Tropical Peat Swamp Soils: The impact of agricultural and restoration practices on activity and diversity of the soil microbial community

A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy

Yuana Nurulita

Bachelor of Science (B.Sc), Bogor Agricultural University Master of Science (M.Sc), Bandung Institute of Technology

School of Applied Sciences

College of Science Engineering and Health

RMIT University

March 2016

Declaration

I certify that except where due acknowledgement has been made, the work is that of the author alone; the work has not been submitted previously, in whole or in part, to qualify for any other academic award; the content of the thesis is the result of work which has been carried out since the official commencement date of the approved research program; any editorial work, paid or unpaid, carried out by a third party is acknowledged; and, ethics procedures and guidelines have been followed.

Yuana Nurulita

March 2016

ii The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

“Say: Though the sea became ink for the Words of my Lord, verily the sea would be used up before the Words of my Lord were exhausted, even though we brought the like thereof to help” (QS Al-Kahf, 18: 109)

Never regard study as a duty but as an enviable opportunity to learn to know the liberting influence of beauty in the realm of the spirit for your own personal joy and to the profit of the community to which your later works belong – Albert Einstein

iii The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

ACKNOWLEDGEMENTS

First, I would like to express my deep and sincere gratitude to my principal supervisor, Professor Andrew S. Ball for giving me this great opportunity to join his friendly and well-equipped lab and for providing me emotional and scientific support and great ideas throughout this project. He has contributed significantly in many ways to my project and each contribution has been valuable. His encourgement, support and valuable suggestions have led to this successful work. Thanks Andy, you are a great supervisor.

My sincere thanks go to my co-supervisor Dr. Eric Adetutu for sharing valuable knowledge and providing advice througout my candidature. His words of wisdom and encourgement were amazing. Thanks for not only being a supervisor, but also a friend.

I am indebted to all my best multicultural-friends in Ball-Lab for their friendship, valuable advice, moral support and for sharing knowledge, valuable hints, experience and fun; especially Dr. Sayali Patil (thanks for showing me how to initiate life in Melbourne - Australia), Dr. Mohamed Taha & Dr. Abdulatif A. Mansur together with their families (you are my brothers and family, I am so fortunate to know you all), Dr. Esi Shahsavari, Dr. Krishna Kadali, Dr. Khalid Alhothaly, Dr. Arturo Aburto-Medina, Dr. Petra Sheppard, Sahar Shah, Taylor Gundry, Adam Truskewycz, Tanvi Makadia, Eman Alamen Koshlaf, Lakshmi Haleyur, and Katharina Stracke. My Indonesian community in Bundoora have stood by me with their kindness and support during this endeavour, thanks for making my days in Melbourne colourful and easier.

I would like also to thank to all my family, especially my beloved husband (Mardoni Akrom) and lovely children (Raihan and Nalisya) for being a constant source of motivation and encourgement. I also thank my institution, University of Riau, for giving me permission and recomendation to commence this study. Lastly but certainly not least, I would like to thank to my beloved country Indonesia, Ministry of Education and Culture and the Ministry of Research and Ministry of Research, Technology and Higher Education for providing me with a scholarship to conduct my PhD; words can not express my appreciation to the Indonesian Government. I hope my expertise will contribute to a better Indonesia.

Lastly, I dedicate this thesis to my husband, my children and my beloved country, Indonesia, for a better life, without haze disasters and with good, sustainable management of our tropical peat swamp area.

iv The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Table of Contents

DECLARATION ...... Ii ACKNOWLEDGMENTS ...... iv TABLE OF CONTENTS ...... V THESIS WITH PUBLICATIONS DECLARATION ...... Ix JOURNAL PAPERS PUBLISHED FROM THIS PROJECT ...... Xi STATEMENT OF AUTHORSHIP ...... Xii Abstract ...... 1 Chapter 1. General Introduction and Literature Review ...... 4 1. Introduction ...... 5 1.1 What is peatland? ...... 6 1.2 Peat soil ...... 12 1.3 Disturbance of peatland – peat soil ...... 13 1.4 Impact of agricutural practices on peatland ...... 14 1.5 Restoration of peatland ...... 16 1.6 Monitoring the impact of human practices in peatland ...... 17 1.6.1 Physical and chemical attributes ...... 17 1.6.2 Biological attributes ...... 19 1.6.3 Polymerse chain reaction (PCR) and Denaturation gradient gel electrophoresis (DGGE) ...... 26 1.6.4 Community level physiological profile (CLPP) as a tool to assess the impact of human practices ...... 33 1.6.5 Using soil enzyme activities to assess the impact of human 35 practices ...... 1.6.6 Site history ...... 37 1.7 Aims and objectives ...... 38

Chapter 2. General Materials and Methods ...... 39 2. Materials and Methods ...... 40 2.1 Study sites ...... 40 2.2 Soil sampling ...... 43 2.3 Field analysis ...... 43 2.4 Physico-chemical analyses of soils ...... 43 2.5 Estimation of microbial viable counts ...... 44 2.6 Community Level Physiological Profiling (CLPP) ...... 44 2.6.1 Statistical analysis of CLPP data ...... 45 2.7 Ion concentration ...... 45 2.8 Enzyme activities ...... 46 2.9 DNA extraction ...... 46 2.10 PCR reactions ...... 47 2.10.1 Amplification of a partial bacterial community ...... 47 2.10.2 Amplification of a partial fungal community ...... 48 2.10.3 Amplification of a partial archaeal community ...... 48 2.11 Agarose gel electrophoresis ...... 50 2.12 Denaturing Gradient Gel Electrophoresis (DGGE) ...... 50 2.12.1 DGGE data analysis ...... 51 2.13 Statistical analysis ...... 51

v The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Chapter 3. The assessment of the impact of oil palm and rubber plantations on the biotic and abiotic properties of tropical peat swamp soil in Indonesia ...... 52 Chapter declaration for thesis by publication ...... 53 3 Abstract ...... 54 3.1 Introduction ...... 54 3.2 Experimental section ...... 56 3.2.1 Study sites ...... 56 3.2.2 Soil sampling ...... 57 3.2.3 Field analysis ...... 57 3.2.4 Physical-chemical analyses of soils ...... 58 3.2.5 Estimation of microbial biomass ...... 59 3.2.6 Community-level physiological profile ...... 59 3.2.7 Statistical analysis for functional diversity ...... 59 3.3 Results 3.3.1 Impact of oil palm and rubber plantation practices on the physical and chemical properties of the soil ...... 60 3.3.2 Impact of oil palm and rubber plantations on soil microbial community ...... 60 3.3.3 Impact of oil palm and rubber plantations practices on soil microbial community function ...... 61 3.4 Discussion ...... 62 3.5 Acknowledgment ...... 66 3.6 References ...... 66

Chapter 4. Assessment of the influence of oil palm and rubber plantations in tropical peat swamp soils using microbial diversity and activity analysis ...... 71 Chapter declaration for thesis by publication ...... 72 4 Abstract ...... 73 4.1 Introduction ...... 74 4.2 Materials and Methods ...... 75 4.2.1 Study sites and soil sampling ...... 75 4.2.2 Ion concentration ...... 75 4.2.3 Enzyme activities ...... 75 4.2.4 DNA extraction ...... 75 4.2.5 PCR amplification 16S rDNA ...... 75 4.2.6 Denaturing gradient gel electrophoresis (DGGE) ...... 76 4.3 Results 4.3.1 Effect of land use on soil C, N and P concentration ...... 76 4.3.2 Effects of land use on soil enzyme activities ...... 77 4.3.3 Influence of land-use change on the soil microbial community ...... 77 4.3.4 Key relationship between land-use change and measured parameter ...... 77 4.4 Disucssion 4.4.1 Effect of land use on soil concentration ...... 79 4.4.2 Effects of land use on soil enzyme activities ...... 80 4.4.3 Influence of land-use change on the soil microbial community ...... 80 4.4.4 Key relationship between land-use change and measured parameters ...... 81

vi The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Acknowledgment ...... 82 References ...... 82

Chapter 5. Restoration of tropical peat soils: the application of soil microbiology for monitoring the success of the retoration process ...... 86 Chapter declaration for thesis by publication ...... 87 5 Abstract ...... 88 5.1 Introduction ...... 88 5.2 Materials and methods ...... 5.2.1 Studi sites ...... 89 5.2.2 Retoration method ...... 89 5.2.3 Soil sampling ...... 89 5.2.4 Field analyses ...... 89 5.2.5 Physico-chemical analyses and estimation of microbial biomass analyses ...... 90 5.2.6 Community-level physilogical profile (CLPP) and its statistical analysis ...... 91 5.2.7 Enzyme activities ...... 91 5.2.8 DNA extraction, amplification and denaturing gradient gel electrophoresis (DGGE) ...... 91 5.3 Results 5.3.1 The impact of restoration of soil from a burned oil palm lantation on physcal-chemical properties of tropical peat swamp soils ...... 92 5.3.2 The impact of restoration of the burned oil palm plantation on biological properties of tropical peat swamp soils ...... 93 5.3.2.1 Viable microbial biomass ...... 93 5.3.2.2 Community-level physiological profile (CLPP) ...... 93 5.3.2.3 Soil enzyme activities ...... 93 5.4 Microbial diversity and function (PCR-DGGE) ...... 94 5.5 Discussion ...... 95 5.5.1 The physical-chemical changes in the restored tropical peat swamp soils...... 95 5.5.2 Changes in the activity and diversty of the soil microbial community in the restored tropical peat swamp soils ...... 95 5.5.3 Relationship between physical-chemical characteristics and activity and diversity of soil microbial community in tropical peat swamp soils ...... 96 5.6 Conclusion ...... 96 Acknowledgment ...... 97 Appendix A. Supplementary data ...... 97 References ...... 97

Chapter 6. General Discussion ...... 99 6.1 General Discussion ...... 100 6.2 Infuence of agricultural practices on biotic and abiotic properties of peat swamp soils ...... 100 6.3 Impact of burning activities before oil palm planting in peat swamp soil ...... 103 6.4 How to restore degraded tropical peat swamp soil and measure the success of this process? ...... 106

vii The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

6.5 Conclusion ...... 109 6.6 Future study ...... 109

References ...... 111

viii The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

ix The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

x The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Journal Papers Published from this Project

NURULITA, Y., ADETUTU, E.M., KADALI, K.K., ZUL, D., MANSUR, A.A. & BALL, A.S. 2015. The assessment of the impact of oil palm and rubber plantation on the biotic and abiotic properties of tropical peat swamp soil in Indonesia. International Journal of Agricultural Sustainability, 13, 150 - 166.

NURULITA, Y., ADETUTU, E.M., KADALI, K.K., SHAHSAVARI, E., ZUL, D., TAHA, M., & BALL, A. S. 2016. Assessment of the influence of oil palm and rubber plantation in tropical peat swamp soils using microbial diversity and activity analysis. Journal of Agricultural Chemistry and Environment, 5, 53 – 65.

NURULITA, Y., ADETUTU, E.M., GUNAWAN, H., ZUL, D., & BALL, A.S. 2016. Restoration of tropical peat soils: The application of soil microbiology for monitoring the success of the restoration process. Agriculture, Ecosystems and Environment, 216, 293 - 303.

xi The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

STATEMENT OF AUTHORSHIP

Three peer-reviewed paper have been published from this project in international journals and are presented as Chapter 3-5.

Yuana Nurulita (PhD Candidate) proposed the gap in knowledge, planned the experimental design, conducted the lab work, analysed and interpreted the results, wrote the manuscript draft and submitted the manuscript for evaluation.

Signed Yuana Nurulita Date: March 2016

Eric M. Adetutu contributed to data analysis, interpreted data and manuscript evaluation Krishna K. Kadali contributed to data analysis Esmaeil Shahsavari contributed to statistical data analysis and manuscript evaluation Delita Zul contributed to sample analysis Haris Gunawan contributed to experiment design of restoration area and sample analysis Abdulatif A. Mansur contributed to molecular analysis Mohamed Taha contributed to molecular analysis Andrew S. Ball contributed to experiment design, interpreted data, manuscript evaluation

All authors have contributed to manuscript evaluation, read and approved the final manuscript.

xii The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Abstract

Although occupying just 3-4% of the world’s landmass covering temperate, boreal and tropical areas, peatlands play an important role in conserving biodiversity and as a carbon sink. Current intensification of agricultural activities, especially in tropical areas, has led to increased use of tropical peatlands such as those in Indonesia. There is currently only limited information on the impact of this conversion. This project aimed to examine the effect of agricultural and restoration practices on the physico-chemical characteristics together with the activity and diversity of the microbial community present in tropical peat swamp soils. In addition, the impact of peat swamp restoration on microbial communities was also evaluated in an effort to monitor the success of the restoration process. To achieve this, analyses of physical, chemical and biological characteristics coupled with molecular biological analyses of peat swamp soils exposed to different human practices was carried out within the Giam Siak Kecil – Bukit Batu (GSKBB) Biosphere Reserve, Riau – Indonesia.

The first component of this study examined the impact of oil palm (burning and without burning) and rubber plantations (5-10 and >40 years old) on both the biotic and abiotic properties of the peatland soil through comparisons with soil from a natural forest. Based on analysis of the physico-chemical properties, soils from plantations demonstrated increased decomposition rates, as shown by a reduction in soil organic matter (4-18%), an increase in bulk density (ρb) (0.08 – 0.17 g cm-3) and an increase in bacterial biomass (0.6 – 5.9 fold) compared with natural forest peat soils. Moreover, drier conditions due to plantation management in peat swamp soil were found, with deeper water tables (45 – 67 cm) and reduced soil water holding capacities (22-53% reduction). However, community level physiological profiling (CLPP) showed impaired microbial community function only in soils from oil palm plantations. Oil palm plantation soil (without burning) showed the lowest microbial activities (50% decrease) and the lowest Shannon diversity values (2.90) compared to natural forest soils. In contrast, soil from young rubber plantations exhibited increased microbial activities (54%) and similar Shannon diversity values (3.13) compared to natural forest soils.

1 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

The second part of this study involved further assessment of the impact of oil palm and rubber plantations on tropical peatland soils using a polyphasic approach involving biochemical and molecular microbial assays. The concentration of ammonium, nitrate and phosphate observed in agricultural soils indicated a substantial increase compared with natural forest. These changes were accompanied by changes in the soil enzyme activity; reduced activities of β-glucosidase, cellobiohydrolase and acid phosphatase activities (50– 55% reduction) were detected in agricultural soils while increased chitinase activity was detected in the rubber plantation soil (37% increase). In terms of soil microbial community diversity, PCR-Denaturing Gradient Gel Electrophoresis (DGGE) based analysis showed that the soil bacterial community from agricultural soils exhibited the lowest similarity amongst the different microbial groups (bacteria, fungi and archaea) evaluated, showing only 34% similarity to the natural forest soil. The Shannon diversity index values further confirmed that the conversion of tropical peatland natural forest to agriculture resulted in the greatest impact on microbial diversity being significantly different compared with the natural forest. Overall, this study indicated substantial shifts in soil microbial activity and diversity occured upon conversion of natural peatland forest to agricultural areas.

The final stage of the study investigated the restoration process of burnt oil palm plantation through revegetation with native peat swamp forest plants and land rewetting through assessment of the activity and diversity of the soil microbial community together with soil chemical and physical characterisation. Overall, the physical-chemical characteristics of the restoration soils remained similar to the soil from the burnt oil palm plantation with increased depth of water table (5-6 times deeper), reduced water holding capacity (23- 35%), increased bulk density (ρb) (0.31–.32 g cm-3), an increase the C:N ratio (41:1) and higher ammonium and nitrate concentrations (4-17 times higher) when compared to the forest soil (p<0.05). Restoration, involving revegetation and land rewetting resulted in a significant decrease in the phosphate concentration of the restoration soils (4.722 mg kg-1) (p<0.05) compared with other soil samples. In terms of microbial diversity, PCR-DGGE revealed that the bacterial community of the restoration soil changed significantly (only 10% similarity), amongst the different microbial groups (fungal and archaeal communities).

2 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Principal Component Analyses (PCA) showed all three soil samples clustered individually with different dependent parameters. Overall, after 3.5 years of restoration, the degraded burnt oil palm plantation soils did not appear to be similar to the peat swamp natural forest soil.

Overall, this thesis contributes to our understanding of the impact of agricultural practices, especially oil palm and rubber plantations, on the microbial activity and diversity in tropical peat swamp soil. In addition, soil microbial ecology was found to be a useful indicator for use in the monitoring of the restoration process. Periodic analyses of soils under restoration using molecular microbial techniques are suggested as a useful tool for monitoring the success of the restoration process.

3 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

CHAPTER 1

General Introduction and Literature Review

4 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

1. Introduction

Peat swamp forests are important ecosystems for conserving unique biodiversity, moderating climate and energy fluxes through carbon sequestration, controlling soil erosion and promoting ecosystem stabilization (Harrison, 2013, Rieley et al., 2008, Sorensen, 1993). Unfortunately, this fragile ecosystem is under pressure from agriculture, agroforestry and silviculture (Pretty et al., 2011, Wosten et al., 1997). The conversion of peatlands from natural forest to other uses is usually accompanied by many negative effects on this environment. These include increased greenhouse gas emission (Oleszczuk et al., 2008), increased carbon loss through aerobic peat decomposition and reduction in carbon assimilation by photosynthesis (Nakane et al., 1996) as well as the loss of its vital functions such as a reservoir for unique biodiversity (Puglisi et al., 2014).

Due to high population growth in many tropical countries and associated land-use pressures, this ecosystem faces greater risk than temperate and boreal peatlands (Rieley et al., 1996, Vijarnsorn, 1996). Tropical peatland represents 11% of the global peatland area (441,025 km2), with 56% of it is Southeast Asia (247,779 km2) (Page et al., 2011). However, in the early 2000s, approximately 8800 km2 of tropical peatland was converted to oil palm plantation and 230,000 km2 of peat swamp forest was clear-felled and is currently listed as degraded lands (Koh et al., 2011). These disturbances have resulted in peat degradation. Peat burning associated with agricultural practices releases CO2 and increases drainage. It can also increase CO2 emission steadily through the acceleration of aerobic peat decomposition.

CO2 uptake by vegetation through photosynthesis is also reduced by shading due to dense smoke from peat fires ignited accidentally or deliberately for agricultural purposes (Hirano et al., 2012). Therefore, without due care, tropical peatlands can switch from their traditional roles as carbon sinks to sources of carbon to the atmosphere.

As a result of these adverse effects, current research focuses on developing measures to reduce peat swamp deforestation and to restore damaged peat forests. Several restoration practices have been conducted in tropical peatlands (Holden et al., 2007, Page et al., 2009b).

5 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Restoration work centers around land rewetting, revegetation of bare peat or shifting vegetation assemblage for raising the water table and rapid peat formation (Blundell and Holden, 2015, Holden et al., 2007, Parry et al., 2014b, Parry et al., 2014a). Replanting of native peat swamp tree species is an efficient restoration technique for damaged peatlands (Wösten et al., 2008) with accompanying beneficial effects on the diversity and abundance of soil eukaryotes (Jing et al., 2014). Restoration efforts have also included raising and stabilizing the water table level by blocking drainage canals which reduce aerobic peat decomposition in the flooded peatlands. All these practices can have positive influences on the physical-chemical and biological properties of peat swamp soil. Biological properties, especially those related to soil microorganisms, are believed to be more sensitive; confirms that changes in the soil ecosystem can be analysed by the activity and diversity of soil microbial communities. Thus, analysis of soil microbial activity and diversity alongside physic-chemical properties can be useful tools for evaluating peat swamp restoration projects.

Here, we examine the recent issues relating to tropical peat swamp forest degradation and examine methodologies involved in the management of these unique soils. The focus of this review is on biology coupled with physico-chemical aspects of tropical peat swamp soils.

1.1 What is peatland? Waterlogged or water-inundated land which become conducive to the development of hydrophytic vegetation are called wetlands (Osman, 2012). Due to their diversity and demarcation, there are many different definitions of wetland. The general definition, covers everything from tropical mangrove swamps to subarctic peatlands; Keddy (2000) stated that “a wetland is an ecosystem that arises when inundation by water produces soils dominated by anaerobic processes and forces the biota, particularly rooted plants, to exhibit adaptations to tolerate flooding”. The terminology describing wetland varies both among society and within scientific communities (Brinson, 2011, Keddy, 2000). The six basic types of wetland are swamps, marsh, bog, fen, wet meadow and shallow water. A swamp is dominated by trees while a marsh is dominated by herbaceous plants. Bogs are dominated

6 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. by Sphagnum moss, sedges, Ericaceous shrubs or evergreen trees rooted in deep peat, fen is usually dominated by sedges and grasses rooted in shallow peat, often with considerable water movement through the peat. Wet meadow and shallow water are distinguished by occasional and permanent flooding respectively. Osman (2012) and Brinson (2011) compiled the types and characteristics of wetlands (Table 1.1). These classifications try to summarize the major types of wetland vegetation and associate them with different sets of environmental conditions.

Table 1.1. Types of wetlands and its characteristics (Brinson, 2011, Osman, 2012) Systems/classes: Subsystems/subclasses Cowardin et al. (1985) -Marine: Subtidal and intertidal -Estuarine: Subtidal and intertidal -Riverine: Tidal, lower perennial, upper perennial and intermittent -Lacustrine: Littoral and limnetic -Palustrine: -

Classes within subsystem based on substrate material and flooding regime: -Rock bottom: bedrock, boulders or stones -Unconsolidated bottom: cobbles, gravel, sand, mud or organic material (these 2 classes are flooded all or most of time) -Rocky shore: bedrock, boulders or stones -Unconsolidated shore: cobbles, gravel, sand, mud or organic material (these 2 classes are exposed most of time) -Streambed: any substrates -Reef: substrate composed of the living and dead remains of invertebrates (corals, molluscs, or worms)

Classes on the basis of the life-form of the dominant vegetation: -Aquatic bed, dominated by plants that grow principally on or below the surface of the water -Moss-lichen wetland, dominated by mosses and lichens -Emergent wetland, dominated by emergent herbaceous angiosperms -Scrub-shrub wetland, dominated by shrubs or small trees -Forested wetland, dominated by large trees.

