Sequence Homology of Androgen-Regulated Epididymal Proteins with Glutathione Peroxidase in Mice N

Home , Sequence homology

Sequence homology of androgen-regulated epididymal proteins with glutathione peroxidase in mice N. B. Ghyselinck, C. Jimenez and J. P. Dufaure Laboratoire de Biologie Cellulaire, Université Biaise Pascal et CNRS URA 360, 24 Avenue des Landais, 63177 Aubière Cedex, France

Summary. The M53 cDNA for Mr 24 000 androgen-regulated secretory proteins of the mouse caput epididymidis previously reported has been sequenced. This clone presents a 5\m='\-incompleteopen reading frame of 525 base pairs. The 3\m='\-untranslatedregion of 946 base pairs contains a repetitive DNA element of the rodent B1 family just between two canonical polyadenylation signals AATAAA, upstream of the poly(A) track. The deduced amino acid sequence for the Mr 24 000 proteins reveals significant homologies of 66\m=.\6,66, 65\m=.\2,63\m=.\1 and 64\m=.\5%with mouse, rat, man, bull and rabbit cloned selenium\x=req-\ dependent glutathione peroxidases, respectively. The present results emphasize pre- vious studies performed in numerous laboratories suggesting that the major protective system against oxidative damage in mouse spermatozoa could be an enzyme similar to glutathione peroxidase.

Keywords: Mr 24 000 proteins; androgen-regulated; epididymis; glutathione peroxidase; mouse

Introduction

Molecular cloning of the M53 cDNA for secretory proteins of Mr 24000 whose corresponding mRNAs are accumulated in the mouse caput epididymidis, under androgenic control has recently been reported (Ghyselinck et ai, 1990). Antibodies against Mr 24 000 androgen-regulated epi¬ didymal secretory proteins, which represent a substantial proportion of total newly synthesized and secreted proteins within the organ, have revealed association with the sperm head (Jimenez et ai, 1990). In general, such proteins are thought to play an important role, as yet undefined, in the maturation of spermatozoa, leading finally to their acquiring the ability to bind and fertilize oocytes (Orgebin-Crist et ai, 1975; Fournier-Delpech et ai, 1984). As an aid in elucidating physio¬ logical function and adrogenic control of the Mx 24 000 proteins, the primary amino acid sequence was deduced from cDNA sequence and compared with entries in protein-sequence data bases.

Materials and Methods

Molecular cloning of the cDNA has been described previously (Ghyselinck et ai, 1990). Nuclease Bal 31 (Promega Biotec, Madison, WI, USA) deleted DNA fragments (Nixon, 1987) or restriction fragments were ligated into suitably restricted replicative forms of M13 mp 18 or mp 19 vectors (Boehringer Mannheim, Meylan, France) and transfected into Escherichia coli DH5aF' cells (Gibco BRL, Cergy Pontoise, France). Recombinant phages were selected and grown to yield single-stranded DNA (Sanger et ai, 1980). DNA was sequenced by the dideoxy-chain-termination method (Sanger et ai, 1977) using the 15 mer M13 universal primer and a Boehringer Mannheim sequencing kit. Reactions were carried out according to manufacturer's instructions. DNA samples were electrophoresed at 45 watts constant power in 89 mmol Tris borate/1, 2 mmol EDTA/1 pH 8-3 on 0-4 mm 6% (w/v) polyacrylamide, 7 mol urea gels/1. DNA was fixed for 10 min in 10% (v/v) methanol and 10% (v/v) acetic acid; gels were dried and autoradiogra- phied at room temperature without screens. Each clone was sequenced at least twice using independently derived templates. DNA sequence data were assembled and analysed with the bisance programs at CITI2 in Paris on a DPS8

Downloaded from Bioscientifica.com at 09/29/2021 05:04:18AM via free access Bull computer (Dessen et ai, 1990). The primary amino acid deduced sequence was compared with entries in the GenPro data bank. Optimal alignment of sequences was according to the algorithm of Kanehisa (1984).

