Proc. Nati. Acad. Sci. USA Vol. 82, pp. 8577-8581, December 1985 Genetics Sequence-directed mutagenesis: Evidence from a phylogenetic history of human a-interferon genes (spontaneous mutatlon/multigene families/evolution) G. BRIAN GOLDING AND BARRY W. GLICKMAN Department of Biology, York University, Toronto, ON M3J 1P3, Canada Communicated by Lynn Margulis, August 12, 1985

ABSTRACT We have studied the potential contribution of the data ofOkada et al. (7) and Pribnow et al. (8) who showed template-dependent events to genetic variation in mammals by that frameshift hotspots in bacteriophage T4 occur in se- examining the sequence alterations that have occurred in the quences ofthe same nucleotide. Similarly, sequencing oflacI recent evolution of human interferon genes. Fifteen members frameshift hotspot mutants confirmed a role for repeated of the human a-interferon gene family were aligned, and a sequences (9). This model for frameshift mutation was later phylogenetic history was inferred. Many multiple events are extended (e.g., ref. 10) to include deletion and insertion inferred to have occurred in the evolution of the interferon events. genes and for the majority of these local DNA sequences were Work with prokaryotes has provided additional examples present that were capable of serving as templates for their of mutations involving repeated sequences. These studies, occurrence. We conclude that the DNA sequence has the however, suggest not only a role for direct repeats in potential to explain many of the inferred spontaneous events template-directed mutation but also inverted repeats-i.e., and to explain complex alterations to sequences-i.e., thejoint palindromic sequences. For example, deletions lacking re- occurrence of base substitutions and insertions/deletions. peated sequences at their endpoints can often be explained on Thus, such a mechanism would often cause multiple sequence the basis of structural intermediates in which misalignments changes as a result of a single mutational event and would involving intrastrand mispairing are mediated by inverted provide additional genetic variation for evolution. Sequence- repeats (11, 12). Frameshifts and base substitutions can also directed mutations would depend upon the local DNA se- arise as a consequence of the processing of similar interme- quences and, hence, would not be random at the DNA level. diates (11, 13, 14). Mechanisms involving misaligned structural intermediates Inherent in the reproduction of all organisms is the potential have two major consequences. Mutations produced by this for mutation. Such errors, though rare, provide the ultimate mechanism are not random. Rather, they are specified by driving force behind evolution. It is through the genetic nearby DNA sequences. Such sequence-directed events variation provided by mutation that natural selection and reflect features ofboth the template sequence and local DNA random drift can alter the genetic composition ofpopulations. structure. Secondly, misalignment-mediated mutagenesis The rate of mutation has been estimated to be on the order of predicts the occurrence of complex mixtures of base substi- 10-8-10-10 errors per base pair (bp) copied in a wide range of tutions, deletions, and insertions as the result of a single organisms (1). This high level of fidelity is astonishing event. considering the properties ofthe DNA bases, the complexity This paper describes an effort to extend these studies on of the processes of DNA replication and repair, and the the role of sequence-directed events by examining their environmental threats to the integrity of the DNA. possible contribution to genetic variation in mammals. Such The number ofpotential DNA sequence changes as well as a study requires a source of large numbers of spontaneous the mechanisms behind them are extensive, but they all mutations. The human leukocyte interferon genes form a provide opportunity for genetic variation. The relative con- large and closely related multigene family. Analysis of the tribution of each kind of mutational event to spontaneous sequences of 15 interferon genes reveals that a substantial mutation is not known. Such information is particularly proportion of their sequence divergence in man can be sparse in mammals, but an analysis of 176 spontaneous lacI explained as a consequence of sequence-directed events. mutations isolated by Schaaper et al. (2) reveals that only DNA misalignments mediated by both repeated and 11% were base substitutions and just 4% involved insertion palindromic sequences