Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations

1993 Identification and characterization of mycoplasma promoters Kevin Lee Knudtson Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Microbiology Commons, and the Molecular Biology Commons

Recommended Citation Knudtson, Kevin Lee, "Identification and characterization of mycoplasma promoters " (1993). Retrospective Theses and Dissertations. 10575. https://lib.dr.iastate.edu/rtd/10575

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. U-M-I MICROFILMED 1994

I INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction.

In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.

Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order.

University Microfilms International A Bell & Howell Information Company 300 North Zeeb Road. Ann Arbor, Ml 48106-1346 USA 313/761-4700 800/521-0600

Order Number 9414044

Identification and characterization of mycoplasma promoters

Knudtson, Kevin Lee, Ph.D.

Iowa State University, 1993

UMI 300 N. ZeebRd. Ann Arbor, MI 48106

Identification and characterization of mycoplasma promoters

by

Kevin Lee Knudtson

A Thesis Submitted to the

Graduate Faculty in Partial Fulfillment of the

Requirements for the Degree of

DOCTOR OF PHILOSOPHY

Department: Microbiology, Immunology and Preventive Medicine Major: Immunobiology

Approved: Members of the Committee Signature was redacted for privacy. In Charge of Major Work

Signature was redacted for privacy. Vpx the I^or Progtain Signature was redacted for privacy. Signature was redacted for privacy. For the Major Department

Signature was redacted for privacy. For th€Gfaduate College

Iowa State University Ames, Iowa

1993 u

TABLE OF CONTENTS

LIST OF FIGURES iv

LIST OF TABLES vi

LIST OF ABBREVIATIONS vu

ACKNOWLEDGMENTS ix

INTRODUCTION 1

LITERATURE REVIEW 4

General Background and Classification of Mycoplasmas 4

Gene Transfer in Mycoplasmas 13

Development of Cloning Systems for Mycoplasmas 17

Regulation of Gene Expression in Mycoplasmas 22

MATERIALS AND METHODS 34

Bacterial Strains and Culture Media 34

Reagents and Buffers 34

Transformation of Acholeplasma spp., M. gallisepticum and E. coli 39

Preparation of Acholeplasma ISM 1499 Chromosomal DNA 40

Plasmid Constructions 41

Preparation of RNA and Measurement of mRNA Levels 43 p-galactosidase Assays 43

Immunoblot Analysis 44

DNA Sequencing 45

Primer Extension Analysis 45

Exo/Mung Deletion Analysis of the pISM2050.2 Insert 46

RESULTS 47

M. capricoliim Promoter trp'-lacZYA Fusion Studies 47

Tn4001lac Promoter Probe Studies 50 m

Plasmid pISM2050 Promoter Probe Vector Studies 62

Analysis of Acholeplasma ISM 1499 Promoters 70

DISCUSSION 77

M. capricolum Promoter trp'-lacZYA Fusion Studies 77

Tn4001lac Promoter Probe Studies 78

Plasmid pISM2050 Promoter Probe Studies 82

Summary 87

REFERENCES 89

APPENDIX A: SEQUENCES UPSTREAM OF LACZ IN 117

THE pISM2050 FUSION PLASMIDS

APPENDIX B: IMMUNE RESPONSE OF A FOREIGN GENE EXPRESSED IN 131

ACHOLEPLASMA ISM 1499

APPENDK C: DEVELOPMENT OF A VACCINE TO MYCOPLASMA 135

HYOPNEUMONIAE

APPENDIX D: DEVELOPMENT OF A RECOMBINANT VACCINE TO 139

SERPULINA HYODYSENTERJAE iv

LIST OF FIGURES

Figure 1. Construction, message levels, and P-galactosidase activities of the 48 trp'-lacZYA fusion plasmids

Figure 2. Placement of unique BamHl and Smal RE sites in an IS256 arm 51 of transposon Tn400I

Figure 3. Rernoval of the translational stop codons from the inverted repeat of an 56 IS256 element and construction of Tn400I lac

Figure 4. Construction of promoter probe transposons designed to rescue adjacent 59 chromosomal sequences

Figure 5. Construction of the promoter probe vector, pISM2050 63

Figure 6. Acholeplasma ISM 1520 transformants 66

Figure 7. Quantitation of lacZ transcript levels of the lacZ fusion vectors in 67 Acholeplasma ISM 1520

Figure 8. Immunoblot analysis of the lacZ fusions in Acholeplasma 69

Figure 9. Primer extension analysis of the transcriptional site of the 72 lacZ fusion transcript of ISM2050.8

Figure 10. Exo/Mung deletion analysis of the ISM 1499 chromosomal 74 DNA region of pISM2050.2

Figure A1. Sequence upstream of the lacZ gene in pISM2050.1 118

Figure A2. Sequence upstream of the lacZ gene in pISM2050.2 119

Figure A3. Sequence upstream of the lacZ gene in pISM2050.8 120

Figure A4. Sequence upstream of the lacZ gene in pISM2050.18 121

Figure A5. Sequence upstream of the lacZ gene in pISM2050.19 122

Figure A6. Sequence upstream of the lacZ gene in pISM2050.25 123

Figure A7. Sequence upstream of the lacZ gene in pISM2050.39 124

Figure A8. Sequence upstream of the lacZ gene in pISM2050.40 125

Figure A9. Sequence upstream of the lacZ gene in pISM2050.66 126

Figure A10. Sequence upstream of the lacZ gene in pISM2050.69 127 Figure All. Sequence upstream of the lacZ gene in pISM2050.70

Figure A12. Sequence upstream of the lacZ gene in pISM2050.86

Figure A13. Sequence upstream of the lacZ gene in pISM2050.89 vi

LIST OF TABLES

Table 1. Bacterial strains and plasmids 35

Table 2. Transformation frequencies of Tn-^OO/ derivatives in Acholeplasma 54

Table 3. Insert size and P-gal activity of lacZ fusion constructs 64 in Acholeplasma and E. coli

Table 4. Alignment and determination of the putative -10 and -35 promoter 75 regions of the promoters driving the expression of lacZ in the plasmid pISM2050 derivatives

Table B1. Experimental design of the Acholeplasma challenge study 132

Table B2. Absorbance values of an ELISA examining the antibody response 134 to recombinant Acholeplasmas expressing the E. coli lacZ vil

LIST OF ABBREVIATIONS

A adenosine

AIDS acquired immunodeficiency syndrome

Ap ampicillin

AMV avian myeloblastosis virus

bp base pair

p-gal P-galactosidase

C cytosine

CAP catabolite activator protein

CPU colony forming unit

cpm counts per minute

CRP cyclic AMP receptor protein cAMP cyclic adenosine monophosphate cat chloramphenicol acetyl transferase

Da daltons

DMA deoxyribonucleic acid

EDTA ethylenediamine tetraacetic acid

G guanine

Gm gentamicin

IPTG isopropylthio-P-galactoside

IS insertion sequence

Km kanamycin kb kilobase pair kDa kilodaltons

MCS multiple cloning site

-mer used to denote an oligonucleotide VIU

MLO mycoplasma like organism

NET Sodium chloride-EDTA-Tris buffer

p plasmid

PBS phosphate buffered saline

PGR polymerase chain reaction

PEG polyethylene glycol

PPLO pleuropneumonia like organism

SDS sodium dodecyl sulfate rbs ribosomal binding site

RE restriction enzyme

RNA ribonucleic acid rRNA ribosomal RNA

T thymine tRNA transfer RNA

TE Tris [hydroxymethyl aminomethane]-EDTA [ethylene diamine tetraacetic

acid] buffer

Tn transposon

U units

X-gal 5-bromo-4-chloro-3-indolyl-P-D galactoside ACKNOWLEDGMENTS

I would like to thank Drs. A. Myers, P. A. Pattee, P. S. Paul, and M. J. Wannemuehler

for serving on my examining committee. I appreciate their helpful suggestions and

encouragement. I would like to extend a very special thanks to Dr. F. Chris Minion. His

patience, suggestions, and encouragement have made it possible for me reach this level in my career. Our scientific discussions were stimulating as well as enlightening. I consider him to be

more than my major advisor, I consider him to be a good friend.

It is impossible to spend as much time in one area as I have and not make some very good friends. I would like to thank Greg Mahairas, Laura Hruska, Tim Freier, Paul Kapke, Eli

Tigges, Jian Cao, Brenda Smiley, Karalee Taylor, Debra Moore, Anna Yeung, and Tina

VanDyk. Their support inside the lab as well as outside the lab setting were equally as important in keeping me going.

I would like extend my deepest thanks and love to the most important person I have met here and in my life, my wife Linda Knudtson. Her love and support have kept me going and have played an important role in making this possible.

Finally, I would like to extend a very special thanks to my parents, Vernon and Suzanne

Knudtson, for patiently waiting and offering support when needed. 1 INTRODUCTION

The term "mycoplasmas" is used as the trivial name for ail members of the class

Mollicutes. The class Mollicutes is composed of six genera which include: Mycoplasma,

Ureaplasma, Spiroplasma, Acholeplasma, Anaeroplasma, and Asteroleplasma (186). The

members of this class are cell'wall-less eubacteria that possess the smallest genome size

thought necessary for autonomous existence (184). As a result of their small genome size,

mycoplasmas have limited biosynthetic pathways. Generally, the macromolecules required for growth must be scavenged from the environment because mycoplasmas possess only catabolic and conversion pathways to obtain amino acids and nucleotides (reviewed in 62,63). Thus, complex undefined media are required for their growth. Despite an apparent fragile existence, mycoplasmas have been shown to colonize humans, animals, plants, and insects (reviewed in

185).

Mycoplasmas have become recognized as important human and agricultural pathogens.

They are generally mucosal pathogens in animals, colonizing the urogenital and respiratory tracts (222). The human pathogen Mycoplasma pneumoniae, which causes tracheobronchitis and primary atypical pneumonia, is the leading cause of pneumonia in older children and young adults (111). Ureaplasma urealyticum is a cause of nongonococcal urethritis in men and is often associated with pelvic inflammatory disease in women (111). Recently, a strain of

Mycoplasma fermentans, Mycoplasma incognitus, has been associated with AIDS (reviewed in

125). In addition, mycoplasmas have had a great impact on both the agronomy and livestock industries (reviewed in 120, 222).

Mycoplasmas are thought to be a product of degenerative evolution from Gram positive bacteria (135). Like many Gram positive bacterial species, mycoplasmas are A + T-rich (60 -

77 %) organisms (186). Because of the phylogenetic relationship between mycoplasmas and

Gram positive bacteria and their lack of a cell wall, they have been compared to Gram positive 2

bacterial protoplasts. Consequently, the basis for the development of gene transfer methods and tools (i. e., transposons and plasmids) in mycoplasmas has been derived from Gram positive bacterial systems. Gene transfer via conjugation, transfection, and transformation have been demonstrated in mycoplasmas (reviewed in 51, 52).

