Presence of Archaea in the Indoor Environment and Their Relationships with Housing Characteristics

Microb Ecol (2016) 72:305–312 DOI 10.1007/s00248-016-0767-z ENVIRONMENTAL MICROBIOLOGY Presence of Archaea in the Indoor Environment and Their Relationships with Housing Characteristics Sepideh Pakpour1,2 & James A. Scott3 & Stuart E. Turvey 4,5 & Jeffrey R. Brook3 & Timothy K. Takaro6 & Malcolm R. Sears7 & John Klironomos1 Received: 3 April 2016 /Accepted: 5 April 2016 /Published online: 20 April 2016 # Springer Science+Business Media New York 2016 Abstract Archaea are widespread and abundant in soils, Based on the results, Archaea are not equally distributed with- oceans, or human and animal gastrointestinal (GI) tracts. in houses, and the areas with greater input of outdoor However, very little is known about the presence of Archaea microbiome and higher traffic and material heterogeneity tend in indoor environments and factors that can regulate their to have a higher abundance of Archaea. Nevertheless, more re- abundances. Using a quantitative PCR approach, and search is needed to better understand causes and consequences of targeting the archaeal and bacterial 16S rRNA genes in floor this microbial group in indoor environments. dust samples, we found that Archaea are a common part of the indoor microbiota, 5.01 ± 0.14 (log 16S rRNA gene copies/g Keywords Archaea . Bacteria . Indoor environment . qPCR . dust, mean ± SE) in bedrooms and 5.58 ± 0.13 in common Building characteristics . Human activities rooms, such as living rooms. Their abundance, however, was lower than bacteria: 9.20 ± 0.32 and 9.17 ± 0.32 in bedrooms and common rooms, respectively. In addition, by mea- Introduction suring a broad array of environmental factors, we obtained preliminary insights into how the abundance of total archaeal The biology and ecology of the third domain of life, Archaea, 16S rRNA gene copies in indoor environment would be asso- have been studied far less when compared to the other do- ciated with building characteristics and occupants’ activities. mains including bacteria and eukarya. Archaea are microor- ganisms discovered in the late 1970s [1]. For years after their discovery, scientists believed that archaea were restricted to * Sepideh Pakpour extreme environments, such as deep-sea hydrothermal vents, [email protected] hypersaline waters, or strictly anoxic ecosystems [2]. Development of culture-independent molecular techniques 1 Department of Biology, University of British Columbia, and high-throughput molecular sequencing approaches trans- Kelowna, BC, Canada formed this belief by illustrating their presence, often with 2 Department of Biological Engineering, Massachusetts Institute of high abundance and diversity, in terrestrial and aquatic envi- Technology, Cambridge, MA, USA ronments [3–5], animal care facilities [6–8], deteriorated me- 3 Dalla Lana School of Public Health, University of Toronto, dieval wall paintings [9], as well as the human and animal Toronto, ON, Canada microbiome such as gastrointestinal (GI) tracts [10–14]and 4 Department of Pediatrics, University of British Columbia, human oral cavities [15]. However, the presence of archaea in Vancouver, BC, Canada many other ecosystems has still been investigated scarcely and 5 Child & Family Research Institute, BC Children’s Hospital, our understanding of their role in their habitat is limited. Vancouver, BC, Canada One such overlooked ecosystem is the indoor built envi- 6 Faculty of Health Sciences, Simon Fraser University, Vancouver, BC, ronment. There is significant ongoing interest in better under- Canada standing the Bbuilt environment microbiome^ [16], with a 7 Faculty of Health Sciences, McMaster University, Hamilton, ON, focus on characterizing microbial diversity as well as the en- Canada vironmental parameters that would drive its patterns [16–26]. 306 S. Pakpour et al. Nevertheless, most of the past studies on the indoor gel electrophoresis with Lambda DNA HindIII Digest stan- microbiome considered mainly bacteria [16, 17, 27–30]and, dards (New England BioLabs, Ipswich, MA, USA), and their to a lesser degree, fungi [19, 20, 23, 25, 31, 32]. Here, we used quantities were measured using the QuantiFluor® dsDNA culture-independent molecular approaches to study the archaea System (Promega, Madison, WI, USA). The purity of extracted in indoor dust from homes in the so-called BminiCHILD^ DNA samples was evaluated by measuring each sample’s ratio study, which is a preliminary cohort of 54 homes in the of the optical density at 260 and 280 nm using the NanoVue Vancouver area recruited to assist in the optimization and val- Plus™ spectrophotometer (GE Healthcare, Buckinghamshire, idation of data collection tools for the larger Canadian Healthy UK), before preserving them at −20 °C. Abundances of both Infant Longitudinal Development (CHILD) study [33, 34]. We archaeal and bacterial 16S rRNA gene copy numbers were sought to answer three general questions: (1) Are archaea reg- measured by quantitative PCR (qPCR); using A364aF (5′ ular components of built environment microbiomes? If