7 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Modifying terms applied to the classes or subclasses for the system -in tidal areas, water regimes modifiers by subtidal, irregularly exposed, regularly flooded and irregularly flooded. -in non-tidal areas, regimes are used permanently flooded, intermittently exposed, semi-permanently flooded, seasonally flooded, saturated, temporarily flooded, intermittently flooded and artificial flooded. The Ramsar Convention Marine/coastal wetlands, with subclasses permanent (Gardner and Davidson, shallow marine waters; marine subtidal aquatic beds; coral 2011, Osman, 2012) reefs; rocky marine shores; sand, shingle, or pebble shores; estuarine waters; intertidal mud, sand, or salt flats; intertidal marshes; intertidal forested wetlands; coastal brackish/saline lagoons; coastal freshwater lagoons; and karst and other subterranean hydrological systems.

Inland wetlands, with subclasses permanent inland deltas, permanent rivers/streams/creeks, seasonal/ intermittent/irregular rivers/streams/creeks, permanent freshwater lakes (over 8 ha), seasonal/intermittent freshwater lakes (over 8 ha), permanent saline/brackish/alkaline lakes, seasonal/intermittent saline/brackish/alkaline lakes, permanent saline/brackish/alkaline marshes/pools, seasonal/ intermittent saline/brackish/alkaline marshes/pools, permanent freshwater marshes/pools, seasonal/intermittent freshwater marshes/pools on inorganic soil, non-forested peatlands, alpine wetlands, tundra wetlands, shrub-dominated wetlands, freshwater tree-dominated wetlands, forested peatlands, freshwater springs, geothermal wetlands, and karst and other subterranean hydrological systems, inland.

Human-made wetlands, with subclasses aquaculture ponds, ponds, irrigated lands, seasonally flooded agricultural land, salt exploitation sites, water storage areas, excavations, wastewater treatment areas, canals and drainage channels, and karst and other subterranean hydrological systems. Keddy (2000) Swamp, marsh, bog, fen and truly aquatic plants (shallow water and wet meadow) Circular 39 (Shaw and Based on a geographically stratified approach Fredine, 1956) -inland fresh areas -inland saline areas

8 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

-coastal fresh areas -coastal saline area Semeniuk and Semeniuk Based on geographic regions in the world (1995) -lake and river (permanent inundation) -sumpland, creek, floodplain (seasonal inundation) -playa, wadi and barkarra (intermittent inundation) -dampland, trough, palusplain, paluslop and palusmont (seasonal waterlogging) Mistch and Gosselink, 1993 Bog, fen, mire, marsh, playa, slough, swamp, wet, meadow, and open water

A lack of oxygen is the main factor determining the rate of plant detritus decomposition in wetlands (Kayranli et al., 2010). These complicated processes (involving aerobic and anaerobic processes) lead to organic matter accumulation/sediments depending on the ratio between inputs and outputs of carbon (Figure 1.1). While respiratory processes occur in the aerobic zone (key process), fermentation, methanogenesis and sulphate, iron and nitrate reduction processes occur in the anaerobic zone. Bacterial oxidation of organic carbon subsequently results in mineralization, which is a process by which organic matter is converted to inorganic substances. While respiration is a conversion of carbohydrates to carbon dioxide, fermentation is the conversion of carbohydrates to chemical compounds not only carbon dioxide, but also lactic acid or ethanol. In a wetland, organic carbon is converted into compounds including carbon dioxide and methane and/or stored in plants, dead plant matter, microorganisms, or peat.

As a part of a wetland, peatland forests occupy 3-4% of the world surface (Blodau, 2002) and are found in arctic, boreal, temperate or tropical climates (Page et al., 2007). The wide distribution of peatland results in considerable temporal and spatial variability in different peatlands. Similar to wetlands, the term peatland covers a wide array of ecosystems types across the globe such as bogs, fens, fen-meadows, moors, peat-swamp forest and permafrost tundra (Andriesse, 1988, Joosten and Clarke, 2002). The basic classes of peatland ecosystems are ombrotrophic and minerotrophic (Thormann, 2006). Thormann (2006) suggested that based on peatlands in Canada, ombrotrophic peatlands receive water and nutrients solely from precipitation while minerotrophic peat ecosystems receive water and nutrients not only from precipitation, but also ground and/or surface water flow.

9 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Methane and carbon Carbon dioxide uptake dioxide fluxes

Air Carbon dioxide Methane and carbon dioxide fluxes Surface Decomposition Photosynthesis and Particulate Carbon water (Aerobic) respiration and output Oxidized soil Decomposition dissolved layer anaerobic carbon Reduced input soil layer Sulphate and nitrate reduction

Fermentation of dissolved organic carbon (lactic and ethanol) and methanogenesis Figure 1.1. Schematic diagram showing the major components of the carbon cycle occurring in peatland (adapted from Kayranli et al., 2010).

Sorensen (1993) showed that, based on Thormann’s (2006) assertions, Indonesian peatland, the largest tropical peatland area in Asia, has 3 types: topogenous, ombrogenous high peat and ombrogenous basin/coastal peat. Topogenous peat is formed in the topographic depression, with a high water table with nutrients from many sources such as mineral subsoil, river water and plant remains and rain (Posa et al., 2011). Ombrogenous peat has its surface above the surrounding land and there are no nutrients entering the system from a mineral soil, ground and river water (Andriesse, 1988, Sorensen, 1993). The vegetation utilizes nutrients solely from living biomass, peat and rain water. Ombrogenous high peat and basin/coastal peat are differentiated based on their topographic position; ombrogenous high peat is older than ombrogenous basin/coastal peat.

Estimations of carbon (C) storage in worldwide peatlands varies; for example, northern peatlands are estimated to store between 180 and 277 Gt C (Gorham, 1991), tropical peatlands may store 40-90 Gt C (Kurnianto et al., 2014), temperate peatlands have 462 Gt C (Mitra et al., 2005) and boreal and subarctic peatlands may store 270-370 Gt C (Turunen et al., 2002). Most of this C comes from litter accumulation and peat storage on the acrotelm

10 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

(oxygenated peat horizon) and the catotelm (anaerobic peat horizon). The highest decomposition rate is in the acrotelm, mediated by aerobic microorganisms (fungi and bacteria) resulting in CO2 production (Thormann, 2006). However, in the catotelm decomposition occurs very slowly and is mediated by anaerobic bacteria (Clymo, 1984). This results in CH4 production which is subsequently released to the atmosphere or oxidized by aerobic methanotrophic bacteria as it diffuses vertically through the acrotelm (Dedysh 2002; Wartiainen et al. 2003 in Thormann, 2006) (Figure 1.2).

Figure 1.2. Major carbon pathways in peatlands and the microbial groups (fungi and bacteria) responsible for the dominant biogeochemical processes (Figure reproduced from Thormann, 2006)

The carbon density of tropical peatlands is relatively high compared with temperate or boreal peatlands (up to 20 m of peat thickness) (Anderson, 1983, Page et al., 2002). The enormous carbon sink associated with peatland is caused by long-term accumulation of plant biomass under high humidity and acidic water-logged conditions (Kanokratana et al., 2011, Limpens et al., 2008, MacDicken, 2001, Maltby and Immirzi, 1993, Rieley and Setiadi, 1997, Sorensen, 1993).

11 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

1.2 Peat soil The lithosphere (the upper part of the earth’s crust) consists of rocks, minerals and soils. Soils are developed by rocks and minerals as parent materials that undergo weathering processes involving both physical breakdown and chemical alteration (Rowell, 1994). These natural unconsolidated materials are composed of solid particles (organic and inorganic matter), liquid and gas (Osman, 2012). Thus, the major components of soil are mineral matter, organic matter, water and air. Interestingly, there are only a few soils developed from organic parent materials. Under wet conditions, these materials are made by deposition of residues of past vegetation (Osman, 2013). The main factors that differentiate organic soil and mineral soil are presented in Table 1.2.

Table 1.2. A comparison of the key factors differentiating organic soil from mineral soil Factor Organic Soil Mineral Soil References Developed material Organic material, Rocks and minerals (Osman, 2013) vegetation Decomposition Incomplete Complete processes decomposition decomposition

Plant/organic Plant/organic residues + anaerobic residues + soil bacteria → PEAT + microbes + O2 → CH4 (in stagnant HUMUS + CO2 + H2O water or poor in oxygen) Average volume At least 25% organic 45% mineral matter, (Andriesse, 1988, composition soil (fresh, 5% organic matter Osman, 2012, undecomposed and (fully decomposed Sorensen, 1993) partially organic matter or decomposed organic humus) matter)

Generally, peat soils are composed of at least 65% organic matter and less than 35% mineral content at a depth of 30 – 80 cm (Andriesse, 1988, Joosten and Clarke, 2002, Sorensen, 1993). Peatland can be defined as a thick peat layer (exceeding 40 cm or 60 cm) created by the non- decomposition of dead leaves and wood (trees) due to waterlogged conditions over a long time period (Management, 2006). Various forms of peat exist from fibrous forms to soft crust forms, with some reaching very low pH (3-5).

12 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

1.3 Disturbance of peatlands – peat soil Peatlands have been rapidly disappearing due to agricultural and forestry activities (Hooijer et al., 2010) and are being harmed by illegal logging, drainage and burning (Yule, 2010). High populations are increasing demand for forest resources and increasing deforestation activity. Laurance (1999) concluded that tropical deforestation can be promoted by population pressure, weak government and poor policies, trade liberalization and tropical logging. Biodiversity in these tropical areas is at risk due to the loss and degradation of ecosystem function and services through overexploitation of peat swamp resources (Bradshaw et al., 2008). Annually between 1990 and 1997, the rate of deforestation of humid tropical forests was 0.52% and the rate of degradation was 0.20%, while the rate of regrowth was just 0.08% (Achard et al., 2002). Achard et al. (2002) also concluded that Southeast Asia has the highest rates of peat swamp forest degradation compared to Latin America and Africa. Fortunately, reforestation was dominant in Southeast Asia and followed by Latin America and Africa.

Koh et al. (2011) stated that 6% of tropical peatlands in Southeast Asia have been converted to oil palm (Elaeis guineensis) plantation by the early 2000s. In 2013, BPS (2013), Indonesian Statistics Bureau confirmed that oil palm plantation areas in Indonesia totaled 10,586 thousand ha with a production of 26,896 thousand tonnes. Sumatera Island particularly has been affected by oil palm plantation, with 47% of the total forest area of 8.3 million ha being converted to oil palm production (Koh et al., 2011). Figure 1.3 shows the area of tropical peatland that has been converted to oil palm plantation. Another important Indonesian agricultural commodity is rubber. Rubber (Hevea brasiliensis) plantation areas in Indonesia totaled 3,555 thousand ha with a total production of 3,108 thousand tonnes (BPS, 2013). In 2012 alone, in Riau Province, oil palm and rubber plantations on peat swamp soil (Pelalawan, Bengkalis, Rokan Hilir, Siak and Indragiri Hilir) produced 3528 and 1016 kg ha-1 of palm oil and rubber, respectively (Government, 2012).

13 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

1.4 Impact of agricultural practices on peatland The use of peatlands for agriculture results in a number of ecological and environment issues as the nature of the conversion process requires clearance, drainage, fertilizer application and liming to increase the pH and boost microbial activity (Andriesse, 1988, Posa et al., 2011). Nevertheless on a worldwide scale significant areas of peatlands have been converted to agriculture areas; in Europe 14%, in North America 13.4% and in Asia 22.3% (Table 1.3) (Oleszczuk et al., 2008). Despite this extensive conversion there has been only limited research into the impact of agricultural practices in terms of ecosystem services and the impact on soil microbial diversity and activity.

Figure 1.3. Distribution of closed canopy oil palm plantations and tropical peatlands in the lowlands of Peninsular, Malaysia, Borneo and Sumatera (Koh et al., 2011). PM: Peninsular Malaysia; SW: Sarawak; SB: Sabah; WK: West Kalimantan; CK: Central Kalimantan; SK: South Kalimantan; EK: East Kalimantan; AC: Aceh; NS: north Sumatera; RI: Riau; WS: West Sumatera; JB: Jambi; BK: Bengkulu; SS: South Sumatera; LP: Lampung

14 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Table 1.3. The area of peatland used for agricultural production in some countries of the world (compiled by Oleszczuk et al., 2008). Country Total peatland area Peatland area used for agriculture (km2) (km2) (%) Europe Belarus 23, 967 9,631 40 Estonia 10,091 1,300 13 Finland 94,000 2,000 2 Germany 14,200 12,000 85 Great Britain 17,549 720 4 Iceland 10,000 1,300 13 Ireland 11,757 896 8 Latvia 6,691 1,000 15 Lithuania 4,826 1,900 39 Netherland 20,350 17,300 85 Norway 23,700 1,905 8 Poland 10,877 7,620 70 Russia 568,000 70,400 12 Sweden 66,680 3,000 5 Ukraine 10,081 5,000 50 North America Canada 1,114,000 170,000 15 U.S.A 611,000 61,000 10 Asia Indonesia 200,728 42,000 20 Malaysia 25,890 8,285 32 China 10,440 2,610 25

The preparation of peat swamps for long-term cultivation and agricultural use has led to a number of effects including lowering of the water table, increased aeration and changed plant communities, all aimed at meeting the requirements of cultivated plants. The decline in peat soil moisture content leads to shrinkage of the peat layers resulting in mechanical compression of the permanently saturated peat layers. The combination of shrinkage and compaction causes subsidence of the peat soil surface. If the drying process continues, shrinkage cracks are formed. This allows oxygen to diffuse into the deep layers of the soil profile resulting in decomposition, mineralization and nitrification processes. Later, transformation of peat into new material (moorsh) occurs with a change in the structure of the peat from fibrous to amorphous, together with increasing bulk density. Long term

15 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. intensive land use (50 to 200 years) results in a larger proportion of aromatic structures (Kalbitz et al., 1999); for example a low lipid content and an increase in the proportion of humic acids in the humus (Orlov et al., 2000).

Potent greenhouse gases, methane (CH4), carbon dioxide (CO2) and nitrous oxide (N2O), can also be released by drainage of agriculture in peatlands; peatlands generally have a soil organic carbon content exceeding 30%. Drainage for agriculture increases CO2 and N2O emission, whilst decreasing CH4 emission through changes in the physical and hydraulic properties of the peat soils (Kasimir-Klemedtsson et al., 1997). Sakata et al. (2015) found that in the agricultural tropical peat soil especially for oil palm plantations, soil type influenced the fluxes of CO2 and NO2, but no effect of fertilizer treatment. Furthermore, agricultural tropical peat soil influences greenhouse gas emissions through microbial activities (Arai et al., 2014). Globally, peat soils and land use play an important role in the global budgets of these gases.

1.5 Restoration of peatland Considering the global importance of peatlands, their protection and restoration is critical to maintaining the significant biodiversity and hydrological functions they provide (Erwin, 2009). Currently, ecological rehabilitation is still based on trial and error (Zak et al., 2011). However, Page et al. (2009b) concluded that peatland restoration through vegetation rehabilitation, restoration of hydrology and rehabilitation of carbon sequestration and storage in Kalimantan, Indonesia could be effective. Vegetation rehabilitation coupled with inoculation of arbuscular mycorrhizal fungi which can improve the early growth of some tree species grown in peat swamp forest is proposed as a key technology to rehabilitate disturbed peatlands (Tawaraya et al., 2003). Further analysis of palaeoecological techniques in Keighley Moor Reservoir Catchment, Northern England showed that Sphagnum levels declined severely as a result of burning activity and the raising of the water table was recommended to encourage greater Sphagnum abundance (Blundell and Holden, 2015). Drain blocking techniques, gully blocking and reprofiling, together with bare peat stabilization are alternative restoration techniques that can improve peatland ecosystem

16 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. services (Parry et al., 2014b). However, the restoration technology used and the outcome achieved are very site dependent, due to spatial and temporal heterogeneity inherent in all peatland layers. Maintaining groundwater levels at 40 – 100 cm and replanting the damaged peatlands with native peat swamp tree species has also resulted in successful restoration (Wösten et al., 2008).

1.6 Monitoring the impact of human practices in peatland As a critical component of the earth’s biosphere, maintaining soil quality and health is important. Soil health and soil quality can be assessed through the evaluation of physical and chemical indicators and soil microbial dynamics. Criteria for indicators of soil quality and health relate to their utility in defining ecosystem processes integrating physical, chemical and biological properties (Arias et al., 2005, Doran and Parkin, 1996). Table 1.4 examines the most common soil indicators (Nortcliff, 2002). Each indicator does not stand alone, but must be supported by a number of soil attributes (Burger and Kelting, 1999).

Table 1.4. Indicators of soil quality (adapted from Nortcliff, 2002) Indicators Example Physical attributes Soil texture, bulk density, porosity, aggregate strength and stability, soil crusting, soil compaction and top soil depth Chemical attributes pH, salinity, aeration status, organic matter content, cation exchange capacity, status of plant nutrients, concentration of potential toxic elements Biological attributes The populations of macro-, meso-, and microorganisms, respiration rate Visible attributes Evidence of erosion, surface ponding of water, surface run-off and poor plant growth Soil organic matter as an Total soil organic carbon and nitrogen light fraction and indicator particulate macro-organic matter, mineralizable carbon and nitrogen, microbial biomass, soil carbohydrates and soil enzymes

1.6.1 Physical and chemical attributes Soil indicators, sensitive to variations in management, are needed to compare the effects of a management practice on soil. For example, in terms of the conversion of peatland to

17 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. agricultural activity, water and oxygen supply are often dramatically changed, perhaps through the installation of drainage channels. In this instance, bulk density is an ideal parameter to assess management effects (Schoenholtz et al., 2000). It also can be used to monitor the degree of soil compaction. Elemental analysis using peat soil combustion followed by gas chromatography and infrared detection of the carbon oxides represent another key soil indicator. Another indicator that is useful for analysis in peatlands is water holding capacity. Available water holding capacity measures the relative capacity of a soil to supply water. However, loss of ignition and bulk density analysis coupled with the Warren equation can give accurate results if expensive, sensitive equipment is not available (Farmer et al., 2014).

As previously mentioned, a set of indicators must be used as many soil processes are closely linked. For example, many soil chemical properties (e.g. nutrient and carbon supply) directly influence microbiological processes, and in turn these processes determine physical- chemical attributes. Soil pH is important for peatlands, not only because it is characteristic of peatlands especially tropical peat swamp soil which is highly acidic due to high organic matter (tannin, humic acid etc.) but it also provides direct information about critical soil processes and productivity capacity. Soil pH should be above 4.5 for agriculture; generally peatland soils require liming to increase the pH making the soil suitable for plant growth at the site (Schoenholtz et al., 2000). Other chemical parameters that are important for the agricultural management of peatlands and related to microbial activities are nutrient concentrations resulting mainly from processes such as decomposition and mineralization. Drainage management in peatland results in the lowering of the water table which exposes the peat soil to oxygen and triggers microbial decomposition of soil carbon. Parameters such as the soil C:N ratio and total organic carbon (C), nitrogen (N) and phosphorus (P) contents are also important parameters. Analysis of the soil carbon content can reveal the effect of human practices (Farmer et al., 2014); a high C:N ratio suggests low rates of decomposition. In peat soil, the carbon content is high due to low decomposition as a result of anaerobic and acidic conditions. However, for total N and P, concentrations will vary depending on the rate of decomposition.

18 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

1.6.2 Biological attributes Because of their short regeneration time, rapid evolutionary potential and large surface-to- volume ratios, soil microorganisms are sensitive and respond quickly to environmental changes compared to plants and animals (Andersen et al., 2013). It also reveal soil health because of the relationship between microbial diversity, soil and plant quality and ecosystem sustainability (Doran et al., 1994). Levine et al. (2011) stated that microbial diversity can be used to predict the impact of agriculture. In peatlands, any impact on soil microbial communities may, due to changed activities, affect carbon dynamics and nutrient cycling; thus these changes can influence the global climate (Andersen et al., 2013, Bardgett et al., 2008). Soil microorganisms play a fundamental role in ecosystem functioning through nutrient cycling, decomposition, mineralization and energy flow. The role that microorganisms play in determining soil quality can be determined by evaluating community structure and metabolic functions (Marinari et al., 2013). Examination of the functional and taxonomic diversity in ecosystems provide greater understanding of the relationship between microbial diversity and ecosystem function (Zak et al., 1994). The assessment of diversity within microbial communities is one of the most challenging and fascinating aspects of microbiology. It is therefore essential to fully assess and understand the shift in microbial communities and their activities as result of land-use changes. Girvan et al. (2003) said many studies have used bacterial communities to study the regulation of biogeochemical transformations in various kind of soils.

Microbial functional diversity is defined as the composition of microbial communities (described by the numbers, types, activities and rates of substrates is utilized) to perform and maintain ecosystem processes in the soil (Marinari et al., 2013, Zak et al., 1994). Examination of soil microbial diversity using molecular techniques can provide important information relating to the numerically dominant members of the community (Lynch et al., 2004). Functional diversity also provides information on the functioning of those members of the soil microflora involved in specific processes (Marinari et al., 2013). The development of effective methods for studying the diversity of microorganisms in soil habitats is essential for a broader understanding of soil health and soil quality, especially as it relates to peat

19 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. swamp forests. Figure 1.4 shows the techniques and their relationship between various microbial analyses. There are two main methods of analyzing microbial diversity; biochemical-based methods and molecular-based methods. All these types of community analyses are part of culture-dependent and –independent methods (Hill et al., 2000). These methods, together with their advantages and disadvantages are presented in Table 1.5.