The use of Escherichia coli cloning hosts has generated misleading results in studies of the regulation of both mycoplasma transcription and translation. Gafny et al. showed that both E. coli and Mycoplasma capricolwn RNA polymerase recognized the M. capricolum rRNA gene promoter, but during amino acid starvation, transcription was activated in E. coli instead of repressed (67). Notamicola et al. have shown that E. coli initiated translation at internal sites in a Mycoplasma hyorhinis lipoprotein gene (170). In addition, most mycoplasmas, except for

Acholeplasma, have an alternative codon usage in which the UGA codon encodes tryptophan

(94, 265). The alternative codon usage results in the expression of a truncated mycoplasma gene product that may or may not be detectable (101). Therefore, it is important to be able to examine mycoplasma genes and their regulatory elements in their normal genetic background, the mycoplasma.

The lack of genetic tools has made the development of mycoplasma cloning systems difficult. Only two transposons, Tn9/6 and Tn400I, have been shown to be useful for studying mycoplasma genetics (53, 54,133). Broad host-range Gram positive plasmids have been examined as possible cloning vectors, but they have proven to be unstable. Naturally occurring mycoplasma plasmids have been examined as possible cloning vectors, but they have not been shown to maintain and express a cloned gene (reviewed in 52). A cloning system has been developed in spiroplasmas that uses a spiroplasma virus as a cloning vector, but, the virus has a limited host range (231,232). Mahairas and Minion have developed a cloning system based on the ability to integrate cloned genes into mycoplasma chromosomes via homologous recombination (132, 134). The stability and versatility of the integrated plasmid cloning system 3 make it possible to incorporate any DNA sequence into the host including cloning vectors designed to study gene regulation.

Therefore, the goals of this study were to expand the mycoplasma cloning system developed by Mahairas and Minion to include a reporter gene for the detection of mycoplasma upstream gene regulatory elements. The approach involved the development of both plasmid- and transposon-based reporter gene vectors. Once mycoplasmal promoter sequences were identified, the sequences were analyzed, and a consensus promoter sequence was be derived. 4 LITERATURE REVIEW

General Background and Classification of Mycoplasmas

History of mycoplasmas

Mycoplasmas were originally isolated in 1898 by Nocard and Roux (169) as an agent of

bovine pleuropneumonia. As a result, during the first half of this century, similar organisms were known as "pleuropneumonia-like organisms" or "PPLOs" (85). Despite nearly one hundred years of study with these organisms, their growth requirements and genetics remain an enigma. In addition, their taxonomic classification has been one of the most confusing and controversial battles encountered for any bacterial group.

Prior to the 1930's, mycoplasmas were considered to be viruses because they could pass through filters that blocked the passage of other bacteria. As the true nature of viruses became apparent, however, it was obvious that mycoplasmas could not be considered to be viruses.

Interestingly, the mycoplasma species recently identified in AIDS patients was originally thought to be a novel virus (126, 127).

The most difficult battle for independent taxonomic status for mycoplasmas was the distinction between L-forms of other bacteria and mycoplasmas. Following the observation that bacteria could be induced to grow as stable L-forms (118), the notion that mycoplasmas were merely L-forms of other bacteria predominated. The isolation of walled bacteria in mycoplasma cultures enhanced this notion (181). Following nearly 30 years of heated debate, the controversy was resolved based on genomic analysis of G + C content (181). The A + T-rich mycoplasmas could be definitively differentiated from the G + C-rich bacterial contaminants.

Just as the establishment of taxonomic status for mycoplasmas was highly controversial, the appropriate placement of mycoplasmas in the bacterial phylogenetic tree also was a subject for heated debate. One model proposed by Neimark suggested that the different mycoplasmas 5

arose from different branches of the bacterial phylogenetic tree through degenerative evolution

(167, 168). For example, the model predicted that the genus Mycoplasma arose from one

species of bacteria while the genus Acholeplasma arose from another. The other model,

proposed by Morowitz and Wallace (155, 255), predicted that mycoplasmas were the first

bacteria. Neither of these models, however, are accepted today. The present model suggests that mycoplasmas arose through degenerative evolution from Gram positive bacteria (probably

Lactobacillus spp.) and that the entire class of Mollicutes have a common origin (135, 136).

This model was supported by 16S rRNA gene sequence homology studies (257). The

Mollicutes phylogenetic order, from earliest to latest branch, was predicted to be

Asteroleplasma, Anaeroplasma, Acholeplasma, Spiroplasma, Mycoplasma, and Ureaplasma

(257). Thus, the association of mycoplasmas with L-forms is not entirely unjustified because they are thought to be a product of degenerative evolution from Gram positive bacteria (135).

Dujardin-Beaumetz was the first to cultivate a mycoplasma on solid medium (cited in ref.

85). He described the distinctive "fried-egg" colony morphology that has become the trademark of mycoplasmas. The fried-egg colony appearance is achieved by the production of a dark center that penetrates into the medium and is surrounded by a thinning periphery.

The first isolation of a mycoplasma from a human source was reported in 1937 by Dienes and Edsall (44). It was not until 1962, however, that etiological proof for the involvement of a mycoplasma in human disease was provided (26). This organism is presently known as

Mycoplasma pneumoniae, the etiologic agent of primary atypical pneumonia. In addition to being human pathogens, mycoplasmas have become known as important agricultural pathogens, severely affecting the agronomy and livestock industries.

In 1936, another mycoplasma was isolated from sewage and was thought to be a saprophyte (117). A similar organism was later isolated from the bovine genital tract (57).

These two organisms, unlike the pleuropneumonia causing agents, did not require sterols for 6

growth. Because they lacked a cell wall, they were later assigned a separate genus within the class MoUicutes called Acholeplasma (59).

Organisms which produced tiny colonies (7 to 15 |im in diameter) were first isolated from men with primary and recurrent nongonococcal urethritis by Shepard in 1954 (218). As a result of their tiny colony morphology, they were originally referred to as T-strains and were later named Ureaplasma urealyticum (219). To definitively prove that Ureaplasma urealyticum was an etiological agent in nongonococcal urethritis, Taylor-Robinson infected himself (244).

Spiroplasmas were first observed in 1961 when they were mistaken for spirochetes (177).

Although they were observed throughout the decade as infectious agents of insects and plants, they were not defined as a Mollicute until 1973 (211, 259).

The first strictly anaerobic mycoplasma was reported in 1966 by Hungate (91). This organism was characterized by Robinson (199) and was originally assigned the name

Acholeplasma bactoclasticwn. Because this organism required sterols for its growth, it was assigned a separate genus for strictly anaerobic mycoplasmas, Anaeroplasma (200,201).

Taxonomy of mycoplasmas

The current classification system of mycoplasmas is an expansion of the classification system originally presented by Edward and Freundt in 1956 (58). The name "mycoplasma" was derived from the Greek word mykes meaning fungus and plasma for something molded or formed to describe the fungus-like morphology of M. mycoides (185). MoUicutes is presently the only class in the division Tenericutes which is composed of wall-less bacteria (186). The name "mycoplasmas" is loosely used to describe any organism within the class MoUicutes despite the introduction of 5 new genera since mycoplasmas were first classified.

The class MoUicutes consists of 3 orders, Mycoplasmatales, Acholeplasmatales, and

Aneroplasmatales. Because this work did not involve species from the order Aneroplasmatales, this discussion will focus primarily on the other two orders. For the sake of completeness, 7

there is another group of organisms within the class Mollicutes, the mycoplasma-like

organisms (MLOs), that have tentatively been placed there because they lack a cell wall.

Because they have not been cultivated, their metabolic or other distinctive properties have not

been defined (185).

Mycoplasmatales. The order Mycoplasmatales is composed of facultative anaerobic sterol-requiring mollicutes that may or may not ferment glucose and hydrolyze arginine. The order has two families, Mycoplasmataceae and Spiroplasmataceae (186).

The family Mycoplasmataceae is composed of two genera, Mycoplasma and Ureaplasma

(186). Ninety-two of the 125 currently recognized species are members of the genus

Mycoplasma (185). Members of this genus have a wide habitat including humans, animals, plants, and insects. The other genus within this family, Ureaplasma, possesses species that are pathogens of humans and animals, and are characterized by having the ability to hydrolyze urea to CO2 and NH3 (220).

The family Spiroplasmataceae contains one genus, Spiroplasma. Arthropods and plants are the primary habitat for the eleven species within this genus. These organisms are characterized by helical filaments and their genome sizes are among the largest (1,350 to 2,575 kb) of the Mollicutes (14,121).

Acholeplasmatales. The order Acholeplasmatales is composed of mollicutes that are facultative anaerobes that do not require sterols for growth (186). The members of this order are the only mollicutes that are able to modulate membrane fluidity by carotenoid synthesis, selective incorporation and elongation of fatty acids, and de novo synthesis of fatty acids

(183). In addition, these organisms can metabolize glucose, but they cannot hydrolyze arginine or urea (250). This order has one family, Acholeplasmataceae, which has one genus,

Acholeplasma (186). Members of this genus are primarily found in animals, plants and insects

(251). 8 Growth requirements of mycoplasmas

The Mollicutes are among the most fastidious groups of bacteria, and their close association with their plant or animal host have led to dependence on their host for many of their macromolecule precursors (144). The ability to determine the specific nutrient requirements for a microorganism usually requires the use of defined growth media.

Unfortunately, fully defined or semi-defined growth media have only been developed for a few

Mollicute species including M. mycoides, M. gallisepticum, M. capricolum, A. laidlawii, and

Spiroplasma spp. (24, 74,79, 119, 202, 204, 246). In addition, the ability to define the organic growth requirements is confounded by the interaction between metabolic pathways

(144). For example, alanine was essential for growth of M. mycoides only in the absence of pyridoxal (202), and tyrosine and phenylalanine were not required by A. laidlawii when alanine was added to the medium (246). Also, nutritional antagonism has been demonstrated between alanine and glycine in M. mycoides (202). This type of antagonism is common among eubacteria (e. g., abundant glucose levels inhibiting the utilization of other sugars in the medium). Thus, the precise nutritional requirements for many of the mycoplasmas are not known at this time because of the lack of well-defined growth media.

Generally, the organic elements required for mycoplasma growth must be scavenged from the environment Mycoplasmas must acquire many of their amino acids because they lack the pathways to synthesize them. For example, M. arthritidis was shown to catabolize arginine, glutamine, glutamic acid, aspartic acid, histidine, leucine, and threonine under aerobic conditions and tyrosine and tryptophan under anaerobic conditions (226). Fisher et al. has compiled a list of amino acid requirements of organisms known to grow on a defined or semi- defined media (63).

Mycoplasmas require nucleic acid precursors for growth because they lack the de novo pathways for their synthesis (150). Mycoplasmas are capable, however, of converting one 9 nucleotide to another. For example, M. mycoides subsp. mycoides was reported to be able to convert guanine to adenine (150, 166, reviewed in 62).

Sterols and fatty acids are essential for growth for all mollicutes except Acholeplasma and

Asteroleplasma species. However, sterols were shown to be incorporated into the membrane by A. laidlawii if provided in the medium (12). Sterols account for 20% of the mass of the total membrane lipids in mycoplasmas. Interestingly, a cholesterol-rich growth medium was shown to reduce the growth rate of M. capricolum (122). Fatty acids were reported to be required for phospholipid synthesis and their uptake by M. capricolum required ATP and a transport protein

(35). M. mycoides apparentiy lacked the ability to alter the chain length of saturated or unsaturated fatty acids, thus both fatty acids were required in a defined medium (204).

