DOCSLIB.ORG

This Electronic Thesis Or Dissertation Has Been Downloaded from the King’S Research Portal At

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
This Electronic Thesis Or Dissertation Has Been Downloaded from the King’S Research Portal At This electronic thesis or dissertation has been downloaded from the King’s Research Portal at https://kclpure.kcl.ac.uk/portal/ Role of EZH2 in Myelodysplastic Syndromes Shinde, Sneha Awarding institution: King's College London The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without proper acknowledgement. END USER LICENCE AGREEMENT This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International licence. https://creativecommons.org/licenses/by-nc-nd/4.0/ You are free to: Share: to copy, distribute and transmit the work Under the following conditions: Attribution: You must attribute the work in the manner specified by the author (but not in any way that suggests that they endorse you or your use of the work). Non Commercial: You may not use this work for commercial purposes. No Derivative Works - You may not alter, transform, or build upon this work. Any of these conditions can be waived if you receive permission from the author. Your fair dealings and other rights are in no way affected by the above. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 06. Nov. 2017 Role of EZH2 in Myelodysplastic Syndromes Sneha Shinde THESIS PRESENTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY King’s College London Department of Haematological Medicine 2015 0 Declaration I hereby declare that I alone composed this thesis and that the work is my own, except where stated otherwise. Sneha Shinde March 2015 1 Acknowledgement First and foremost, I would like to thank my primary supervisor, Prof. Ghulam J. Mufti for giving me this opportunity. Without your faith in me, this PhD would not have happened. Sincere thanks for your quick feedback during the write up stage of this project in spite of your hectic schedule. Special thanks to my second supervisor and now a friend, Dr. Azim Mohamedali for his critical feedback on my work and for all your help in the crucial last few months of my PhD. Many thanks to Dr. Joop Gaken who was not my supervisor officially but who still helped me immensely in the cloning work of this project. Your kindness cannot be described in words. For me, I am your (adopted!) student. I would also like to show my gratitude to our small but special group; Terry, Richard, Farooq, Jiang, Shok Ping, Austin and Alex for sharing their reagents in the time of need, for their help, valuable advice and encouraging words. Thank you to Shreyans for providing large amounts of clinical data needed for this project in spite of last minute notifications and to Syed, Lin for proof reading part of my thesis. I would like to express deepest thanks to my best friends Heba, Nazia, Pilar and Guilia for listening to and supporting me in everything over the past four years. I cannot begin to express my gratitude, appreciation for your friendship. Truly blessed to share my PhD journey with friends like you! Many thanks to the PhD co-ordinators, Professor Shaun Thomas for being a wonderful mentor, guide and to Dr. Alan Ramsay for the prompt help and kind words. Thanks to everyone in the Department of Haematological Medicine; Thomas, Winston and David for helping with long hours of cell sorting, Aytug, Rick and to the tissue bank (Nigel, Rajani, Bu) for providing the invaluable patient samples. Last but not the least, I would like to thank my parents for their love, support, encouragement always and especially for the past four years. Without them this dream would not have come true.A big appreciation goes to my husband, friend for his help and advice in the time of need. Finally, I take this opportunity to acknowledge the financial support of Celgene for this project. 