Results

The M 53 cDNA for Mr 24 000 epididymal proteins was mapped for cleavage sites by several restriction endonucleases (Fig. 1) and appropriate fragments were subcloned into M13 vectors, to be sequenced. The cDNA consists of 1471 base pairs (Fig. 2). The longest open reading frame (ORF) of 525 base pairs starts at the first base and is unfortunately 5' incomplete, as it does not start with the methionine codon contained in the translation initiation consensus sequence ACCATGG (Kozak, 1986). The 3' noncoding region of 946 base pairs presents two eucaryotic consensus signals of polyadenylation AATAAA at position 735 and 1434, upstream of the poly(A) stretch consisting of 17 nucleotides. This suggests that the 3' untranslated region of the cDNA is virtually complete. Examination of the 3' sequence reveals an element of 153 base pairs which resembles the Bl (Alu-like) repetitive DNA elements dispersed in mouse genome (Kramerov et ai, 1979). Amongst the six defined Bl subfamilies (Quentin, 1989), the best sequence alignment (66% homology) is obtained with the F group (not shown). This retroposon is flanked by a seven-base direct repeat and extensive 5' A-G rich and 3' -C rich regions. The sequences which could corres¬ pond to intragenic consensus RNA Pol III promoters (Geiduschek & Tocchini-Valentini, 1988) are bold typed. They are well conserved. The primary amino acid sequence deduced from the M53 cDNA ORF gives rise to a peptide having a basic calculated pi (8-8). This is in good agreement with the isoelectric points of the Mr 24 000 epididymal proteins, which are found between 7 and 9, as determined by isoelectric focusing (Ghyselinck et ai, 1989). There is an unusually high leucine (9%), and phenylalanine (8%) content, and a very low alanine (3%) content, relative to the average amino acid distribution in proteins (Doolittle, 1981). No consensus sequence for potential TV-glycosylation sites (Asn-X-Ser or Asn- X-Thr) are present within the sequence, although the mature Mr 24 000 proteins are known to be glycosylated (unpublished observations). The plot for hydrophilicity (Hopp & Woods, 1981) of the deduced ORF reveals successive stretches of hydrophobic and hydrophilic amino acids in the TV- terminal domain; the C-terminal region of the proteins is essentially hydrophobic (Fig. 3). Nevertheless, using the algorithm of Eisenberg et al. (1984), no membrane-spanning-associated helix is predicted in the protein, which is classified as peripheral membrane protein (Kleine et ai, 1985). Comparison of the deduced protein with a library of protein sequences revealed significant homology with members of the glutathione peroxidase family (Fig. 4). The conserved residues are spread uniformly along the central length of the protein. The cDNA ORF sequence shows 66-6, 66, 65-2, 64-5 and 631% homology with mouse (Chambers et ai, 1986), rat (Ho et ai, 1988; Reddy et ai, 1988; Yoshimura et ai, 1988), human (Ishida et ai, 1987; Mullenbach et ai, 1987; Sukenaga et ai, 1987), rabbit (Akasaka et ai, 1989) and bovine (Giinzler et ai, 1984) selenium-dependent glutathione peroxidase (E.C. 1.11.1.9), respectively. A smaller similarity (56%) is observed also with the BtuE polypeptide involved in vitamin B12 transport in E. coli (Friedrisch et ai, 1986).

Discussion

The M53 cDNA clone is demonstrated to select abundant mRNA populations specific to the principal cells of the caput epididymidis (Faure et ai, 1991) that encode proteins of Mr 26000 which are processed in vitro, in the presence of microsomal membranes, into proteins of Mr 24 000 (Ghyselinck et ai, 1989, 1990). The predicted amino acid sequence for the protein shows similari¬ ties with the glutathione peroxidase. Highly conserved areas can be seen and overall homology as high as ~ 67% is observed. Glutathione peroxidase (E.C. 1.11.1.9) is distributed widely in many tissues and organs (Chow & Tappel, 1972) while mRNAs homologous to the M53 cDNA probe are only

Downloaded from Bioscientifica.com at 09/29/2021 05:04:18AM via free access > rr E E 5 .1 X X < X J-H poly(A) ->—>—>->-->--> —*—>~

— -1- -1-1-1 0-25 0 50 0-75 1 1-25 1-5 kbp

Fig. 1. Partial restriction map and sequencing strategy of mouse M53 cDNA. The direction and extent of each sequencing run is indicated by arrows. The box represents the coding region, and the stippled segment the Bl repetitive element. The broken left side of the box indicates that the cDNA is not complete in the 5' region.