Ureaplasmas were shown to synthesize both saturated and unsaturated fatty acids (207).

Exogenous phospholipids such as sphingomyelin and phosphatidylcholine could be incorporated directiy into the membranes of mycoplasmas and spiroplasmas (39, 209). For further background of lipid incorporation, biosynthesis, and metabolism see the reviews of

McElhaney (142) and Smith (227).

Glucose was originally used as an energy source in the preparation of defined media

(202). A study examining ten different mycoplasmas and acholeplasmas suggested that mollicutes do not use the TCA pathway, but rather they appear to ferment glucose via the

Embden-Meyerhof-Pamas pathway (31,43, 139). Glucose can be replaced by other sugars or pyruvate, but growth rates may be affected (145, 146). Studies suggested that all glucose- fermenting mycoplasmas also ferment maltose, starch, and glycogen (186,205). Arginine hydrolysis via the arginine dihydrolase pathway has been shown to be utilized by some mycoplasmas as an energy source (61). There are no reports of mycoplasmas using lactose as an energy source. Thus, it does not appear that mycoplasmas possess the ability to breakdown lactose to glucose and galactose. This implies that lacZ could be an efi'ective reporter gene in 10

mycoplasmas. For a review of carbohydrate metabolism and energy utilization in mollicutes see

Pollack (176).

Mycoplasmas appear to require a large number of vitamins for their growth (202,204,

205). The vast vitamin requirement was based on the large number of vitamins and coenzymes

(6 to 8) used in preparation of the defined media for M. mycoides Y and A. laidlawii B (204).

Studies performed with spiroplasmas showed that only nicotinic acid or riboflavin were

required for growth (22). The best growth rates were achieved when both vitamins were

present, but high concentrations of the vitamins appeared to reduce the growth rate (23). Thus,

the vitamin requirements for Mollicute growth has not been precisely determined. It is apparent

that macromolecules must be scavenged from the environment because they do not possess

complete anabolic pathways to synthesize necessary macromolecules. Moreover, the metabolic

pathways they do possess appear to be cataboUc or are involved in interconversion (182).

Little work has been done on the inorganic requirements of the Mollicutes. The preparation

of the defined media and semi-defined media for M. mycoides and A. laidlawii implied the

requirement for P043-, Mg2+, K+, and Fe^+(204). The author suggested that other elements,

namely metals, would be required but adequate amounts could be obtained as contaminants on glassware (204). Tryon and Baseman have shown that M. pneumoniae is able to bind human lactoferrin as a potential iron acquisition mechanism for mycoplasmas (249). It should be noted that high concentrations of metal ions (Zn^+, Mn2+, Co^+, and Fe^+) inhibited mycoplasmal growth (203)

The temperature range for mycoplasma growth generally is from 7° to 40°C (144). The optimal temperature is usually indicative of the natural habitat in which the mycoplasma is found. Mycoplasmas will grow and survive over a narrow pH range (144). The optimal pH for most species of vertebrate origin is 7.4 with a range of 6.5 to 8.0 (205). The optimal temperature and atmospheric conditions for mycoplasma growth are discussed by Gardella and

Del Giudice (69). 11 Genomic composition of mycoplasmas

The genomes of mycoplasmas are small and have a low G + C content as compared to

other bacteria (184). For nearly twenty years, the genome size served as one of the major

taxonomic criterion for distinguishing the genera of the Class Mollicutes. Recent data from

analysis of over 40 different mollicutes shows that the genomic sizes of the Mycoplasma and

Ureaplasma species range from 500- to 1,300-kb, while the Spiroplasma and Acholeplasma species range from 1,350- to 2,600-kb (5, 8, 32, 115, 121, 124, 179, 198, 236, 258).

Therefore, some of the genome sizes of Mycoplasmas and Ureaplasmas are similar to that of

Acholeplasmas and Spiroplasmas. This makes distinguishing these species by genomic size a less reliable tool for taxonomic classification.

The size of the genome is an indication of the number of genes it encodes. A genome of 5

X 10^ Da (approx. 750-kb) has the potential to code for approximately 650 proteins of an average molecular mass of 4 x 10'^ Da if no intergenic spacer regions are present (153, 154).

Twenty to thirty percent of the bacterial genome is usually composed of spacer regions. Thus, it would be predicted that a mycoplasma genome would encode about 500 proteins (100).

Two-dimensional gel analysis of the M. capricolum genome revealed about 350 spots suggesting that this mycoplasma encodes at least 350 proteins (100). As a comparison,

Escherichia coli is known to encode for more that 1,100 proteins with a genome size of 4,000- kb (123).

The mycoplasma genomes examined to date have one or two sets of rRNA opérons encoding the 23S, 16S, and 5S rRNAs (I, 73, 215, 216). This contrasts to the 10 rRNA opérons in each of their closest relatives Clostridium spp. (70) and Bacillus spp. (98) and the 7 in E. coli (105). The M. capricolum genome possesses 30 genes that encode 29 tRNA species

(14, 161), whereas E. coli possesses 78 genes for 45 tRNA species (109) and B. subtilis possesses at least 51 genes for 31 tRNA species (254). Therefore, it appears that the number of mycoplasma tRNA and rRNA species is considerably lower than in other eubacteria. 12

The G + C content for mycoplasmas range from 25 to 40 mol% (186). The G + C content

of M. capricolum spacer regions are about 20 mol%, the protein genes are about 30 mol%,

and the rRNA and tRNA genes are 46 to 54 mol% (163). The G + C content of the M.

capricolum rRNA and tRNA is lower than the corresponding regions in other eubacteria (163).

The low G + C content of mycoplasmas is hypothesized to be a product of A T-biased

directional mutation pressure that was exerted on the entire genome (163, 238). As the

mycoplasma evolved, selective pressure must have occurred on the entire genome to replace the

G C pairs with A T pairs. Muto et al. (163) suggest that the spacers are functionally the least

important regions of the genome, and mutations in those regions are selectively neutral

resulting in a mutation rate higher than any other regions. The A T shift in the rRNA and tRNA genes is least pronounced because most of the transcripts serve a biological function. Protein genes are more variable than the RNA genes because of the redundancy of the genetic code.

Based on two-dimensional protein analysis of the M. capricolum genome and the relatively low number of rRNA and tRNA genes, it appears as though the M. capricolum genome codes for about 400 genes (184). Morowitz (153) suggested that mycoplasmas have a limited number of genes that are required for growth and has discarded many unnecessary genes as it evolved.

The basic elements for DNA replication (64), transcription of DNA to RNA (66), and translation of RNA into proteins (257) have been conserved in mycoplasmas. In addition, a number of DNA-related systems have also been maintained including DNA recombination and repair (56,114, 131, 134, 261), DNA restriction/modification (137), and heat shock proteins

(37),implying the necessity of these functions. It has not been determined whether proof­ reading capability during DNA replication has been retained in mycoplasmas (136). Thus, it appears as though mycoplasmas possess the minimal genetic information necessary for life. 13 Gene Transfer in Mycoplasmas

The ability to genetically manipulate mycoplasmas through gene transfer is fundamental if

an understanding of the genetic regulation of mycoplasmas is to be obtained. Gene transfer via

conjugation, transfection, and transformation have been demonstrated in mycoplasmas (for

reviews see 51, 52). Transduction has not yet been described for mycoplasmas. Because of the

phylogenetic relationship between mycoplasmas and Gram positive bacteria and their lack of a

cell wall, they have been compared to Gram positive bacterial protoplasts. Thus, many of the

methodologies and tools (i. e., transposons and plasmids) developed to transfer genes in

mycoplasmas were originally derived from Gram positive bacterial systems.

Mycoplasma conjugation

The acquisition of the tetM gene in clinical isolates of M. hominis and U. urealyticum was

thought to occur through a conjugation event involving Enterococcus faecalis as a donor in

vivo (194, 195, 197). Further investigations suggested that the mechanism of conjugal transfer

might involve the Gram positive transposon Tn9/<5 based on several observations. First, cell to

cell contact was required for DNA transfer between Enterococcus faecalis and Mycoplasma

hominis (196). Second, it was shown that the Gram positive conjugative transposon, Tn9/6,

was transferred from E. faecalis to M. hominis and M. pulmonis at a frequency of 10"^ to 10"^ transconjugants per recipient colony forming unit (CFU) (50,196). Finally, tetM is the antibiotic resistance marker found on TnP/6 (71). Conjugal transfer of Tn9/6 using mycoplasmas as a donor has not yet been reported, however. Naglich and Andrews described comobilization of plasmids pC194 and pUBl 10 in the conjugal transfer of Tn9/6 from

Bacillus subtilis to Bacillus thuringiensis subsp. israelensis (165). Thus, conjugative transposons may provide a means of introducing various antibiotic resistances or other genetic markers into mycoplasmas. 14

Another phenomenon of gene transfer in Mollicutes requiring cell-to-cell contact has been

demonstrated in Acholeplasma and Spiroplasma (6,7, 131). Gene transfer between

Acholeplasma was demonstrated using cells that possessed either the gentamicin resistance

marker from Tn4001 or the tetracycline resistance marker from Tn9/<5. Broth or agar surface

mating mixtures yielded colonies possessing both of the antibiotic resistance markers.

Moreover, the antibiotic resistance markers were located at the same place on the chromosome

in the transconjugants as in the parents (131). The mating phenomenon was DNase I

insensitive (6,7,131) ruling out a role for natural transformation. The matings occurred in the

absence of polyethylene glycol (PEG) which has been shown to be effective in promoting the fusion of Bacillus subtilis protoplasts (25) as well as in the transformation and transfecdon of

mycoplasmas (54, 224). Triparental matings in mycoplasmas have not been observed (6).

The mechanism of DNA transfer in the Acholeplasma and Spiroplasma mating systems is not clear. The mechanism resembles conjugation in that the transfer was not DNase-sensitive and required cell-to-cell contact similar to the clumping observed in pheromone-induced enterococcal mating (47,48). On the other hand, gene transfer resembled a protoplast fusion event because transposon markers in the progeny were in the same chromosomal locations as the parental strains and prolonged mating in non-selective media enhanced the frequency of colonies possessing both markers. Hopwood reported a similar phenomenon with Bacillus protoplast fusions in which single colonies harvested from non-selective regeneration media gave rise to multiple phenotypes (89). The generation of multiple phenotypes was suggested to be a result of interruption of recombination at different chromosomal locations during fusion.

Thus, the long incubation time in non-selective media for the spiroplasma matings might allow for complete acquisition of both markers.

Mahairas and Minion reported that mating did not occur with M. pulmonis, M. gallisepticum, and the A. laidlawii strain ATCC 14192, and that mating appeared to require the presence of a trypsin-sensidve membrane protein (131). Thus, it appears that this mating 15

phenomenon only occurs in a few members of the Mollicutes, S. citri and an Acholeplasma

species. Because it is advantageous for an organism to be able to acquire useful genes from the

environment, the limited evidence presented here might suggest that these two strains continue

to possess a DNA acquisition mechanism that other mollicutes with smaller genomes have lost.