2 Abstract Occurrence of mutations in the Polycomb (PcG) gene; EZH2 (Enhancer of Zeste Homologue 2) represent a new class of molecular lesions associated with instability in the epigenome of patients with Myelodysplastic Syndrome (MDS). Detection of microdeletion at 7q36.1 or 7q Copy Neutral Loss of Heterozygosity [CN (LOH)] led to the identification of EZH2 mutations. EZH2 is the catalytic component of Polycomb Repressive Complex 2 (PRC2) that trimethylates lysine 27 of histone 3 (H3K27) resulting in gene silencing and recruitment of the sister complex i.e. Polycomb Repressive Complex 1 (PRC1) to target genes. Discovery of EZH2 mutations have shed light on the involvement of other PcG and PcG interacting proteins i.e. Jumonji (jmj) family of demethylases and DNA methyltrasferase 3A (DNMT3A) in MDS. Investigation of Single Nucleotide Polymorphism (SNP) array abnormalities and mutational analysis of these genes have not been ascertained and therefore I examined cytogenetic aberrations affecting twelve Polycomb (PRC1) and seventeen Jumonji genes using high density SNP 6 arrays. SNP6 data analyzed in this study was generated by our group for previous research projects. I visualised this data using CHromosome Analysis Suite (Chas) from Affymetrix and identified five PRC1 genes (BMI1, PHC1, PHC2, RING1A and RING1B) in 17/91 (19 %) patients with either Copy Number Variations (CNVs) like deletions or amplifications or CN (LOH). Interestingly, the frequency of SNP6 aberrations was high (two times) in Jumonji genes as compared to PRC1. 29/91 patients (31 %) showed either CNVs or CN (LOH) in fifteen (JMJD3, JMJD4, JMJD1B, JMJD2A, JARID2, JMJD1C, JARID1B, JMJD2C, UTX, JARID1C, JARID1A, JMJD2D, JHJD1A, JARID1D and JHJD1B) Jumonji genes. Mutational analysis of patients with SNP6 aberrations was carried out using Sanger or 454 sequencing but no mutations were detected in either the PRC1 or Jumonji genes. To elucidate changes in gene expression as a result of 3 amplification or deletion of genomic material, qPCR was performed on 22/29 patients for thirteen Jumonji genes. Gene expression of JARID1A, JARID1C and UTX were modulated concomitant to the CNVs. Deletion of JARID1A locus was associated with reduced gene expression (p value <0.0001) in two patients while trisomy of JARID1C (n=1) and UTX (n=2) were associated with increased expression (p value <0.0001) of both the genes. Mutational analysis of PRC2 core components (SUZ12, EED, EZH1) and DNMT3A was carried out in a cohort of 61 MDS patients previously sequenced by our group for EZH2 mutations to examine their mutational overlap. 10/61 patients had heterozygous DNMT3A mutations (clone size 20-44 %) with two patients showing mutations at the R882 site. Interestingly, these mutations were seen predominantly (n= 6) in patients with monosomy 7/del 7q however only one patient had both DNMT3A (R882H) and EZH2 (V626M) mutations suggesting that there is no specific association between mutations of the two genes. In contrast, PRC2 genes were not mutated in this cohort emphasizing the importance of EZH2 mutations alone in MDS pathogenesis. Therefore I examined the functional consequences of the commonly occurring EZH2 (R690C/R690H) and DNMT3A (R882H) mutations in myeloid cell lines. To achieve this, numerous attempts were made to clone DNMT3A R882H mutation into p3XFLAG-myc-CMV-26 to allow transfection and in vitro assessment of the mutant in myeloid cells but all attempts to ligate the plasmid failed and therefore work on DNMT3A was discontinued. EZH2 (R690C/R69H) and Flag tagged wild type EZH2 were constructed in p3XFLAG- myc-CMV-26 vector using a PCR based cloning strategy and transfected into K562 cells. Western blot analysis at 72 hr post transfection, showed elevated levels of both 4 R690C/R690H mutants and Flag tagged wild type EZH2 but no alterations in its target H3K27me3 levels. Affymetrix Human Transcriptome 2.0 gene expression profiling was used to identify modulation of gene signature as result of elevated EZH2 levels and MLLT10 gene was found to be up regulated in cells transfected with Flag-tagged wild type EZH2 (2.3 fold) as well as R690C/ R690H (3.6 – 4.6 fold) mutants. In contrast, PML (promyelocytic leukaemia) (2.16 fold) and FANCL (Fanconi Anaemia, Complementation Group L) (2.18 fold) genes were up regulated exclusively in cells over expressing the Flag tagged wild type EZH2. To compare this gene signature to gene expression changes as a result of EZH2 knock out (KO), shRNA mediated inhibition of EZH2 was carried out in myeloid cells and 95 % KO of both EZH2 and H3K27me3 levels were observed at Day 7 post transduction. Microarray gene expression profiling identified BCL2 (-2.14 fold), FLT1 (-4.03 fold), HOXA10 (-2.2 fold), CD44 (-8.2 fold), CD83 (-2.1 fold), TLSP (-3.24 fold), IFI16 (-3.11 fold) and PAG1 (-3.37 fold) inhibition in cells transduced with shRNA against EZH2 compared to the scrambled and wild type K562 cells. There were no overlapping genes in K562 cells with EZH2 KO and EZH2 mutants R690C/R690H. The differences in expression profiling could be due to the difference in H3K27me3 levels modulated by EZH2. Comparison of gene signature obtained by EZH2 KO on patient samples carrying the R690H mutation, showed contrasting results i.e. up regulation of HOXA10, FLT1, PAG1B, EZH1 and TLSP compared to patients with wild type EZH2 suggesting that EZH2 R690C/R690H mutants do not mimic the transcriptional changes seen in EZH2 KO. This strongly suggests the presence of other mechanisms to compensate for the loss of EZH2 in myeloid cells. However the results obtained here should be examined in additional other myeloid cell lines to validate the findings
Load more

Recommended publications
  • Genomics of Inherited Bone Marrow Failure and Myelodysplasia Michael
    Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2015 Reading Committee: Mary-Claire King, Chair Akiko Shimamura Marshall Horwitz Program Authorized to Offer Degree: Molecular and Cellular Biology 1 ©Copyright 2015 Michael Yu Zhang 2 University of Washington ABSTRACT Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang Chair of the Supervisory Committee: Professor Mary-Claire King Department of Medicine (Medical Genetics) and Genome Sciences Bone marrow failure and myelodysplastic syndromes (BMF/MDS) are disorders of impaired blood cell production with increased leukemia risk. BMF/MDS may be acquired or inherited, a distinction critical for treatment selection. Currently, diagnosis of these inherited syndromes is based on clinical history, family history, and laboratory studies, which directs the ordering of genetic tests on a gene-by-gene basis. However, despite extensive clinical workup and serial genetic testing, many cases remain unexplained. We sought to define the genetic etiology and pathophysiology of unclassified bone marrow failure and myelodysplastic syndromes. First, to determine the extent to which patients remained undiagnosed due to atypical or cryptic presentations of known inherited BMF/MDS, we developed a massively-parallel, next- generation DNA sequencing assay to simultaneously screen for mutations in 85 BMF/MDS genes. Querying 71 pediatric and adult patients with unclassified BMF/MDS using this assay revealed 8 (11%) patients with constitutional, pathogenic mutations in GATA2 , RUNX1 , DKC1 , or LIG4 . All eight patients lacked classic features or laboratory findings for their syndromes.
    [Show full text]
  • Noncoding Rnas As Novel Pancreatic Cancer Targets
    NONCODING RNAS AS NOVEL PANCREATIC CANCER TARGETS by Amy Makler A Thesis Submitted to the Faculty of The Charles E. Schmidt College of Science In Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, FL August 2018 Copyright 2018 by Amy Makler ii ACKNOWLEDGEMENTS I would first like to thank Dr. Narayanan for his continuous support, constant encouragement, and his gentle, but sometimes critical, guidance throughout the past two years of my master’s education. His faith in my abilities and his belief in my future success ensured I continue down this path of research. Working in Dr. Narayanan’s lab has truly been an unforgettable experience as well as a critical step in my future endeavors. I would also like to extend my gratitude to my committee members, Dr. Binninger and Dr. Jia, for their support and suggestions regarding my thesis. Their recommendations added a fresh perspective that enriched our initial hypothesis. They have been indispensable as members of my committee, and I thank them for their contributions. My parents have been integral to my successes in life and their support throughout my education has been crucial. They taught me to push through difficulties and encouraged me to pursue my interests. Thank you, mom and dad! I would like to thank my boyfriend, Joshua Disatham, for his assistance in ensuring my writing maintained a logical progression and flow as well as his unwavering support. He was my rock when the stress grew unbearable and his encouraging words kept me pushing along.