ABUNDANCE RICHNESS ACTIVITY

Microscopic counts PLFA Respiration Viable plate counts FAME Decomposition Traditional Most probable number N/P mineralization approaches Microbial biomass Soil Enzymes ATP content

TAXONOMY/FUNCTION ACTIVITY/FUNCTION Whole soil FISH Labeled Soil sample Stable isotope probing molecular in situ PCR substrate STARFISH approaches

DIVERSITY Cloning Re-association kinetics Nucleic Acids Metagenomics RICHNESS/FUNCTION DNA RNA Nucleic Screening Hybridization acid RFLP Microarrays Sequencing PHYLOGENY analyses

Probes & Sequence primers Design Databases Accession

RICHNESS PCR ABUNDANCE Community Fingerprinting (or RT-PCR) PCR-based qPCR ARDRA ITS-PCR REP-PCR methods competitive PCR RAPD T-RFLP DGGE Excise bands

Figure 1.4. Overview of traditional and molecular techniques used in soil ecology studies (from Thies, 2006) . ATP; adenosine triphosphate PLFA; phospholipid fatty acids, FAME; Fatty Acid Methyl Esters, FISH; Fluorescence in Situ Hybridization, PCR; polymerase chain reaction, STARFISH; substrate tracking autoradiographic fluorescence in situ hybridization, DNA; deoxyribonucleic acids, RNA; ribonucleic

20 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

acids, RFLP; RT-PCR; Reverse Transcriptase PCR, ARDRA: Amplified Ribosomal DNA Restriction Analysis, ITS-PCR; the Internal Transcribed Spacer PCR, RAPD; Random Amplification of Polymorphic DNA, T-RFLP; Terminal Restriction Fragment Length Polymorphism, DGGE; Denaturing Gradient Gel Electrophoresis, qPCR; Quantitative PCR.

Given the importance of this research area, it is no surprise that there has recently been a number of papers using soil indicators to assess the impact of human disturbance on peatland ecosystems. For example, Huat et al. (2011) and Hogg et al. (1992) used physical properties to predict peatland profiles due to land disturbances. Joosten and Clarke (2002) assessed the influence of drought-induced acidification using chemical properties coupled with physical properties. However few studies have included assessment of soil microbial diversity and activity; yet their assessment will improve our understanding of the impact of agricultural practice on the ecosystem functioning of peatland soils. Mishra et al. (2013) reported the initial analysis of the soil microbial community together with metabolic profiling to identify the influence of changing water table and land-use patterns. Fenner et al. (2005) concluded that hydrological effects in peatland can be assessed by measurement of the diversity of specific bacteria such as phenolics-degrading bacteria.

Table 1.5. Advantages and disadvantages of current methods of studying soil microbial diversity (Hill et al., 2000, Kirk et al., 2004, Van Elsas and Boersma, 2011, Valášková and Baldrian, 2009). Method Advantages Disadvantages Selected references Biochemical-based methods Plate counts Fast Unculturable Tabacchioni et al. Inexpensive microorganisms not (2000), Trevors (1998) detected Bias towards fast growing individuals Bias towards fungal species that produce large quantities of spores Community level Fast Only represent the Classen et al. (2003), physiological Highly reproducible culturable fraction of Garland (1996b), profiling (CLPP) Relatively inexpensive a community Garland and Mills Differentiate between Favours fast growing (1991) microbial organism communities Only represents Generates large amount microorganisms of data capable of utilizing

21 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Option of using available carbon bacterial, fungal plates sources or site specific carbon Potential metabolic source (Biolog) diversity, not in situ diversity Sensitive to inoculum density Fatty acid methyl ester No culturing of If using fungal spores, a Graham et al. (1995), analysis (FAME) microorganisms lot of material is Siciliano and Germida required, direct needed (1998), Zelles (1999) extraction from soil Can be influenced by Can follow specific external factors organism or Possibility results can communities be confounded by other microorganisms Molecular-based methods Guanine plus cytosine Not influenced by PCR Requires large Tiedje et al. (1999), biases quantities of DNA Nüsslein and Tiedje Includes all DNA Dependent on lysing (1999) extracted quantitative and extraction Includes rare members efficiency of the community Coarse level of resolution Nucleic acid Total DNA extracted Lack of sensitivity Torsvik et al. (1996), reassociation and Not influence by PCR Sequences need to be in Torsvik et al. (1990b), hybridization biases high copy number to Torsvik et al. (1990a), Study DNA or RNA be detected Cho and Tiedje (2001) can be studied in situ Dependent on lysing and extraction efficiency DNA microarrays and Same as nucleic acid Only detect the most Hubert et al. (1999), DNA hybridization hybridization abundant species, Cho and Tiedje (2001), Thousands of genes can sequences correspond Greene and Voordouw be analysed to probes (2003), Shalon et al. If using genes or DNA Need to be able to (1996) fragments, increased culture organisms specificity, no bias due Only accurate in low to PCR diversity systems Denaturing and Large number of PCR biases Muyzer et al. (1993), temperature gradient samples can be Dependent on lysing Duineveld et al. (2001), gel electrophoresis analyzed and extraction Maarit Niemi et al. (DGGE and TGGE) simultaneously efficiency (2001), Reliable, reproducible Sample handling can and rapid influence community Provide full sequences i.e. if store too long that can be subject to before extraction further analysis community can change One band can represent more than one species (co-migration) Only detect dominant species Gel-to-gel variation

22 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Requires PCR primer design (GC clamp) Only short sequences <400 bp can be analyzed using TGGE Single strand Same as DGGE/TGGE PCR biases Lee et al. (1996), Tiedje conformation No GC clamp Some ssDNA can form et al. (1999), Dohrmann polymorphism (SSCP) No gradient more than one stable and Tebbe (2004) Technically simple gel conformation, variant preparation folding of single strand molecules Only short sequences <200 bp can be analysed Amplified ribosomal Detect structural PCR biases Liu et al. (1997), Tiedje DNA restriction changes in the Banding pattern often et al. (1999) analysis (ARDRA) or microbial community too complex restriction fragment length polymorphism (RFLP) Terminal restriction Simpler banding Dependent on Tiedje et al. (1999), fragment length patterns than RFLP extraction and lysing Dunbar et al. (2000), polymorphism (T- Can be automated; large efficiency Osborn et al. (2000), Liu RFLP) number of samples PCR biases et al. (1997) Highly reproducible Type of Taq can Compare differences in increase variability microbial Dependent on choice of communities/high universal primers discrimination power Choice of restriction (number of enzymes will types/analysis) influence community fingerprint Low phylogenetic specificity of terminal restriction sites Ribosomal intergenic Technically simple Requires large Fisher and Triplett spacer analysis Highly reproducible quantities of DNA (1999) intergenic spacer community profiles Low discrimination analysis (ARISA) power Stable isotope probing Isolation of an tire Highly dependent on Uhlík et al. (2009), community involved separation during Malik et al. (2008), in the metabolism of a ultracentrifugation Radajewski et al. (2000) substrate High-throughput All-at-once analysis in Methods are error- Van Elsas and Boersma sequencing: high-throughput prone (2011), Su et al. (2012) -metagenome High potential for Caution with -metatranscriptome comparative studies interpretation of data -metaproteomics Large amounts of needed -single-cell genomics information on total and active members of the community at sequence level

23 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

The study of microbial diversity and function using conventional method such as selective isolation plating and culturing can be biased due to the fact that most soil microorganisms cannot be cultured (Hill et al., 2000) or easily observed under the microscope (Torsvik and Øvreås, 2002). Community-level physiological profiles (CLPP), which assesses bacterial diversity based on the utilization of different carbon sources, still has bias problems making in interpretation problematic (Hill et al., 2000). To overcome these issues, molecular methods involving culture-independent methods have provided a new understanding of the phylogenetic diversity of microbial communities in soil. Metagenomics and bioinformatics are new methods that provide information on microbial taxonomy and functionality based on the characterization of microbial DNA and RNA. Combining culture-dependent and independent methods of community analysis can be a useful approach to tackle all these problems (Van Elsas and Boersma, 2011). For example Yang et al. (2001) successfully evaluated phyllosphere microbial communities on leaves of field-grown plant species using culture-dependent and –independent methods.

Studies based on the use of both biochemical and molecular approaches can reveal useful information relating to soil microbial diversity and activity with regards to the impact of agroecosystem practices. In a study of the impact of intensive-managed agricultural land in the Central Valley of California, Bowles et al. (2014) used soil physico-chemical characteristics, enzyme activities and FAME analysis to show that differences in organic agroecosystem management only influenced soil nutrient and enzyme activities; no effect on soil microbial communities was observed. Microbial communities could adapt efficiently through changing their nutrient cycling capacity. A study examining the influence of soil depth, soil orders and forest type in Northeast Puerto Rico using analysis of enzyme activities and microbial community structure (based on PLFA analysis) showed that shifts in community structure may contribute increased enzyme activity in deep soils (Stone et al., 2014). Another study on the short-term impact of a mineral amendment using biochemical (CLPP) and molecular (PCR) methods showed that bacterial communities involved in soil mineral weathering can be influenced by the bioavailability of nutritive cations (Lepleux et al., 2013). Thus, measurement of activity and diversity of soil microorganisms appears to be

24 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. one key soil health indicator. Table 1.6 lists related studies about involving the measurement of microbial diversity and function used to assess peatland ecosystems

Table 1.6. Methods and primers sets used to assess microbial diversity and/or microbial functionality of wetland/peatland/peat swamp soils Samples Methods Primers References Sediment and soil of PCR, DGGE and pA and pH Kowalchuk et al. inside and outside Oligonucleotide (Eubacterial (1998) of the root zone at probe hybridisation primers) Lake Drontermeer, the Netherlands. Methanogenic PCR, clone DNA, Archaeal 16S rRNA Sizova et al. (2003) consortia collected RFLP, FISH position 109 under Eriophorum through 934 (A109f, Sphagnum and A934b, A112f and Carex-Sphagnum A533b) plant associations in incubation of peat soil Agricultural soil PCR, clone DNA and mcrA-f and mcrA-r Castro et al. (2004) samples from the RFLP (mcr genes, northern Florida methanogen Everglades during assemblages) two seasons, spring and summer Rice roots from rice PCR, clone DNA, T- Ar109f and Ar915r Lu et al. (2005) fields in Vercelli, RFLP and SIP Italy Sediments from PCR, T-RFLP 8F and 926R Angeloni et al. Cheboygan Marsh, a (bacteria) (2006) coastal freshwater nirS1F and nirS6R wetland (nirS, denitrifier) nirK1F and nirK5R (nirK, denitrifier) Soil samples from PCR, clone DNA BSF 343/15 and Hartman et al. the North Caroline BSR 926/20 (2008) coastal plain Wetland Biolog®Ecoplates, Weber et al. (2008) mesocosms Sediments of Extracellular Bac1070f and Jackson et al. (2009) Malaysian peat enzyme activity, Univ1392rGC swamp forest based PCR, DGGE, (bacteria) on depth

25 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Arc931f and Univ1392rGC (archaea) Bac8f and Univ 1492r (cloning bacteria) Arc2f and Univ1492r (cloning archaea) Marsh-pond-marsh PCR, DGGE PRBA338f and Dong and Reddy (MPM) wetland PRUN518r (2010) soils (bacterial V3 region) Peat samples from PLFAs and Biolog Andersen et al. the Bois-des-Bel Ecoplates (CLPP) (2010) Ecological Field Station, in Québec, Canada Paddy field soil in Physicochemical 341FGC and 534R Huang et al. (2013) Yanting, Sichuan properties, (bacteria) Biolog®Ecoplates, PCR, DGGE Water sample from High-throughput 27F and 519R Quiroga et al. (2015) pools in a sub- sequencing Antarctic peat bog Soil from bogs in qPCR, T-RFLP, SIP 27F-FAM and 907r Deng et al. (2016) plateau wetlands

1.6.3 Polymerase chain reaction (PCR) and Denaturation gradient gel electrophoresis (DGGE) Nucleic acids provide information about an organism’s genetic composition and allow its classification. The nucleic acids (DNA/RNA) in a soil sample have to be extracted from the solid phase. Nucleic acid extraction can use indirect (cell fractionation) or direct lysis (Nybroe et al., 2007). In cell fractionation, microbial cells are initially extracted from the soil matrix by, for example density gradient centrifugation then chemically lysed and nucleic acids separated from the cell debris and purified. In direct lysis, microbial cells are lysed directly in the soil; microbial cells are not separated from the soil matrix prior to cell lysis. Table 1.7 describes the advantages and disadvantages of indirect and direct lysis of DNA from soils. After extraction, DNA is separated from the cell wall debris and other cell contents

26 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. by a series of precipitation, binding and elution steps. Contaminants, such as humic substances are also common problems that may interfere with PCR amplification. Due to the high concentration of organic matter and humic acids in peat soil, methods to reduce contaminants are compulsory; for example post-PCR DNA clean–up kits can be used or a washing step with dilute EDTA, or passage of the extract through a Sephadex G-75 column (Thies, 2006).

Table 1.7. Advantages and disadvantages of indirect and direct lysis of DNA extraction from soil (Nybroe et al., 2007) Indirect lysis Direct lysis Advantages Minimizing the co-extraction of Provide the highest DNA yields enzyme inhibitors like humic Efficient for targeting cells which acids are easy to lyse but strongly attached to soil particles Disadvantages Highly dependent on an efficient Contamination with humic acids and unbiased separation of Need optimization of the cells from soil aggregates purification steps

Obtaining a sample that is representative of the resident community and an extract free of contaminants that could interfere with subsequent analyses such as PCR or hybridization with nucleic acid probes are important and challenging concerns. Cells in the resting state and near starvation are more difficult to lyse than cells growing rapidly in culture media. However, any manipulation of the nucleic acid extract can lead to loss of material or representative members of community. Furthermore, all post-extraction clean-up procedures add extra expense and processing time. After extraction from the soil sample, qualitative and quantitative analysis of the DNA/RNA extract must be carried out. Fluorimetry or SYBR Green I dye and gel electrophoresis as well as a UV spectrophotometer measuring the ratio of OD260/OD280 (DNA : contaminant ratio) are among the most common methods used.

DNA analysis has been used most frequently because DNA is more stable and easier and less costly to extract from soil. However the use of DNA does not allow determination of the abundance or level of activity of different organisms in a sample; dead or dormant cells will

27 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. be extracted together with active cells. While RNA will overcome these limitations, RNA is highly labile and often difficult to extract from soil. Practically, only rRNA can be extracted with reasonable efficiency from soil. For examination of gene expression, mRNA can be used, but considerable difficulty will be experienced in mRNA isolation from soil due to the fact that mRNA is extremely short-lived and frequently being transcribed and translated simultaneously in prokaryotes. Further steps require first reverse-transcription into cDNA, then using cDNA for further analysis. The advantage of using RNA is that it generally represents only active metabolizing cells which produce large quantities of mRNA. Thus analysis of RNA is more reflective of the portion of the active soil microbial community.

PCR is a powerful technique for the measurement of genotypic variation, identifying taxonomic unit and defining genetic relationships. PCR is the most widely used method for the amplification of the 16S rRNA, or its genes, prior to profiling studies. PCR involves the separation of a double-stranded DNA template into two strands (denaturation) by heat, the hybridization (annealing) of the oligonucleotides primers (short strands of nucleotides of a known sequence) to the template DNA, and extension (elongation) of the primers-template hybrid by a thermostable DNA polymerase (Figure 1.5).

There are many PCR protocols for the specific, sensitive detection of nucleic acid sequences (Pepper and Dowd, 2002). Generally, the principles of PCR are as follows; the reagents are repeatedly cycled through a set of three temperatures. Normal PCR uses raised temperature (92-96°C) to denature the template DNA, decreased temperature to allow the primers to attach to their target sequences in the single strand template, then raised to 72°C or an ideal temperature for the DNA polymerase activity to extend the primers, based on copying of the primer-targeted sequences. This cycle usually is repeated 25 to 30 times.

There are some modifications of PCR which may be applied depending on the condition of the DNA samples and the genes targeted. Nested PCR is the initial basic PCR but followed by a second complete PCR in which a new set of primers is used to sequence within the product of the first PCR. Touchdown PCR is carried out in order to increase the specificity and

28 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. sensitivity of the PCR. This PCR involves the steady increase or gradual decrease of the annealing temperature during the cycles of the PCR. Another PCR method is Hot-Start PCR. Hot-Start PCR is effective for decreasing the formation of non-specific products, enhancing the amplification and reducing the formation of primer dimers and cold fusion products. This is carried out by mixing all the reagents minus one essential reagent for the reaction to commence, then heating at 95°C for 5 to 10 minutes before bringing down the temperature to 80°C. Usually the missing ingredient is the DNA polymerase or the Mg2+, which is then added when the temperature is 80°C and the cycling is then started. Reducing primer dimers and cold fusion products can also be achieved through the use of booster PCR. This type of PCR involves the addition of primers up to final concentration of 0.1 µM after 15 cycles and followed by another 30-40 cycles. If using or designing primers with higher annealing temperatures (more than 65°C), two-step PCR can be used with a combination of the annealing and extension phase resulting in a two-temperature-cycle PCR. This mode provides maximal specificity and reduces the reaction time. Another PCR method is multiplex PCR which involves the use of multiple sets of primers and results in multiple products of amplification enabling the detection of more than one organism in one PCR.

One relatively recent innovation is reverse transcriptase PCR (RT-PCR). This is different to normal PCR as it starts with RNA as the template and uses the enzyme RT, which is an RNA- dependent DNA polymerase. The enzyme is used to make a cDNA copy of a single-stranded RNA sequence. The cDNA is a complimentary copy of the bases in the RNA except that thymine replaces uracil. In the first cycle of PCR, a strand complimentary to the RNA is formed. This is performed using the enzyme RT. Following, the RT-catalyzed formation of cDNA from the RNA, the reaction mixture can then subjected to normal PCR with Taq polymerase.

Thies (2006) concluded that the main sources of bias that must be considered when using PCR are: (1) use of very small sample size, which may represent only a small fraction of the whole soil community; (2) preferential binding and subsequent amplification of DNA polymerase; (3) multiple copies of the target operons of many bacteria result in

29 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. overrepresentation among amplification products; (4) using too many cycles in PCR, resulting in the formation of double-stranded DNA derived from different organisms. In addition, sample collection, transportation and storage of samples prior to extraction may bias the microbial analysis of native communities. However overall, although PCR-based experiments have disadvantages, this method has provided a new understanding of the phylogenetic diversity of microbial communities in soil especially when integrated with other methods.

30 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Figure 1.5. The stages of the polymerase chain reaction. The left part illustrates how the DNA template and primers interact to copy the target DNA. The right box is the example of temperature variation in a thermal cycler during traction (adapted from Thies, 2006).

To distinguish differences in the genetic makeup of microbial populations between samples, molecular fingerprinting from amplification can be carried out using denaturing gradient gel electrophoresis (DGGE) (Muyzer et al., 1993) (Figure 1.6). This technique is based on the electrophoretic mobility of nucleic acid sequences in a polyacrylamide gel in the presence of a denaturant such as urea and formamide and constant temperature (Fischer and Lerman, 1980). The mobility of the DNA in the gel depends on the duplex stability of DNA sequence and nucleotide interactions (Whyte and Greer, 2005). The double stranded DNA from microbial community is partially melted resulting in the retardation of its electrophoretic mobility, and the subsequent fingerprint pattern. The pattern is caused by variation in the sequences of different DNA fragments of the same length. Migration of partially melted DNA molecules will be slower than that of complete double stranded DNA. This results in a pattern or finger prints which can be used to differentiate between microbial community structures within an environment (Muyzer et al., 1993).

To maximize the separation of the DNA fragments within the polyacrylamide gel, about 30- 50 nucleotide sequences of guanines (G) and cytosine (C) (GC-clamp) can be added to the 5- prime end of the PCR primers; this allows the incorporation of the GC-clamp into the PCR amplification (Myers et al., 1985). The GC-clamp acts as a high melting domain which prevents the complete dissociation of the DNA fragments into single strands and ensures that fragments differing by even a single base substitution can be separated (Myers et al., 1985). The DNA migrates along the gel, exposed to a gradual increase in denaturing conditions. The separated DNA molecules can be visualized using nucleic acid dyes such as ethidium bromide, SYBR GREEN I or silver nitrate (Muyzer and Smalla, 1998).

31 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

The resultant fingerprints can be analysed using statistical methods such as unweighted paired matched group analysis (UPMGA), Shannon Weaver indices, principal component analysis and moving windows analysis among others. Further analysis with DGGE band excision followed by sequence analysis can give detailed information of some of the community members (Machado de Oliveira et al., 2007).

The advantages of these techniques is that they are rapid in comparison with sequencing methods, thus enabling high sample throughput, and can be used to target sequences that are phylogenetically or functionally significant (Thies, 2006). The major limitations of the DGGE technique include (1) only relative small fragments (up to 500 bp) can be separated, limiting the information available, allowing for only a incomplete phylogenetic inference (Myers et al., 1985). (2) Sequences amplified from DNA of different organisms may have similar melting properties in the presence of the denaturant and thus occupy the same band in the denaturing gel, thus one cannot differentiate between fragments that migrate to the same position (Jackson et al., 2000, Sekiguchi et al., 2001). To circumvent this problem cloning of the re-amplified DGGE excised bands can be carried out. However this does not resolve the effect co-migrating bands on the structural diversity of the microbial community. (3) DGGE can only reveal members of the population that represent about 1% of the total bacterial community in an environment thereby giving partial information on the community structure and diversity (Marzorati et al., 2008).

32 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Figure 1.6. (A) Schematic representation of the denaturing gradient gel electrophoresis (DGGE) technique. In DGGE, the forward primer (e.g. f318) is tagged with a GC clamp to prevent the double strains from completely separating. Along with the reverse primer (e.g. r518), it amplifies the V3 region of the 16S rRNA gene in target DNA. (B) when amplified DNA product are loaded on a denaturing gradient gel and run in an electric field, the product separate according the their total ratio of A:T vs G:C base pairs and the locations of these base pairs relative to each other (adapted from Theis, 2006)

1.6.4 Community level physiological profile (CLPP) as a tool to assess the impact of human practices Microbial communities have a great potential for temporal and spatial change, and therefore represent a powerful tool for understanding community dynamics in both basic and applied

33 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. ecological contexts. Here, to understand the impact of agricultural practices on peat swamp soil, this analysis can be more useful than physico-chemical analysis alone. In this method of community analysis, the differences in sole carbon source utilization of a soil community (Table 1.8) can be used to distinguish between different microbial communities and considered an therefore ecologically important approach (Nannipieri et al., 2002). The technique, coupled with the use of dyes, such as tetrazolium violet and incorporation of these dyes into microtitre plates, has allowed for the rapid profiling of sole carbon source utilization by bacterial communities (Garland and Mills, 1991). The CLPP method requires the extraction of cells from a soil sample, which is inoculated directly onto microtitre plates containing commercially available sole-carbon source (e.g. Biolog Ecoplates). A data set of optical density (OD) values is obtained over time of incubation from the colorimetric assessment of the reduction of a tetrazolium dye.