Evidence to support this notion comes from the observation that low-frequency transformation

of spiroplasmas occurs in the absence of PEG (33,212) suggesting the possible existence of a

natural transformation system in some mycoplasma species.

Transformation and transfection of mycoplasmas

Initial attempts to transform mycoplasmas was based on the treatment of the cells with

divalent cations (21,65) similar to the methods used in preparing E. coli competent cells (82,

83). These attempts were not repeatable by another laboratory, however (196). The ability to

effectively and repeatably transform mycoplasmas was based on the observation that PEG

promoted the fusion of Gram positive protoplasts (25, 89). Because mycoplasmas resemble

protoplasts, Sladek and Maniloff first utilized PEG-mediated transformation of Acholeplasma

in transfection studies using a mycoplasma virus L2 (225).

Transformation protocols have since been developed for introducing DNA into a number

of Acholeplasma, Mycoplasma, and Spiroplasma species (reviewed in 52). The DNA

introduced into mollicutes has been in the form of a virus, transposon, or plasmid with a

frequency ranging from lO"^ to 10"^ transformants per colony forming unit. The DNA size also affected transformation frequency as Mahairas and Minion showed an inverse relationship with plasmid size (134). A similar observation was reported with the 39-kb dsDNA mycoplasma virus L3. While attempts to transfect/4. laidlawii with L3 using PEG were not successful, electroporation was effective (130). Thus, the inefficient transformation frequencies and plasmid size have become important considerations when conducting genetic studies in mycoplasmas. 16

The PEG concentration, stage of growth of the cell, and amount of DNA must be

considered when introducing DNA into mycoplasmas. King and Dybvig have shown that

transformation frequencies of Mycoplasma mycoides subsp. mycoides increased with higher

PEG concentrations (53 - 62% w/v) (103). On the other hand, Mahairas and Minion reported

that transformation of Acholeplasma ISM 1499 was successful only at PEG concentrations of

34 to 37% (w/v) with an optimal concentration of 35% (w/v) (134). King and Dybvig reported

that optimal transformation occurred when M. mycoides subspecies mycoides was in the mid- late logarithmic phase of growth (103), but Mahairas and Minion failed to observe a similar relationship v/ith Acholeplasma ISM1499 (134). Transformation frequency significantly decreased after mid to late log growth phase suggesting that once mycoplasma cells have reached a certain stage of growth they are less likely to be transformed. Generally, 5 to 10 |j.g of homogeneous DNA were required per transformation (103, 134). The addition of yeast tRNA was shown to enhance transformation frequencies in acholeplasmas (54, 134) by acting as substrate for a potent surface nuclease (149)

Electroporation has also been used to successfully introduce DNA into mycoplasmas. The efficiency of transformation using electroporation versus PEG varies between the species of mycoplasmas and the size of the DNA. Lorenz et al. showed a 10-fold decrease in the efficiency of transfection by electroporation of the 4.5-kb mycoplasma virus LI DNA compared to the PEG method. However, electroporation was the only means whereby the

39.5-kb mycoplasma virus L3 DNA could be introduced into A. laidlawii (130).

Transformation frequency of M. mycoides subsp. mycoides with plasmid pAM120 was 2 logs more efficient using PEG (103) as compared to electroporation (260). It should be noted that the electroporation conditions used (260) were markedly different than the conditions that have been successfully used with other mycoplasmas. Therefore, the transformation frequency could increase if other conditions were used. In addition to the mycoplasma species already 17

mentioned, electroporation has been used to transform M. pneumoniae (D. Krause, personal

communication), M. gallisepticum (Minion, unpublished data), and S. citri. (231).

Development of Cloning Systems for Mycoplasmas

The development of a cloning system in mycoplasmas is essential if studies of their gene regulation are to be conducted. Although some mycoplasma genes have been cloned and expressed in E. coli (13,110,157), the majority of mycoplasma genes may not be expressed because of alternative codon usage (265). Moreover, gene regulatory signals differ between mycoplasmas and E. coli (67). Therefore, it is necessary to be able to study gene regulation in its natural setting, the mycoplasma cell.

The lack of genetic tools has made the development of cloning systems difficult in mycoplasmas. Only two transposons, Tn9/(5 and Tn4001, have been shown to be useful for studying mycoplasma genetics (53, 54, 133). A number of broad host-range Gram positive plasmids have been examined as possible cloning vectors but they have proven to be unstable

(49). Mycoplasma viruses have also been examined as possible cloning vectors (231), and preliminary studies show promise. Problems with low transformation frequencies and the requirement of high amounts of DNA which are inherent with the PEG transformation protocol have hindered development of an effective mycoplasma cloning system.

Alternative codon usage in mycoplasmas

Mycoplasma DNA is A + T-rich compared to the DNA of other bacteria. For example, the coding regions of M. capricolum have an A + T content of 75 mol% whereas the coding regions for E. coli are 51 mol% (162). The A + T content for the coding regions for M. pneumoniae, on the other hand, are only 60 mol% (93). Many of the tRNAs of M. capricolum have been purified and sequenced (3), and examination of the anticodon regions show an extremely high level (90%) of A or U in the third position (162, 172). Muto and Osawa have 18 examined the nucleotide usage in all three positions in the codons of M. capricolum as well as their use in other bacteria (163). They found that mycoplasmas were A + U biased in all three positions of the codon. The bias was highest in the third position, followed by the first position. The second position was the most invariable because changes at that position would cause a change in the amino acid. M. capricolum possesses only 29 different tRNA genes (2,

162,264) for the 62 possible codon combinations. It has been predicted that there are limited number of tRNA genes found in M. mycoides (214). Samuelsson et al. (214) hypothesized that mycoplasmas have eliminated a number of the tRNA genes by taking advantage of the

"wobble hypothesis" proposed by Crick (34). Thus, the tRNA in some instances needs only to recognize the first two nucleotides in the codon, and tRNAs that would recognize the other three possible codons would not be necessary. Examination of the tRNA species produced in

M. capricolum support this notion in that one tRNA species appears to be available for the codons that have the same nucleotides in the first two positions and code for the same amino acid (160).

The most notable feature of the codon usage of most mycoplasmas is the deviation from the universal genetic code from a stop codon to a tryptophan encoded codon (i. e., UGA )

(265), Based on a survey of 6,814 codons used in genes in M. capricolum, the UGA codon for tryptophan was used 42 times, the UGG codon for tryptophan was used 7 times, and the

CGG codon for tryptophan was not used (160). Because the UGA codon was preferentially used, a protein possessing a tryptophan would probably include the UGA codon.

In addition to M. capricolum, other Mycoplasma species have been shown to use the UGA codon for tryptophan including M. arginini (110), M. gallisepticum (94, 96), M. genitalium

(94), M. hyopneumoniae (107), M. hyorhinis (46), and M. pneumoniae (93, 94, 129). Other

Mollicutes that have been reported to use the UGA codon for tryptophan include Ureaplasmas

(13) and Spiroplasmas (14, 28). Acholeplasma laidlawii does not use the UGA codon for tryptophan, but continues to use UGA as a stop codon (241). 19

Translational termination in E. coli is mediated by two codon-specific protein factors,

release factor 1 and release factor 2. Release factor 1 recognizes the stop codons UAA and

UAG, and release factor 2 recognizes the stop codons UGA and UAA (20). Because the UGA

codon is used for tryptophan in most mycoplasmas, it remains to be determined whether

release factor 2 has been deleted or if release factor 2 has become specific for UAA. Moreover,

it is not known if mycoplasmas use release factors because they have not been identified.

The alternate codon usage of mycoplasmas creates two major problems in using E. coli to

express mycoplasma genes. First, the UGA codon would be read as a translational stop in E.

coli instead of a tryptophan resulting in truncated protein products (101). Unfortunately, some

of the truncated protein products were not detectable with specific or convalescent antisera and

thus escaped screening (13, 36,237). Second, different codon usage preferences and tRNA

concentrations may interfere with translation (3). In E. coli, there is a positive correlation

between codon frequency and the relative concentrations of corresponding tRNAs (160). Thus,

mycoplasma genes may not be expressed or are expressed at low levels in E. coli because the

necessary tRNAs may be limiting.

Development of cloning systems in mycoplasmas

The first cloning system for mycoplasmas was developed by Mahairas and Minion, and

was based on the ability to integrate cloned genes into mycoplasmal chromosomes via homologous recombination (132,134). A cloning system involving two plasmids that share a region of homology such as an origin of replication and/or an antibiotic resistance marker was developed to simplify cloning steps (132). The cloning vectors are not able to replicate extrachromosomally in mycoplasmas. Thus, the plasmids must integrate into the chromosome in order to get expression and maintenance of the resistance marker. A recipient strain was created by transforming with one of the plasmids containing a mycoplasmal chromosomal

DNA fragment. The plasmid integrated into the chromosome via homologous recombination 20

conferring antibiotic resistance (gentamicin or tetracycline) on the transformed cell. A second

plasmid, containing the cloned gene of interest, was then used to transform the recipient strain.

The second plasmid integrated into the previously integrated plasmid via homologous

recombination. The presence of the second plasmid is selected for and maintained by a different

antibiotic resistance marker than the one used to construct the recipient strain. Mahairas and

Minion used the cloning vectors pSP64 (Promega Corp.) and pKS (Stratagene) (131,134),

and attempted to express the PI gene and operon as well as a gene encoding a 31-kDa protein

fcom Brucella abortus in Acholeplasma (132). Although integration into the chromosome of

these genes was confirmed by DNA-DNA hybridization, the protein products were not detected

by screening with antisera. More recent studies have confirmed the versatility of this system by introducing recombinant plasmids into M. gallisepticum (Cao and Minion, unpublished results).

The primary advantage of this system is its versatility because any plasmid, whether it is of Gram positive or Gram negative origin, can be inserted into the chromosome. Thus, the cloning vectors can be shuttied between mycoplasmas and other cloning hosts. In addition, this system will accommodate DNA inserts of at least 15-kb and the inserted DNA is stable, even in the absence of selection (134). Because the cloned gene is integrated into the chromosome, it has a copy number of one or two. Thus, the copy number of the cloned gene would be similar to the way it is normally represented in the bacterial cell. If high levels of expression of the cloned gene were desired, higher gene copy numbers might be more advantageous, but high copy number plasmid cloning vectors are not presentiy available. The disadvantage of this system is the requirement that the cloning and amplification steps must occur in another cloning host due to the inherent limitations of the PEG transformation procedure. In addition, because the cloned insert can only integrate into one site in the chromosome, regulation in that region may also influence levels of gene expression. 21

Another cloning system has been developed in S. citri using the Spiroplasma spp. virus

SpVl as a cloning vehicle (231). SpVl has a single-stranded DNA genome with a double-

stranded replicative form that can be used a cloning vehicle (188). Initially, Stamburski et al.

cloned and expressed the E. coli chloramphenicol acetyl transferase (CAT) gene in S. citri

(231). They were able to introduce cat at a frequency of 6 x 10^ transfectants/|J.g of DNA via

electroporation. Moreover, the vector provided the promoter, translational start region, and

termination sequence for the cat gene. In order to show that genes possessing a UGA codon

would s tin be expressed, one TGG tryptophan codon of the cat gene was mutated to the stop codon TGA (232). The altered cat gene was expressed in S. citri, but not in E. coli. The system was then used to clone and express a 1.4-kb fragment of the PI gene of M.

pneumoniae containing 7 UGA codons (140). Thus, this cloning and expression system has demonstrated the ability to express mycoplasmal genes. The advantages of this system include the proven ability to clone and express mycoplasmal genes, high transformation frequencies, high copy number of the recombinant in spiroplasmas, and an effective reporter gene, cat

(187). The system's major disadvantage is instability. As the insert size increased, the ability to maintain and express the cloned gene decreased. In addition, there is a limited host range because the virus will only infect spiroplasmas.