TCTCTTAATGGGAAGGAACACATTCCATTCAAGCAGTATCGAGGAAAGCACGTCCTCTTTGTCAATGTGGCTACC 75 SLNGKEHIPFKQYRGKHVLFVNVAT 25 TATTGCGGTCTGACAATCCAGTACCCTGAGCTGAATGCACTCCAGGAGGATCTGAAGCCATTTGGCTTGGTTATA 150 YCGLTIQYPELNALQEDLKPFGLVI 50 TTGGGCTTTCCCTGCAACCAATTTGGAAAGCAAGAACCAGGAGACAATTTAGAGATTCTTCCTGGGCTCAAGTAT 225 LGFPCNQFGKQEPGDNLEILPGLKY 75 GTTCGTCCAGGAAAAGGGTTTTTACCTAACTTCCAGCTTTTTGCAAAAGGGGATGTAAATGGTGAAAACGAGCAG 300 VRPGKGFLPNFQLFAKGDVNGENEQ 100 AAAATCTTCACCTTCTTGAAGCGTTCTTGTCCTCACCCCTCAGAGACTGTGGTCATGAGCAAACATACCTCCTGG 375 ¡CIFTFLKRSCPHPSETVVMSKHTSW 125 GAGCCAATAAAAGTCCATGACATCCGCTGGAACTTTGAGAAGTTCCTGGTGGGACCCGATGGCGTCCCTGTCATG 450 EPIKVHDIRWNFEKFLVGPDGVPVM 150 CGCTGGTTCCACCAGGCTCCTGTCAGCACTGTCAAGTCTGACATCATGGCGTACCTGAGCCATTTCAAAACCATA 525 RWFHQAPVSTVKSDIMAYLSHFKTI 175 TAGGAAGGCCAAGCTTCTGACCTCTTCCTCCTTCCCCCTTAAAGACTGCTCTGAAAAAAAGACTCCATCTTCTCA 600 Stop GCACACTCTTCACTGAAATGGACTCTACCTCCCAAGTCACCCCTAAATTGCCTAAGTTCTTCCCCTGCACAAGTA 675 GATTTGTGTCTGGGAAGCTGTAGATGTTITTCCTTGTTAGATTTATGAGTTGAAGAGAGAaIÄÄTÄAAIaTAAAAAA 750 GAAAAAAGCTAAATCCÁGAGACCTCAGAGGTTTGGCTGAGTATGTTAGTACTCACCTATAATGTCGCACTCAGCA 825 GACATTACAGACATTTCAGACAGTAAGCGACAGGAGGAACATGAATGGCAGGCCAGCCTAAGCTACAAGATATCA 900 tgtgtccaaaaaaaaaaaaaaaatccacgaccaccaacacaacccgattgaactactctaattcaccaaaggata 975 tggggatagcttggttgaaggctgtatctgaaggaagagtccttggccattcagagtctttctcttcccagcctg 1050 aaggtggagaaagagcaatggaggctggtcagacaatctagtttgctcctctgaaactgtgtgtctcctgagaca 1125 aatgccttgtcagttcctgaggtcttttaattcggtcttcatctctgtctccatcctctctgcccttctcctgcg 1200 gccaatctgagggagagtctgagcagattgactggcacaggaggagggcatctccctgatgccaggatcggggac 1275 ttgtcctgattctgcataagtgctcctttctgtgtgatcttcacggggtcagctagtgcttatgagtggggatgc 1350 ctttcatcatctgaagagtaggaccccccacatgcagaccccaacctgggattcttcaacttcgaaactagacat 1425 attatttcdäataaalatgttttctgaagcaaaaaaaaaaaaaaaaa 1471 Fig. 2. Nucleotide sequence of M 53 cDNA showing the predicted amino acid sequence for the Mr 24 000 androgen-regulated secretory proteins of the mouse caput epididymidis. The sequence of the noncoding, RNA-like strand, is given in the 5' to 3' direction. Numbers corres¬ ponding to the nucleotides or to the amino acids (indicated in the one-letter code) are shown on the right. The consensus presumptive polyadenylation signals are boxed, and the Bl repetitive DNA element is underlined. Arrows indicate seven base pairs which are direct repeats and putative RNA Pol III promoter sequences are in bold type. detected in the caput epididymidis (Faure et ai, 1991). It is a selenium-dependent 'house-keeping' enzyme in which the selenium is incorporated as selenocysteine (the analogue of cysteine whose sulphur is replaced by selenium). The incorporation occurs during translation by a suppressor tRNA which recognizes an opal (UGA) stop codon (Chambers et ai, 1986). The corresponding UGA codon is not present in M53 mRNA. It has been replaced by a UGC codon directing the incorporation of cysteine. It is unknown whether the MT 24 000 epididymal proteins contain selenium that also can be post-traductionally incorporated into proteins (Kleene et ai, 1989). Selenium and selenium-