Table 1.8. Sole carbon sources present in Biolog® Eco-plates (adapted from Borrero et al., 2006) Amines Carbohydrates Carboxylic acids Polymers Putrescine α-D-Lactose α-Ketobutyric acid α-Cyclodextrin Phenyl ethylamine β-Methyl-D-glucoside D-Malic acid Glycogen cellobiose Itaconic acid Tween40 Amino acids D-Mannitol Pyruvic acid methyl Tween80 L-Arginine I-Erythritol ester L-Asparagine Glucose-1-phosphate γ-Hydroxy butyric acid Phenolic compounds L-Phenylalanine Xylose 2-Hydroxy benzoic acid L-Serine D-Galactonic acid lactone Acids derived from 4- Hydroxy benzoic acid L-Threonine N-Acetyl-D-glucosamine carbohydrate Glycyl-L-glutamic acid D,L-α-Glicerol phosphate D-Galacturonic acid D-Glucosaminic acid

This method measure the response not only of culturable cells, but also non-culturable cells (Garland and Lehman, 1999). This approach avoids the bias associated with traditional culturing techniques (Preston-Mafham et al., 2002). Furthermore, CLPP provides a rapid and simple technique (Nannipieri et al., 2002) as well as an analytically valid, reproducible result that allows for the discrimination of bacterial communities from diverse environmental samples using a one-to-one comparison (San Miguel et al., 2007). The ability to reveal the changes of microbial communities, both the initial work and subsequent studies can use

34 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. distinctive multivariate profiles of carbon source utilization among a variety of microbial communities (Garland and Mills, 1991).

The interpretation of CLPP is interrelated with analytical questions since it is provides a complex multivariate response. There are three major components of CLPP: (1) the overall rate of activity, (2) diversity of response, and (3) patterns of utilisation. The overall rate can be estimated by the rate of average well colour development (AWCD) and is a function of inoculum density (Garland, 1996a) which therefore must always be standardised. The diversity is a function of both the richness (i.e. the number of positive tests) and the evenness (i.e. variation in colour development among wells) of response. The threshold for a positive test can be defined as any positive value after background correction (Vahjen et al., 1995), although a higher positive value such as 0.25 absorbance units may eliminate weak false positive response (Garland, 1996a). The response pattern can be analysed using multivariate statistical techniques (i.e. clustering; Winding (1994), principal component analysis; Garland and Mills (1991) and canonical correspondence analysis Bossio and Scow (1995)).

The disadvantages associated with using this method are that it does not necessarily indicate that such metabolism would occur in the field (Garland and Lehman, 1999) and may give an incomplete picture of the microbial community’s functional structure (Preston- Mafham et al., 2002) (Table 1.9).

Table 1.9. Advantages and disadvantages of the Biolog Techniques (adapted from Nannipieri et al., 2002) Advantages Disadvantages Simple and rapid Fungi are not involved in the carbon Use of organic carbon substrates, a key substrate utilization profiles, factor in governing microbial growth in Only culturable microorganism provide soils, information, Patterns of carbon source oxidation are Changes in the microbial community reproducible and habitat-specific structure may occur during incubation.

1.6.5 Using soil enzyme activities to assess the impact of human practices To understand how human activity changes biogeochemical cycles in ecosystems, soil enzyme activities have been widely used (Dick et al., 1997, Bandick and Dick, 1999).

35 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

However, microbial ecosystems that are typified by diverse microbial interactions and competition result in highly complex microbial networks and metabolic dynamics. Thus, it is impossible to select key enzymes that are involved in all these reactions. Marinari et al. (2000) used acid phosphatase, dehydrogenase and protease to describe the influence of organic and mineral fertiliser. Jackson and Vallaire (2009) used β-glucosidase, N-acetyl glucosaminase and acid phosphatase to assess the effect of salinity and nutrient in Louisiana Wetland sediments. Ushio et al. (2010) used acid phosphatase, β-D-glucosidase and phenol oxidase to describe the effects of tree species on soil physicochemical and microbial properties. In a recent paper by Tischer et al. (2014), six hydrolytic enzymes including α and β glucosidase were used to investigate the effects of land-use change. Generally, acid phosphatase and β- glucosidase are the most commonly used enzymes for assessment of the impact of land-use change.

Lupwayi et al. (2009) stated that Biolog EcoPlates gave unclear responses in studies on the effect of herbicides on soil microbial communities. Floch et al. (2011) concluded that in describing changes in the functional diversity of soil microbial communities, the sensitivity of soil enzyme activity measurement were found to be greater than that of Biolog EcoPlates. Environmental effects and ecological interactions alter the rate of enzyme production and the fate of produced enzymes (Kandeler et al., 1996). Thus, it is important to analyse soil enzyme activities coupled with CLPP/Biolog Ecoplates to get a fuller understanding of the impact of a parameter or treatment on the soil microbial activity and diversity. Due to the involvement of many biochemical reaction in the soil (such as soil organic matter decomposition and synthesis and nutrient cycling), soil enzyme activities are important indicators of soil microbiological and biochemical processes (Dick et al., 1997, Nannipieri et al., 2002).

The assays of soil enzymes are generally simple, accurate, sensitive and relatively rapid (Nannipieri et al., 2012b). However, Nannipieri et al. (2012a) guarded that using enzyme activities as indicators of soil functions is problematic because the meaning of the measured enzyme activities is unclear. Poor substrate solubility, adsorption of substrates and reaction

36 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. products to soil particles, interferences of soil components to the determination of reaction products or substrates, choice of buffer are among the problems associated with soil enzyme analyses (Nannipieri, 2011). However the use of soluble substrates such as p-nitrophenyl phosphate and it’s derivates has been shown to be a sensitive and reliable method to determine soil enzyme activity (Tabatabai and Bremner, 1969). A calibration curve of different amounts of p-nitrophenyl with the soil under study is needed due to the fact that the released p-nitrophenyl can sometimes be adsorbed to soil particles (Gianfreda and Ruggiero, 2006). Using optimal parameters (pH and substrate concentration) are recommended. This results in an estimation of the maximum potential soil enzyme activity, providing reproducible assay conditions for comparing enzyme activities among different studies (Dick and Burns, 2011, Nannipieri et al., 2012a).

In this research, the impact of agricultural practices (oil palm and rubber plantations) and restoration in tropical peat swamp forest were assessed on the soil microbial activity and diversity using physical-chemical characteristics coupled with biological analyses (using culture dependent and independent methods).

1.6.6 The site history The Giam Siak Kecil – Bukit Batu landscape, representing tropical peat swamp forest, was selected for the study. This region, occupying with 698,663 ha, forms the Biosphere Reserve (BR) which is listed as a World Heritage Forest Site (Gunawan et al., 2012, Persic and Ocloo, 2011). It contains a unique peat swamp forest in which peat depth can reach up to 20 m (Sukara and Purwanto, 2009, Sutapa, 2009). This area consists of primary and secondary pristine forest and agriculture areas for local people and for company activities. Most of the area is unexplored in terms of its microbial diversity and functionality. Many human activities occur in the GSKBB and surrounding areas; this has resulted in significant ecosystem and ecological disturbance of this area. The activities include forest clearing, forest fires, illegal logging, industrial forestry replanting and agriculture. These activities can affect the environment and change microbial diversity and activity.

37 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

1.7 Aims and Objectives Using analysis of physico-chemical and biological analyses, this thesis focuses on the impact of agricultural practices and peatland restoration on the activity and diversity of soil microbial communities in the Giam Siak Kecil – Bukit Batu Biosphere Reserve. The specific aims are as follows: 1. To assess the impact of agricultural practices on biotic and abiotic properties in tropical peat swamp soil, especially the greatest agricultural commodities of Indonesia; oil palm and rubber plantations. 2. To investigate the impact of these agricultural practices on microbial function and diversity in the tropical peat swamp soils. 3. To investigate the process of peat swamp soil restoration practices using land re- wetting and re-vegetation with native peat swamp forest plants methods on microbial function and diversity.

38 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

CHAPTER 2

General Materials and Methods

39 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

2. Materials and Methods

The general materials and methods used throughout the research program are described in this chapter. Specific materials and methods related to individual Research Chapter are presented in detail in the relevant Chapters. 2.1. Study sites Study sites were selected in the Giam Siak Kecil – Bukit Batu (GSKBB) Biosphere Reverse in Indonesia, representing a tropical peat swamp forest of 698,663 ha. It is located in Riau Province on the Island of Sumatera. This landscape is listed as a World Heritage Forest Site (Gunawan et al., 2012, Persic and Ocloo, 2011). It contains a unique peat swamp forest (tropical peatland) in which peat depth can reach up to 20 m (Sukara and Purwanto, 2009, Sutapa, 2009). There are two seasons; wet and dry. The GSKBB reserve consists of natural forest and agricultural areas for local people and companies. Forest clearing and burning for agricultural purposes, illegal logging and industrial forestry replanting are known to occur in the agricultural areas. The natural forest is only accessible by boat and only during the wet season. Soil samples were taken from sites with different land management (agricultural) regimes (oil palm (with and without burning) and rubber (plantations, 5-10 years and over 40 years old)) and natural tropical peat swamp forest soil as comparison (Table 2.1). The approximate location of each site is shown in Figure 2.1 and the longitude and latitude of the sampling areas are given in Table 2.1.

40 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

OPPB2 OPP2 OPP1 Malaysia RA OPPB1 RP1 RP2 RJ2 2 2

RJ1

NF2

NF1 Kalimantan

Java

Figure 2.1. The study area and location (Gunawan et al., 2012). The GSKBB biosphere reverse is in Siak and Bengkalis Districts of Riau Province – Sumatera Island, Indonesia. NF: Natural forest, OPP: Oil palm plantation with the age of oil palm plants 8-10 years, OPPB: Oil palm plantation after burning with the age of oil palm plants 3- 4 years, RP: Rubber plantation with the age of rubber plants 5-10 year, RJ: Rubber jungle with the age of plant 40-60 years and RA: Restoration area. Approximate sampling locations are shown on the map. Numbers 1 and 2 refer to the two sites that sampling was carried out on each soil sample.

41 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Table 2.1. Sample sites specification Elevation Distance Latitude and Site (m)* from coast Description Longitude (km)* Natural Forest 01°23’13.6’’N 23 - 29 14.7 – 18.5 Secondary peat swamp forest, (NF) 101°52’59.2’’E some illegal logging activities and until 2009 but natural forest 01°22’ 50.6’’ N regrowth occurred, located in 101°50’15.1’’ E core zone of the GSKBB Biosphere Reserve.

Oil Palm 01°38’33.3’’N 4 – 5 0.5 Located in Desa Tanjung Plantation 101°46’30.0’’E Leban Kecamatan Sukajadi (OPP) and and the transition zone of the 01°38’29.9’’N GSKBB Biosphere Reserve. Oil 101°46’35.1’’E palm (Elaeis guineensis) age is around 8-10 years.

Oil Palm 01°38’14.9’’N 17 - 19 1.5 – 2.7 Located in Desa Tanjung Plantation 101°45’59.2’’E Leban Kecamatan Bukit Batu after Burning and and the transition zone of the (OPPB) 01°38’35.5’’N GSKBB Biosphere Reserve. Oil 101°44’14.8’’E palms (E. guineensis) age is around 3-4 years. Until 2009, there was burning activities in this location Rubber 01°34’26.3’’N 8 – 17 0.5 – 0.7 Located in Desa Sepahat Plantation (RP) 101°50’47.7’’E Kecamatan Bukit Batu and the and transition zone of the GSKBB 01°33’52.5’’N Biosphere Reserve. Rubber 101°51’48.0’’E tree (Hevea brasiliensis Mull. Arg.) age is 5-10 years. Fertilizer addition has not occurred.

Rubber Jungle 01°26’58.0’’N 7 - 13 1.0 – 1.2 Located in Desa Sepahat (RJ) 102°00’09.3’’E Kecamatan Bukit Batu and the and transition zone of the GSKBB 01°32’58.7’’N Biosphere Reserve. Rubber 101°52’23.2’’E tree (H. brasiliensis Mull. Arg.) age is 40-60 years. Fertilizer addition and burning activities have not occurred in this area.

Restoration 01°38’31.6’’N 22 2.8 Located in Desa Tanjung Area 101°44’14.5’’E Leban Kecamatan Sukajadi (RA) and the transition zone of the GSKBB Biosphere Reserve. *measured from google earth (SRTM) by A/Prof Paul Nelson.

42 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

2.2. Soil Sampling Sampling was done on November 2011 for soil samples on Chapter 3 and 4; and January 2014 for soil samples on Chapter 5. A random sampling method was used at each site. At each site, soil samples were collected in 9 m2 grids (10-15 cm deep) in a selected sampling area and pooled together as one sample. Five sampling points within each grid were used at each site (one at each corner and one in the middle of the sampling area). Following bulking of samples from each soil sampling area, they were transported to Australia where they underwent laboratory analysis upon arrival. In Australia, soil samples was stored in a Quarantine Laboratory of School of Applied Sciences, RMIT University (Certificate Number V1200 and V2586) under room temperature until physical chemical analysis. It was about a week.

2.3. Field analysis Peat thickness and water table depth were measured traditionally by hand drilling and a ruler on site in Indonesia. Water table depth was quantified as the level (m) below which the ground was completely saturated with water. Short term field soil emissions of CO2 were determined using an EGM-4 Environmental Gas Monitor for CO2 (PP Systems) as per the manufacturer’s protocols (forest soil temperature was 27-28ºC; agricultural soil temperature was 28-30ºC). Due to accommodation and security constraints, measurements were carried out only during the day and diurnal variations were not taken into account. The analysis were done in triplicate.

2.4. Physico-chemical analyses of soils Bulk density was determined by assessing the ratio of the dried soil mass to the volume of soil (Black and Hartge, 1986). The soil pH and moisture content were determined using standard methods (Rowell, 1994). The organic matter concentration was measured by loss on ignition of dry soil in a muffle furnace at 800°C for 4 h (Ball, 1964). The water-holding capacity was determined by using the 0-bar method of saturation followed by free draining (Cassel and Nielsen, 2003). Total C and N concentrations were measured with a model LECO TruMac CNS analyser. Samples were combusted at 1250°C. Total carbon determination was

43 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. performed by infrared detection and total nitrogen determined using a thermal conductivity cell (Pichler, 2010). Each analysis was conducted in triplicate. Data were analysed by ANOVA (SPSS21) to determine the significance of the difference between the agricltural practice samples and the forest samples (NF).

2.5. Estimation of microbial viable counts Media, buffers and all solutions were sterilised at 121○C for 15 min. Microbial viable counts were measured by plating aliquots from the serial dilution (10-1 – 10-5 diluted with sterile milliQ Water) of soil samples on nutrient agar (Acumedia) and potato dextrose agar (acumedia) (Lawlor et al., 2000). The plates (in triplicate for each sample) were incubated at 27oC for up to 4 d. CFU (colony forming units) were calculated and expressed as log cfu g- 1 of soil.

2.6. Community Level Physiological Profiling (CLPP) BIOLOG Eco microplates that contained three replicate wells of 31 carbon substrates plus 3 wells without substrate as a control were used to assess the CLPP of the soil community from each sample (Garland, 1996a, Girvan et al., 2003). These substrates consist of carbohydrates (n=10), carboxylic acid (n=7), amino acid (n=6), polymer (n=4), amines and phenols (n=2 for each) (Christian and Lind, 2006). The ability of a microbial community to utilize different C substrates contained in a microplate was assessed colorimetrically using standardized inoculum densities. A soil suspension (100 ml) was generated from an original aliquot (10 g dry-weight equivalent) in 0.25 strength sterile Ringer’s solution (2.25 g/l NaCl; 0.105 g/l KCl;

0.12 g/l CaCl2 6H2O; and 0.05 g/l NaHCO3) thus achieving a 10-1 dilution. This solution was vigorously shaken for 10 min (Stuart Scientific) to dislodge bacteria from soil before dilution to 10-3. Low-speed centrifugation (1,500 × g for 10 min) was used to remove soil particles. An aliquot (150 µl) of the bacterial suspension was inoculated into each well of a BIOLOG Eco-Plate and incubated at 27oC. The colour development for each carbon substrate in the plates was read with a BioRad iMark Microplate Reader over a 7 d period (every 6 hours during the first day, then 12 hours for days 2 to 7) at a wavelength of 590 nm. Readings at day 0 were subtracted from subsequent readings to eliminate background colour generated

44 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. from the substrates and the bacterial suspension. In addition, readings generated from the control wells (no substrate; tetrazolium dye only) were also subtracted.

2.6.1. Statistical Analysis of CLPP Data An average well-colour development (AWCD) that represents the potential utilization of various carbon sources by microbial communities was determined from BIOLOG Eco-plates using the following equation: ΣODi AWCD = 31 where ODi was the optical density value from each well (Ci), corrected by subtracting the blank well value (inoculated, without a carbon source) from each plate well and the value from day 0 (R) (Garland and Mills, 1991, Garland, 1996a). Substrate richness values were calculated as the number of oxidized C substrates that gave a positive response with an OD > 0.10 (Gomez et al., 2000, Garland, 1997).

The Shannon–Weaver index values, which represents the richness of the community, were calculated using the following equation: 퐻′ H’ = −Σpi(lnpi) and E = ln 푆 where pi is the ratio of the activity on each substrate (ODi) to the sum of activities on all substrates ΣODi and S is the number of positive wells in each sample (Yang et al., 2013, Derry et al., 1998). Factor analysis of the principle component (PCA) was used to visualize the relationship between the structures of the bacterial community among peat swamp soils from different agricultural practices according to their substrate utilization patterns using SPSS (version 21) software. A covariance matrix was used. Data were analysed by ANOVA (SPSS 21) to determine the significance of the difference between the agricultural samples and the forest samples (NF).

2.7. Ion Concentration Concentration of key ions in peat swamp soil including sodium, potassium, nitrates, phosphates and sulphates were measured by using a Dionex ICS-110 (Thermo Scientific) -

45 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. ion chromatograph (IC). Soil samples were serially diluted with miliQ water and the 10-3 soil diluent (250 µl) was used to inject the IC and the rest of the analysis carried out as per the manufacturer’s protocols.

2.8. Enzyme Activities Four soil enzymes, β-glucosidase and cellobiohydrolase (key enzymes in carbon cycling), chitinase (involved in both the N and C cycles), and acid phosphatases (involved in the phosphorous cycle) were selected for study based on their importance in nutrient cycling in soils (Girvan et al., 2003). Modified enzyme assay protocols of Tabatabai and Bremner’s original method (Tabatabai and Bremner, 1969) were used. This involved the use of p- nitrophenol (p-NP) linked substrates and the colorimetric determination of pNP released by each enzyme when soil was incubated with a buffered substrate solution. For each enzyme, soil (5 g) was mixed with 0.05 M acetate buffer (50 ml, pH 5.0 for all enzymes) and placed on a magnetic stirrer. Aliquots (2 ml) of slurry were pipetted and transferred to polypropylene tubes, which were kept chilled pending incubation. At the beginning of incubation, 2 ml of substrate (prepared at 2 mM concentration) were added to each sample. The tubes were then capped and placed on a rotary shaker for 2 h at 250C. Following incubation, tubes were centrifuged at 3900 × g for 5 min and aliquots (150 µl) of supernatant were taken from each tube and transferred into microplates containing 1 M NaOH,(30 µl) to stop the reaction and cause a colour change. The assays were mixed and absorbance values measured with a BioRad iMark Microplate Reader at 410 nm. Substrate and sample controls were routinely included. The concentration of p-NP detected in samples after incubation was corrected by subtracting the combined absorption results for the sample and substrate controls from the analytical samples. Enzyme activity was expressed as µmol p-NP/g soil/hour.

2.9. DNA Extraction All chemicals for molecular methods were of analytical grade and were purchased from Sigma-Aldrich or Merck unless mentioned in the text. All glassware, tubes and pipettes were RNase-free or treated with RNA ZAP (Ambion) prior to the commencement of molecular work. All solutions used for DNA/RNA extraction were also prepared using RNase free

46 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. chemicals and nuclease-free sterile water. DNA was extracted from soils as previously described (Steffan et al., 1988) with some modification. Soil samples (0.5 g) in a 2 ml extraction tube containing sterile sodium phosphate buffer (0.5 ml, 100 mM, pH 7.5) and autoclaved glass beads (0.5 g, 106 microns, Sigma/Aldrich) were bead beaten for 30 s at 4 m/s using a mini-BeatBeater (Biospec Product) and then placed on ice for 1 min to prevent enzymatic degradation. This step was repeated two times. Liquefied phenol-chloroform- isoamyl alcohol (25:24:1), saturated with 10 mM Tris pH 8.0, 1 mM EDTA (0.5 ml, Sigma) was then added to the DNA solution. The mixture was centrifuged at 12000 × g for 10 min at 4°C and the aqueous phase was removed to a new tube where an equal volume of phenol- chloroform-isoamyl alcohol was added. The tubes were then centrifuged at 12000 x g for 10 min at 4°C. The phenol-chloroform-isoamyl alcohol wash was repeated three times. The crude DNA extract was then cleaned with a GENECLEAN TURBO Clean up kit (MP Biomedicals LLC) as per the manufacturer’s instructions. Every soil sample was extracted in triplicate.

2.10. PCR Reactions 2.10.1. Amplification of a partial bacterial community The 16S rDNA were amplified from extracted genomic DNA by the polymerase chain reaction (PCR) using a T100 Thermal Cycler (BioRad). The 16S rRNA genes from members of the domains bacteria were amplified using universal primers. The bacterial community was amplified using the 314 F primer with incorporation of a 40-bp GC clamp in the 5′ primer and the 907 R primer (Zhu et al., 2014). The bacterial community was amplified using RedTaq polymerase (Sigma) with the final 50 μl reaction mixture for bacterial amplification containing 5 μl of PCR buffer (Sigma), 5 μl of RedTaq MgCl2, 1 μl of 10 mmol l−1 dNTP, 2 μl of 10 pmol (each) of forward and reverse primers, 2.5 μl of RedTaq polymerase (5 U μl−1), 0.25 μl of bovine serum albumin (Kreader, 1996) and 2 μl of template DNA. The bacterial community PCR protocol was a touch-down thermal program which included an initial denaturation step 95°C for 5 min followed by 15 cycles of 94°C for 30 s, 60°C for 30 s (with 1°C decreased each cycle till 45°C), 72°C for 1 min, then by 20 cycles of 95°C for 45 s, 45°C

47 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. for 45 s, 72°C for 2 min, and a final extension of 72°C for 3 min.. For all PCR reactions, amplifications were check using 1.5% agarose gel electrophoresis.