A third cloning system has utilized naturally occurring mycoplasma plasmids as cloning vectors (55,102). Unfortunately, there have been only three plasmids isolated from the genus

Mycoplasma, and only two have been characterized (11, 104, 253). The mycoplasma plasmids pKMKl and pADB201 were both isolated from M. mycoides subsp. mycoides and belong to the family of Gram positive plasmids that replicate by a single-stranded intermediate (77,104).

King and Dybvig have cloned the tetM gene from Tn9/(5 into plasmid pKMKl to generate plasmid pJI3, and they were able to introduce this plasmid into M. mycoides subsp. mycoides.

This plasmid, however, was unstable and tended to delete portions of the plasmid (King and

Dybvig, personal communication, 55). The potential advantages of this system remain to be 22

proven. While this system shows promise, there are precedents of plasmid instability using

plasmids from Gram positive bacteria as cloning vectors (60,76, 77).

It should be noted that broad host range Gram positive plasmids pVA868, pVA920, and

pNZ18 have also been examined as potential cloning hosts in mycoplasmas (49, 239).

Plasmids pVA868 and pVA920 were highly unstable and spontaneously deleted cloned fragments, whereas, pNZ18 was stable in A. laidlawii. A. laidlawii, however, uses UGA as a stop codon, offering no advantage over E. coli as a cloning host. These plasmids have not been shown to transform any of the other Mollicutes. Opal suppressor strains have also been examined as a means of obtaining full-length expression of mycoplasmal proteins in E. coli

(Smiley and Minion, submitted; 189).

Regulation of Gene Expression in Mycoplasmas

The regulation of gene expression in mycoplasmas remains an enigma because of the lack of mycoplasma-based genetic systems to perform valid studies. Other cloning hosts such as E. coli, have been shown to be inappropriate for examining gene regulation (67). The present knowledge of gene regulation in mycoplasmas is based on models developed for other bacterial genes; it remains to be determined whether they will apply to mycoplasmas. Because mycoplasmas possess the smallest genomes necessary for autonomous existence, it is possible that they may also possess novel means of regulating their genes.

Transcription in mycoplasmas

Transcription, the synthesis of mRNA from a DNA template, occurs through the action of a DNA-dependent RNA polymerase following the specific recognition of a promoter sequence upstream of a gene or operon. The E. coli RNA polymerase holoenzyme is an 480-kDa protein that is composed of 4 subunits and can be divided into two components, the core enzyme («2,

(3, p') and a sigma factor {a) (123). The a subunit is 40-kDa and is involved in promoter 23

binding. The 155-kDa |3 subunit is involved in nucleotide binding and the 160-kDa P' subunit

is involved in template binding during elongation. The 85-kDa sigma subunit is involved in

specific promoter recognition and is released once chain elongation has initiated (123).

Mycoplasma RNA polymerase has been partially characterized from two genera. Gadeau et al.

isolated spiroplasma RNA polymerase by running a purified cell lysate over a heparin-agarose

column (66), The product was run on a SDS polyacrylamide gel and three major bands of 140,

130-, and 38-kDa were present. The authors suggest that they correspond to the P, P', and a

subunits, respectively, of the core enzyme. A partially purified M. capricolum fraction also

revealed two large proteins of 140- and 130-kDa (160).

A notable feature of the mycoplasma RNA polymerase is its insensitivity to the antibiotic

rifampicin (66,219). Rifampicin binds to the P subunits of eubacterial RNA polymerase and

prevents transcription initiation (123). Spiroplasma spp., A. laidlawii, and M. mycoides was

shown to be 10 to 1,000 times more resistant to rifampicin than E. coli (66). Therefore, the

structure of the mycoplasma RNA polymerase is similar to other eubacteria. The size or protein conformation of the individual subunits may differ because the mycoplasma RNA polymerase appeared to possess the same subunits as the E. coli RNA polymerase yet the mycoplasma

RNA polymerase was resistant to rifampicin.

The sigma factor of mycoplasma RNA polymerase has not been identified. The sigma factor is important because it confers promoter specificity on the transcriptional process (86). A number of bacteria, including E. coli and B. subtilis, have been shown to possess more than one sigma factor each recognizing a different set of promoters. By altering the sigma factor component in RNA polymerase, global changes in transcription can be initiated such as during a heat shock response or during induction of sporulation (92, 164,235). High temperature induced proteins that cross-react with the DnaK and GroEL heat shock proteins of E. coli have been identified in mycoplasmas (37). The presence of multiple mycoplasma sigma factors have 24 not been addressed, and it remains to be determined whether mycoplasmas respond to environmental changes.

Promoters. The analysis of mycoplasma promoters has been based on the ability of upstream regions of mycoplasma genes to generate a product in E. coli and on transcriptional start site mapping studies (67). Defining a mycoplasma promoter by its ability to drive the expression of a gene in E. coli could be misleading because mycoplasma DNA, like E. coli promoters, is A + T-rich. It has been shown with another A + T-rich organism, Streptococcus pneumoniae, that strong promoter-acting sequences were commonly observed in randomly cloned DNA fragments in E. coli, and they occurred more frequently than in randomly cloned

E. coli sequences (27). Thus, mycoplasma DNA may generate pseudo promoter activity in E. coli (159, 184). The mapping of transcriptional start sites by S1 nuclease or primer extension have merely shown where transcription begins and does not necessarily imply that the upstream regions at -10 and -35 are the mycoplasma RNA polymerase binding or recognition sites.

Hawley and McClure analyzed over 110 E. coli promoter sequences and derived a consensus promoter sequence at regions -35 and -10 nucleotides upstream of the transcriptional start site (84). The -10 region or the consensus TATAAT is referred to as the Pribnow box

(123). Unfortunately, relatively few mycoplasma genes have been sequenced, and most of the genes analyzed so far are rRNA, tRNA, and ribosomal protein genes (29,30,160).

Comparison of mycoplasma regions upstream of the transcriptional start sites with the E. coli consensus promoter sequence showed that the -10 region was conserved, but the -35 region was more variable showing significant heterogeneity (29, 30). It should be noted that for the E. coli promoters examined by Hawley and McClure (84) 3.9 of 6 bases of the -35 consensus and

4.2 of 6 bases of the -10 consensus promoter sequence matched. The observation of E. coli- like promoters has been noted in other A + T-rich organisms, including B. subtilis and 5. pneumoniae (151, 156). Because the likelihood of randomly encountering an E. co/Mike 25

promoter sequence is high in these A + T-rich organisms (159), their RNA polymerases are

expected to have a more stringent sequence requirement than does E. coli RNA polymerase

(151, 156). There have been a number of attempts to develop a promoter search algorithm

which would efficiently detect promoter sites within a large DNA sequence (158, 159, 171,

173, 234). These programs have been based on the ability to detect E. coli promoters.

Two models for the association of RNA polymerase with the -35 and -10 regions of the

promoter have been offered. The bipartite model suggests that the -10 region is involved in the

melting-in of the RNA polymerase near the transcriptional start site and the -35 region is

involved in the specific recognition of the promoter by RNA polymerase (72). The other

model, proposed by Stefano and Gralla, suggests that there is simultaneous recognition by the

RNA polymerase at the -10 region, the -35 region, and the spacer elements between the two regions (233). Reznikoff and McClure, however, offer a more general model that a preferred promoter-RNA polymerase interaction exists for a given promoter, but that other influences such as ancillary proteins or supercoiling affect the ideal interaction between the promoter and

RNA polymerase (192).

The transcription initiation sites have been mapped for several of mycoplasma genes and they appear 6 to 8 bp downstream of the putative -10 region (67, 242, 243). This observation agreed with the distance reported for E. coli (180). The apparent conservation of the Pribnow box sequence and its distance from the start site in mycoplasmas has led investigators to suggest that the M. capricolum RNA polymerase recognizes promoter sequences resembling those in E. coli (67, 160). They supported their hypothesis with the observation that promoters of the rrnA and tRNA genes were recognized by E. coli RNA polymerase both in vivo and in vitro (67). This experiment does not prove their hypothesis, however. Their evidence, at best, merely indicates that the melting-in region (Pribnow box) and its distance from the start site have been conserved in mycoplasmas. Because of the variability at the -35 regions of mycoplasma promoters, it would be unwarranted to assume that this region is recognized by 26

the mycoplasma RNA polymerase until fine structure analysis of this region has been performed in mycoplasmas.

Transcription initiation. Regulation of transcription initiation generally falls into two forms, negative and positive regulation. Moreover, several genetic regulatory systems have exhibited dual control effected by the same protein, with positive or negative regulation determined by the protein binding site relative to the promoter (reviewed in 192). Other means of regulating transcription initiation include DNA supercoiling (45, 178), DNA methylation

(106), and altering the specificity of the RNA polymerase by substituting sigma factors (86).

Positive and negative regulation are defined by the response of the operon when no regulatory protein is present. Genes under negative control are constitutively expressed unless they are switched off by a repressor protein. One model system of negative regulation is the lac operon (reviewed in 192). Negative regulation of the lac operon occurs via the lac repressor protein which binds to the operator region {lacO) located between the promoter {lacP) for lacZ and the translational start site of the structural gene. This prevents the RNA polymerase from forming an open complex to initiate transcription. The lac repressor is a tetramer of identical 38 kDa subunits produced by lad, located upstream of lacP. Mutations in lad result in the constitutive phenotype irrespective of whether the inducer is present or not (148). The other component of this negative regulatory system is the inducer which binds the repressor causing an allosteric change in the configuration of the repressor, and reduces its affinity for the operator region. The inducer is a P-galactoside (e. g., lactose, allolactose, and isopropylthio-P- galactoside or IPTG) which is the substrate for the lacZ product.