    [Show full text]
  • Somatic Mutations and Progressive Monosomy Modify SAMD9-Related Phenotypes in Humans
    Downloaded from http://www.jci.org on June 26, 2017. https://doi.org/10.1172/JCI91913 RESEARCH ARTICLE The Journal of Clinical Investigation Somatic mutations and progressive monosomy modify SAMD9-related phenotypes in humans Federica Buonocore,1 Peter Kühnen,2 Jenifer P. Suntharalingham,1 Ignacio Del Valle,1 Martin Digweed,3 Harald Stachelscheid,4 Noushafarin Khajavi,2 Mohammed Didi,5 Angela F. Brady,6 Oliver Blankenstein,2 Annie M. Procter,7 Paul Dimitri,8 Jerry K.H. Wales,9 Paolo Ghirri,10 Dieter Knöbl,11 Brigitte Strahm,12 Miriam Erlacher,12,13 Marcin W. Wlodarski,12,13 Wei Chen,14 George K. Kokai,15 Glenn Anderson,16 Deborah Morrogh,17 Dale A. Moulding,18 Shane A. McKee,19 Charlotte M. Niemeyer,12,13 Annette Grüters,2 and John C. Achermann1 1Genetics and Genomic Medicine, University College London (UCL) Great Ormond Street Institute of Child Health, London, United Kingdom. 2Institute of Experimental Pediatric Endocrinology and Department of Pediatric Endocrinology, Charité, Berlin, Germany. 3Department of Human and Medical Genetics, Charité, Berlin, Germany. 4Berlin Institute of Health, Berlin, Germany, and Berlin-Brandenburg Centrum for Regenerative Therapies, Charité, Berlin, Germany. 5Department of Paediatric Endocrinology, Alder Hey Children’s NHS Foundation Trust, Liverpool, United Kingdom. 6North West Thames Regional Genetics Service, Northwick Park Hospital, Harrow, United Kingdom. 7Institute of Medical Genetics, University Hospital of Wales, Cardiff, United Kingdom. 8Academic Unit of Child Health, University of Sheffield, Sheffield, United Kingdom. 9Department of Endocrinology, Children’s Health Queensland Clinical Unit, University of Queensland, Brisbane, Australia. 10Department of Neonatology, University of Pisa, Pisa, Italy. 11Pediatric Endocrinology, Karlsruhe, Germany.
    [Show full text]
  • Of Small Intestine Harboring Driver Gene Mutations: a Case Report and a Literature Review
    1161 Case Report A rare multiple primary sarcomatoid carcinoma (SCA) of small intestine harboring driver gene mutations: a case report and a literature review Zhu Zhu1#, Xinyi Liu2#, Wenliang Li1, Zhengqi Wen1, Xiang Ji1, Ruize Zhou1, Xiaoyu Tuo3, Yaru Chen2, Xian Gong2, Guifeng Liu2, Yanqing Zhou2, Shifu Chen2, Lele Song2#^, Jian Huang1 1Department of Oncology, First Affiliated Hospital of Kunming Medical University, Kunming, China; 2HaploX Biotechnology, Shenzhen, China; 3Department of Pathology, First Affiliated Hospital of Kunming Medical University, Kunming, China #These authors contributed equally to this work. Correspondence to: Jian Huang. Department of Oncology, First Affiliated Hospital of Kunming Medical University, No. 295, Xichang Road, Kunming 560032, Yunnan Province, China. Email: [email protected]; Lele Song. HaploX Biotechnology, 8th floor, Auto Electric Power Building, Songpingshan Road, Nanshan District, Shenzhen 518057, Guangdong Province, China. Email: [email protected]. Abstract: Primary sarcomatoid carcinoma (SCA) is a type of rare tumor consisting of both malignant epithelial and mesenchymal components. Only 32 cases of SCA of the small bowel have been reported in the literature to date. Due to its rarity and complexity, this cancer has not been genetically studied and its diagnosis and treatment remain difficult. Here we report a 54-year-old male underwent emergency surgical resection in the small intestine due to severe obstruction and was diagnosed with multiple SCA based on postoperative pathological examination. Over 100 polypoid tumors scattered along his whole jejunum and proximal ileum. Chemotherapy (IFO+Epirubicin) was performed after surgery while the patient died two months after the surgery due to severe malnutrition. Whole-exome sequencing was performed for the tumor tissue with normal tissue as the control.
