IDC (0.43) (0.49) 0 ADAMTS12 (p.E1469K) 14IDC ERBB2, LASP1,CDK12( CCNE1 ( NUTM2B SDHC,FCGR2B,PBX1,TPR( CD1D, B4GALT3, BCL9, FLG,NUP21OL,TPM3,TDRD10,RIT1,LMNA,PRCC,NTRK1 0 ADAMTS16 (p.E67K) (0.67) (0.89) (0.54) 0 ARHGEF38 (p.P179Hfs*29) 0 ATG9B (p.P823S) (0.68) (1.0) ARID5B, CCDC6 CCNE1, TSHZ3,CEP89 CREB3L2,TRIM24 BRAF, EGFR (7p11); 0 ABRACL (p.R35H) 0 CATSPER1 (p.P152H) 0 ADAMTS18 (p.Y799C) 19q12 0 CCDC88C (p.X1371_splice) (0) 0 ADRA1A (p.P327L) (10q22.3) 0 CCNF (p.D637N) −4 −2 −4 −2 0 AKAP4 (p.G454A) 0 CDYL (p.Y353Lfs*5) −4 −2 Log2 Ratio Log2 Ratio −4 −2 Log2 Ratio Log2 Ratio 0 2 4 0 2 4 0 ARID2 (p.R1068H) 0 COL27A1 (p.G646E) 0 2 4 0 2 4 2 EDRF1 (p.E521K) 0 ARPP21 (p.P791L) ) 0 DDX11 (p.E78K) 2 GPR101, p.A174V 0 ARPP21 (p.P791T) 0 DMGDH (p.W606C) 5 ANP32B, p.G237S 16IDC (Ploidy:2.01) 16DCIS (Ploidy:2.02) 14IDC (Ploidy:2.01) 14DCIS (Ploidy:2.9) -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 Log Ratio Log Ratio Log Ratio Log Ratio 12DCIS 0 ASPM (p.S222T) Log Ratio Log Ratio 0 FMN2 (p.G941A) 20 1 2 3 2 0 1 2 3 2 ERBB3 (p.D297Y) 2 0 1 2 3 20 1 2 3 0 ATRX (p.L1276I) 20 1 2 3 2 0 1 2 3 0 GALNT18 (p.F92L) 2 MAPK4, p.H147Y 0 GALNTL6 (p.E236K) 5 C11orf1, p.Y53C (10q21.2); 0 ATRX (p.R1401W) PIK3CA, p.H1047R 28IDC (Ploidy:2.0) 28DCIS (Ploidy:2.0) 22IDC (Ploidy:3.7) 22DCIS (Ploidy:4.1) 18IDC (Ploidy:3.9) 18DCIS (Ploidy:2.3) 17q12 0 HCFC1 (p.S2025C) 2 LCMT1 (p.S34A) 0 ATXN7L2 (p.X453_splice) SPEN, p.P677Lfs*13 CBFB 1 2 3 4 5 6 7 8 9 10 11
    [Show full text]
  • OR51G2 (C-13): Sc-131007
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . OR51G2 (C-13): sc-131007 BACKGROUND PRODUCT Olfactory receptors interact with odorant molecules in the nose to initiate a Each vial contains 200 µg IgG in 1.0 ml of PBS with < 0.1% sodium azide neuronal response that leads to the perception of smell. While they share a and 0.1% gelatin. seven transmembrane domain structure with many neurotransmitter and hor - Blocking peptide available for competition studies, sc-131007 P, (100 µg mone receptors, olfactory receptors are responsible for the recognition and peptide in 0.5 ml PBS containing < 0.1% sodium azide and 0.2% BSA). transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. OR51G2 (olfactory receptor 51G2), also known as APPLICATIONS OR11-28, is a 314 amino acid multi-pass membrane protein that belongs to the G-protein coupled receptor 1 family. The gene that encodes OR51G2 con - OR51G2 (C-13) is recommended for detection of OR51G2 of human origin sists of more than 900 bases and maps to human chromosome 11p15.4. Chro- by Western Blotting (starting dilution 1:200, dilution range 1:100-1:1000), mosome 11 houses over 1,400 genes and comprises nearly 4% of the human immunofluorescence (starting dilution 1:50, dilution range 1:50-1:500) and genome. Jervell and Lange-Nielsen syndrome, Jacobsen syndrome, Niemann- solid phase ELISA (starting dilution 1:30, dilution range 1:30-1:3000); non Pick disease, hereditary angioedema and Smith-Lemli-Opitz syndrome are cross-reactive with other OR51 family members.