2.10.2. Amplification of a partial Fungal Community Internal Transcribed Spacer Region (ITS) of soil fungi was targeted to evaluate the fungal community. Target DNA was amplified using a nested PCR method, ITS1F primer and ITS4 primer were used for the first PCR (without a GC clamp), continued with ITS1F primer with incorporation of a 40-bp GC clamp in the 5′ primer and ITS2 primer for the first PCR product (2 µl – as template DNA in the second PCR) (White et al., 1990, Muyzer et al., 1993, Gardes and Bruns, 1993). The fungal community was amplified using GoTaq polymerase (Promega) with the final 50 μl reaction mixture containing 10 μl of 5× PCR buffer (Promega), 3 μl of 25 mmol l−1 MgCl2, 1 μl of 10 mmol l−1 dNTP, 2 μl of 10 pmol (each) of forward and reverse primers, 1 μl of 1.25 U of Taq polymerase (5 U μl−1), 0.25 μl of bovine serum albumin and 2 μl of template DNA. The fungal community PCR protocol also used a touch-down thermal program which included an initial denaturation step 95°C for 5 min followed by 10 cycles of 94°C for 45 s, 68°C for 45 s (with a 1°C decrease each cycle till 58°C), 72°C for 45 s, then by 24 cycles of 94°C for 45 s, 58°C for 45 s and 72°C for 45 s, and a final extension of 72°C for 10 min. To check for the possibility of contamination in the nested PCR, negative controls of the first reactions were used as template in the second PCR. For all PCR reactions, amplifications were check in 1.5% agarose gel electrophoresis.

2.10.3. Amplification of a partial Archaeal Community The 16S rRNA genes from members of the domains archaea were amplified universal primers for archael domain. The archaeal community was amplified using Arc931F primer and Univ 1392R with incorporation of a 40-bp GC clamp in the 5′ primer (Jackson et al., 2001). The archaeal community was amplified using MyTaq polymerase (Bioline) with the final 50 μl reaction mixture for archaeal amplification containing 10 μl MyTaq buffer (Bioline), 2 μl of 10 pmol (each) of forward and reverse primers, 0.25 μl of 1.25 U of MyTaq polymerase (5 U μl−1), 0.25 μl of bovine serum albumin and 2 μl of template DNA. The archaeal PCR protocol included a 2 min initial denaturation at 95°C, 26 cycles of 94°C for 45

48 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. s, 43°C for 45 s, 72°C for 45 s and a final extension (72°C, 7 min). For all PCR reactions, amplifications were check by 1.5% agarose gel electrophoresis. All PCR amplicons were purified using the Wizard® SV gel and PCR clean-up system (Promega) as per the manufacturer's protocol. DNA quantification was performed with a NANODROP lite spectrophotometer (Thermoscientific).

Table 2.2. Primers that used on this project Oligonucleotide Sequence (5’-3’) 314 F 5′- CGCCCGCCGCGCGCGGCGGGCGGGGCGGGG-3′ For bacteria (Muyzer et al., 1993, Zhu et al., 2014) 314 F GC 5’- For bacteria CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGG (Zhu et al., 2014, GGCCTACGGGAGGCAGCAG-3 Muyzer et al., 1993) 907 R 5′- CCGTCAATTCCTTTRAGTTT-3′ For bacteria (Zhu et al., 2014, Muyzer et al., 1993) ITS1 5’-CTTGGTCATTTAGAGGAAGTAA-3’ For fungi (White et al., 1990, Muyzer et al., 1993, Gardes and Bruns, 1993) ITS1 GC 5'- For fungi CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGG (White et al., 1990, GGCTTGGTCATTTAGAGGAAGTAA-3' Muyzer et al., 1993, Gardes and Bruns, 1993) ITS2 5’-GCTGCGTTCTTCATCGATGC-3’ For fungi (White et al., 1990, Muyzer et al., 1993, Gardes and Bruns, 1993) ITS4 5’-TCCTCCGCTTATTGATATGC-3’ For fungi (White et al., 1990, Muyzer et al., 1993, Gardes and Bruns, 1993) Arc931F 5’-AGGAATTGGCGGGGGAGCA-3’ For archaea

49 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

(Jackson et al., 2001) Univ 5’-ACGGGCGGTGTGTAC-3’ For archaea 1392R (Jackson et al., 2001) Univ 5’- For archaea 1392R GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCC (Jackson et al., CCGCACGGGCGGTGTGT-AC-3’ 2001)

2.11. Agarose Gel Electrophoresis The size and quality of genomic DNA and DNA fragments generated from PCR were determined by electrophoresis at room temperature using 0.8~1% (w/v) agarose gel stained with 1xSYBR Safe TM nucleic acid stain (Invitrogen, Carlsbab, CA, USA). PCR products were mixed with 6×loading buffer (Promega) and electrophoresed in 1×TAE buffer (40 mM Tris-HCl, 40 mM acetic acid, 1 mM EDTA) at 60 V with an Owl electrophoresis chamber connected to a BIORAD Power Pack TM. After electrophoresis, DNA was visualised using a GelDoc-System (BIORad).

2.12. Denaturing Gradient Gel Electrophoresis (DGGE) DGGE was performed with a D-Code System (BioRad) in accordance with the manufacturer's instructions. The PCR products were loaded onto polyacrylamide gels in 1.0× TAE running buffer (40 mM Tris-HCl, 40 mM acetic acid, 1 mM EDTA). Polyacrylamide gels were made with a denaturing gradient (where 100% denaturant contains 7 M urea and 40% formamide). Polymerisation of gels were catalysed by the addition of ammonium persulfate solution (10% APS) and N,N,N’,N’-tetramethylethylenediamine (TEMED). The gradients used were 50-60%, 57-63% and 45-60% for bacteria, fungi and archaea respectively. The gel was loaded with PCR product (12-15 µl) plus loading dye (5 µl, Promega). The polyacrylamide gel (37.5:1, acrylamide/bisacrylamide) was run for 18 h at 60°C and 60 V for all microbial community profiling. The DGGE gels were stained by silver staining by incubating each gel in 400 ml of fixing solution (40% methanol/10% acetic acid, v/v) for 2 h followed by incubation in 200 ml silver nitrate solution (0.2 g silver nitrate in 200 ml dsH2O, w/v) for 20 min. Each gel was then placed in 200 ml of developing solution (0.02 g sodium borohydride, 0.8 ml formaldehyde, 3 g sodium hydroxide in 200 ml dsH2O, w/v) for 30 min

50 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. after which the gel was fixed in 400 ml of fixing solution (10% ethanol/5% acetic acid, v/v) for 10 min. Finally, the gel was preserved by soaking in 400 ml preservative solution (125 ml of absolute ethanol, 50 ml glycerol in 325 ml of dsH2O, v/v) for 10 min. After staining, the DGGE gel was scanned with an EPSON Expression 1600 V.2.65 E software as TIFF format.

2.12.1. DGGE Data Analyses Analysis of DGGE gels followed normalization of the volume data derived from the DGGE gels using the Phoretix 1D Advanced Analysis package TotalLab (United Kingdom). UPGMA (unweighted pair-group method with mathematic average) dendrograms were constructed by Phoretix TotalLab (Muyzer et al., 1993). The Shannon Weaver index was calculated to determine the diversity within each bacterial community sample (Shannon and Weaver, 1949, Muyzer et al., 1993); Pareto Lorenz distribution curves were used to assess the functional structure of the microbial community (Marzorati et al., 2008). Principal- component analysis (PCA) was performed by SPSS 22 for DGGE gels and xlstat for correlation analysis. Data were analysed by ANOVA (SPSS 21) to determine the significance of the difference between the agricultural samples and the forest samples (NF).

2.13. Statistical Analysis Where necessary statistical significance was determined by analysis of pair-wise comparisons (ANOVA) and Tukey Test (IBM SPSS, Statistics 21). Statistical significance was accepted at P<0.05.

51 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

CHAPTER 3

The Assessment of the Impact of Oil Palm and Rubber Plantations on the Biotic and Abiotic Properties of Tropical Peat Swamp Soil in Indonesia

Published in International Journal of Agricultural Sustainability, 2015, 13(2), 150 – 166

52 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Chapter Declaration for Thesis with Publication

Chapter 3 is presented by the following paper: The assessment of the impact of oil palm and rubber plantations on the biotic and abiotic properties of tropical peat swamp soil in Indonesia Yuana Nurulita, Eric M. Adetutu, Krishna K. Kadali, Delita Zul, Abdulatif A. Mansur, Andrew S. Ball International Journal of Agricultural Sustainability Volume 13, No. 2, 150 – 166 2015

I declare that I wrote the initial draft of this manuscript, and my overall contribution to this paper is detailed below: Extent of Nature of contribution contribution (%) Performed experiment design, analysis of samples, molecular and statistical data analysis, interpreted data, manuscript writing and 76% evaluation, corresponding author

The following co-authors contributed to the work. The undersigned declare that the contributions of the candidate and co-authors are correctly attributed below. Extent of Author Nature of contribution contribution Signature (%) Eric M. Adetutu Molecular and statistical data 7 analysis, interpreted data and manuscript correction. Krishna K. Kadali Molecular and statistical data 4 analysis

Delita Zul Analysis of samples 2

Abdulatif A. Mansur Molecular analysis 1

Andrew S. Ball Performed experiment design, 10 interpreted data, manuscript correction and evaluation.

Candidate’s signature: Date: 23 March 2016 Primary supervisor’s signature: Date: 23 March 2016

53 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

54 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

55 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

56 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

57 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

58 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

59 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

60 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

61 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

62 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

63 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

64 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

65 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

66 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

67 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

68 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

69 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

70 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

CHAPTER 4

Assessment of the Influence of Oil Palm and Rubber Plantations in Tropical Peat Swamp Soils Using Microbial Diversity and Activity Analysis

Published in Journal of Agricultural Chemistry and Environment, April 2016, 5, 53 – 65

71 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Chapter Declaration for Thesis with Publication

Chapter 4 is presented by the following paper: Assessment of the Influence of Oil Palm and Rubber Plantations in Tropical Peat Swamp Soils Using Microbial Diversity and Activity Analysis Yuana Nurulita, Eric M. Adetutu, Krishna K. Kadali, Esmaeil Shahsavari, Delita Zul, Mohammad Taha and Andrew S. Ball Journal of Agricultural Chemistry and Environment, 2016, Volume 5, 53 - 65 2016 I declare that I wrote the initial draft of this manuscript, and my overall contribution to this paper is detailed below: Extent of Nature of contribution contribution (%) Performed experiment design, analysis of samples, molecular and statistical data analysis, interpreted data, manuscript writing and 76% evaluation, corresponding author

The following co-authors contributed to the work. The undersigned declare that the contributions of the candidate and co-authors are correctly attributed below. Extent of Author Nature of contribution contribution Signature (%) Molecular and statistical data Eric M. Adetutu 7 analysis, interpreted data and manuscript correction. Molecular and statistical data Krishna K. Kadali 2 analysis Statistical data analysis and Esmaeil Shahsavari 2 manuscript correction Analysis of samples Delita Zul 2

Molecular analysis Mohammad Taha 1

Performed experiment design, Andrew S. Ball 10 interpreted data, manuscript correction and evaluation. Candidate’s signature: Date: 23 March 2016 Primary supervisor’s signature: Date: 23 March 2016

72 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

73 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

74 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

75 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

76 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

77 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

78 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

79 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

80 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

81 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

82 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

83 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

84 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

85 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

CHAPTER 5

Restoration of Tropicl Peat Soils: The Application of Soil Microbiology for Monitoring the Success of the Restoration Process

Published in Agriculture, Ecosystems and Environment, 2016, 216, 293 – 303

86 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Chapter Declaration for Thesis with Publication

Chapter 5 is presented by the following paper: Restoration of tropical peat soils: The application of soil microbiology for monitoring the success of the restoration process Yuana Nurulita, Eric M. Adetutu, Haris Gunawan, Delita Zul, Andrew S. Ball Journal of Agriculture, Ecology and Environment Volume 216, 293 - 303 2016

I declare that I wrote the initial draft of this manuscript, and my overall contribution to this paper is detailed below: Extent of Nature of contribution contribution (%) Performed experiment design, analysis of samples, molecular and statistical data analysis, interpreted data, manuscript writing and 76% evaluation, corresponding author

The following co-authors contributed to the work. The undersigned declare that the contributions of the candidate and co-authors are correctly attributed below. Extent of Author Nature of contribution contribution Signature (%) Molecular and statistical data 8 Eric M. Adetutu analysis, interpreted data and manuscript correction. Performed experiment design 4 Haris Gunawan especially restoration area and analysis of samples Analysis of samples 2 Delita Zul

Performed experiment design, 10 Andrew S. Ball interpreted data, manuscript correction and evaluation.

Candidate’s signature: Date: 23 March 2016 Primary supervisor’s signature: Date: 23 March 2016

87 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

88 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

89 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

90 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

91 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

92 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

93 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

94 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

95 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

96 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

97 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

98 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

CHAPTER 6

General Discussion

99 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

6. General Discussion

Until now, most of the studies examining the impact of agricultural practices on peat swamp soil have focussed on physicochemical changes. For example, groundwater level measurement (Wösten et al., 2008, Lampela et al., 2014), greenhouse gas release (Inubushi et al., 2003, Takakai et al., 2006, Hergoualc'h and Verchot, 2012), bulk density and micro mineral concentrations (Lampela et al., 2014). In contrast, studies on the impact of agricultural practices on peat swamp soils have rarely been conducted. Soil health can be defined as the capacity of soil function to maintain plant and animal productivity and enhance water and air quality then promote plant and animal health (Doran and Zeiss, 2000) and has been used widely to measure the impact of agricultural practices on many different soils (Chun-Juan et al., 2013). However there are relatively few publications that focus on the impact on the soil health of tropical peat swamps (Zinck, 2011). Soil microorganisms, represent one soil health parameter which may be used to evaluate the impact of agricultural practices on peat swamp soils. This parameter has been successfully used in other soils, such as arable soil (Joly et al., 2014) and many other soil types (Chun-Juan et al., 2013). In this project, soil microorganism analysis, coupled with physical and chemical assessment provides information relating to the impact of land use change. The ability of the microbial community of peat swamp soil to adapt to anthropogenic disturbance and to maintain its function was assessed by comparing the activity and diversity of the microbial community of peat swamp soils under different land management practices, including soils undergoing active restoration.

6.1 Influence of agricultural practices on biotic and abiotic properties of peat swamp soils. Analysis of the soils used in this study revealed large concentration of organic matter (more than 75%) and total C (greater 48%) in all soils, confirming the organic nature of these tropical peat soils (Table 3.3 and 5.2) although the sampling period associated with the results reported in Chapter 3 (November, 2011) and Chapter 5 (January, 2014) were different. The establishment of agriculture on peat swamp soil led to drier soils, with a

100 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. deeper water table, lower soil water content and lower soil water holding capacity. Water acts physically as an agent of transport as well as chemically as a solvent for important chemical and biological reactions. Thus, drought conditions result in a change from anaerobic to aerobic conditions and led to increased decomposition of organic matter (Bragazza et al., 2013, Fenner and Freeman, 2011, Thormann, 2006).

Decomposition of organic matter can be showed by analysis of the microbial viable counts together with assessment of their metabolic activity through Biolog data. Although C:N ratios of all soil samples was greater than 25 for all soils indicating slow decomposition rates (Hazelton and Murphy, 2007); however the transformation of the peat swamp forest to a rubber plantation (RP and RJ soils) led to an increase in total microbial counts and metabolic activity. Interestingly, in contrast the transformation to an oil palm plantation (OPP and OPPB) resulted in decreased microbial activity when compared with natural forest (NF) soil (Figure 3.2 and 3.3). Zhang et al. (2013) reported that the conversion of natural rainforest to a rubber plantation resulted in more extensive humification, presumably as a result of increased microbial activity. Furthermore, microbial properties, such as enzyme activities, have been reported to be influenced by type of tree species (Ushio et al., 2010); Zak et al. (2003) had previously stated that plant-microbe interaction in soil can be an integral component of the influence of plant diversity.

In terms of changes in soil enzyme activities, during land-use change, phosphatase have been reported to play a key role in maintaining the soil system (Dick et al., 2000, Nannipieri et al., 1983) and as such appears to be a valueable indicator of overall microbial activity (Dick and Tabatabai, 1983, Lagerström et al., 2009). In this study, the conversion of peat swamp soils to agricultural practice resulted in reduced enzyme activities, varying from reductions of 13% (chitinase activity on OPP) to 86% (acid phosphatase activity on OPP) (Figure 4.1 and Figure 5.5). The biggest influence was seen in acid phosphatase activity with a significantly reduced enzyme activity (2.68 – 4.25 µmol pNP g-1 h-1 reduction) compared with the activity found in soils from a natural forest). A change in soil water availability can also change the level of soil enzyme activities; Sardans and Peñuelas (2005) found that a reduction in soil

101 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. moisture led to a reduction in soil enzyme activities, which resulted in a slower nutrient turnover and decreased the nutrient supply to plants.

Anthropogenic activities are believed to reduce microbial activity and the overall diversity of soil organisms (Helgason et al., 1998, Mäder et al., 2002, de Vries et al., 2013). In this study, microbial diversity was assessed using molecular culture-independent methods, PCR – DGGE. Analyses of the results revealed that the bacterial community was the most changeable community compared with fungal and archaeal communities (Figure 4.2 and Figure 5.6) when the land management of a tropical peatland soil was altered. This shift in the soil bacterial community has the potential to be used as an early predictor of the impact of anthropogenic activities on peatland/wetland ecosystems due to the vital roles that the bacterial community plays in peatlands. Hartman et al. (2008) identified a relationship between soil nutrient concentration (nitrogen and phosphorus) and bacterial communities across all wetland types. In this project, non-specific 16S based primers were selected in preference to specific process based primers (such as nitrogenase, cellulose) as a general measure of soil health was required. The changes observed in bacterial communities may have occurred through changes in vegetation (Schweitzer et al., 2011, Lee-Cruz et al., 2013), fertilizer management (Marschner et al., 2003) and soil moisture (Ng et al., 2014) among other parameters. Further analysis of bacterial communities in this study is required to reveal the critical role of bacterial community in the recovery of peat swamp soils following disturbance.

Investigation of the changes in the Shannon diversity indices (H’) of microbial communities from tropical peatland soils under different management systems again confirmed the significant impact of agricultural practices (Table 3.4, 4.2 and 5.3). The lowest functional diversity was observed in oil palm soils. An increase in microbial species diversity may increase the contribution of these organisms to ecosystem services (Ferris and Tuomisto, 2015). It is likely that functional redundancy present within these soil bacterial communities promotes soil stability and protects soil processes from species loss through processes such as burning (Bossio et al., 2005). Ecosystem services are complex in terms of their regulation;

102 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. in addition to the microbial community, protozoa, herbivores, predators or other communities also play an important role. The current study assessed only the microbial communities; this work should be extended to include higher trophic organisms. In addition, the study of the role of specific microbial communities such as methanogens, methanotrophs or denitrifiers in tropical peat swamp soils would provide useful additional data (Blaud et al., 2015, Levine et al., 2011).

In summary, comparison of the impact of agricultural management on the activity and diversity of the microbial communities in soil from rubber and oil palm plantations confirmed the activity of soil microbial community in rubber plantations were less impaired in terms of their natural functions. However, this study showed substantial shifts in soil microbial activity and diversity occurred upon conversion of a natural peat swamp forest to agriculture. Acid phosphatase activity appears to be a useful parameter for assessing the impact of land-use change in this system.

6.2 Impact of burning activities before oil palm planting in peat swamp soil Forest fires can be induced by high-temperature, weather events or human activity, affecting soil properties and the soil microbial community, resulting in peat swamp soil degradation. The extent of the degradation is influenced by peat temperatures and duration of the fire (Certini, 2005). Certini (2005) explained that the levels of severity of fires are low to moderate and severe. Low to moderate fires result in a reversible ecosystem change, promoting the dominant vegetation, transiently increasing pH and availability of nutrients. Serious fires have adverse effects on soil, causing significant organic matter deterioration, substantial nutrient loss and changes in the quantity and composition of microbial and invertebrate communities. In the transition area of GSKBB Biosphere Reserve, burning for agricultural purposes occurred almost every year before 2009. As a result of indiscrimate burning an poor management, one important social outcome from these burning activities has been the impact on human health through smogs especially in el nino years and in dry seasons (Page et al., 2002, Page et al., 2009a).

103 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

The result of burning practices associated with oil palm plantations, in terms of the soil microbial community results in a significant decrease in both fungal biomass (41%) (Figure 3.2) and total microbial biomass (74%) (Figure 5.2). Fire has been shown to cause a major shift in the microbial community structure, reducing biomass C, soil respiration rates and soil hydrolase activity (Goberna et al., 2012). Heat transfer to the soil during fire may result in heat-induced microbial mortality (Cairney and Bastias, 2007, Hart et al., 2005). In general, fungi are more severely affected than other microbial communities. Nearly 100% mortality of fungi has been observed in soils heated to 60°C (moist soil) and 80°C (dry soil) (Dunn et al., 1985). Bacteria are more tolerate of heat; the threshold temperature for bacteria are 120°C and 100°C for dry and moist soil respectively (Dunn and DeBano, 1977). Dooley and Treseder (2012) reported that fire reduced soil microbial abundance by 33.2% and fungal abundance by 47.6%. Hamman et al. (2007) also confirmed a decrease in the fungal community after fire, using ester-linked fatty acid analysis (EL-FAME) analysis.