    [Show full text]
  • Somatic Mutations and Progressive Monosomy Modify SAMD9-Related Phenotypes in Humans
    Downloaded from http://www.jci.org on June 5, 2017. https://doi.org/10.1172/JCI91913 RESEARCH ARTICLE The Journal of Clinical Investigation Somatic mutations and progressive monosomy modify SAMD9-related phenotypes in humans Federica Buonocore,1 Peter Kühnen,2 Jenifer P. Suntharalingham,1 Ignacio Del Valle,1 Martin Digweed,3 Harald Stachelscheid,4 Noushafarin Khajavi,2 Mohammed Didi,5 Angela F. Brady,6 Oliver Blankenstein,2 Annie M. Procter,7 Paul Dimitri,8 Jerry K.H. Wales,9 Paolo Ghirri,10 Dieter Knöbl,11 Brigitte Strahm,12 Miriam Erlacher,12,13 Marcin W. Wlodarski,12,13 Wei Chen,14 George K. Kokai,15 Glenn Anderson,16 Deborah Morrogh,17 Dale A. Moulding,18 Shane A. McKee,19 Charlotte M. Niemeyer,12,13 Annette Grüters,2 and John C. Achermann1 1Genetics and Genomic Medicine, University College London (UCL) Great Ormond Street Institute of Child Health, London, United Kingdom. 2Institute of Experimental Pediatric Endocrinology and Department of Pediatric Endocrinology, Charité, Berlin, Germany. 3Department of Human and Medical Genetics, Charité, Berlin, Germany. 4Berlin Institute of Health, Berlin, Germany, and Berlin-Brandenburg Centrum for Regenerative Therapies, Charité, Berlin, Germany. 5Department of Paediatric Endocrinology, Alder Hey Children’s NHS Foundation Trust, Liverpool, United Kingdom. 6North West Thames Regional Genetics Service, Northwick Park Hospital, Harrow, United Kingdom. 7Institute of Medical Genetics, University Hospital of Wales, Cardiff, United Kingdom. 8Academic Unit of Child Health, University of Sheffield, Sheffield, United Kingdom. 9Department of Endocrinology, Children’s Health Queensland Clinical Unit, University of Queensland, Brisbane, Australia. 10Department of Neonatology, University of Pisa, Pisa, Italy. 11Pediatric Endocrinology, Karlsruhe, Germany.
    [Show full text]
  • Genome-Wide Association Study for Feed Efficiency and Growth Traits in U.S. Beef Cattle Christopher M
    Seabury et al. BMC Genomics (2017) 18:386 DOI 10.1186/s12864-017-3754-y RESEARCH ARTICLE Open Access Genome-wide association study for feed efficiency and growth traits in U.S. beef cattle Christopher M. Seabury1*, David L. Oldeschulte1, Mahdi Saatchi2, Jonathan E. Beever3, Jared E. Decker4,5, Yvette A. Halley1, Eric K. Bhattarai1, Maral Molaei1, Harvey C. Freetly6, Stephanie L. Hansen2, Helen Yampara-Iquise4, Kristen A. Johnson7, Monty S. Kerley4, JaeWoo Kim4, Daniel D. Loy2, Elisa Marques8, Holly L. Neibergs7, Robert D. Schnabel4,5, Daniel W. Shike3, Matthew L. Spangler9, Robert L. Weaber10, Dorian J. Garrick2,11 and Jeremy F. Taylor4* Abstract Background: Single nucleotide polymorphism (SNP) arrays for domestic cattle have catalyzed the identification of genetic markers associated with complex traits for inclusion in modern breeding and selection programs. Using actual and imputed Illumina 778K genotypes for 3887 U.S. beef cattle from 3 populations (Angus, Hereford, SimAngus), we performed genome-wide association analyses for feed efficiency and growth traits including average daily gain (ADG), dry matter intake (DMI), mid-test metabolic weight (MMWT), and residual feed intake (RFI), with marker-based heritability estimates produced for all traits and populations. Results: Moderate and/or large-effect QTL were detected for all traits in all populations, as jointly defined by the estimated proportion of variance explained (PVE) by marker effects (PVE ≥ 1.0%) and a nominal P-value threshold (P ≤ 5e-05). Lead SNPs with PVE ≥ 2.0% were considered putative evidence of large-effect QTL (n = 52), whereas those with PVE ≥ 1.0% but < 2.0% were considered putative evidence for moderate-effect QTL (n = 35).