are inferred. elements. The majority ofevents were frameshifts, deletions, and duplications. Similarly, within the flanking and intron Divergence in the Human Interferon Gene Family sequences of globin it has been suggested that deletion/ The DNA sequences for 15 different members of the human insertion events and "block mutations" are prevalent com- leukocyte interferon family were collected from the National pared to single-base substitutions (3, 4). Biomedical Research Foundation (NBRF) Computer Mechanisms proposed to account for frameshift, deletion, Database* (15-21). Because interferon exists as a multi-gene and insertion events are diverse, but they share a common- family, gene conversion events can correct the sequence of ality such that in the proposed mutational intermediates the one gene against the sequence of another. This preserves bases are correctly paired in the Watson and Crick (5) sense strong sequence homology between members of the gene but are misaligned because they are out ofregister. Misalign- family (22). Weissmann et al. (23) estimate that the two most ment mutational intermediates were first proposed by dissimilar members have a divergence of 11.7% (corrected to Streisinger et al. (6) to explain frameshift mutations at sites account for of repetitive sequences. This model was later supported by multiple mutations and replacement sites). After Abbreviation: bp, base pair(s). The publication costs of this article were defrayed in part by page charge *National Institutes of Health (1983) Genetic Sequence Databank: payment. This article must therefore be hereby marked "advertisement" Genbank (Research Systems Div., Bolt, Beranek, and Newman in accordance with 18 U.S.C. §1734 solely to indicate this fact. Inc., Boston), Tape Release 15.0. 8577 Downloaded by guest on September 24, 2021 8578 Genetics: Golding and Glickman Proc. Natl. Acad Sci. USA 82 (1985) their most recent conversion or duplication event these genes ations were inferred of which more than 300 were examined diverged by mutational alterations. Miyata and Hayashida for nearby repeats. (24) estimate that this has occurred within the last 26-million years. The functional significance of these sequence changes Multiple Concurrent Mutation is not known and many of the changes may be selectively neutral. But the fact that the interferon gene family has neither Multiple concurrent mutational events are one ofthe expect- significantly expanded nor contracted during primate diver- ed consequences of sequence-directed mutagenesis. Within gence (25) coupled with the demonstrated antiviral activity of the coding sequence of the interferon genes there were two interferon and with the different cell specificities of different sets of three adjacent substitutional events and one of four interferon genes (23) suggests that at least some of the changes adjacent substitutions along with a large number of pairs of affect the functional properties of these proteins. adjacent substitutions. A simulation was conducted by ran- The sequences were aligned using the resident alignment domly scattering the same number of substitutions, at the program of the NBRF. Gaps between any two sequences same densities and over the same length of DNA as observed were given twice the weight of base substitutions. Because for each gene sequence. This was repeated 1000 times, and it the sequences are so similar, the alignments are particularly was found that three occurrences of more than two adjacent reliable. To establish the mutational events during the history substitutions is statistically significant (P < 0.032). Thus, there ofthe interferon genes, a phylogenetic tree was created using is excessive clustering of substitutions within these genes. a maximum parsimony method of Felsenstein (26). Such a Because the salient feature of sequence-directed mutation- tree allows the most likely sequence for each ancestor to be al events is its potential to explain these concurrent, closely inferred (27), again utilizing a maximum parsimony algo- linked multiple changes, our initial examination of the se- rithm. Although more than one phylogenetic history is quence differences between the various interferon genes possible, the sequences are sufficiently similar that small concentrated on such occurrences. We selected only those differences in their inferred history will not strongly affect the sites where two or more sequence changes occurred either most likely ancestral sequences. A phylogenetic history for adjacent to one another or separated