Downloaded from Bioscientifica.com at 09/29/2021 05:04:18AM via free access Hydrophilic

Hydrophobic - - — - — — — — — — 25 50 75 loo100 125 150 175 Amino acid residue number Fig. 3. Plot of hydrophilicity of the deduced mouse protein obtained using a protein structure analysis computer program with an average window of six amino acids. Note the alternate presence of hydrophilic and hydrophobic domains; *the position of the cysteine residue replacing the selenocysteine implicated in the catalytic site of the homologous glutathione peroxidases.

M53 ORF IPFIQÏ R G K E L N I. Q EjD 49 Mouse S L G S L R G K M N I. Q K R 70 Rat S L G S I, R G K M N L Q K R G L V 70 Rabbit N L G S I. R C K S Q M N lqÎJr L V 69 Bovine P F N L S S L R G K S Q M N G L V 68 Human pMs.Qa L G S L R G K S Q M N (LI 70

M53 ORF ILGFPCNqFG E I L G I. K Y V R P G D V N G E 99 Mouse VLGFPCNQFG E ] L S L K V V R P G N F E V N G E 120 Rat VLGFPCNQFG E I L S L K Y V R P G N F E V N G E 120 Rabbit VLGFPCNQFG E I L S L K Y V R P G N F E V N G 119 Bovine VLGFPCNQFG E I L N cil, K Y V R P G N F E V N G 118 Human VLGFPCNQFG E I I. n(s l. K Y V R P G N F E V N G 120

M53 ORF Q K I F T F L K P S E VMS K II T F K V II WNFEKFLVGPD 145 Mouse H P L F T F L R P S D L M T D K 1 I C R » WNFEKFLVGPD 170 Rat H P L F T F L R P S D L M T I) P K I I G R N WNFEKFLVGPD 170 Rabbit S P L F A F L R P S D L M T I) P K I T CRN WNFEKFLVGPD 169 Bovine Il P L F A F L R P S 11 L M T I) P K 1 T CRN WNFEKFLVGPD 168 Human Il P L F F L R # P S D I, M T I) K I, I T CRN WNFEKFLVGPD 170 Fig. 4. Alignment of the amino acid sequence of the M53 cDNA ORF (M53 ORF) with cloned mouse, rat, rabbit, bovine, and human selenium-dependent glutathione peroxidases. Amino acids are given in the one-letter code. Dashes indicate gaps introduced to optimize the align¬ ment. Sequences are numbered on the right. Residues in the alignment which are identical or homologous are boxed. containing peptides are essential components of sperm or seminal plasma (Saaranen et ai, 1989) and are generally related to sperm motility (Wallace et ai, 1983). Glutathione peroxidase plays an important role in detoxification of lipid peroxide (Sunde & Hoekstra, 1980). In human spermato¬ zoa, lipid peroxidation occurs (Alvarez et ai, 1987). It is required to increase the capacity to bind to zona pellucida (Aitken et ai, 1989), but is also implicated in the aetiology of some male infertility (Aitken & Clarkson, 1987; Aitken et ai, 1988). Enhanced lipid peroxidation is known to activate phospholipase A2 (Ungemach, 1985), which induces acrosome reaction (Bennet et ai, 1987). Thus, it is likely that protection systems against such peroxide damage are necessary to prevent antici¬ pated acrosome reaction in the male genital tract. It has been demonstrated that mouse spermato¬ zoa and epididymal fluid contain high concentrations of glutathione and selenium-dependent