After 5-7 years of an oil palm plantation including a burning cycle, increased β glucosidase and cellobiohydrolase soil enzyme activities were detected (20% and 21% respectively) together with decreased acid phosphatase (75%) when compared to enzyme activities detected in the natural forest soil (Figure 5.5). Dick et al. (1988) found significant correlations between the burning of plant residues and acid phosphatase activity. In addition, Ajwa et al. (1999) reported burning and fertilisation practices were associated with increased β glucosidase activity. In this study, activities of both β glucosidase and acid phosphatase were significantly affected by the oil palm plantation and burning activities on peat swamp soil compared with other enzymes. However, burning has the opposite effect on the activity of these two enzymes. β Glucosidase activity was increased in burned soils while acid phosphatase activity was decreased (Figure 5.7). Phosphate reduction in soils has also been used as an estimation of the impact of fire on soils (Pourreza et al., 2014). The results suggests that these enzymes may be a useful indicator to assess the effect of long-term burning on soil biological activity.

104 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

Further assessment of the functionality of the microbial community of the tropical peatland soil under different management regimes using CLPP confirmed that treatment had affected soil microbial activity. Previously it was shown that burning resulted in a reduction in soil microbial biomass and a large loss of soil organic matter (Certini, 2005). The importance of burning in soil organic matter terms is in the mineralisation of organic N, resulting in increased concentrations of inorganic N and other mineral nutrients (Choromanska and DeLuca, 2002). As a consequence of all these effects, significant changes and often a reduction in microbial activities in burned soils can be expected.

Interestingly, similar analysis of oil palm plantation soils, two years post burning showed increased activity (again using CLPP) when compared with the peat swamp forest soil (Figure 5.4). Perhaps this is an indication that the processes involved in the restoration of soil microbial activity has begun. Fernández et al. (1999) stated that alteration in soil mineralization processes occurs at least two years after a wildfire and it was accompanied by an increase in organic matter stabilization. Furthermore, charcoal fragments present in the soil after a fire stimulated the activity of ectomycorrhizae, an indication of increased turnover of decaying organic matter (Harvey et al., 1976). Charcoal may also act as a strong sorption agent for phenolic substances, resulting in increased soil respiration (Zackrisson et al., 1996, Wardle et al., 1998).

Interestingly, although the fungal : bacterial ratios and the microbial viable counts observed from OPPB soil was the lowest (Figure 3.2 and 5.2), burning activities on oil palm plantation gave higher bacterial community growth and higher Shannon index values (Figure 3.3 and 5.3) compared with all other samples. Burning activities may stimulate the chemical degradation of organic matter providing key nutrients for soil microbial growth thereby improving metabolic function. Although it is a highly debatable issue, in this case, burning activities on peat swamp soil could lead to an increase in microbial functionality through increased availability of soil nutrients following burning.

105 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

6.3 How to restore degraded tropical peat swamp soil and measure the success of this process. To restore degraded peat swamp areas, raising the water table and stimulating peat formation represent established approaches (Blundell and Holden, 2015, Parry et al., 2014b). A relationship exists between peat formation and the thickness of the aerobic surface layer. The aerobic layer limits peat deposition; reducing this layer through increasing the water table therefore stimulates peat formation and carbon sequestration (Belyea and Clymo, 2001). Thus, maintaining the water table level and reducing the depth of the aerobic surface layer is often applied for peatland restoration. A number of publications have reported the successful restoration of peatlands. Wösten et al. (2008) and Jing et al. (2014) stated that revegetation methods such as replanting degraded peat swamp soil with native peat swamp forest plants together with the maintenance of soil moisture (by land rewetting) led to improvements especially in the diversity and abundance of soil eukaryotes. Increased revegetation in the restoration area also significantly increased soil microbial activity (Haifang et al., 2013).

The water level of peat swamps should be maintained at appropriate levels (not more than 50 cm depth below the surface and 100 cm above the peat surface in flooding conditions) (Wösten et al., 2008). The effective water-level for an oil palm plantation in peat is 50 – 75 cm, as it is considered an optimum depth for plant growth (Lim et al., 2012). The agricultural areas have water table depths of more than 50 cm (Table 3.2 and 5.2). This condition is susceptible to fire, not only human-induced but also natural fires, especially as higher temperatures are reached during the dry season in this tropical area. Moreover, flooding more than 100 cm above the peat surface for a prolonged period of time will inhibit the restoration process and may change the vegetation in that area. In this project, analysis of the soils some 3.5 years after replanting with native forest plants together with land rewetting, revealed that no significant increase in the water table occured. Strack et al. (2015) suggested that the peatland area under restoration in the Rivière-du-Loup region, Quebec, Canada remains in an intermediate state between natural and unrestored peatland after ten years. Although most of the data on the restoration of peatlands are specific to the

106 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. peatland and the location (such as temperate, boreal or tropical), the data does highlight the fact that peat swamp restoration is not a short process, and therefore long term monitoring is required to fully assess of the process.

Analysis of soil after 3-4 years of burning suggested that microbial functionality had not yet been restored and that perhaps microbial communities were still in the recovery stage. Significantly reduced activities were observed in this soil when compared with those of the natural forest (Figure 3.3). In terms of soil microbial community analysis, the CLPP pattern of the restored soils (RA) soil showed increased utilisation of the Biolog Ecoplate substrates compared with the natural forest (NF) soil (Figure 5.3), despite the fact that the bacterial viable count of RA soil was less than of NF soil (44% decreased). It is possible that the changes in the physicochemical environment of the soil, resulted in reduced C availability and a greater acid insoluble fraction, perhaps resulting in physical confinement of the dominant microorganism (Andersen et al., 2006) and subsequent starvation (Morita, 1990).

Despite being widely used as a restoration technology, rewetting peat swamp soil does run the risk of nutrient release and leaching. Kleimeier et al. (2014) found that, although the flushing of organic compounds was generally slow in peatlands, nitrate was released faster and in higher concentration following rewetting. RA soil showed the largest concentration of nitrate (3.36 mg kg-1, ANOVA p<0.05). It seems that the rewetting process did result in nitrate flushing. The increased nitrate concentration compared with the ammonium concentration in all soil samples suggests that the process of nitrification was occurring. Peralta et al. (2013) and Martikainen et al. (1993) agreed that drier soils can increase aerobic nitrification. This study demonstrated that the rewetting process in soils under restoration did not decrease soil nitrate concentration through inhibition of aerobic nitrification. Although rewetting would in theory increase anaerobicity, nitrification would still occur in the aerobic zone of the soil.

In terms of phosphate, concentrations in soil were lowest in RA soil (83 – 94% reduction compared with other samples, Table 5.2). Burning and rewetting activities have been

107 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. reported to cause significant loss of phosphate. Burning can destroy 90% of organic phosphorus in peat soils leading to a two fold increase in the availability of inorganic phosphate (Wang et al., 2014). Phosphorus is bound to metal oxides or clay minerals; hence inundation stimulates formation of inorganic ferric-bound phosphorus which then dissolves in soil water (Reynolds and Davies, 2001, van de Riet et al., 2013, Zak et al., 2010, Vasander et al., 2003). This suggests that, burning results in the transformation of organic phosphorus to inorganic phosphate, while rewetting during the restoration of peat swamp soils can decrease inorganic phosphate concentration through flushing.

Due to the concentration of phenolic compounds present in peat swamp soil, phenol oxidase activity might be a key soil enzyme, perhaps as important as hydrolase activities. The utilization of phenolic substrates in CLPP - Biolog Ecoplates was relatively high and supports this statement (Figure 5.4). Degradation of phenolic substrates by the soil microbial community in OPPB and RA soils were more than double that detected in NF soil. The biochemical degradation and transformation of organic substances can be stimulated by plant-litter-soil interactions (Berthrong et al., 2013, Schmidt and Lipson, 2004). For example, root turnover and root exudation are known to affect soil enzyme activity (Kotroczó et al., 2014). In months to years after rewetting, soil enzymes will generally be considerably more active, driving decomposition of the peat matrix (Fenner and Freeman, 2011). This study show that CLPP is a useful technique for elucidation of the changes in soil metabolic potential.

PCA analyses of physical-chemical characteristics, together with the activity and diversity of the soil microbial community, showed that key determinants of a natural forest soil are pH and acid phosphatase (Figure 5.7). In addition in this particular environment, metabolic adaptation of the soil microbial community under conditions of land management change is an important process (Andersen et al., 2013). Acid phosphatase activity is a crucial enzyme in this environment. Phosphate would be readily utilised by microorganisms and phosphatase production is induced due to low phosphate availability (Kang and Freeman, 1999). Moreover Kang and Freeman (1999) reported a correlation between pH and

108 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N. phosphatase activity in wetland soils. Overall, the knowledge gained from the application of PCA analysis in terms of soil microbiol analysis and physical-chemical properties revealed that acidic conditions (low pH) and high acid phosphatase activity appear to be key determinants for use in following the restoration of peatland restoration.

6.4 Conclusion The results from physico-chemical and biological characterisation revealed that agricultural practices significantly affected the diversity and activity of the soil microbial diversity in tropical peat swamp soils. The data obtained throughout this study using a combination of biochemical- (plate counts, enzyme activity and CLPP) and molecular-based methods (PCR- DGGE) coupled with physical-chemical measurement showed substantial changes in agricultural soils (oil palm plantation with different management (with and without burning) and rubber plantation with different ages of plants) in terms of microbial activity and diversity compared with natural forest soil. The establishment of a rubber plantation in tropical peat swamp soils resulted in significant changes in microbial biomass and activity. The study also showed that the most significant changes occurred in the soil bacterial community. In addition, an integrated assessment of the process of peatland restoration (using a land-rewetting method and revegetation with natural peat swamp forest plants) showed that after 3.5 years, the restored soils had not returned the degraded peatland to a condition similar to that found in the natural forest soil. Principal Component Analysis (PCA), highlighted that acidic pH and high acid phosphatase are the key features of a natural peat swamp forest. This study has contributed to our understanding of the impact of agricultural and restoration practices on this unique ecosystem, providing novel information relating to how tropical peat swamp ecosystems respond to agricultural and restoration practices.

6.5 Future study On the basis of the findings of this study, the following future projects are suggested: 1. Future studies on the microbial diversity study should focus on key microbial communities involved in biogeochemical cycling in peatlands (such as methanogens,

109 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

and denitrifying bacteria) as next using more advanced methodologies such generation sequencing. For example metagenomic studies based on whole genome sequencing will present broader overviews of the different microbial groups present and their potential function. 2. Further studies should also be performed to investigate and understand the mechanism of restoration in peatlands. Restoration is not a short term process, and therefore periodic measurement (e.g. 10, 15 and 20 years post restoration) on physical-chemical and biological properties using soil microbiology integrated with a polyphasic and statistical analysis is required to assess the process of restoration.

110 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

References

111 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

References ACHARD, F., EVA, H. D., STIBIG, H.-J., MAYAUX, P., GALLEGO, J., RICHARDS, T. & MALINGREAU, J.-P. 2002. Determination of deforestation rates of the world's humid tropical forests. Science, 297, 999- 1002. AJWA, H., DELL, C. & RICE, C. 1999. Changes in enzyme activities and microbial biomass of tallgrass prairie soil as related to burning and nitrogen fertilization. Soil Biology and Biochemistry, 31, 769-777. ANDERSEN, R., CHAPMAN, S. & ARTZ, R. 2013. Microbial communities in natural and disturbed peatlands: a review. Soil Biology and Biochemistry, 57, 979-994. ANDERSEN, R., FRANCEZ, A. J. & ROCHEFORT, L. 2006. The physicochemical and microbiological status of a restored bog in Québec: Identification of relevant criteria to monitor success. Soil Biology and Biochemistry, 38, 1375-1387. ANDERSEN, R., GRASSET, L., THORMANN, M. N., ROCHEFORT, L. & FRANCEZ, A.-J. 2010. Changes in microbial community structure and function following Sphagnum peatland restoration. Soil Biology and Biochemistry, 42, 291-301. ANDERSON, J. A. R. 1983. The tropical peat swamps of western Malaysia. In: GORE, A. J. P. (ed.) Mires: swamp, bog, fen, and moor. Amsterdam: Elsevier. ANDRIESSE, J. 1988. Nature and Management of Tropical Peat Soils, Rome - Italy, Food and Agriculture Organization (FAO) of United Nations. ANGELONI, N. L., JANKOWSKI, K. J., TUCHMAN, N. C. & KELLY, J. J. 2006. Effects of an invasive cattail species (Typha× glauca) on sediment nitrogen and microbial community composition in a freshwater wetland. FEMS microbiology letters, 263, 86-92. ARAI, H., HADI, A., DARUNG, U., LIMIN, S. H., TAKAHASHI, H., HATANO, R. & INUBUSHI, K. 2014. Land use change affects microbial biomass and fluxes of carbon dioxide and nitrous oxide in tropical peatlands. Soil Science and Plant Nutrition, 60, 423-434. ARIAS, M. E., GONZÁLEZ-PÉREZ, J. A., GONZÁLEZ-VILA, F. J. & BALL, A. S. 2005. Soil health- a new challenge for microbiologists and chemists. International Microbiology, 8, 13-21. BALL, D. 1964. Loss-on-ignition as an estimate of organic matter and organic carbon in non-calcareous soils. Journal of Soil Science, 15, 84-92. BANDICK, A. K. & DICK, R. P. 1999. Field management effects on soil enzyme activities. Soil Biology and Biochemistry, 31, 1471-1479. BARDGETT, R. D., FREEMAN, C. & OSTLE, N. J. 2008. Microbial contributions to climate change through carbon cycle feedbacks. The ISME Journal, 2, 805-814. BELYEA, L. R. & CLYMO, R. 2001. Feedback control of the rate of peat formation. Proceedings of the Royal Society of London B: Biological Sciences, 268, 1315-1321. BERTHRONG, S. T., BUCKLEY, D. H. & DRINKWATER, L. E. 2013. Agricultural Management and Labile Carbon Additions Affect Soil Microbial Community Structure and Interact with Carbon and Nitrogen Cycling. Microbial ecology, 66, 158-170. BLACK, G. & HARTGE, K. 1986. Bulk density. Methods of soil analysis. Part, 1, 363-376. BLAUD, A., LERCH, T. Z., PHOENIX, G. K. & OSBORN, A. M. 2015. Arctic soil microbial diversity in a changing world. Research in microbiology. BLODAU, C. 2002. Carbon cycling in peatlands A review of processes and controls. Environmental Reviews, 10, 111-134. BLUNDELL, A. & HOLDEN, J. 2015. Using palaeoecology to support blanket peatland management. Ecological Indicators, 49, 110-120.

112 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

BORRERO, C., ORDOVÁS, J., TRILLAS, M. & AVILÉS, M. 2006. Tomato Fusarium wilt suppressiveness. The relationship between the organic plant growth media and their microbial communities as characterised by Biolog®. Soil Biology and Biochemistry, 38, 1631-1637. BOSSIO, D., GIRVAN, M. S., VERCHOT, L., BULLIMORE, J., BORELLI, T., ALBRECHT, A., SCOW, K., BALL, A. S., PRETTY, J. & OSBORN, A. M. 2005. Soil microbial community response to land use change in an agricultural landscape of western Kenya. Microbial ecology, 49, 50-62. BOSSIO, D. A. & SCOW, K. M. 1995. Impact of carbon and flooding on the metabolic diversity of microbial communities in soils. Applied and Environmental Microbiology, 61, 4043-4050. BOWLES, T. M., ACOSTA-MARTÍNEZ, V., CALDERÓN, F. & JACKSON, L. E. 2014. Soil enzyme activities, microbial communities, and carbon and nitrogen availability in organic agroecosystems across an intensively-managed agricultural landscape. Soil Biology and Biochemistry, 68, 252-262. BPS 2013. Statistical Yearbook of Indonesia. May 2013 ed.: BPS - Statistics Indonesia. BRADSHAW, C. J., SODHI, N. S. & BROOK, B. W. 2008. Tropical turmoil: a biodiversity tragedy in progress. Frontiers in Ecology and the Environment, 7, 79-87. BRAGAZZA, L., PARISOD, J., BUTTLER, A. & BARDGETT, R. D. 2013. Biogeochemical plant-soil microbe feedback in response to climate warming in peatlands. Nature Climate Change, 3, 273-277. BRINSON, M. M. 2011. Classification of Wetlands. In: LEPAGE, B. A. (ed.) Wetlands: Integrating Multidisciplinary Concepts. New York: Springer Science+Businessd Media. BURGER, J. A. & KELTING, D. L. 1999. Using soil quality indicators to assess forest stand management. Forest Ecology and Management, 122, 155-166. CAIRNEY, J. W. & BASTIAS, B. A. 2007. Influences of fire on forest soil fungal communities This article is one of a selection of papers published in the Special Forum on Towards Sustainable Forestry-The Living Soil: Soil Biodiversity and Ecosystem Function. Canadian Journal of Forest Research, 37, 207- 215. CASSEL, D. & NIELSEN, D. 2003. Field capacity and available water capacity. in: KLUTE, A. (ed) Methods of Soil Analyses, 2 nd edn. American Society of Agronomy, Madison, 901-926. CASTRO, H., OGRAM, A. & REDDY, K. 2004. Phylogenetic characterization of methanogenic assemblages in eutrophic and oligotrophic areas of the Florida Everglades. Applied and environmental microbiology, 70, 6559-6568. CERTINI, G. 2005. Effects of fire on properties of forest soils: a review. Oecologia, 143, 1-10. CHO, J. C. & TIEDJE, J. M. 2001. Bacterial species determination from DNA-DNA hybridization by using genome fragments and DNA microarrays. Applied and environmental microbiology, 67, 3677- 3682. CHOROMANSKA, U. & DELUCA, T. 2002. Microbial activity and nitrogen mineralization in forest mineral soils following heating: evaluation of post-fire effects. Soil Biology and Biochemistry, 34, 263-271. CHRISTIAN, B. W. & LIND, O. T. 2006. Key issues concerning Biolog use for aerobic and anaerobic freshwater bacterial community‐level physiological profiling. International review of hydrobiology, 91, 257-268. CHUN-JUAN, B., ZHEN-LOU, C., JUN, W. & DONG, Z. 2013. Quantitative assessment of soil health under different planting patterns and soil types. Pedosphere, 23, 194-204. CLASSEN, A. T., BOYLE, S. I., HASKINS, K. E., OVERBY, S. T. & HART, S. C. 2003. Community‐level physiological profiles of bacteria and fungi: plate type and incubation temperature influences on contrasting soils. FEMS Microbiology Ecology, 44, 319-328. CLYMO, R. 1984. The limits to peat bog growth. Philosophical Transactions of the Royal Society of London. B, Biological Sciences, 303, 605-654. COWARDIN, L. M., CARTER, V., GOLET, F. C. & LAROE, E. T. 1985. Classification of wetlands and deepwater habitats of the United States. Washington: United States Fish and Wildlife Service.

113 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

DE VRIES, F. T., THÉBAULT, E., LIIRI, M., BIRKHOFER, K., TSIAFOULI, M. A., BJØRNLUND, L., JØRGENSEN, H. B., BRADY, M. V., CHRISTENSEN, S. & DE RUITER, P. C. 2013. Soil food web properties explain ecosystem services across European land use systems. Proceedings of the National Academy of Sciences, 110, 14296-14301. DENG, Y., CUI, X. & DUMONT, M. G. 2016. Identification of active aerobic methanotrophs in plateau wetlands using DNA stable isotope probing. FEMS Microbiology Letters, 363, fnw168. DERRY, A., STADDON, W. & TREVORS, J. 1998. Functional diversity and community structure of microorganisms in uncontaminated and creosote-contaminated soils as determined by sole- carbon-source-utilization. World Journal of Microbiology and Biotechnology, 14, 571-578. DICK, R., PANKHURST, C., DOUBE, B. & GUPTA, V. 1997. Soil enzyme activities as integrative indicators of soil health. Biological indicators of soil health., 121-156. DICK, R., RASMUSSEN, P. & KERLE, E. 1988. Influence of long-term residue management on soil enzyme activities in relation to soil chemical properties of a wheat-fallow system. Biology and Fertility of Soils, 6, 159-164. DICK, R. P. & BURNS, R. G. 2011. A brief history of soil enzymology research. Methods of soil enzymology. Soil Science Society of America, Madison, 1-34. DICK, W., CHENG, L. & WANG, P. 2000. Soil acid and alkaline phosphatase activity as pH adjustment indicators. Soil Biology and Biochemistry, 32, 1915-1919. DICK, W. & TABATABAI, M. 1983. Activation of soil pyrophosphatase by metal ions. Soil biology and biochemistry, 15, 359-363. DOHRMANN, A. & TEBBE, C. 2004. Microbial community analysis by PCR-single-strand conformation polymorphism (PCR-SSCP). In: KOWALCHUK, G., DE BRUIJN, F., HEAD, I., AKKERMANS, A. & VAN ELSAS, J. (eds.) Molecular Microbial Ecology Manual. Dordrecht: Kluwer Academic Publishers. DONG, X. & REDDY, G. B. 2010. Soil bacterial communities in constructed wetlands treated with swine wastewater using PCR-DGGE technique. Bioresource technology, 101, 1175-1182. DOOLEY, S. R. & TRESEDER, K. K. 2012. The effect of fire on microbial biomass: a meta-analysis of field studies. Biogeochemistry, 109, 49-61. DORAN, J. W., COLEMAN, D., BEZDICEK, D. & STEWART, B. Defining soil quality for a sustainable environment. 1994. Soil Science Society of America Madison, WI. DORAN, J. W. & PARKIN, T. B. 1996. Quantitative indicators of soil quality: a minimum data set. In: DORAN, J. W. & JONES, A. J. (eds.) Methods for assessing soil quality. Medison, WI: Soil Science Sociaty of America. DORAN, J. W. & ZEISS, M. R. 2000. Soil health and sustainability: managing the biotic component of soil quality. Applied Soil Ecology, 15, 3-11. DUINEVELD, B. M., KOWALCHUK, G. A., KEIJZER, A., VAN ELSAS, J. D. & VAN VEEN, J. A. 2001. Analysis of bacterial communities in the rhizosphere of chrysanthemum via denaturing gradient gel electrophoresis of PCR-amplified 16S rRNA as well as DNA fragments coding for 16S rRNA. Applied and environmental microbiology, 67, 172-178. DUNBAR, J., TICKNOR, L. O. & KUSKE, C. R. 2000. Assessment of microbial diversity in four southwestern United States soils by 16S rRNA gene terminal restriction fragment analysis. Applied and environmental microbiology, 66, 2943-2950. DUNN, P. H., BARRO, S. C. & POTH, M. 1985. Soil moisture affects survival of microorganisms in heated chaparral soil. Soil Biology and Biochemistry, 17, 143-148. DUNN, P. H. & DEBANO, L. F. 1977. Fire's effect on biological and chemical properties of chaparral soils. USDA Forest Service General Technical Report WO. ERWIN, K. L. 2009. Wetlands and global climate change: the role of wetland restoration in a changing world. Wetlands Ecology and management, 17, 71-84.