by no more than 2 bp. these sequences is shown in Fig. 1. The sequence for a8/aH Multiple events involving deletions or insertions are not appears to have undergone a recent conversion event ex- included in Table 1. A total of 114 examples from within the tending part way into the gene (25). The general features of genes and flanking the genes were identified, and the local both trees are very similar on each side. Each of the 15 DNA region was searched for direct and inverted repeats different sequences was analyzed, and 738-sequence alter- capable of directing the sequence changes. We limited our initial investigation to sequences lying within 100 bp of the altered site. Repeats were viewed as possible templates when they contained at least 3 continuous bases if directly adja- cent, at least 4 bases if located within 20 bases and at least 5 continuous bases iffurther away. Even limiting the search to within 100 bp of the substitution, numerous sequences that were capable ofdirecting a substantial fraction ofthe mutants were revealed (Table 1). Often, more than one repeat could have potentially directed a mutation. We note that the percentage of events for which potential DNA templates are available increases with the complexity of the mutational event. The limit of 100 bp is probably too stringent since direct repeats separated by several hundred bp can result in misalignment deletions in Escherichia coli (29). Similar Al SD e2 dNtA ge6d7 AeTds d8 dH d9 d5 Td3 d4 misalignments separated by thousands of bp are responsible for gene fusions (28). Many of the multiple mutations identified in the interferon family could be accounted for by misaligned intermediates. 3 Side of the gene / Six examples that demonstrate the richness of the DNA sequence in its ability to direct mutational events are de- scribed below. The first three examples involve inverted repeats (see Figs. 2-4) while the latter three involve direct repeats. We stress that these examples are typical of the kinds of structures that can be identified to account for the multiple alterations described in Table 1. In addition, the intermediates proposed for the six cases described below are not necessarily the only misalignments capable of mediating their occurrence. In all cases the most recent ancestors for the extant sequences were reconstructed by using the tree in 5 a4 d 1 dD d2 ocN xA d7 To s d6 d10lOH d8 d9 d to3 Fig. 1 (26) and the maximum parsimony method (27). FIG. 1. A maximum parsimony tree for the human leukocyte Case 1. An in-frame deletion of three nucleotides is seen in interferon genes constructed via the PHYLIP program of Felsenstein the sequence of interferon a2 (NBRF notation) that is not (26). From sequence analysis there appears to have been a recent present in any of the other interferon genes. There is no conversion extending into the 3' edge ofthe gene and hence each side adjacent direct repeat available that could create this deletion of the genes have had different histories. The conversion endpoint by a slippage type event of the kind proposed by Streisinger was chosen to lie 107 bp to the 3' side of the stop codon in order to et al. (6). However, this small deletion could have been maximize the number of nucleotide sites that give the correct directed by a palindromic sequence in the manner proposed topology. The nomenclature follows that of the National Biomedical The deleted Research Foundation Computer Database* with aD, aN, aA and aH by Ripley (13) and Glickman and Ripley (12). an 5 located 9 from chosen as names for the variants listed therein. Branch lengths do not triplet is part of inverted repeat of bp bp reflect the number of substitutions and are only a reflection of the the mutational site. This palindromic sequence permits the relative branching order. formation of a secondary structure (Fig. 2) from which the Downloaded by guest on September 24, 2021 Genetics: Golding and Glickman Proc. Natl. Acad. Sci. USA 82 (1985) 8579 Table 1. Percent of multiple mutations potentially directed by direct repeats or inverted repeats Template directed, % Total Direct Inverted Both Template Mutation repeat repeat repeats directed, %* Number Two substitutions separated by 1 bp 26 26 4 56 27 Two substitutions separated by 2 bp 28 12 36 76 25 Two adjacent substitutions 24 13 54 91 54 Three adjacent substitutions 14 43 29 86 7 Four adjacent substitutions 100 0 0 100 1 The sequences were examined for repeats or palindromes that have the potential to act as a template for the inferred sequence alterations for 100 bp either side of the mutants. *The fraction of mutations accounted for can be altered by changing the window used in the search for repeats. When a more extensive area is examined a larger proportion of sequence alterations can be accounted for.