Downloaded from Bioscientifica.com at 09/29/2021 05:04:18AM via free access glutathione peroxidase activity (Alvarez & Storey, 1984 and personal observations), which is the major protective system against oxidative damage (Alvarez & Storey, 1984). These observations emphasize the sequence homology found between the glutathione peroxidase and cloned protein that is proposed to bind to the sperm head in the acrosome region (Jimenez et ai, 1990). We have not demonstrated directly the enzymatic nature of the protein and it will be the subject of future studies. Sequence homology is also observed with the BtuE peptide, which is a vitamin B12 transport protein in E. coli (Friedrisch et ai, 1986). Little is known about the role of vitamin B12 in sperm physiology. In eucaryotic cells, it is a component of the coenzyme implicated in the synthesis of succinyl coenzyme A. This could be related to sperm metabolism, including fatty acid degradation. In terms of regulation, this report stimulates the basic question about the mechanism by which the gene is regulated by testosterone. The sequence homology of the cDNA with a so-called 'house¬ keeping' gene, which is not usually regulated by the hormone is described. The molecular basis of the mechanism by which the gene would have turned into a testosterone-dependent gene is not known. The presence of a retroposon in the 3' region of the cDNA, which is not represented in the ancestral gene (Chambers et ai, 1986), leads one to suppose that gene duplication(s) and/or recombination(s) must have occurred. Genomic cloning will provide more information about gene organization and evolution.

We would like to thank E. Pailhoux for valuable discussions concerning the sequencing pro¬ cedure and A. Lenoir for helpful technical assistance in DNA preparation. The text was typed by F. Grath. Sequence data treatments were performed using computer facilities at CITI2 in Paris on a DPS8 Bull computer with the help of the French Ministère de la Recherche et de la Technologie ('Essor des Biotechnologies'). This work was supported by grants from CNRS (URA 360 Organis¬ ation et régulation du génome), the Fondation pour la Recherche Médicale Française and the Institut National de la Santé et de la Recherche Médicale (INSERM 894004). The nucleotide sequence reported in this paper has been submitted to the GenBank@)/EMBL Data bank with accession number X53780.

References

Aitken, R.J. & Clarkson, J.S. (1987) Cellular basis of acrosome reaction of human sperm elicited by cal¬ defective sperm function and its association with the cium ionophore A23187. Biochim. biophys. Ada 919, genesis of reactive oxygen species by human 255-265. spermatozoa. J. Reprod. Fert. 81, 459-469. Chambers, I., Frampton, J., Goldfarb, P., Affara, N., Aitken, R.J., Clarkson, J.S., Hargreave, T.B., Irvine, Me Bain, W. & Harrison, P.R. (1986) The structure of D.S. & Wu, F.C.W. (1988) Analysis of the relation¬ the mouse glutathione peroxidase gene: the selenocys- ship between defective sperm function and the gener¬ teine in the active site is encoded by the 'termination' ation of reactive oxygen species in cases of oligo- codon, TGA. EMBOJ.S, 1221-1227. zoospermia. J. Andro!. 10, 214-220. Chow, CK. & Tappel, A.L. ( 1972) An enzymatic protective Aitken, R.J., Clarkson, J.S. & Fishel, S. ( 1989) Generation mechanism against lipid peroxidation damage to lungs of reactive oxygen species, lipid peroxidation, and of ozone-exposed rats. Lipids 7,518-524. human sperm function. Biol. Reprod. 40, 183-197. Dessen, P., Fondrat, C, Valencien, C & Mugnier, C. Akasaka, M., Mizoguch, J., Yoshimura, S. & Watanabe, (1990) BISANCE: A French service for access to bio- K. (1989) Nucleotide sequence of cDNA for rabbit molecular sequence databases. Comp. Appi Biosci. 6, glutathione peroxidase. Nucl. Acids Res. 17, 2136. 355-356. Alvarez, J.G. & Storey, B.T. (1984) Lipid peroxidation and Doolittle, R.F. (1981) Similar amino acid sequences: the reactions of Superoxide and hydrogen peroxide in chance or common ancestry? Science, NY 214, mouse spermatozoa. Biol. Reprod. 30, 833-841. 149-159. Alvarez, J.G., Touchstone, J.C, Blacso, L. & Storey, Eisenberg, I)., Schwarz, E., Kamaromy, M. & Wall, R. B.T. (1987) Spontaneous lipid peroxidation and pro¬ (1984) Analysis of membrane and surface protein duction of hydrogen peroxide and Superoxide in sequences with the hydrophobic moment plot. J. mol. human spermatozoa. J. Andro!. 8, 338-348. Biol. 179, 125-142. Bennet, P.J., Moat ti, J.P., Mansat, ., Ribbes, H. Cayrac, Faure, J., Ghyselinck, N.B., Jimenez, C & Dufaure, J.P. J.C, Pontonnier, F., Chap, H. & Doust-Blazy, C ( 1987) (1991) Specific distribution of messenger ribonucleic Evidence for the activation of phospholipases during acids for 24-kilodalton proteins in the mouse