    [Show full text]
  • The Plasma Peptides of Alzheimer's Disease
    Florentinus‑Mefailoski et al. Clin Proteom (2021) 18:17 https://doi.org/10.1186/s12014‑021‑09320‑2 Clinical Proteomics RESEARCH Open Access The plasma peptides of Alzheimer’s disease Angelique Florentinus‑Mefailoski1, Peter Bowden1, Philip Scheltens2, Joep Killestein3, Charlotte Teunissen4 and John G. Marshall1,5* Abstract Background: A practical strategy to discover proteins specifc to Alzheimer’s dementia (AD) may be to compare the plasma peptides and proteins from patients with dementia to normal controls and patients with neurological condi‑ tions like multiple sclerosis or other diseases. The aim was a proof of principle for a method to discover proteins and/ or peptides of plasma that show greater observation frequency and/or precursor intensity in AD. The endogenous tryptic peptides of Alzheimer’s were compared to normals, multiple sclerosis, ovarian cancer, breast cancer, female normal, sepsis, ICU Control, heart attack, along with their institution‑matched controls, and normal samples collected directly onto ice. Methods: Endogenous tryptic peptides were extracted from blinded, individual AD and control EDTA plasma sam‑ ples in a step gradient of acetonitrile for random and independent sampling by LC–ESI–MS/MS with a set of robust and sensitive linear quadrupole ion traps. The MS/MS spectra were ft to fully tryptic peptides within proteins identi‑ fed using the X!TANDEM algorithm. Observation frequency of the identifed proteins was counted using SEQUEST algorithm. The proteins with apparently increased observation frequency in AD versus AD Control were revealed graphically and subsequently tested by Chi Square analysis. The proteins specifc to AD plasma by Chi Square with FDR correction were analyzed by the STRING algorithm.
    [Show full text]
  • Supplementary File 2A Revised
    Supplementary file 2A. Differentially expressed genes in aldosteronomas compared to all other samples, ranked according to statistical significance. Missing values were not allowed in aldosteronomas, but to a maximum of five in the other samples. Acc UGCluster Name Symbol log Fold Change P - Value Adj. P-Value B R99527 Hs.8162 Hypothetical protein MGC39372 MGC39372 2,17 6,3E-09 5,1E-05 10,2 AA398335 Hs.10414 Kelch domain containing 8A KLHDC8A 2,26 1,2E-08 5,1E-05 9,56 AA441933 Hs.519075 Leiomodin 1 (smooth muscle) LMOD1 2,33 1,3E-08 5,1E-05 9,54 AA630120 Hs.78781 Vascular endothelial growth factor B VEGFB 1,24 1,1E-07 2,9E-04 7,59 R07846 Data not found 3,71 1,2E-07 2,9E-04 7,49 W92795 Hs.434386 Hypothetical protein LOC201229 LOC201229 1,55 2,0E-07 4,0E-04 7,03 AA454564 Hs.323396 Family with sequence similarity 54, member B FAM54B 1,25 3,0E-07 5,2E-04 6,65 AA775249 Hs.513633 G protein-coupled receptor 56 GPR56 -1,63 4,3E-07 6,4E-04 6,33 AA012822 Hs.713814 Oxysterol bining protein OSBP 1,35 5,3E-07 7,1E-04 6,14 R45592 Hs.655271 Regulating synaptic membrane exocytosis 2 RIMS2 2,51 5,9E-07 7,1E-04 6,04 AA282936 Hs.240 M-phase phosphoprotein 1 MPHOSPH -1,40 8,1E-07 8,9E-04 5,74 N34945 Hs.234898 Acetyl-Coenzyme A carboxylase beta ACACB 0,87 9,7E-07 9,8E-04 5,58 R07322 Hs.464137 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 0,82 1,3E-06 1,2E-03 5,35 R77144 Hs.488835 Transmembrane protein 120A TMEM120A 1,55 1,7E-06 1,4E-03 5,07 H68542 Hs.420009 Transcribed locus 1,07 1,7E-06 1,4E-03 5,06 AA410184 Hs.696454 PBX/knotted 1 homeobox 2 PKNOX2 1,78 2,0E-06
    [Show full text]