deleted triplet is excluded. The altered DNA sequence has sion. A similar conversion-like event has been suggested for lost these three base pairs resulting in the perfection of the the FC47 frameshift mutation recovered spontaneously in the inverted repeat. Several metabolic processes capable of T4 rIIB gene though, in this case, the 16-base repeat thought producing these template-directed changes have been sug- to mediate the mutation is 256 bp downstream from the gested and have been discussed in detail elsewhere (11-14). mutated site (8, 11). Case 2. The sequence of pseudogene Tas differs from the Case 5. As indicated in Table 1, many of the sequence sequence to which it is most closely related by the loss of a changes could have been directed by either an inverted or a single cytosine at nucleotide 186 and the insertion of an direct repeat. The deletion of the three bases (Fig. 2) in a2 is adenosine and thymidine. Such complex sequence changes one such case. Although no direct repeats border the altered are precisely the product predicted from sequence-directed sequence, direct repeats that span 5 bases (or alternatively 10 events. Only 9 nucleotides away, an inverted repeat is bases with 2 mismatches) are located 16 bp to the 5' side of present that includes 6 nucleotides which could have directed the mutant site (11 bp ifanear repeat is considered) (Fig. 6). This the mutational event (Fig. 3). The mutation results in the second repeat is identical to the mutated sequence and, hence, perfection of the stem of this secondary structure. could have directed it in the manner described in Case 4. Case 3. An example of a multiple base change in a flanking Case 6. The flanking sequence 5' ofthe interferon gene alO region is drawn from the sequence of a9. This sequence differs from its most recent ancestor by five closely linked differs from its closest ancestor at nucleotide positions -448 mutational changes. The changes include 2 transitions, 2 and -447 (on the 5' side of the initiation codon) by an AA to transversions, and the insertion of a guanosine and occur GT change. A possible template exists in the form of an within 10 bp (Fig. 7). Traditionally, this complex sequence inverted repeat only 25 bases away (Fig. 4) that includes 9 bp. alteration would be viewed as the result of five independent Again, the mutation perfects the stem of the palindrome. mutational events. However, such multiple mutations are the Case 4. The coding sequence of pseudogene Tas differs hallmark of sequence-directed mechanisms. No inverted from its most recent ancestor at a site 234 bp beyond the repeats capable of directing this complex change were initiation codon. At this site, the triplet CTG was changed to identified within TCC. A search for inverted repeats permitting intrastrand 100 bp ofthe mutations. However, only 7 bp misalignments capable of directing this complex event re- to the 3' side of this site, is a 16-bp direct repeat identical to vealed no obvious candidates. However, the altered se- the mutant sequence. Via this mechanism, a slippage event quence is identical to an adjacent 6-bp direct repeat (Fig. 5). could create a template that would account for all five This sequence has the potential of directing the observed sequence changes as the product ofa single mutational event. mutational event with a structural intermediate involving an interstrand misalignment mediated by the direct repeat. The Discussion proposed structural intermediate is similar to the slippage scheme proposed by Streisinger et al. (6), however, its The strength of the correlations between possible misalign- resolution involves a realignment and further strand exten- ments involving either direct repeats or palindromic se- quences and the mutational outcomes that they predict