    [Show full text]
  • Bioinformatics Mining of the Dark Matter Proteome For
    BIOINFORMATICS MINING OF THE DARK MATTER PROTEOME FOR CANCER TARGETS DISCOVERY by Ana Paula Delgado A Thesis Submitted to the Faculty of The Charles E. Schmidt College of Science In Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, Florida May 2015 Copyright 2015 by Ana Paula Delgado ii ACKNOWLEDGEMENTS I would first like to thank Dr. Narayanan for his continuous encouragement, guidance, and support during the past two years of my graduate education. It has truly been an unforgettable experience working in his laboratory. I also want to express gratitude to my external advisor Professor Van de Ven from the University of Leuven, Belgium for his constant involvement and assistance on my project. Moreover, I would like to thank Dr. Binninger and Dr. Dawson-Scully for their advice and for agreeing to serve on my thesis committee. I also thank provost Dr. Perry for his involvement in my project. I thank Jeanine Narayanan for editorial assistance with the publications and with this dissertation. It has been a pleasure working with various undergraduate students some of whom became lab mates including Pamela Brandao, Maria Julia Chapado and Sheilin Hamid. I thank them for their expert help in the projects we were involved in. Lastly, I want to express my profound thanks to my parents and brother for their unconditional love, support and guidance over the last couple of years. They were my rock when I was in doubt and never let me give up. I would also like to thank my boyfriend Spencer Daniel and best friends for being part of an incredible support system.
    [Show full text]
  • Early Mechanisms of Retinal Degeneration in the Harlequin Mouse
    Western University Scholarship@Western Electronic Thesis and Dissertation Repository 7-17-2014 12:00 AM Early Mechanisms of Retinal Degeneration in the harlequin Mouse Eric Dolinar The University of Western Ontario Supervisor Dr. Kathleen Hill The University of Western Ontario Graduate Program in Biology A thesis submitted in partial fulfillment of the equirr ements for the degree in Master of Science © Eric Dolinar 2014 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Biology Commons, Genetics Commons, and the Molecular Genetics Commons Recommended Citation Dolinar, Eric, "Early Mechanisms of Retinal Degeneration in the harlequin Mouse" (2014). Electronic Thesis and Dissertation Repository. 2156. https://ir.lib.uwo.ca/etd/2156 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. i Early Mechanisms of Retinal Degeneration in the harlequin Mouse (Thesis Format: Monograph) by Eric A Dolinar Graduate Program in Biology A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science The School of Graduate and Postdoctoral Studies The University of Western Ontario, London, Ontario, Canada © Eric A Dolinar 2014 i ii Abstract Retinal diseases are personally debilitating and expensive, yet many early disease mechanisms leading to their onset and progression remain poorly understood. The harlequin mouse is a model of human mitochondrial dysfunction and parainflammation leading to subsequent cerebellar and retinal degeneration. Diagnosis of retinal degeneration can be tracked in vivo and is associated with AIF dysfunction.