Downloaded from Bioscientifica.com at 09/29/2021 05:04:18AM via free access epididymis as revealed by in situ hybridization: deve¬ DNA cloning experiments. Nuci. Acids Res. 6, lopmental expression and regulation in the adult. 697-713. Biol. Reprod. 44, 13-22. MuUenbach, G., Tabrizi, ., Irvine, B.D., Bell, G.I. & Fournier-Delpech, S., Hamamah, S., I anaiiis-Anthony. C, Hallewell, R.A. (1987) Sequence of a cDNA coding Courot, M. & Orgebin-Crist, M.C (1984) Hormonal for human glutathione peroxidase confirms TGA regulation of zona-binding ability and fertilizing encodes active site selenocysteine. Nuci Acids Res. ability of rat epididymal spermatozoa. Gamete Res. 9, 15, 5484. 21-30. Nixon, T.B. (1987) Construction of nested deletions for Friedrisch, M.J., DeVeaux, L.C. & Kadner, R.J. (1986) DNA sequencing using Bal31 exonuclease. In Current Nucleotide sequence of the btuCED genes involved in Protocols in Molecular Biology, vol. 7, sect. 3, pp. 1-14. vitamin 12 transport in Escherichia coli and hom¬ Eds F. M. Ausubel, R. Brent, R. E. Kingston, D. D. ology with the components of periplasmic binding- Moore, J.A. Smith, J. G. Seidman & K. Struhl. Greene protein-dependent-transport systems. J. Baderiol. Publishing Associates, New York. 163,928-934. Orgebin-Crist, M.C, Danzo, B.J. & Davies, J. (1975) Geiduschek, E.P. & Tocchini-Valentini, G.P. (1988) Endocrine control of the development and mainten¬ Transcription by RNA polymerase III. A. Rev. Bio¬ ance of sperm fertilizing ability in the epididymis. chem. 57, 873-914. In Handbook of Physiology, sect. 7, vol. 5, Male Ghyselinck, N.B., Jimenez, C, Courty, Y. & Dufaure, Reproductive System, pp. 319-338. Eds D. W. J.P. (1989) Androgen-dependent messenger RNA(s) Hamilton & R. O. Greep. American Physiological related to secretory proteins in the mouse epididymis. Society, Washington, DC. J. Reprod. Fert. 85, 631-639. Quentin, Y. (1989) Successive waves of fixation of Bl Ghyselinck, N.B., Jimenez, C, Lefrançois, A.M. & variants in rodent lineage history. J. moi Evo!. 28, Dufaure, J.P. (1990) Molecular cloning of a cDNA 299-305. for androgen-regulated proteins secreted by the Reddy, A.P., Hsu, B.L., Screenivasula Reddy, P., Li, N., mouse epididymis. J. moi Endocr. 4, 5-12. Thyagaraju, K., Reddy, C.C., Tam, M.F. & Tu, Giinzler, W.A., Steffens, G.J., Grossmann, ., Kim, C.P.D. (1988) Expression of glutathione peroxidase I S.M.A., Otting, F., Wendel, . & Flohé, L. (1984) gene in selenium-deficient rats. Nuci Acids Res. 16, The amino acid sequence of bovine glutathione 5557-5568. peroxidase. Hoppe-Seyler's Z. Physioi Chem. 365, Saaranen, M., Suistomaa, U. & Vanha-Perttula, T. (1989) 195-212. Semen selenium content and sperm mitochondrial Ho, Y.S., Howard, A.J. & Crapo, J.D. (1988) Nucleotide volume in human and some animal species. Hum. sequence of a rat glutathione peroxidase cDNA. Reprod. 