,C A, - 210 C A - 210 'G G A 0 -T G -T, A G A G A A A G T C T T C T C T C 190 - T T G=C 190 - T T' T G=C A=T A=T G = C G=C A C=G - 200 T=A C=G - 200 200 - G *T=A T=A T=A c CsTA T=A *A=T T= A C=G 5' AGGAG AGGCT AGGAG AGGCT 3 C=G C=G C=G 5 ' GTTTT CAACC 220 220 GTTTT CAACC 3 ' 180 180s FIG. 2. An inverted repeat which forms a template for the deletion of a GAT codon in the a2-interferon gene. This repeat FIG. 3. An inverted repeat within the 'Pas-interferon gene that includes five nucleotides and is only nine nucleotides upstream ofthe directs a change from C to AT. This inverted repeat potentially observed deletion. The deletion perfects the structure of the palin- directs a complex mutational event. It explains the deletion of a C drome. Bases are numbered from the ATG start codon and include and the insertion ofAT as the result of a single mutational event that all positions of insertion or deletion. perfects a 6-base palindrome only 9 bases upstream. Downloaded by guest on September 24, 2021 8580 Genetics: Golding and Glickman Proc. Natl. Acad. Sci. USA 8241985)

.l9bp .19bp A 5' 3' * * * * --** ** ***_ _** A T A T C s T C T GACATGACTTTGGATTTCCCCAGGAGGAGTTTGATGGCAA -440 -G A -440 - G A T=A T-A 170 180 190 200 A=T A=T A=T A=T A=T - -410 APT - -410 B T=A, TEA 5' 3' A A => *T=A * ** ***** * ** ***** A C *G=C GACATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAA 'A=T' A=T -450 - A-T -450 - A=T 5 ' AAGTT TTCTG AAGTT TTCTG 3 ' 170 180 190 -400 -400 FIG. 6. The deletion of a GAT codon in the a2 gene potentially mediated by a nearby direct repeat. Located on the 5' side of the FIG. 4. An inverted repeat which directs a double mutation deleted codon, is a direct repeat which includes 5 adjacent bp or an within the c9-flanking sequence. This repeat is 25 nucleotides dis- imperfect repeat which includes 8 of 10 bp (outlined with asterisks). tant, includes 9 nucleotides and mediates an AA to GT change. The original sequence is shown in A, and the sequence after the deletion of the codon is shown in B. suggests that these structures may be important to the organization of the DNA and that such structural intermedi- structurally mediated events such as gene conversion and ates may present a significant challenge to the fidelity ofDNA unequal crossing over are well known. replication. Examinations, of induced and spontaneous mu- The frequency of sequence-directed events, as compared tational events in T4, in the lad gene of E. coli, and in the to mutational events caused by other processes, is not iso-l-cytochrome c gene of yeast (11-13) have indicated the known. Our examination of the potential of sequence- ability of DNA sequences to direct the formation of inter- directed events to direct the inferred multiple-bp substitu- mediates of mutation. Here we demonstrate, with mutations tions suggests that local DNA sequence very often has the inferred from sequence alterations that have occurred in the capacity to mediate their occurrence. This is in part a natural evolution of human interferon genes, that similar mecha- feature of any DNA sequence. Although a large number of nisms may operate in mammalian cells. Data from the globin repeats can be expected with any four letter code, the repeats genes have already been used to illustrate cases offrameshift given here in cases 3, 4, and 6 are statistically significant. For mutation mediated by Streisinger-like slippage intermediates example, the 16-bp direct repeat described in case 6 is larger (5). In this paper, we have extended the possible role of than the largest repeat expected within the -3000 bp exam- misaligned intermediates to include multiple base substitu- ined by more than 5 standard deviations (32). And this tions as well as frameshift mutations. Moreover, these calculation does not make allowance for the fact that this intermediates can be mediated by either direct repeats or repeat includes five specific alterations in sequence. Repeats inverted repeats that need not be adjacent. as extensive and as close to the mutated sites as those found The class of mechanisms described above presents a new in cases 3 and 4 are also significant; they occurred in less than facet to the traditional view that mutations result from DNA 5% of the 400 mutations generated by- simulations. On the polymerase mediated errors via the insertion of incorrect other hand, repeats such as those described in cases 1, 2, and bases. Despite an accurate selection and incorporation of bp 5 are found in greater than 5% of the simulated mutations. by the DNA polymerase, mutations may still occur as the Hence, they cannot be considered statistically significant. result of misalignments during either DNA replication or We stress, however, that a lack of statistical significance repair. Misaligned structural intermediates need to occur concerning the rarity ofthe proposed template sequence does only transiently and hence need not be highly stable struc- not imply a lack ofbiological significance. Indeed, a deletion tures. Moreover, these structures need occur only infre- between any