114 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

FARMER, J., MATTHEWS, R., SMITH, P., LANGAN, C., HERGOUALC'H, K., VERCHOT, L. & SMITH, J. U. 2014. Comparison of methods for quantifying soil carbon in tropical peats. Geoderma, 214, 177-183. FENNER, N. & FREEMAN, C. 2011. Drought-induced carbon loss in peatlands. Nature geoscience, 4, 895- 900. FENNER, N., FREEMAN, C. & REYNOLDS, B. 2005. Hydrological effects on the diversity of phenolic degrading bacteria in a peatland: implications for carbon cycling. Soil Biology and Biochemistry, 37, 1277-1287. FERNÁNDEZ, I., CABANEIRO, A. & CARBALLAS, T. 1999. Carbon mineralization dynamics in soils after wildfires in two Galician forests. Soil Biology and Biochemistry, 31, 1853-1865. FERRIS, H. & TUOMISTO, H. 2015. Unearthing the role of biological diversity in soil health. Soil Biology and Biochemistry, 85, 101-109. FISCHER, S. G. & LERMAN, L. S. 1980. Separation of random fragments of DNA according to properties of their sequences. Proceedings of the National Academy of Sciences, 77, 4420-4424. FISHER, M. M. & TRIPLETT, E. W. 1999. Automated approach for ribosomal intergenic spacer analysis of microbial diversity and its application to freshwater bacterial communities. Applied and environmental microbiology, 65, 4630-4636. FLOCH, C., CHEVREMONT, A.-C., JOANICO, K., CAPOWIEZ, Y. & CRIQUET, S. 2011. Indicators of pesticide contamination: Soil enzyme compared to functional diversity of bacterial communities via Biolog® Ecoplates. European Journal of Soil Biology, 47, 256-263. GARDES, M. & BRUNS, T. D. 1993. ITS primers with enhanced specificity for basidiomycetes‐application to the identification of mycorrhizae and rusts. Molecular ecology, 2, 113-118. GARDNER, R. C. & DAVIDSON, N. C. 2011. The Ramsar convention. In: LEPAGE, B. A. (ed.) Wetlands: integrating multidisciplinary concepts. New York: Springer Science+Business Media. GARLAND, J. L. 1996a. Analytical approaches to the characterization of samples of microbial communities using patterns of potential C source utilization. Soil Biology and Biochemistry, 28, 213-221. GARLAND, J. L. 1996b. Patterns of potential C source utilization by rhizosphere communities. Soil Biology and Biochemistry, 28, 223-230. GARLAND, J. L. 1997. Analysis and interpretation of community‐level physiological profiles in microbial ecology. FEMS Microbiology Ecology, 24, 289-300. GARLAND, J. L. & LEHMAN, R. M. 1999. Dilution/extinction of community phenotypic characters to estimate relative structural diversity in mixed communities. FEMS Microbiology Ecology, 30, 333- 343. GARLAND, J. L. & MILLS, A. L. 1991. Classification and characterization of heterotrophic microbial communities on the basis of patterns of community-level sole-carbon-source utilization. Applied and environmental microbiology, 57, 2351-2359. GIANFREDA, L. & RUGGIERO, P. 2006. Enzyme activities in soil. In: NANNIPIERI, P. & SMALLA, K. (ed) Nucleic acids and proteins in soil, Volume 8 Soil Biology. Berlin, Springer, 257 - 311. GIRVAN, M. S., BULLIMORE, J., PRETTY, J. N., OSBORN, A. M. & BALL, A. S. 2003. Soil type is the primary determinant of the composition of the total and active bacterial communities in arable soils. Applied and Environmental Microbiology, 69, 1800-1809. GOBERNA, M., GARCIA, C., INSAM, H., HERNÁNDEZ, M. & VERDÚ, M. 2012. Burning fire-prone Mediterranean shrublands: immediate changes in soil microbial community structure and ecosystem functions. Microbial ecology, 64, 242-255. GOMEZ, E., BISARO, V. & CONTI, M. 2000. Potential C-source utilization patterns of bacterial communities as influenced by clearing and land use in a vertic soil of Argentina. Applied Soil Ecology, 15, 273- 281. GORHAM, E. 1991. Northern peatlands: role in the carbon cycle and probable responses to climatic warming. Ecological applications, 1, 182-195.

115 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

GOVERNMENT, D. O. H. O. R. P. 2012. Estates Production of Riau Province in Statistics 2012 Pekanbaru GRAHAM, J. H., HODGE, N. C. & MORTON, J. B. 1995. Fatty Acid methyl ester profiles for characterization of glomalean fungi and their endomycorrhizae. Applied and environmental microbiology, 61, 58- 64. GREENE, E. & VOORDOUW, G. 2003. Analysis of environmental microbial communities by reserve sample genome probing. J. Microbial. Methods, 53, 211-219. GUNAWAN, H., KOBAYASHI, S., MIZUNO, K. & KONO, Y. 2012. Peat swamp forest types and their regeneration in Giam Siak Kecil-Bukit Batu Bioshere Reserve, Riau, East Sumatra, Indonesia. Mires and Peat, 10, 1-17. HAIFANG, Z., GANG, L., XIAOLONG, S., DIANLIN, Y., YUJIE, L., JIANG, Q., JINGNI, Z. & SHULAN, Z. 2013. Changes in soil microbial functional diversity under different vegetation restoration patterns for Hulunbeier Sandy Land. Acta Ecologica Sinica, 33, 38-44. HAMMAN, S. T., BURKE, I. C. & STROMBERGER, M. E. 2007. Relationships between microbial community structure and soil environmental conditions in a recently burned system. Soil Biology and Biochemistry, 39, 1703-1711. HARRISON, M. E. 2013. Using Conceptual Models to Understand Ecosystem Function and Impacts of Human Activities in Tropical Peat-swamp Forests. Wetlands, 33, 257-267. HART, S. C., DELUCA, T. H., NEWMAN, G. S., MACKENZIE, M. D. & BOYLE, S. I. 2005. Post-fire vegetative dynamics as drivers of microbial community structure and function in forest soils. Forest Ecology and Management, 220, 166-184. HARTMAN, W. H., RICHARDSON, C. J., VILGALYS, R. & BRULAND, G. L. 2008. Environmental and anthropogenic controls over bacterial communities in wetland soils. Proceedings of the National Academy of Sciences, 105, 17842-17847. HARVEY, A., LARSEN, M. & JURGENSEN, M. 1976. Distribution of ectomycorrhizae in a mature Douglas- fir/larch forest soil in western Montana. Forest Science, 22, 393-398. HAZELTON, P. & MURPHY, B. 2007. Interpreting Soil Test Results : What do all the numbers mean? , Collingwood CSIRO Publising. HELGASON, T., DANIELL, T., HUSBAND, R., FITTER, A. & YOUNG, J. 1998. Ploughing up the wood-wide web? Nature, 394, 431-431. HERGOUALC'H, K. A. & VERCHOT, L. V. 2012. Changes in soil CH4 fluxes from the conversion of tropical peat swamp forests: a meta-analysis. Journal of Integrative Environmental Sciences, 9, 93-101. HILL, G., MITKOWSKI, N., ALDRICH-WOLFE, L., EMELE, L., JURKONIE, D., FICKE, A., MALDONADO-RAMIREZ, S., LYNCH, S. & NELSON, E. 2000. Methods for assessing the composition and diversity of soil microbial communities. Applied Soil Ecology, 15, 25-36. HIRANO, T., SEGAH, H., KUSIN, K., LIMIN, S., TAKAHASHI, H. & OSAKI, M. 2012. Effects of disturbances on the carbon balance of tropical peat swamp forests. Global Change Biology, 18, 3410-3422. HOGG, E. H., LIEFFERS, V. J. & WEIN, R. W. 1992. Potential carbon losses from peat profiles: effects of temperature, drought cycles, and fire. Ecological Applications, 298-306. HOLDEN, J., SHOTBOLT, L., BONN, A., BURT, T., CHAPMAN, P., DOUGILL, A., FRASER, E., HUBACEK, K., IRVINE, B. & KIRKBY, M. 2007. Environmental change in moorland landscapes. Earth-Science Reviews, 82, 75-100. HOOIJER, A., PAGE, S., CANADELL, J., SILVIUS, M., KWADIJK, J., WÖSTEN, H. & JAUHIAINEN, J. 2010. Current and future CO 2 emissions from drained peatlands in Southeast Asia. Biogeosciences, 7, 1505- 1514. HUANG, J., SHENG, X., HE, L., HUANG, Z., WANG, Q. & ZHANG, Z. 2013. Characterization of depth-related changes in bacterial community compositions and functions of a paddy soil profile. FEMS microbiology letters, 347, 33-42.

116 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

HUAT, B. B., KAZEMIAN, S., PRASAD, A. & BARGHCHI, M. 2011. State of an art review of peat: General perspective. Int. J. Phys. Sci, 6, 1988-1996. HUBERT, C., SHEN, Y. & VOORDOUW, G. 1999. Composition of toluene-degrading microbial communities from soil at different concentrations of toluene. Applied and environmental microbiology, 65, 3064-3070. INUBUSHI, K., FURUKAWA, Y., HADI, A., PURNOMO, E. & TSURUTA, H. 2003. Seasonal changes of CO2, CH4 and N2O fluxes in relation to land-use change in tropical peatlands located in coastal area of South Kalimantan. Chemosphere, 52, 603-608. JACKSON, C. R., LANGNER, H. W., DONAHOE‐CHRISTIANSEN, J., INSKEEP, W. P. & MCDERMOTT, T. R. 2001. Molecular analysis of microbial community structure in an arsenite‐oxidizing acidic thermal spring. Environmental Microbiology, 3, 532-542. JACKSON, C. R., LIEW, K. C. & YULE, C. M. 2009. Structural and functional changes with depth in microbial communities in a tropical Malaysian peat swamp forest. Microbial ecology, 57, 402-412. JACKSON, C. R., RODEN, E. E. & CHURCHILL, P. F. 2000. Denaturing gradient gel electrophoresis can fail to separate 16S rDNA fragments with multiple base differences. Mol Biol Today, 1, 49-51. JACKSON, C. R. & VALLAIRE, S. C. 2009. Effects of salinity and nutrients on microbial assemblages in Louisiana wetland sediments. Wetlands, 29, 277-287. JING, Z., CHENG, J., JIN, J., SU, J. & BAI, Y. 2014. Revegetation as an efficient means of improving the diversity and abundance of soil eukaryotes in the Loess Plateau of China. Ecological Engineering, 70, 169-174. JOLY, P., MISSON, B., PERRIÈRE, F., BONNEMOY, F., JOLY, M., DONNADIEU-BERNARD, F., AGUER, J.-P., BOHATIER, J. & MALLET, C. 2014. Soil surface colonization by phototrophic indigenous organisms, in two contrasted soils treated by formulated maize herbicide mixtures. Ecotoxicology, 23, 1648- 1658. JOOSTEN, H. & CLARKE, D. 2002. Wise use of mires and peatlands, International mire conservation group. KALBITZ, K., GEYER, W. & GEYER, S. 1999. Spectroscopic properties of dissolved humic substances—a reflection of land use history in a fen area. Biogeochemistry, 47, 219-238. KANDELER, F., KAMPICHLER, C. & HORAK, O. 1996. Influence of heavy metals on the functional diversity of soil microbial communities. Biology and Fertility of Soils, 23, 299-306. KANG, H. & FREEMAN, C. 1999. Phosphatase and arylsulphatase activities in wetland soils: annual variation and controlling factors. Soil Biology and Biochemistry, 31, 449-454. KANOKRATANA, P., UENGWETWANIT, T., RATTANACHOMSRI, U., BUNTERNGSOOK, B., NIMCHUA, T., TANGPHATSORNRUANG, S., PLENGVIDHYA, V., CHAMPREDA, V. & EURWILAICHITR, L. 2011. Insights into the phylogeny and metabolic potential of a primary tropical peat swamp forest microbial community by metagenomic analysis. Microbial ecology, 61, 518-528. KASIMIR-KLEMEDTSSON, A., KLEMEDTSSON, L., BERGLUND, K., MARTIKAINEN, P., SILVOLA, J. & OENEMA, O. 1997. Greenhouse gas emissions from farmed organic soils: a review. Soil use and management, 13, 245 - 250. KAYRANLI, B., SCHOLZ, M., MUSTAFA, A. & HEDMARK, Å. 2010. Carbon storage and fluxes within freshwater wetlands: a critical review. Wetlands, 30, 111-124. KEDDY, P. A. 2000. Wetland ecology: principles and conservation, Cambridge, Cambridge University Press. KIRK, J. L., BEAUDETTE, L. A., HART, M., MOUTOGLIS, P., KLIRONOMOS, J. N., LEE, H. & TREVORS, J. T. 2004. Methods of studying soil microbial diversity. Journal of microbiological methods, 58, 169-188. KLEIMEIER, C., KARSTEN, U. & LENNARTZ, B. 2014. Suitability of degraded peat for constructed wetlands— Hydraulic properties and nutrient flushing. Geoderma, 228, 25-32. KOH, L. P., MIETTINEN, J., LIEW, S. C. & GHAZOUL, J. 2011. Remotely sensed evidence of tropical peatland conversion to oil palm. Proceedings of the National Academy of Sciences, 108, 5127-5132.

117 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

KOTROCZÓ, Z., VERES, Z., FEKETE, I., KRAKOMPERGER, Z., TÓTH, J. A., LAJTHA, K. & TÓTHMÉRÉSZ, B. 2014. Soil enzyme activity in response to long-term organic matter manipulation. Soil Biology and Biochemistry, 70, 237-243. KOWALCHUK, G. A., BODELIER, P. L., HEILIG, G. H. J., STEPHEN, J. R. & LAANBROEK, H. J. 1998. Community analysis of ammonia-oxidising bacteria, in relation to oxygen availability in soils and root- oxygenated sediments, using PCR, DGGE and oligonucleotide probe hybridisation. FEMS Microbiology Ecology, 27, 339-350. KREADER, C. A. 1996. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Applied and Environmental Microbiology, 62, 1102-1106. KURNIANTO, S., WARREN, M., TALBOT, J., KAUFFMAN, B., MURDIYARSO, D. & FROLKING, S. 2014. Carbon accumulation of tropical peatlands over millennia: a modeling approach. Global change biology. LAGERSTRÖM, A., ESBERG, C., WARDLE, D. A. & GIESLER, R. 2009. Soil phosphorus and microbial response to a long-term wildfire chronosequence in northern Sweden. Biogeochemistry, 95, 199-213. LAMPELA, M., JAUHIAINEN, J. & VASANDER, H. 2014. Surface peat structure and chemistry in a tropical peat swamp forest. Plant and Soil, 382, 329-347. LAURANCE, W. F. 1999. Reflections on the tropical deforestation crisis. Biological Conservation, 91, 109- 117. LAWLOR, K., KNIGHT, B. P., BARBOSA‐JEFFERSON, V. L., LANE, P. W., LILLEY, A. K., PATON, G. I., MCGRATH, S. P., O'FLAHERTY, S. L. M. & HIRSCH, P. R. 2000. Comparison of methods to investigate microbial populations in soils under different agricultural management. FEMS microbiology ecology, 33, 129-137. LEE-CRUZ, L., EDWARDS, D. P., TRIPATHI, B. M. & ADAMS, J. M. 2013. Impact of Logging and Forest Conversion to Oil Palm Plantations on Soil Bacterial Communities in Borneo. Applied and environmental microbiology, 79, 7290-7297. LEE, D. H., ZO, Y. G. & KIM, S. J. 1996. Nonradioactive method to study genetic profiles of natural bacterial communities by PCR-single-strand-conformation polymorphism. Applied and environmental microbiology, 62, 3112-3120. LEPLEUX, C., UROZ, S., COLLIGNON, C., CHURIN, J.-L., TURPAULT, M.-P. & FREY-KLETT, P. 2013. A short- term mineral amendment impacts the mineral weathering bacterial communities in an acidic forest soil. Research in microbiology. LEVINE, U. Y., TEAL, T. K., ROBERTSON, G. P. & SCHMIDT, T. M. 2011. Agriculture's impact on microbial diversity and associated fluxes of carbon dioxide and methane. The ISME journal, 5, 1683-1691. LIM, K. H., LIM, S. S., PARISH, F. & SUHARTO, R. 2012. RSPO Manual on Best Management Practices (BMPs) for Existing Oil Palm Cultivation on Peat. Kuala Lumpur: RSPO. LIMPENS, J., BERENDSE, F., BLODAU, C., CANADELL, J., FREEMAN, C., HOLDEN, J., ROULET, N., RYDIN, H. & SCHAEPMAN-STRUB, G. 2008. Peatlands and the carbon cycle: from local processes to global implications? a synthesis. Biogeosciences Discussions, 5, 1379-1419. LIU, W. T., MARSH, T. L., CHENG, H. & FORNEY, L. J. 1997. Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16S rRNA. Applied and environmental microbiology, 63, 4516-4522. LU, Y., LUEDERS, T., FRIEDRICH, M. W. & CONRAD, R. 2005. Detecting active methanogenic populations on rice roots using stable isotope probing. Environmental Microbiology, 7, 326-336. LUPWAYI, N., HARKER, K., CLAYTON, G., O’DONOVAN, J. & BLACKSHAW, R. 2009. Soil microbial response to herbicides applied to glyphosate-resistant canola. Agriculture, ecosystems & environment, 129, 171-176. MAARIT NIEMI, R., HEISKANEN, I., WALLENIUS, K. & LINDSTRÖM, K. 2001. Extraction and purification of DNA in rhizosphere soil samples for PCR-DGGE analysis of bacterial consortia. Journal of microbiological methods, 45, 155-165.

118 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

MACDICKEN, K. 2002. Cash for tropical peat: Land use change and forestry projects for climate change mitigation. In: RIELEY, J. & SETIADI, B., eds. Peatlands for People: Natural Resources Functions and Sustainable Management 2001 Jakarta. Jakarta: BPPT and Indonesian Peat Association. MACHADO DE OLIVEIRA, J., SIQUEIRA, J., RÔÇAS, I., BAUMGARTNER, J., XIA, T., PEIXOTO, R. & ROSADO, A. 2007. Bacterial community profiles of endodontic abscesses from Brazilian and USA subjects as compared by denaturing gradient gel electrophoresis analysis. Oral microbiology and immunology, 22, 14-18. MÄDER, P., FLIESSBACH, A., DUBOIS, D., GUNST, L., FRIED, P. & NIGGLI, U. 2002. Soil fertility and biodiversity in organic farming. Science, 296, 1694-1697. MALIK, S., BEER, M., MEGHARAJ, M. & NAIDU, R. 2008. The use of molecular techniques to characterize the microbial communities in contaminated soil and water. Environment International, 34, 265- 276. MALTBY, E. & IMMIRZI, P. 1993. Carbon dynamics in peatlands and other wetland soils regional and global perspectives. Chemosphere, 27, 999-1023. MANAGEMENT, N. W. G. O. P. 2006. National Strategy and Action Plan for Sustainable Management of Peatlands. Jakarta: Indonesian Ministry of Home Affairs. MARINARI, S., BONIFACIO, E., MOSCATELLI, M., FALSONE, G., ANTISARI, L. V. & VIANELLO, G. 2013. Soil development and microbial functional diversity: proposal for a methodological approach. Geoderma, 192, 437-445. MARINARI, S., MASCIANDARO, G., CECCANTI, B. & GREGO, S. 2000. Influence of organic and mineral fertilisers on soil biological and physical properties. Bioresource Technology, 72, 9-17. MARSCHNER, P., KANDELER, E. & MARSCHNER, B. 2003. Structure and function of the soil microbial community in a long-term fertilizer experiment. Soil Biology and Biochemistry, 35, 453-461. MARTIKAINEN, P. J., NYKÄNEN, H., CRILL, P. & SILVOLA, J. 1993. Effect of a lowered water table on nitrous oxide fluxes from northern peatlands. Nature, 366, 51-53. MARZORATI, M., WITTEBOLLE, L., BOON, N., DAFFONCHIO, D. & VERSTRAETE, W. 2008. How to get more out of molecular fingerprints: practical tools for microbial ecology. Environmental microbiology, 10, 1571-1581. MISHRA, S., LEE, W., HOOIJER, A., REUBEN, S., SUDIANA, I., IDRIS, A. & SWARUP, S. 2013. Microbial and metabolic profiling reveal strong influence of water table and land-use patterns on classification of degraded tropical peatlands. Biogeosciences Discussions, 10, 14009-14042. MITRA, S., WASSMANN, R. & VLEK, P. L. 2005. An appraisal of global wetland area and its organic carbon stock. Current Science, 88, 25. MORITA, R. 1990. The starvation-survival state of microorganisms in nature and its relationship to the bioavailable energy. Experientia, 46, 813-817. MUYZER, G., DE WAAL, E. C. & UITTERLINDEN, A. G. 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Applied and environmental microbiology, 59, 695-700. MUYZER, G. & SMALLA, K. 1998. Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology. Antonie van Leeuwenhoek, 73, 127-141. MYERS, R. M., LUMELSKY, N., LERMAN, L. S. & MANIATIS, T. 1985. Detection of single base substitutions in total genomic DNA. Nature, 313, 495-498. NAKANE, K., KOHNO, T. & HORIKOSHI, T. 1996. Root respiration rate before and just after clear-felling in a mature, deciduous, broad-leaved forest. Ecological Research, 11, 111-119. NANNIPIERI, P. 2011. Potential impacts of climate change on microbial function in soil. Sustaining Soil Productivity in Response to Global Climate Change: Science, Policy, and Ethics, 201-211.