Positive regulation at transcription initiation refers to the requirement for a protein factor that is called an activator or inducer (193). This protein may be an ancillary protein that allows

RNA polymerase to initiate transcription at specific promoters, a factor tiiat replaces one of the subunits of RNA polymerase thus altering its promoter recognition specificity (i. e., sigma factor), or a new RNA polymerase (193). 27

Perhaps the best known example of an activator is the catabolite activator protein (CAP) or

cyclic AMP receptor protein (CRP) which is activated in response to nutrient changes in E. coli

(40) as well as other bacteria (193). E. coli preferentially utilizes glusose over other sugars as

an energy source. For example, if both glucose and lactose were amply supplied in the

medium, glucose would be preferentially metabolized and the use of lactose would be

repressed in a response termed catabolite repression (40). Catabolite repression is initiated by

the ability of glucose to reduce the level of cyclic AMP (cAMP) in the cell by an unknown

mechanism. But if cAMP levels are high, it can bind to the CAP rendering it capable of assisting RNA polymerase in transcription initiation. The CAP-cAMP complex has been shown to activate the pap operon which codes for type P pilus in E. coli, and consequentiy, is involved in regulation of virulence factors (reviewed in 245).

For the lac operon, DNase protection assays demonstrated that the complex of cAMP-CAP bound just upstream of lacP and protected nucleotides -87 to -49, whereas, the RNA polymerase protected nucleotides -48 to +5 (191). Because the presence of CAP stimulated the initiation of lac mRNA synthesis by 50-fold and because the CAP protein was adjacent to the

RNA polymerase binding region, it is believed that the CAP provides an additional binding site for RNA polymerase (192). The protein-protein interaction acts to either stabilize the RNA polymerase-DNA complex or induces a favorable conformational change in the RNA polymerase. Another hypothesis is that CAP induces a change in the DNA that enhances the ability of RNA polymerase to bind (190). It should be noted that the lac repressor has been shown to bind to nucleotides -3 to +21 which overlapped the RNA polymerase binding site.

Thus, this finding supports the notion that the repressor prevents the binding of RNA polymerase (191, 192).

Regulation of transcription initiation has not been demonstrated in mycoplasmas. Muto et al. suggested that most of the genes encoded within the mycoplasma genome are constitutively expressed because the genome only possesses genes that are necessary for growth (160). 28

Moreover, they asserted that the negative control elements used by other eubacteria in response

to environmental changes may not be required in mycoplasmas. They believed that gene

regulation in mycoplasmas is a quantitative mechanism of gene regulation rather than an on or

off switch for gene expression. They proposed that the quantitative regulation is similar to the

stringent control response that regulates the levels of many housekeeping genes in E. coli in

response to poor growth conditions (reviewed in 19).

Stringent control is an adaptive response that is part of a global regulatory network

activated in response to amino acid starvation (19). The stringent response results in a 10- to

20-fold reduction in rRNA and tRNA synthesis, and a 3-fold reduction in mRNA synthesis.

The response is triggered by the presence of an uncharged tRNA in the A site of the ribosome

during translation. The major regulatory signals in this response are guanosine tetraphosphate

(ppGpp) and guanosine pentaphosphate (pppGpp) which act as negative regulators of

transcription initiation and/or elongation. Stringently controlled promoters in E. coli contain a

conserved G + C-rich discriminator region just 3' to the -10 region of the promoter at -5 to +2

(248). Similar regions have been described in other bacteria including Salmonella typhimurium

and B. subtilis (248). A similar G + C-rich discriminator region does not appear to be present

in mycoplasmas because M. capricolum rrnA was activated rather than repressed in the

presence of high levels of ppGpp in E. coli (67). This suggests that the control mechanism is different from that in E. coli.

In addition to the discriminator region in E. coli, A + T regions centered at -70 and -51

were found to be conserved in rRNA upstream regions (248). It has been shown in both E. coli and mycoplasmas that the region upstream of the -35 region affects levels of gene expression (R. Herrmann, University of Heidelberg, personal communication; 99).

Transcription termination and attenuation. Regulation of gene expression at the level of transcription termination also occurs in bacteria. The termination signals generally fall 29

into three categories: simple (rho-independent) terminators, attenuators, and rho-dependent

terminators (reviewed in 175, 262).

The simple terminators consist of a series of uridine residues at the 3' end of the transcript

which are preceded by a G + C-rich region of dyad symmetry capable of forming a hairpin

loop (262). It has been shown that base analog substitutions or point mutations that strengthen

or weaken the hairpin structure increase or decrease, respectively, the termination signal (175).

The polyuridine region facilitates dissociation of the transcript from the template. Rho-

independent terminator-like structures have been reported for the rRNA, tRNA, and ribosomal

protein genes of M. capricolum that possess A + T-rich hairpin loops instead of the G + C-rich

sequences in E. coli (161, 172, 215). In contrast, it has been shown that the transcription

terminator of spiroplasmas possess G + C-rich hairpin structures (28, 206, 230). Thus, there

appears to be a difference in the termination signals used by mollicutes, and the transcriptional

terminators should be a consideration when developing a cloning system to express mycoplasma genes.

An attenuator is a transcription termination site located within an operon that acts to regulate the expression of the operon's gene product (266). This type of regulation is associated with amino acid biosynthesis such as the histidine, isoleucine, leucine, phenylalanine, threonine, and tryptophan opérons (175). The trp operon has been the model system in studying attenuation in E. coli (266). Similar attenuator-like sequences have been described for tRNA operon coding for tRNAs that recognize the UG A and UGG codons for tryptophan (264, 265). The attenuator-like sequence is located between the two tRNA genes and results in a 5-fold decrease in the level of the tRNAuGG- This correlates with the 5- to 10- fold difference in which these codons are used by the cell (263, 264).

Rho-dependent termination, unlike simple termination, requires the protein rho (p) factor for transcription termination (175). Rho factor's role in transcription termination is unclear because a consensus rho-binding site has not been determined. The hairpin structure of a rho- 30

dependent terminator is not necessarily G + C-rich, nor is there a polyuridine region

downstream. There is usually an 80-bp region upstream of the hairpin that contains

pyrimidines (usually C) in the third position of every fourth codon. It is suggested that the rho

protein winds itself up in the transcript via attachment to these pyrimidine residues in an ATP-

dependent manner resulting in transcription termination (175). Rho-dependent tennination has

not been reported for mycoplasmas, but J. M. Bove (University of Bordeaux) has indicated

that spiroplasmas may exhibit rho-dependent termination (9th International Organization for

Mycoplasmology).

Promoter probe vectors. Promoter probe vectors provide a means of identifying or locating DNA sequences containing promoters in vivo. Generally, they are designed with

unique cloning sites located upstream of a promoterless gene encoding an assayable and/or selectable function such as lacZ ((3-galactosidase) (221), galK (galactokinase) (210), cat

(chloramphenicol acetyltransferase) (78), gusA (^-glucuronidase; GUS) (68), lux (luciferase)

(22^),phoA (alkaline phosphatase) (138), or an antibiotic resistance marker (240).

Introduction of the promoter probe vector into a cell should result in a null phenotype because no promoter is present If a fragment containing a promoter in the proper orientation is cloned upstream of the reporter gene, the reporter gene's phenotype should be expressed.

lac fusions have been shown to be useful in a variety of applications (reviewed in 221).

These applications include; 1) the study of the regulation of a gene or operon, 2) the detection of genes that respond to a particular regulatory signal, 3) the study of the localization of a protein within the cell, and 4) the detection of a protein or gene and the ability to assay for the protein or gene when no assay for the gene product exists. In addition, lac fusion vectors have been widely used because the biochemical and genetic aspects of the lac operon have been well studied and there are a number of indicator media available for detection of p-galactosidase activity (221). Gronenbom and Messing (75) removed the lacZ gene regulatory elements by 31

introducing an fîcoRI site at the fifth codon, and Casadaban et al. (17) introduced a BamYH site

at the eighth codon. Expression of the truncated lacZ gene requires that cloned upstream

sequences possess a promoter, ribosomal binding site, and translational start codon. Operon

fusion vectors have also been constructed using lacZ and a truncated trp promoter (16). The

truncated trp promoter possesses only the translational elements, so that the cloned upstream

fragment need only provide the promoter in any reading frame. Operon fusion vectors,

however, have been difficult to use because of high background expression when placed on a

high copy number plasmid. To avoid the high background, Simons and Kleckner introduced a

transcription termination signal upstream of lacZ to avoid read-through from adjacent genes

(223).

In addition to plasmid based promoter probe vectors, transposable elements carrying lacZ have been used to detect promoters directly on the chromosome. These vectors include derivatives of Mu phage, Mu dlacl and 2 (18) and X plac Mu (108), and many transposons such as Tni (229), Tn70 (256), Tn5 (113), and Tn9/7 (268). These vectors are able to locate promoters in the chromosome by inserting into regions of active transcription and/or translation which drive the expression of the reporter gene carried within the transposon.

Translation in mycoplasmas

The mechanisms of translational regulation in mycoplasmas are merely speculation at this point because of a lack of study. Genetic systems are not available to study translation in mycoplasmas. Like other aspects of gene regulation previously discussed, the precise regions involved are hypothetical based on observations made in other bacterial systems. The probable ribosomal binding sites, as well as translational start sites, for over twenty M. capricolum ribosomal genes have been reported (172). In addition, the probable translational start regions for a number of spiroplasmal proteins (28), the arginine deiminase gene of M. arginini (110), and the urease gene of U. urealyticum (13) have been reported. All of these genes appeared to 32

use AUG as a start codon except for 1 gene of unknown function in S. citri (28). Moreover,

there appeared to be ribosomal binding sites at the proper distance (5 to 9 nucleotides) upstream

of the start site.

The 3' ends of the 16S rRNA sequence of M. capricolum and S. citri have been described

and were shown to be identical (28, 97). Moreover, the last 15 nucleotides of the 3' ends of the

16S rRNA genes of these mycoplasma species are identical to the last 15 nucleotides of the 16S

rRNA gene of 5. subtilis and have a 12-nucleotide homology with E. coll 16S rRNA (28).

Thus, at the sequence level, the translational initiation regions of mycoplasmas appear to be

similar to those of E. coli and B. subtilis. A report by Notarnicola et al. (170) has even made

the issue involving mycoplasma translational start regions more confusing. They observed

translational initiation inside a mycoplasma coding sequence in E. coli.

The ability to clone and express Gram positive genes in Gram negative bacteria has been

reported to occur efficiently, but the ability to clone and express Gram negative genes in Gram

positive bacteria has been inefficient (81). One possible reason for the difference in the ability

to express genes from Gram negative bacteria in Gram positive is the differences in binding

stringencies of their respective ribosomes and mRNA (81, 143). The base pairing of the 16S

rRNA with the ribosomal binding sites of E. coli had a generally lower free energy of binding

than that of ribosomes and mRNA of Gram positive bacteria.

Differences in the stringency of binding of 16S rRNA and the ribosomal binding sites

between Gram positive and negative bacteria cannot account for all the differences in the ability

to express in the heterologous host. Hager and Rabinowitz showed that T7 genes, which possess a long ribosomal binding site, were not translated as well by B. subtilis ribosomes as genes from the B. subtilis phage (j)29 that has the same ribosomal binding site as T7 genes (80,

81). Because the spacing between the ribosomal binding sites and the start sites was nearly identical, the authors suggested that the difference in translation efficiency was due to secondary structure or interaction with the ribosome at another region in the transcript. 33

Secondary structure of the 5' untranslated region of the gltBDF operon of E. coli has been shown to regulate expression (252). Also, enhancing sequences recognized by the ribosome located within the 5 to 9 nucleotide spacer, 5' of the ribosomal binding site, or 3' of the translational start site have been reported (reviewed in 141).