one of4 bp in a direct repeat also lacks statistical quently since mutations themselves are rare events. Indica- significance by this method and yet such repeats would tive of the role of DNA polymerase in the process of commonly be accepted as templates-for frameshifts. is the observation that some Sequence-Directed Mutation and Evolution. The multiple sequence-directed mutagenesis changes predicted by these mechanisms will alter the appar- DNA polymerase mutants of T4 greatly enhance the occur- ent rates of evolution. In the rate at which evolution rence ofsequence-directed events (14) and mutations in DNA general, polymerase I and subunits of DNA polymerase III increase A the frequency of these events in E. coli (30, 31). Other 5' 3'

A TAATTAAATTAA-ATGTCAATAGCTTTTAAACTTAGATTTTAGTT 5' 3' II -450 -440 -430 -420 AGCCATCTCTGTCTTCCATGAG

230 240 B B 5' 3' 5' 3' TAATTAAACTTAGATTTTAATAGCTTTTAAACTTAGATTTTAGTT AGCCATCTTCCTCTTCCATGAG -450 -440 -430 -420 230 240 FIG. 7. A direct repeat capable of directing five changes in the FIG. 5. The substitution of TCC for CTG within an adjacent cr10-flanking sequence. Four base substitutions and one frameshift direct repeat in the W'as gene. This figure shows a 6-bp direct repeat can be explained by a misalignment event involving a 16-bp direct (outlined with asterisks) that could have directed three adjacent bp repeat (outlined with asterisks) located 7 bp to the 3' side. The substitutions (shown with dashes). The ancestral sequence is shown ancestral sequence is shown in A and the descendant (or mutant) in A and the descendant (or mutant) sequence is shown in B. sequence is shown in B. Downloaded by guest on September 24, 2021 Genetics: Golding and Glickman Proc. Natl. Acad. Sci. USA 82 (1985) 8581

occurs is estimated from the number of differences between O., Baralle, F. E., Shoulders, C. C. & Proudfoot, N. J. (1980) two sequences. Multiple changes as the result of a single Cell 21, 653-668. mutational event will artificially inflate these differences. 5. Watson, J. D. & Crick, F. H. C. (1953) Nature (London) 171, This would cause an observer to that the 737-738. suggest sequences 6. Streisinger, G., Okada, Y., Emrich, J., Newton, J., Tsugita, are more divergent than they actually are and, thus, estimat- A., Terzaghi, E. & Inouye, M. (1966) Cold Spring Harbor ed rates of evolution would, in fact, be overestimates. Symp. Quant. Biol. 31, 77-84. Depending on the frequency of multiple, linked changes, 7. Okada, Y., Streisinger, G., Owen, J. E., Newton, J., Tsugita, estimates of divergence times, mutation rates, and the timing A. & Inouye, M. (1972) Nature (London) 236, 338-341. of speciation events could be strongly affected. Multiple 8. Pribnow, D., Sigurdson, D. C., Gold, L., Singer, B. S., events, per se, would not be expected to have a strong Napoli, C., Brosius, J., Dull, T. J. & Noller, H. F. (1981) J. influence on relative measures. This is because, if two Mol. Biol. 149, 337-376. sequences are sufficiently divergent to have accumulated 9. Farabaugh, P. J., Schmeissner, U., Hofer, N. & Miller, J. H. several mutational then their relative will (1978) J. Mol. Biol. 126, 847-863. events, positions 10. Albertini, A. M., Hofer, N., Calos, M. P. & Miller, J. H. not be affected by the number of changes caused per event. (1982) Cell 29, 319-328. However, the absolute nature of their evolution would be 11. Ripley, L. S. & Glickman, B. W. (1983) Cold Spring Harbor strongly affected. Due to the potential production of multiple Symp. Quant. Biol. 43, 851-861. changes per mutational event, this mechanism could be 12. Glickman, B. W. & Ripley, L. S. (1984) Proc. Natl. Acad. Sci. important even under conditions where such events might be USA 81, 512-516. relatively rare compared to mechanisms of mutation capable 13. Ripley, L. S. (1982) Proc. Natl. Acad. Sci. USA 79, of causing only single base changes. 