4, 304-308. Nuci Acids Res. 16, 5207. Sanger, F., Coulson, A.R., Barrell, B.G., Smith, A.J.H. & Hopp, T.P. & Woods, K.R. (1981) Prediction of protein Roe, B.A. (1980) Cloning in single-stranded bacterio- antigenic determinants from amino acid sequences. phage as an aid to rapid DNA sequencing. J. mol. Proc. nati Acad. Sci. USA 78, 3824-3828. Biol. 143, 161-178. Ishida, K., Morino, T., Takagi, . & Sukenaga, Y. (1987) Sanger, F., Nicklen, S. & Coulson, A.R. (1977) DNA Nucleotide sequence of a human gene for glutathione sequencing with chain-terminating inhibitors. Proc. peroxidase. Nuci Acids Res. 23, 10 051. nati Acad. Sci. USA 74, 5463-5467. Jimenez, C, Ghyselinck, N.B., Depeiges, A. & Dufaure, Sukenaga, Y., Ishida, K., Takeda, T. & Takagi, K. (1987) J.P. (1990) Immunochemical localization and associ¬ cDNA sequence coding for human glutathione peroxi¬ ation with spermatozoa of androgen-regulated pro¬ dase. Nuci Acids Res. 15, 7178. teins of M, 24 000 secreted by the mouse epididymis. Sunde, R.A. & Hoekstra, W.G. (1980) Structure, synthesis Biol. Cell6S, 171-174. and function of glutathione peroxidase. Nut. Rew. 38, Kanehisa, M. (1984) Use of statistical criteria for screen¬ 265-273. ing potential homologies in nucleic acid sequences. Ungemach, F.R. (1985) Plasma membrane damage to Nuci Acids Res. 2, 203-215. hepatocytes following lipid peroxidation: involvement Kleene, K.C., Smith, J., Bozorgzadeh, ., Harris, M., of phospholipase A2. In Free Radicals in Liver Injury, Hahn, L. Karimpour, I. & Gerstel, J. (1989) Sequence pp. 127-134. Eds G. Poli, . H. Cheeseman, M. U. and developmental expression of the mRNA encod¬ Dianzani & T. F. Slater. IRL Press, Washington. ing the seleno-protein of the sperm mitochondrial Wallace, E. Calvin, H.I. & Cooper, G.W. (1983) Pro¬ capsule in the mouse. Devi Biol. 137, 395-402. gressive defects observed in mouse sperm during the Klein, P., Kanehisa, M. & Delisi, C (1985) The detection course of three generations of selenium deficiency. and classification of membrane-spanning proteins. Gamete Res. 4, 377-387. Biochim. biophys. Ada 815, 468-476. Yoshimura, S., Takekoshi, S., Watanabe, K. & Fujii- Kozak, M. (1986) Point mutations define a sequence flank¬ Kuriyama, Y. (1988) Determination of nucleotide ing the AUG initiator codon that modulates trans¬ sequence of cDNA coding rat glutathione peroxidase lation by eucaryotic ribosomes. Cell 44, 283-292. and diminished expression of the mRNA in selenium Kramen», D.A., Grigoryan, A.A., Ryskov, P. & Georgiev, deficient rat liver. Biochem. biophys. Res. Commun. G.P. (1979) Long double stranded sequences (ds 154, 1024-1028. RNA-B) of nuclear pre-mRNA consist of a few highly abundant classes of sequence: evidence from Received 9 November 1990

Downloaded from Bioscientifica.com at 09/29/2021 05:04:18AM via free access