    [Show full text]
  • Supplementary Data
    Gene expression profile of the A549 human non-small cell lung carcinoma cell line following treatment with the seeds of Descurainia sophia, a potential anticancer drug Bu-Yeo Kim, Jun Lee, Sung Joon Park, Ok-Sun Bang, and No Soo Kim Supplementary Data Figure Legends Supplementary Figure 1. Electropherogram of total RNA samples used for gene expression profiles. The A549 cells were treated with increasing concentrations of EEDS (0-20 mg/mL). After 24 h drug treatment, total RNAs were extracted from the cells, and their integrities were determined by electropherogram. RIN values range from 10 (intact) to 1(totally degraded). Supplementary Figure 2. Pathways enriched (FDR<0.01) in the Up- and Down-patterns. The genes that are shown in Table 5 and Figure 4, and involved in each pathway are highlighted in green Supplementary Figure 3. The level of similarity is represented in red with a scale bar. The color in the box of a diagonal line or “Activity” on the right panel represents the activity of the pathway. The positions and names of signaling-related pathways are colored red and the metabolism-related pathways are colored blue. Supplementary Table 1. Quality control of total RNA samples used for gene expression analysis. * EEDS (mg/mL) OD260/280 OD260/230 Ratio (28s/18s) RIN Result 0 2.04 2.22 2.3 9.8 Pass 1.25 2.03 2.28 2.2 10.0 Pass 5 2.03 2.28 2.1 10.0 Pass 20 2.04 2.23 2.0 10.0 Pass *RIN values, 10 (intact) to 1 (completely degraded).
    [Show full text]
  • Deciphering Common and Rare Genetic E Ects on Reading Ability
    Deciphering common and rare genetic eects on reading ability © 2016, Amaia Carrion´ Castillo ISBN: 978-90-76203-78-2 Printed and bound by Ipskamp Drukkers Deciphering common and rare genetic eects on reading ability Proefschri ter verkrijging van de graad van doctor aan de Radboud Universiteit Nijmegen op gezag van de rector magnicus prof. dr. J.H.J.M. van Krieken, volgens besluit van het college van decanen in het openbaar te verdedigen op maandag 7 november 2016 om 12.30 uur precies door Amaia Carrion´ Castillo geboren op 22 november 1988 te Donostia (Spanje) Promotor Prof. dr. Simon E. Fisher Copromotor Dr. Clyde Francks (MPI) Manuscriptcommissie Prof. dr. Anneke I. den Hollander Prof. dr. Juha Kere (Karolinska Institutet, Zweden) Prof. dr. Gerd Schulte-Korne¨ (Ludwig-Maximilians-University Munich, Duitsland) Deciphering common and rare genetic eects on reading ability Doctoral esis to obtain the degree of doctor from Radboud University Nijmegen on the authority of the Rector Magnicus prof. dr. J.H.J.M. van Krieken, according to the decision of the Council of Deans to be defended in public on Monday, November 7, 2016 at 12.30 hours by Amaia Carrion´ Castillo Born on 22 November 1988 in Donostia (Spain) Supervisor Prof. dr. Simon E. Fisher Co-supervisor Dr. Clyde Francks (MPI) Doctoral esis Committee Prof. dr. Anneke I. den Hollander Prof. dr. Juha Kere (Karolinska Institutet, Sweden) Prof. dr. Gerd Schulte-Korne¨ (Ludwig-Maximilians-University Munich, Germany) Etxekoei CONTENTS 1 General introduction 11 1.1 e learning-to-read brain ........................ 11 1.2 Variation in reading ability........................ 13 1.3 Complex and multifactorial aetiology.................