4128-4132. Template-directed mutations can also be expected to exert 14. de Boer, J. G. & Ripley, L. S. (1984) Proc. Natl. Acad. Sci. influence on the structure of DNA se- USA 81, 5528-5531. significant primary 15. Taniguchi, T., Mantei, N., Schwarzstein, M., Nagata, S., quences. The occurrence of sequence-directed mutations Muramatsu, M. & Weissmann, C. (1980) Nature (London) 285, has, as a consequence, the perfection of partial repeats and 547-549. of quasipalindromic sequences. Thus sequence-directed 16. Goeddel, D. V., Yelverton, E., Ullrich, A., Heyneker, H. L., events can be expected to result in an excess of both direct Miozzari, G., Holmes, W., Seeburg, P. H., Dull, T., May, L., and inverted repeats in the DNA. Such an excess has been Stebbing, N., Crea, R., Maeda, S., McCandliss, R., Sloma, A., noted by Muller and Fitch (33) and by Karlin et al. (32). Ohno Tabor, J. M., Gross, M., Familletti, P. C. & Pestka, S. (1980) (34) has also observed a tendency for the coding sequences Nature (London) 287, 411-416. of genes to have a highly repetitive structure. He suggests 17. Lawn, R. M., Gross, M., Houck, C. M., Franke, A. E., Gray, that this be an P. V. & Goeddel, D. V. (1981) Proc. Natl. Acad. Sci. USA 78, may evolutionary relic of primitive gene 5435-5439. structures and may be useful in creating new protein se- 18. Lawn, R. M., Adelman, J., Dull, T. G., Gross, M., Goeddel, quences by combining different repeats. D. & Ullrich, A. (1981) Science 212, 1159-1162. The potential ofhotspots, as would be caused by template- 19. Yelverton, E., Leung, D., Weck, P., Gray, P. W. & Goeddel, directed mutations, to alter estimates ofthe rates ofevolution D. V. (1981) Nucleic Acids Res. 9, 731-741. has been recognized by Holmquist and Pearl (35). The 20. Goeddel, D. V., Leung, D. W., Dull, T. J., Gross, M., Lawn, presence of nearby repeats might also explain repeated, R. M., McCandliss, R., Seeburg, P. H., Ullrich, A., convergent substitutions as have, for example, been noted by Yelverton, E. & Gray, P. W. (1981) Nature (London) 290, Aquadro and Greenberg (36) in human mitochondrial se- 20-26. and Fitch in human 21. Ullrich, A., Gray, P. W., Goeddel, D. V. & Dull, T. J. (1982) quences by (37) globin sequences. J. Mol. Biol. 156, 467-486. An intriguing aspect of sequence-directed events is their 22. Smith, G. P. (1974) Cold Spring Harbor Symp. Quant. Biol. ability to generate multiple alterations in a relatively short 38, 507-513. time. This provides a plasticity that was not previously 23. Weissmann, C., Nagata, S., Boll, W., Fountoulakis, M., apparent. In addition to a role in evolution, sequence- Fujisawa, A., Fujisawa, J., Haynes, J., Henco, K., Mantei, directed mechanisms may be particularly useful methods to N., Ragg, H., Schein, C., Schmid, J., Shaw, G., Streuli, M., generate immunoglobin diversity. Novel allelic forms can be Taira, H., Todokoro, K. & Weidle, U. (1983) in Primary and rapidly created and the use of repeated sequences as tem- Tertiary Structure ofNucleic Acids and Cancer Research, eds. plates increases the likelihood of functional products (34). Miwa, M. & Nishimura, S. (Japan Scientific Society Press, The ofDNA sequences to direct their Tokyo), pp. 1-22. extraordinary potential 24. Miyata, T. & Hayashida, H. (1982) Nature (London) 295, mutational fate is an important concept in the repertoire of 165-168. mechanisms leading to genetic change. 25. Wilson, V., Jeffreys, A. J., Barrie, P. A., Boseley, P. G., Slocombe, P. M., Easton, A. & Burke, D. C. (1983) J. Mol. Biol. 166, 457-475. The authors thank Drs. J. W. Drake, R. H. Haynes, R. E. Pearl- 26. Felsenstein, J. (1982) Q. Rev. Biol. 57, 379-404. man, P. A. Bums, C. H. Langley, J. F. Crow, F. Doolittle, and 27. Fitch, W. M. (1977) Am. Nat. 111, 223-257. anonymous reviewers for their helpful comments. The authors 28. Muller-Hill, B. & Kania, J. (1974) Nature (London) 249, benefited from discussions with Dr. L. S. Ripley who shares our 561-563. interest in DNA secondary structure. This work was supported by 29. Franklin, N. C. (1967) Genetics 55, 699-707. the Natural Sciences and Engineering Research Council of Canada 30. Voccaro, K. K. & Siegel, E. C. (1979) Mutat. Res. 24, Grant U0336 to G.B.G. and Grant A2814 to B.W.G. 443-446. 31. Echols, H., Lu, C. & Burger, P. M. J. (1983) Proc. Natl. Acad. Sci. USA 80, 2189-2192. 1. Drake, J. W. (1970) The Molecular Basis ofMutation (Holden- 32. Karlin, S., Ghandour, G., Friedemann, O., Tavare, S. & Korn, Day, San Francisco). L. J. (1983) Proc. Natl. Acad. Sci. USA 80, 5660-5664. 2. Schaaper, R., Danforth, B. N. & Glickman, B. W. (1985) J. 33. Muller, U. R. & Fitch, W. M. (1982) Nature (London) 298, Mol. Biol., in press. 582-585. 3. Konkel, D. A., Maizel, J. V. & Leder, P. (1979) Cell 18, 34. Ohno, S. (1984) Proc. Natl. Acad. Sci. USA 81, 2421-2425. 865-873. 35. Holmquist, R. & Pearl, D. (1980) J. Mol. Evol. 16, 211-267. 4. Efstratiadis, A., Posakony, J. W., Maniatis, T., Lawn, R. M., 36. Aquadro, C. F. & Greenberg, B. D. (1983) Genetics 103, O'Connell, C., Spritz, R. A., DeRiel, J. K., Forget, B. G., 287-312. Weissman, S. M., Slightom, J. L., Blechl, A. E., Smithies, 37. Fitch, W. M. (1980) J. Mol. Evol. 16, 153-209. Downloaded by guest on September 24, 2021