yes, (2) CGGGGYGCASCAGGCGCGAA 3′) and A934bR (5′ what would be their magnitude compared to indoor bacteria? GTGCTCCCCCGCCAATTCCT 3′) primers for archaea [36] And (3) how would building characteristics and occupants’ and BACT1369F (5′ CGGTGAATACGTTCYCGG 3′)and activities relate to the variation of archaeal abundances? PROK1492R (5′ GGWTACCTTGTTACGACTT 3′)forbac- teria [37]. Although the abundance of 16S gene sequences is not a surrogate measure of the relative abundance of the ar- Material and Methods chaeal and bacterial cells containing those sequences (because of variations in genomic copy number of the 16S gene in Sample Collection microbial species), in the rest of this manuscript for the sake of brevity, 16S rRNA gene copy numbers will be referred to as Between May 2008 and May 2009, trained research assistants archaeal/bacterial abundances. collected dust from the homes of families with newborn chil- All PCR amplifications were carried out in a CFX96 dren using a sterile, depyrogenated custom-designed alumi- Touch™ Real-Time PCR Detection System (BioRad, Ontario, num collection device attached to the end of a vacuum cleaner Canada) and each PCR reaction mixture (20 μL) contained (Model S3680, Sanitaire Canister Vac, Charlotte, NC, USA). 10 μL of SsoFast™ EvaGreen® Supermix (Biorad, Hercules, The collection device held two nylon DUSTREAM filters CA), 1.5 μL of 1000 μg/μL T4 gene 32 protein (Biolabs, (Indoor Biotechnologies Inc, Charlottesville, VA). Two dust Ipswich, MA), 0.4 μM of each primer, nuclease-free water samples were collected in each house; the first sample was a (IDT, Coralville, IA, USA), and 2 μLofextractedDNA composite of the mattress and floor in the room where the (5 ng/μL). Thermal-cycling conditions for 16S archaea were subject child slept, and the second sample was collected from as follows: 95 °C for 2 min for the enzyme activation, 40 cycles the floor of the room occupied most often by the family. A of 95 °C for 30 s (denaturation), and 61.5 °C for 30 s (annealing standardized floor area was initially sampled (2 m2), and if and extension), followed by 1 cycle of melting analysis (65– insufficient dust was obtained, the sampling area was expand- 95 °C (0.1 °C/2 s)). These conditions for 16S bacteria included: ed. Research technicians visually observed the thimbles after 95 °C for 2 min for the enzyme activation, 40 cycles of 95 °C vacuuming 2 m2; if the thimbles were less than half-full, the for 30 s (denaturation), and 56 °C for 30 s (annealing and technician continued vacuuming in a new area of the room extension), followed by 1 cycle of melting analysis (65–95 °C until the required amount was met. The exact size of the (0.1 °C/2 s)). vacuumed area was recorded for all samples taken. Samples Standard curves were obtained using three replicates of were then fractionated using a sterile depyrogenated 100 1:10 serial dilutions of linearized plasmids containing both Mesh sieve (∼150 μm), and the fine fraction transferred to a cloned archaeal and bacterial 16S rRNA sequences, giving a sterile depyrogenated borosilicate glass vial with a Teflon- concentration range from 10 to 106 copies/μL. Amplification lined screw cap (VWR 1 dram glass vial, West Chester, PA) efficiencies of 92.2–94.7 % (R2 > 0.985) and 90.1–105.8 and stored at −80 °C until analysis. (R2 > 0.963) were observed for archaeal and bacterial stan- dards, respectively. Finally, melting curve analyses at the DNA Extraction and Quantitative PCR Analyses end of all qPCR runs and agarose gel running of qPCR products were performed to check for amplification and specificity Total DNA was extracted from 100 mg of collected fine dust of the products. samples using a FastDNA® SPIN Kit for Soil (MP Biomedicals, LLC, Solon, OH, USA), which was selected sys- Collection of Environmental Variables and Statistical tematically by using the Order Preference by Similarity to Ideal Analyses Solution (TOPSIS) method [35] as the most optimum extraction kit for dust samples in the present case study. Subsequently, We monitored and recorded 668 housing characteristics as extracted DNA samples were checked for integrity by agarose well as building inhabitant activities by using standardized Indoor Archaea and Housing Characteristics 307 questionnaires and direct on-site visits for the purpose of sta- (listed in the Introduction), the abundance of archaeal and bac- tistical analyses. An exhaustive list of these factors has been terial genes in bedrooms versus the most used rooms were first described in recent publications [33, 34], and a subset is plotted (in log scale) to illuminate the indoor archaeal abun- shown in Table 1. The questionnaire was comprised of ques- dance relative to that of bacteria. Subsequently, a Wilcoxon tions on the location, history, and characteristics of the unit, matched pairs test was used to investigate whether or not there such as basic house dimensions, construction details of the is a significant statistical difference between total archaeal building envelope, furniture materials, and finishes for interior abundances in different types of rooms.

Load more