Loechel et al. have reported that they have identified a novel translational initiation region from M. genitalium that functioned in E. coli (128). The efficiency of this translation initiation was affected by the secondary structure around the site as well as sequences upstream and downstream of the translational start site. Therefore, it appears that secondary structure of the translation initiation region, as well as enhancer-like sequences, may also affect the ability to translate genes in mycoplasmas. 34 MATERIALS AND METHODS

Bacterial Strains and Culture Media

The strains and plasmids used in this study are listed in Table 1. Acholeplasma strain designations ISM2004-2010, or ISM2050.X and ISM1499.2050.X represent mycoplasma recombinants containing plasmids pISM2004-pISM2010 or pISM2050.X, respectively. The X suffix designates a derivative of the parent lacZ fusion vector, pISM2050, containing a cloned

Acholeplasma chromosomal DNA fragment. Fragment sizes of these cloned fragments are given in Table 1. Strain IS M1499 is a laboratory isolate that has been serotyped by J. G. Tully

(NIAID) to be related to Acholeplasma oculi and Acholeplasma laidlawii. All references to M. pulmonis ISM1499 should be regarded as Acholeplasma ISM 1499.

Acholeplasma strains were grown in PPLO broth (Difco Laboratories, Detroit, Mich.) supplemented with 15% gamma globulin-free horse serum (GIBCO Laboratories, Grand

Island, N.Y.), 2.5% yeast extract, 0.5% glucose, 2.5 |i.g/ml of Cefobid (Pfizer, Inc., New

York, N.Y.), 0.02% herring sperm DNA (Sigma Chemical Co., St. Louis, Mo.), 0.002% phenol red, and (when required) 1% Noble agar (Difco). Selective levels of antibiotics for

Acholeplasma ISM 1499 were 2 ng/ml tetracycline (Sigma) and 15 |ig/ml gentamicin (Sigma), and resistant cultures were maintained at 10 |J.g/ml tetracycline and 15 to 20 |J.g/ml gentamicin.

E. coli cultures were grown in Luria broth containing 100 Hg/ml ampiciUin (Sigma) or 12.5 jig/ml tetracycline when appropriate.

Reagents and Buffers

Restriction enzymes (RE), T4 DNA ligase, and Klenow enzyme were purchased from

Promega Corporation (Madison, Wis.) or GEBCO BRL (Gaithersburg, Md.) and used according to manufacturer's instructions. 5-bromo-4-chloro-3-indolyl-|3-D-galactoside (X-gal)

(GIBCO BRL or Gold Biotechnology, Inc., St. Louis, Mo.) was used at a concentration of 35

Table 1. Bacterial strains and plasmids

Bacterial strain or Relevant genotype and phenotype^ Source plasmid

E. coli DH5a (t)80d/acZAM15 enclAI recAl hsclRl? supE44 thi-I BRL gyrA relAl F" A(lacZYA argF)U 169 CSH50 ara DQac-pro) strA thi F" (147) CSHSO.Xb CSH50(pISM2050.X) This study %289 F- supE42 X- TSr R. Curtiss III XLl-Blue recAl, lac, endAl, gyrA96, thi, hsdRIV, supE44, Stratagene relAl [F proAB, lacfi, /acZAM15, Tn70] Tc^

Acholeplasma sp. ISM1499 Laboratory isolate This study ISM 1499.x ISM 1499 with integrated plasmid X Gm^ This study ISM 1520 ISM 1499 with integratedpISM1026 Tc^ (132) ISMX ISM1520 with integrated plasmind X Gm^ Tc^ This study

Plasmids pDIAlS trp-lacZYA Km^ (41) pKS- Multipurpose cloning vector Ap*" Stratagene pMC1871 Prokaryotic fusion vector Tc^" Pharmacia pSP64 Multipurpose cloning vector Ap^ Promega pSP71 Multipurpose cloning vector Ap^ Promega pISM205 pKS' containing the 3.1-kb lacZ fragment from This study pMC1871 in which the downstream 5fl/nHI RE site has been altered Ap^

^Apf, Tc^, Gm^, and Kmi" denote resistance to ampicillin, tetracycline, gentamicin, and kanamycin, respectively. RE denotes restriction endonuclease.

bx denotes the plasmid designation which was then used to denote the strain designation

(e.g.. Strain ISM2050.1 = ISM 1520 with pISM2050.1, Strain ISM 1499.2050.1 = ISM1499 with pISM2050.1, and Strain CSH50.2050.1 = CSH50(pISM2050.1). 36

Table 1. (continued) pISMlOOl 13.5-kb plasmid containing Tn4001 Ap^ Gm^" (133) pISM1003 5.75-kb plasmid containing the gentamicin resistance (134) marker from Tn4001 Gm^ Ap^ pISM2002 pISM1003 with M. capricolum rniA P2 promoter Gm'" This study Ap^ pISM2003 pis M1003 with E. coli rniB PI promoter Gm^ Ap^" This study pISM2004 pISM1003 with trp-lacZYA Gm^ Ap^ This study pISM2005 pISM2002 with trp-lacZYA Gm^" Ap^ This study pISM2006 pISM2003 with trp-lacZYA Gm^ Ap^" This study pISM2009 pISM2G04 with E. coli rrnB PI promoter containing This study 700 bp of the upstream region of the M. capricolum rrnB P2 promoter Gm^ Ap^ pISM2010 pISM2004 with M. capricolum rrnA P2 promoter This study containing 700 bp of the upstream region of tetM. capricolum rrnB P2 promoter Gm^ Ap^ pISM2011 pISM2004 with E. coli rrnB PI promoter containing This study 700 bp of the upstream region of the M. capricolum rrnB P2 promoter in the reverse orientation Gm^ Ap"" pISM2012 pISM2004 with M. capricolum rrnA P2 promoter This study containing the -35 region of the E. coli rrnB PI promoter and the -10 region of tetM. capricolum rrnB P2 promoter Gm^" Api" pISM2013 pISM2012 containing the trp-lacZYA Gm^ Ap^ This study pISM2025 10.3-kb rescue plasmid derivative of pSP64 containing This study the tetM from Tn916 and the gentamicin resistance marker from Tn-^OO/ Ap^ Tc^ Gm^ pISM2030 pISM2002 containing the B52 adhesion gene from M. This study pneumoniae Ap^" Gm^ pISM2031 pISM2002 containing the B52 adhesion gene from M. This study pneumoniae in the reverse orientation Ap^ Gm^ 37

Table 1 .(continued) pISM2032 pISM2008 containing the B52 adhesion gene from M. This study pneumoniae Api" Gm^" pISM2033 pISM2008 containing the B52 adhesion gene from M. This study pneumoniae in the reverse orientation Ap*" Gm^ pISM2034 pISM2002 containing the PI adhesion gene from M. This study pneumoniae Ap^ Gm*" pISM2035 pISM2002 containing the PI adhesion gene from This study pneumoniae in the reverse orientation Ap*" Gm'" pISM2036 pISM2008 containing the PI adhesion gene from M. This study pneumoniae Ap^ Gm^ pISM2037 pISM2008 containing the PI adhesion gene from M. This study pneumoniae in the reverse orientation Ap^ Gm^ pISM2046 pKS" with BamWl and Sma\ RE sites removed Ap^ This study pISM2048 pISM2046 containing a 1.3-kb fragment containing the This study ca. 1-kb distal end of an \S256 arm oiTn400I Ap^ pISM2048.5 pISM2048 with the insertion of BamWl and Smal RE This study sites ca. 30 bp from the distal end of an IS256 arm of TïAOOl Ap^ pISM2050 Promoterless lacZ fusion vector Gm^ Ap'" This study pISM2050.1 pISM2050 with 2.8-kb of ISM 1499 chromosomal This study DNA Gmi"Ap^ pISM2050.2 pISM2050 with 0.9-kb of ISM 1499 chromosomal This study DNA Gm^ApT pISM2050.8 pISM2050 with 1.0-kb of ISM 1499 chromosomal This study DNA Gm^Apr pISM2050.18 pISM2050 with 0.9-kb of ISM 1499 chromosomal This study DNA Gm^'Ap'" pISM2050.19 pisM2050 with 1.5-kb of ISM 1499 chromosomal This study DNA Gm^Ap^ pISM2050.25 pISM2050 with 0.8-kb of ISM 1499 chromosomal This study DNA Gm^Apr 38

Table 1. (continued) PISM2050.39 pISM2050 with 1.0-kb of ISM 1499 chromosomal This study DNA Gmr Apr pISM2050.40 pISM2050 with 1.7-kb of IS M1499 chromosomal This study DNA Gmr Apr pISM2050.66 pISM2050 with 2.0-kb of ISM1499 chromosomal This study DNA Gm^Apr pISM2050.69 pISM2050 with 2.5-kb of IS M1499 chromosomal This study DNA Gm^ Apr pISM2050.70 pISM2050 with 2.3-kb of IS M1499 chromosomal This study DNA Gmr Apr pISM2050.86 pISM2050 with 2.2-kb of ISM1499 chromosomal This study DNA Gmr Apr pISM2050.89 pISM2050 with 1.0-kb of ISM1499 chromosomal This study DNA Gmr Apr pISM2061 pKS' containing a 5.8-kb Pstl-Sacl fragment from This study pISMlOOl harboring Tn400/ Apr Gmr pISM2062 pISM2061 containing the BawHi. and Smal RE sites in This study an IS25d arm of Tn4001 Apr Gmr pISM2062/flc pISM2062 containing the 3.1-kb lacZ fragment from This study pMC1871 Apr Gmr pISM2062.2 pISM2062 with two translational stop codons altered This study ApT Gmr pISM2062.3 pISM2062 with three translational stop codons altered This study Apr Gmr pISM2062.2/flc pISM2062.2 containing the 3.1-kb lacZ fragment from This study pMC1871 Apr Gmr pISM2062.2/ûc(rev) pISM2062.2 containing the 3.1-kb lacZ fragment from This study pMC1871 in the reverse orientation Apr Gmr pISM2062.3/flc pISM2062.3 containing the 3.1-kb lacZ fragment from This study pMC1871 Apr Gmr 39

Table 1. (continued) pISM2062.3/ac(rev) pISM2062.3 containing the 3.1-kb lacZ fragment from This study pMC1871 in the reverse orientation Ap^ Gm*" pISM2064 pISM2062.2 containing pISM205 Ap'" Gm^ This study pISM2065 pISM2062.3 containing pISM205 Ap^ Gm'" This study pISM2075 Exo/Mung deletion clone of pISM2050.2 Lac" Ap^ This study Gm^ pISM2076 Exo/Mung deletion clone of pISM2050.2 Lac"*" Ap^ This study Gmf pISM2077 Exo/Mung deletion clone of pISM2050.2 Lac"*" Ap^ This study Gmf pISM2078 Exo/Mung deletion clone of pISM2050.2 Lac+ Ap^ This study Gmf pISM2079 Exo/Mung deletion clone of pISM2050.2 Lac"*" Ap^ This study Gmf pISM2080 Exo/Mung deletion clone of pISM2050.2 Lac"^ Ap^ This study Gmr pISM208I pKS containing a 1.4-kb fragment harboring the 16S This study rRNA gene of ISM 1499 Ap^ pISM2083 pSP71 containing the promoter containing insert from This study PISM2050.2 Apr

80 |U.g/ml when scoring for the Lac+ phenotype in Acholeplasma or 25 |lg/ml in E. coll All other chemicals and reagents were obtained from Sigma except where noted. Isopropylthio-P-

D-galactoside (GEBCO BRL or Gold Biotechnology) was used at a final concentration of 10 mM. Oligonucleotides were synthesized by the Iowa State University Nucleic Acid Facility.