119 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

NANNIPIERI, P., GIAGNONI, L., RENELLA, G., PUGLISI, E., CECCANTI, B., MASCIANDARO, G., FORNASIER, F., MOSCATELLI, M. & MARINARI, S. 2012a. Soil enzymology: classical and molecular approaches. Biology and Fertility of Soils, 48, 743-762. NANNIPIERI, P., KANDELER, E. & RUGGIERO, P. 2002. Enzyme activities and microbiological and biochemical processes in soil. In: BURNS, R. G. & DICK, R. P. (eds.) Enzymes in the Environment. Activity, Ecology and Applications. New York: Marcel Dekker. NANNIPIERI, P., LANDI, L., GIAGNONI, L. & RENELLA, G. 2012b. Past, Present and Future in Soil Enzymology. In: TRASAR-CEPEDA, C., HERNANDEZ, T., GARCIA, C., RAD, C. & GONZÁLEZ-CARCEDO, S. (eds.) Soil Enzymology in the Recycling of Organic Wastes and Environmental Restoration. Heidelberg Springer Sciences+Business media. NANNIPIERI, P., MUCCINI, L. & CIARDI, C. 1983. Microbial biomass and enzyme activities: production and persistence. Soil Biology and Biochemistry, 15, 679-685. NG, E.-L., PATTI, A., ROSE, M., SCHEFE, C., SMERNIK, R. & CAVAGNARO, T. 2014. Do organic inputs alter resistance and resilience of soil microbial community to drying? Soil Biology and Biochemistry. NORTCLIFF, S. 2002. Standardisation of soil quality attributes. Agriculture, ecosystems & environment, 88, 161-168. NÜSSLEIN, K. & TIEDJE, J. M. 1999. Soil bacterial community shift correlated with change from forest to pasture vegetation in a tropical soil. Applied and environmental microbiology, 65, 3622-3626. NYBROE, O., BRANDT, K. K., NICOLAISEN, M. H. & SORENSEN, J. 2007. Methods to Detect and Quantify Bacteria in Soil. In: VAN ELSAS, J. D., JANSSON, J. K. & TREVORS, J. T. (eds.) Modern Soil Microbiology. 2nd ed. Boca Rotan, FL: CRC Press - Taylor & Francis Group. OLESZCZUK, R., REGINA, K., SZAJDAK, L., HÖPER, H. & MARYGANOVA, V. 2008. Impacts of agricultural utilization of peat soils on the greenhouse gas balance. In: STRACK, M. (ed.) Peatlands and climate change. Jyvaskyla, Finland: International Peat Society. ORLOV, D., SADOVNIKOVA, L. & SUKHOVA, I. 2000. Organic matter in the peaty podzolic-gley soils of the Yaroslavl Oblast and its changes upon drainage. Eurasian soil science, 33, 954-958. OSBORN, A. M., MOORE, E. R. B. & TIMMIS, K. N. 2000. An evaluation of terminal‐restriction fragment length polymorphism (T‐RFLP) analysis for the study of microbial community structure and dynamics. Environmental Microbiology, 2, 39-50. OSMAN, K. T. 2012. Soils: principles, properties and management, Springer Science & Business Media. OSMAN, K. T. 2013. Forest Soils: Properties and Management, Springer Science & Business Media. PAGE, S., HOSCILO, A., LANGNER, A., TANSEY, K., SIEGERT, F., LIMIN, S. & RIELEY, J. 2009a. Tropical peatland fires in Southeast Asia. Tropical Fire Ecology. Springer. PAGE, S., HOSCIŁO, A., WÖSTEN, H., JAUHIAINEN, J., SILVIUS, M., RIELEY, J., RITZEMA, H., TANSEY, K., GRAHAM, L. & VASANDER, H. 2009b. Restoration ecology of lowland tropical peatlands in Southeast Asia: current knowledge and future research directions. Ecosystems, 12, 888-905. PAGE, S. E., BANKS, C. & RIELEY, J. O. 2007. Tropical peatlands: distribution, extent and carbon storage- uncertainties and knowledge gaps. Peatlands International, 2, 26-27. PAGE, S. E., RIELEY, J. O. & BANKS, C. J. 2011. Global and regional importance of the tropical peatland carbon pool. Global Change Biology, 17, 798-818. PAGE, S. E., SIEGERT, F., RIELEY, J. O., BOEHM, H. D. V., JAYA, A. & LIMIN, S. 2002. The amount of carbon released from peat and forest fires in Indonesia during 1997. Nature, 420, 61-65. PARRY, L., WEST, L., HOLDEN, J. & CHAPMAN, P. 2014a. Evaluating approaches for estimating peat depth. Journal of Geophysical Research: Biogeosciences, 119, 567-576. PARRY, L. E., HOLDEN, J. & CHAPMAN, P. J. 2014b. Restoration of blanket peatlands. Journal of environmental management, 133, 193-205. PEPPER, I. L. & DOWD, S. E. 2002. PCR aplications for plant and soil microbes. In: HURST, C. (ed.) Manuat of Enviornmental Microbiology. 2 ed. Wahington DC: ASM Press.

120 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

PERALTA, A. L., LUDMER, S. & KENT, A. D. 2013. Hydrologic history influences microbial community composition and nitrogen cycling under experimental drying/wetting treatments. Soil Biology and Biochemistry, 66, 29-37. PERSIC, A. & OCLOO, M. 2011. Biosphere Reserves, World Heritage Sites and People: Enhancing Synergies for Sustainable Forests. In: PATRY, M., HORN, R. & HARAGUCHI, S. (eds.) Adapting to Change - The State of Conservation of World Heritage Forests in 2011. Paris: World Heritage Center - United Nations Educational, Scientific and Cultural Organization (UNESCO). PICHLER, B. 2010. Biochars and their impact on nutrient retention and water mass balance in a Swiss vineyard soil. Master Thesis University of Zurich. POSA, M. R. C., WIJEDASA, L. S. & CORLETT, R. T. 2011. Biodiversity and conservation of tropical peat swamp forests. BioScience, 61, 49-57. POURREZA, M., HOSSEINI, S. M., SINEGANI, A. A. S., MATINIZADEH, M. & DICK, W. A. 2014. Soil microbial activity in response to fire severity in Zagros oak (Quercus brantii Lindl.) forests, Iran, after one year. Geoderma, 213, 95-102. PRESTON-MAFHAM, J., BODDY, L. & RANDERSON, P. F. 2002. Analysis of microbial community functional diversity using sole-carbon-source utilisation profiles–a critique. FEMS Microbiology Ecology, 42, 1-14. PRETTY, J., TOULMIN, C. & WILLIAMS, S. 2011. Sustainable intensification in African agriculture. International journal of agricultural sustainability, 9, 5-24. PUGLISI, E., ZACCONE, C., CAPPA, F., COCCONCELLI, P. S., SHOTYK, W., TREVISAN, M. & MIANO, T. M. 2014. Changes in bacterial and archaeal community assemblages along an ombrotrophic peat bog profile. Biology and Fertility of Soils, 1-12. QUIROGA, M. V., VALVERDE, A., MATALONI, G. & COWAN, D. 2015. Understanding diversity patterns in bacterioplankton communities from a sub-Antarctic peatland. Environmental Microbiology Reports, 7, 547-553. RADAJEWSKI, S., INESON, P., PAREKH, N. R. & MURRELL, J. C. 2000. Stable-isotope probing as a tool in microbial ecology. Nature, 403, 646-649. REYNOLDS, C. & DAVIES, P. 2001. Sources and bioavailability of phosphorus fractions in freshwaters: a British perspective. Biological Reviews, 76, 27-64. RIELEY, J., AHMAD-SHAH, A. & BRADY, M. The extent and nature of tropical peat swamp. In: MALTBY, E., IMMIRZI, C. & SAFFORD, R., eds. Tropical lowland peatlands of Southeast Asia, 1996 Cisarua, Indonesia. Gland Switzerland: IUCN, 17-53. RIELEY, J. & SETIADI, B. 1997. Role of tropical peatlands in the global carbon balance: preliminary findings from the high peats of Central Kalimantan, Indonesia Alami, 2, 52-56. RIELEY, J., WÜST, R., JAUHIAINEN, J., PAGE, S., WÖSTEN, H., HOOIJER, A., SIEGERT, F., LIMIN, S., VASANDER, H. & STAHLHUT, M. 2008. Tropical peatlands: carbon stores, carbon gas Emissions and contribution to climate change Processes. Peatlands and Climate Change. International Peat Society, Vapaudenkatu, 12, 148-182. ROWELL, D. L. 1994. Soil science: methods and applications, Essex, Longman Scientific & Technical. SAKATA, R., SHIMADA, S., ARAI, H., YOSHIOKA, N., YOSHIOKA, R., AOKI, H., KIMOTO, N., SAKAMOTO, A., MELLING, L. & INUBUSHI, K. 2015. Effect of soil types and nitrogen fertilizer on nitrous oxide and carbon dioxide emissions in oil palm plantations. Soil Science and Plant Nutrition, 61, 48-60. SAN MIGUEL, C., DULINSKI, M. & TATE, R. L. 2007. Direct comparison of individual substrate utilization from a CLPP study: a new analysis for metabolic diversity data. Soil Biology and Biochemistry, 39, 1870-1877. SARDANS, J. & PEÑUELAS, J. 2005. Drought decreases soil enzyme activity in a Mediterranean Quercus ilex L. forest. Soil Biology and Biochemistry, 37, 455-461.

121 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

SCHMIDT, S. & LIPSON, D. 2004. Microbial growth under the snow: implications for nutrient and allelochemical availability in temperate soils. Plant and Soil, 259, 1-7. SCHOENHOLTZ, S. H., MIEGROET, H. V. & BURGER, J. 2000. A review of chemical and physical properties as indicators of forest soil quality: challenges and opportunities. Forest Ecology and management, 138, 335-356. SCHWEITZER, J. A., FISCHER, D. G., REHILL, B. J., WOOLEY, S. C., WOOLBRIGHT, S. A., LINDROTH, R. L., WHITHAM, T. G., ZAK, D. R. & HART, S. C. 2011. Forest gene diversity is correlated with the composition and function of soil microbial communities. Population ecology, 53, 35-46. SEKIGUCHI, H., TOMIOKA, N., NAKAHARA, T. & UCHIYAMA, H. 2001. A single band does not always represent single bacterial strains in denaturing gradient gel electrophoresis analysis. Biotechnology letters, 23, 1205-1208. SEMENIUK, C. & SEMENIUK, V. 1995. A geomorphic approach to global classification for inland wetlands. Vegetatio, 118, 103-124. SHALON, D., SMITH, S. J. & BROWN, P. O. 1996. A DNA microarray system for analyzing complex DNA samples using two-color fluorescent probe hybridization. Genome research, 6, 639-645. SHANNON, C. E. & WEAVER, W. 1949. The mathematical theory of communication, Champaign, University of Illinois Press. SHAW, S. P. & FREDINE, C. G. 1956. Wetlands of United States, Washington, United States Department of the Interior, Fish and Wildlife Service Circular 39. SICILIANO, S. D. & GERMIDA, J. J. 1998. Biolog analysis and fatty acid methyl ester profiles indicate that pseudomonad inoculants that promote phytoremediation alter the root-associated microbial community of Bromus biebersteinii. Soil Biology and Biochemistry, 30, 1717-1723. SIZOVA, M. V., PANIKOV, N. S., TOUROVA, T. P. & FLANAGAN, P. W. 2003. Isolation and characterization of oligotrophic acido-tolerant methanogenic consortia from a Sphagnum peat bog. FEMS microbiology ecology, 45, 301-315. SORENSEN, K. W. 1993. Indonesian peat swamp forests and their role as a carbon sink. Chemosphere, 27, 1065-1082. STEFFAN, R. J., GOKSØYR, J., BEJ, A. & ATLAS, R. 1988. Recovery of DNA from soils and sediments. Applied and environmental microbiology, 54, 2908-2915. STONE, M., DEFOREST, J. & PLANTE, A. 2014. Changes in extracellular enzyme activity and microbial community structure with soil depth at the Luquillo Critical Zone Observatory. Soil Biology and Biochemistry, 75, 237-247. STRACK, M., ZUBACK, Y., MCCARTER, C. & PRICE, J. 2015. Changes in dissolved organic carbon quality in soils and discharge 10years after peatland restoration. Journal of Hydrology, 527, 345-354. SU, C., LEI, L., DUAN, Y., ZHANG, K.-Q. & YANG, J. 2012. Culture-independent methods for studying environmental microorganisms: methods, application, and perspective. Applied microbiology and biotechnology, 93, 993-1003. SUKARA, E. & PURWANTO, Y. 2009. Biosphere reserve: the management of conservation areas for sustainable economic development. The 3rd Humanosphere Science School: Scientific Exploration and Sustainable Management of peat and Land Resorces in Giam Siak Kecil-Bukit Batu Biosphere Reserve Riau. Pekanbaru, Indonesia. SUTAPA, I. 2009. Water management system in peat swamp region. The 3rd Humanosphere Science School: Scientific Exploration and Sustainable Management of Peat and Land Resources in Giam Siak Kecil-Bukit Batu Bioshere Reserve. Pekanbaru. TABACCHIONI, S., CHIARINI, L., BEVIVINO, A., CANTALE, C. & DALMASTRI, C. 2000. Bias caused by using different isolation media for assessing the genetic diversity of a natural microbial population. Microbial ecology, 40, 169-176.

122 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

TABATABAI, M. & BREMNER, J. 1969. Use of p-nitrophenyl phosphate for assay of soil phosphatase activity. Soil Biology and Biochemistry, 1, 301-307. TAKAKAI, F., MORISHITA, T., HASHIDOKO, Y., DARUNG, U., KURAMOCHI, K., DOHONG, S., LIMIN, S. H. & HATANO, R. 2006. Effects of agricultural land-use change and forest fire on N2O emission from tropical peatlands, Central Kalimantan, Indonesia. Soil Science and Plant Nutrition, 52, 662-674. TAWARAYA, K., TAKAYA, Y., TURJAMAN, M., TUAH, S., LIMIN, S., TAMAI, Y., CHA, J., WAGATSUMA, T. & OSAKI, M. 2003. Arbuscular mycorrhizal colonization of tree species grown in peat swamp forests of Central Kalimantan, Indonesia. Forest Ecology and Management, 182, 381-386. THIES, J. E. 2006. Molecular methods for studying soil ecology. In: PAUL, E. A. (ed.) Soil Microbiology, Ecology and Biochemistry. Burlington: Elsevier Science. THORMANN, M. N. 2006. Diversity and function of fungi in peatlands: a carbon cycling perspective. Canadian journal of soil science, 86, 281-293. TIEDJE, J. M., ASUMING-BREMPONG, S., NÜSSLEIN, K., MARSH, T. L. & FLYNN, S. J. 1999. Opening the black box of soil microbial diversity. Applied Soil Ecology, 13, 109-122. TISCHER, A., BLAGODATSKAYA, E. & HAMER, U. 2014. Extracellular enzyme activities in a tropical mountain rainforest region of southern Ecuador affected by low soil P status and land-use change. Applied Soil Ecology, 74, 1-11. TORSVIK, V., GOKSØYR, J. & DAAE, F. L. 1990a. High diversity in DNA of soil bacteria. Applied and environmental microbiology, 56, 782-787. TORSVIK, V. & ØVREÅS, L. 2002. Microbial diversity and function in soil: from genes to ecosystems. Current opinion in microbiology, 5, 240-245. TORSVIK, V., SALTE, K., SØRHEIM, R. & GOKSØYR, J. 1990b. Comparison of phenotypic diversity and DNA heterogeneity in a population of soil bacteria. Applied and environmental microbiology, 56, 776- 781. TORSVIK, V., SØRHEIM, R. & GOKSØYR, J. 1996. Total bacterial diversity in soil and sediment communities—a review. Journal of Industrial Microbiology & Biotechnology, 17, 170-178. TREVORS, J. 1998. Bacterial biodiversity in soil with an emphasis on chemically-contaminated soils. Water, Air, & Soil Pollution, 101, 45-67. TURUNEN, J., TOMPPO, E., TOLONEN, K. & REINIKAINEN, A. 2002. Estimating carbon accumulation rates of undrained mires in Finland–application to boreal and subarctic regions. The Holocene, 12, 69- 80. UHLÍK, O., JECNÁ, K., LEIGH, M. B., MACKOVÁ, M. & MACEK, T. 2009. DNA-based stable isotope probing: a link between community structure and function. Science of the Total Environment, 407, 3611- 3619. USHIO, M., KITAYAMA, K. & BALSER, T. C. 2010. Tree species effects on soil enzyme activities through effects on soil physicochemical and microbial properties in a tropical montane forest on Mt. Kinabalu, Borneo. Pedobiologia, 53, 227-233. VAHJEN, W., MUNCH, J.-C. & TEBBE, C. C. 1995. Carbon source utilization of soil extracted microorganisms as a tool to detect the effects of soil supplemented with genetically engineered and non- engineered Corynebacterium glutamicum and a recombinant peptide at the community level. FEMS Microbiology Ecology, 18, 317-328. VALÁŠKOVÁ, V. & BALDRIAN, P. 2009. Denaturing gradient gel electrophoresis as a fingerprinting method for the analysis of soil microbial communities. Plant Soil Environ, 55, 413-423. VAN DE RIET, B., HEFTING, M. & VERHOEVEN, J. 2013. Rewetting Drained Peat Meadows: Risks and Benefits in Terms of Nutrient Release and Greenhouse Gas Exchange. Water, Air, & Soil Pollution, 224, 1-12. VAN ELSAS, J. & BOERSMA, F. 2011. A review of molecular methods to study the microbiota of soil and the mycosphere. European Journal of Soil Biology, 47, 77-87.

123 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

VASANDER, H., TUITTILA, E.-S., LODE, E., LUNDIN, L., ILOMETS, M., SALLANTAUS, T., HEIKKILÄ, R., PITKÄNEN, M.-L. & LAINE, J. 2003. Status and restoration of peatlands in northern Europe. Wetlands Ecology and Management, 11, 51-63. VIJARNSORN, P. Peatlands in Southeast Asia: a regional perspective. In: MALTBY, E., IMMIRZI, C. P. & SAFFORD, R. J., eds. Tropical Lowland Peatlands of Southeast Asia. Workshop on integrated planning and management of tropical lowland peatlands 1996 Gland, Switzerland. IUCN. WANG, G., YU, X., BAO, K., XING, W., GAO, C., LIN, Q. & LU, X. 2014. Effect of fire on phosphorus forms in Sphagnum moss and peat soils of ombrotrophic bogs. Chemosphere, 119, 1329 - 1334. WARDLE, D., ZACKRISSON, O. & NILSSON, M.-C. 1998. The charcoal effect in Boreal forests: mechanisms and ecological consequences. Oecologia, 115, 419-426. WEBER, K. P., GEHDER, M. & LEGGE, R. L. 2008. Assessment of changes in the microbial community of constructed wetland mesocosms in response to acid mine drainage exposure. Water research, 42, 180-188. WHITE, T. J., BRUNS, T., LEE, S. & TAYLOR, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications, 18, 315-322. WHYTE, L. G. & GREER, C. W. 2005. Molecular techniques for monitoring and assessing soil bioremediation. Monitoring and Assessing Soil Bioremediation. Springer. WINDING, A. 1994. Fingerprinting bacterial soil communities using Biolog microtitre plates. WÖSTEN, J., CLYMANS, E., PAGE, S., RIELEY, J. & LIMIN, S. 2008. Peat–water interrelationships in a tropical peatland ecosystem in Southeast Asia. Catena, 73, 212-224. WOSTEN, J., ISMAIL, A. & VAN WIJK, A. 1997. Peat subsidence and its practical implications: a case study in Malaysia. Geoderma, 78, 25-36. YANG, C.-H., CROWLEY, D. E., BORNEMAN, J. & KEEN, N. T. 2001. Microbial phyllosphere populations are more complex than previously realized. Proceedings of the National Academy of Sciences, 98, 3889-3894. YANG, Y., HU, X., ZHANG, J. & GONG, Y. 2013. Community level physiological study of algicidal bacteria in the phycospheres of Skeletonema costatum and Scrippsiella trochoidea. Harmful Algae, 28, 88- 96. YULE, C. M. 2010. Loss of biodiversity and ecosystem functioning in Indo-Malayan peat swamp forests. Biodiversity and conservation, 19, 393-409. ZACKRISSON, O., NILSSON, M.-C. & WARDLE, D. A. 1996. Key ecological function of charcoal from wildfire in the Boreal forest. Oikos, 10-19. ZAK, D., MCINNES, R. & GELBRECHT, J. 2011. Preface: restoration, biogeochemistry and ecological services of wetlands. Hydrobiologia, 674, 1-4. ZAK, D., WAGNER, C., PAYER, B., AUGUSTIN, J. & GELBRECHT, J. 2010. Phosphorus mobilization in rewetted fens: the effect of altered peat properties and implications for their restoration. Ecological Applications, 20, 1336-1349. ZAK, D. R., HOLMES, W. E., WHITE, D. C., PEACOCK, A. D. & TILMAN, D. 2003. Plant diversity, soil microbial communities, and ecosystem function: are there any links? Ecology, 84, 2042-2050. ZAK, J. C., WILLIG, M. R., MOORHEAD, D. L. & WILDMAN, H. G. 1994. Functional diversity of microbial communities: a quantitative approach. Soil Biology and Biochemistry, 26, 1101-1108. ZELLES, L. 1999. Fatty acid patterns of phospholipids and lipopolysaccharides in the characterisation of microbial communities in soil: a review. Biology and Fertility of Soils, 29, 111-129. ZHANG, M., SCHAEFER, D. A., CHAN, O. C. & ZOU, X. 2013. Decomposition differences of labile carbon from litter to soil in a tropical rain forest and rubber plantation of Xishuangbanna, southwest China. European Journal of Soil Biology, 55, 55-61. ZHU, L., XU, H., ZHANG, Y., FU, G., WU, P. Q. & LI, Y. 2014. BOX-PCR and PCR-DGGE analysis for bacterial diversity of a naturally fermented functional food (Enzyme®). Food Bioscience, 5, 115 - 122.

124 The impact of agricultural and restoration practices in tropical peat swamp soils Yuana N.

ZINCK, J. 2011. Tropical and Subtropical Peats: An Overview. In: ZINCK, J. & HUBER, O. (eds.) Peatlands of the Western Guayana Highlands, Venezuela. Berlin: Springer.

125