    [Show full text]
  • Supplementary Table 1. Expression
    Supplementary Table 1. Expression (Mean Standard Deviation of the log2 average expression or transcript detection) of Sus scrofa specific miRNAs detected by the GeneChip™ miRNA 4.0 Array (ThermoFisher Scientific) in spermatozoa retrieved from the SRF of the ejaculate of healthy mature boars (n=3). The miRNA is designed to interrogate all mature miRNA sequences in miRBase v20. The array includes 30.424 mature miRNA (all organisms) and we select specifically the 326 Sus scrofa- specific miRNAs included in the array. Expression Mean ± Standard Deviation Sequence Transcript ID (log2) Accession Length Sequence ssc-miR-1285 13.98 ± 0.13 MIMAT0013954 24 CUGGGCAACAUAGCGAGACCCCGU ssc-miR-16 12.6 ± 0.74 MIMAT0007754 22 UAGCAGCACGUAAAUAUUGGCG ssc-miR-4332 12.32 ± 0.29 MIMAT0017962 20 CACGGCCGCCGCCGGGCGCC ssc-miR-92a 12.06 ± 0.09 MIMAT0013908 22 UAUUGCACUUGUCCCGGCCUGU ssc-miR-671-5p 11.73 ± 0.54 MIMAT0025381 24 AGGAAGCCCUGGAGGGGCUGGAGG ssc-miR-4334-5p 11.31 ± 0.05 MIMAT0017966 19 CCCUGGAGUGACGGGGGUG ssc-miR-425-5p 10.99 ± 0.15 MIMAT0013917 23 AAUGACACGAUCACUCCCGUUGA ssc-miR-191 10.57 ± 0.22 MIMAT0013876 23 CAACGGAAUCCCAAAAGCAGCUG ssc-miR-92b-5p 10.53 ± 0.18 MIMAT0017377 24 AGGGACGGGACGCGGUGCAGUGUU ssc-miR-15b 10.01 ± 0.9 MIMAT0002125 22 UAGCAGCACAUCAUGGUUUACA ssc-miR-30d 9.89 ± 0.36 MIMAT0013871 24 UGUAAACAUCCCCGACUGGAAGCU ssc-miR-26a 9.62 ± 0.47 MIMAT0002135 22 UUCAAGUAAUCCAGGAUAGGCU ssc-miR-484 9.55 ± 0.14 MIMAT0017974 20 CCCAGGGGGCGACCCAGGCU ssc-miR-103 9.53 ± 0.22 MIMAT0002154 23 AGCAGCAUUGUACAGGGCUAUGA ssc-miR-296-3p 9.41 ± 0.26 MIMAT0022958
    [Show full text]
  • Position Effect on FGF13 Associated with X-Linked Congenital Generalized Hypertrichosis
    Position effect on FGF13 associated with X-linked congenital generalized hypertrichosis Gina M. DeStefanoa, Katherine A. Fantauzzoa,b, Lynn Petukhovab,c, Mazen Kurbanb, Marija Tadin-Strappsa, Brynn Levyd, Dorothy Warburtona,e, Elizabeth T. Cirullif, Yujun Hanf, Xiaoyun Sung, Yufeng Sheng, Maryam Shirazid, Vaidehi Jobanputrad, Rodrigo Cepeda-Valdesh, Julio Cesar Salas-Alanish,i, and Angela M. Christianoa,b,1 Departments of aGenetics and Development, bDermatology, cEpidemiology, and dPathology and Cell Biology, Columbia University, New York, NY; eDepartment of Pediatrics, Columbia University Medical Center, New York, NY 10032; fCenter for Human Genome Variation, Duke University School of Medicine, Durham, NC 27708; gDepartment of Biomedical Informatics, Columbia Initiative in Systems Biology, Columbia University, New York, NY 10032; hDystrophic Epidermolysis Bullosa Research Association (DebRA), Nuevo Leon 67150, Mexico; and iBasic Science, Universidad de Monterrey, Nueva Leon 63238, Mexico Edited by Elaine Fuchs, The Rockefeller University, New York, NY, and approved March 12, 2013 (received for review October 17, 2012) X-linked congenital generalized hypertrichosis (Online Mendelian providing evidence to support a position effect as the un- Inheritance in Man 307150) is an extremely rare condition of hair derlying genetic basis of X-linked hypertrichosis. overgrowth on different body sites. We previously reported link- age in a large Mexican family with X-linked congenital generalized Results and Discussion hypertrichosis cosegregating with deafness and with dental and We ascertained a large kindred from Mexico with X-linked CGH (Online Mendelian Inheritance in Man 307150) cosegregating palate anomalies to Xq24-27. Using SNP oligonucleotide microar- – ray analysis and whole-genome sequencing, we identified a 389- with deafness and with dental and palate anomalies (Fig.
    [Show full text]