Transformation of Acholeplasma spp., M. gallisepticum, and E. coli

The transformation of Acholeplasma was performed as described previously (134).

Mycoplasma gallisepticum was transformed via electroporation using the BTX model 600 40

electroporator (Biotechnologies & Experimental Research, Inc., San Diego, Cal.), using 2 mm gap cuvettes, with settings of 2.5 kV, 50 |J.F, and 129 ohm, to generate a pulse length of 5

msec. Mid-log phase cells were washed 3 times with prechilled electroporation buffer (272 mM

sucrose, 8 mM HEPES, pH 7.4). After the final wash the cells were resuspended in one-fourth

to one-tenth the original culture volume with electroporation buffer and placed on ice. One

hundred microliters of cells were mixed with 20 |il of electroporation buffer containing 7 to 10

Hg of DNA and placed in the cuvette on ice. After a 10 min incubation the mixture was pulsed.

The cells were immediately resuspended in 1 ml of complete PPLO media, transferred to a

prechilled microfuge tube, and incubated on ice for 10 min. The cells were incubated at 37°C

for 0 to 2 hr prior to plating. X-gal was spread on the agar surface 1 to 2 h prior to plating the

mycoplasma transformation mixture. Blue colonies were picked and analyzed for P-

galactosidase (P-gal) activity. Transformation of E. coli was achieved by the method of

Hanahan (82) or by electroporation using cuvettes with a 1 mm gap, settings of 0.81 kV, 50

uF, and 129 ohm, to generate a pulse length of 5 msec.

Preparation of Acholeplasma ISM1499 Chromosomal DNA

Chromosomal DNA was prepared by washing the cells isolated from a 500 ml culture by centrifugation (10,000 x g, 15 min) with phosphate buffered saline (PBS, 10 mM sodium phosphate, 150 mM NaCl, pH 7.4) and resuspending the pellet in 5 ml of NET buffer (0.15 M

NaCl, 0.08 M ethylene diamine tetraacetic acid (EDTA), 0.1 M Tris, pH 7.5) containing 10 mg/ml Proteinase K. After a 2 h incubation at 37°C, the cells were lysed with 1 ml of a detergent solution containing 1% sodium dodecyl sulfate (SDS), 1% Nonidet P-40, and 1% deoxycholate. The DNA was extracted with phenol until the interface between the organic and aqueous phases was clear. The DNA was then extracted once with phenol-chloroform. The

DNA was purified on a cesium chloride-ethidium bromide buoyant density gradient (213). 41

DNA bands were collected, ethidium bromide extracted, and salt removed as described previously (213).

The chromosomal DNA was partially digested with Sau3Al and fragments were separated by a sucrose gradient as described previously (213). One-to six-kilobase fragments were isolated and cloned into pISM2050 using standard recombinant DNA techniques.

Plasmid Constructions

Construction of M. capricolum promoter-trp'-lacZYA translational fusions

The -35 and -10 regions of the M. capricolum rrnA P2 promoter or the -35 and -10 regions of the E. coli rrnB PI promoter (87) were cloned into the ficoRI and BamHl sites of plasmid pISM1003 (133) to generate plasmids pISM2002 or pISM2003, respectively.

Plasmids pISM2005 and pISM2006 were constructed by inserting the 7.1-kb BarrMï fragment containing trp'-lacZYA from plasmid pDIA15 (41) downstream of the promoters in plasmids pISM2002 and pISM2003. Plasmids pISM2010 and pISM2009 are identical to plasmids pISM2005 and pISM2006, respectively, except that an additional 700-bp region upstream of the M. capricolum rrnB P2 promoter has been placed upstream of the promoters. Plasmid pISM2011 is identical to plasmid pISM2010 except that the M. capricolum promoter and rrnB

P2 upstream sequences are in the reverse orientation.

Construction of pISM2062 by using site-directed mutagenesis via the polymerase chain reaction (PCR)

The Smal and BamWl RE sites were placed into an lS25d arm of Tn^OO/ by using oligonucleodde-directed mutagenesis via PCR, generating plasmid pISM2048.5. The mutant oligonucleotide primer, 5' TTGTGTAAAAGTCCCGGGGATCCAAAAAGGCCATAT-3', and the T3 primer provided with the plasmid pKS" were used to synthesize a 1-kb fragment 42 flanked with HinàBl and BamVO. RE sites. The complementary mutant oligonucleotide primer,

5'-ATATGGCTTTTTGGATCCCCGGGACTTTTACACAA-3', and the T7 primer were used to synthesize a 300-bp fragment flanked with BamRl and Pst\ RE sites. The DNA fragments were generated with a Coy Tempcycler. One hundred nanograms of each primer was added to

50 ng of template (pISM2048) and the PGR was run using the following program: four cycles of 7 min denaturation at 94°C, 10 min cooling, 5 min annealing at 25°C and 4 min of polymerization at 72°C; twenty cycles of 90 s denaturation at 94°C, 90 s annealing at 48°C, and

2 min of polymerization at 72°C; and one cycle of 90 s denaturation at 94°C, 90 s annealing at

48°C and 7 min of polymerization at 72°C.

Construction of the promoter probe vector, pISM2050

Plasmid pISM2050 is a derivate of plasmid pISM1003 (133). Plasmid pISM1003 was digested with BamlQ. and the 3.1-kb BamHl fragment of plasmid pMC1871 (16) containing a promoterless lacZ gene was ligated into the site. In order to generate a unique BamHl RE site for cloning, the downstream BamHl site was removed by partial digestion with BamHl followed by a fill-in reaction with Klenow fragment of DNA polymerase I, ligation to circularize, and transformation into E. coli. Transformants were selected on ampicUlin- containing media, and the proper construct was confirmed by restriction enzyme analysis.

Plasmid pISM2050 was constructed with a gentamicin marker for selection in mycoplasmas, a promoterless lacZ reporter gene with unique upstream BamHl and Sma\ RE sites for cloning SûmSAI and blunt end fragments, respectively, and an ampicillin marker and origin of replication for amplification of DNA in E. coli prior to transformation into

Acholeplasma. The ampicillin gene and origin of replication also provided a region of homology to insert the plasmid into the Acholeplasma recipient strain ISM 1520 via homologous recombination (134). 43 Preparation of RNA and Measurement of mRNA Levels

Total RNA from a 5 to 10 ml overnight culture was prepared using RNA STAT-60

isolation reagent (guanidinium thiocyanate-phenol mixture) (Tel-Test "B", Inc., Friendswood,

Tex.) according to manufacturer's instructions . Messenger RNA levels were measured by slot

blot analysis using a Minifold II apparatus (Schleicher & Schuell, Keene, N.H.) and the

procedure described previously (213). Two micrograms of total RNA were placed into each

slot and transferred to nitrocellulose (Schleicher & Schuell) and probed with a 1.4-kb fragment

containing the 16S rRNA gene from ISM 1499 or a 3-kb fragment containing the lacZ gene.

The blot was exposed to X-ray film or was examined with a Phosphorlmager and analyzed

with the ImageQuant program (Molecular Dynamics, Sunnyvale, Calif.). Levels of the lacZ

mRNA were adjusted by normalizing to the 16S rRNA levels to account for differences in

amounts of RNA that may have been loaded in each slot for each strain.

P-galactosidase Assays

P-galactosidase assays were performed as described by Schleif and Wensink (217).

Briefly, 5 ml of an Acholeplasma culture was washed once with PBS and the pellet was resuspended in 2 ml of Z buffer (0.1 M sodium phosphate, pH 7.0; 0.001 M magnesium sulfate; 0.1 M 2-mercaptoethanol). Fifty microliters of 0.1% SDS were added to 1 ml of the cell suspension and vortexed for 15 sec. One hundred microliters of the lysed cell suspension were added to 1 ml of Z buffer and equilibrated to 37°C. In order to examine the P-gal activity of an unlysed cell preparation, 100 |al of the remaining cells suspended in Z buffer were added to another 1 ml of Z buffer and similarly equilibrated to 37°C. Two hundred microliters of a 4 mg/ml o-nitrophenyl-P-D-galactopyranoside (Sigma) solution were added. The reaction was stopped by adding 0.5 ml of 1 M sodium carbonate. The absorbance of the reaction was measured with a Spectronic 20 (Bausch & Lomb) at an absorbance of 420 nm. E. coli cultures were assayed similarly except that 100 |il of a 1 ml culture was used, and the cells were 44

permeabilized with 0.1% SDS and a couple of drops of chloroform. Fully induced E. coli strain %289 was used as a positive control.

Protein concentration was measured by using the Bio-Rad protein assay (Bio-Rad,

Richmond, Calif.) according to the manufacturer's directions. The number of colony forming

units (CPU) per milligram of protein was determined by dividing the number of CPU/ml by

mg/ml from the average of three cultures each measured in triplicate. The amount of P-gal

enzyme required to give an OD = 1.0 at an absorbance of 420 nm in one minute is 4.45 x 10^2

monomers (217). The levels of P-gal activity, therefore, was expressed as the number of

monomers per CPU as shown below. Cultures were assayed in triplicate.

Units of P-gal activity = A420 x 4.45 x 10^^ monomers time (min) x mg protein x CPU/mg

Immunoblot Analysis

Protein samples containing 25 jig protein from washed mycoplasmas were resuspended in

water and lysed with 0.01% (final concentration) SDS, SDS-PAGE sample buffer (116) was

added, the samples were boiled for 5 min and then separated on a 7.5% polyacrylamide

resolving gel. Following electrophoresis for 4 h at 25 mAmp constant current, proteins were

transferred to nitrocellulose following the procedure of Towbin (247). The blots were analyzed

using a 1:3,000 dilution of a monoclonal antibody to P-gal (Promega) followed by goat anti-

mouse antibody conjugated to alkaline phosphatase (Kirkegaard & Perry Laboratories, Inc.,

Gaithersburg, Md.) (1:1,000 dilution). The blot was developed by using the BCIP/NBT one component alkaline phosphatase substrate system (Kirkegaard & Perry Laboratories, Inc.). 45 DNA Sequencing

The mycoplasma chromosomal DNA driving the expression of the lacZ gene was

sequenced using the Sequenase Kit Version 2.0 (United States Biochemical) or was sequenced

by the Nucleic Acid Facility at Iowa State University. The sequencing primer was an

oligonucleotide that was 30 bases long (30-mer) (5'-GCTGGCGAAAGGGGGATGTGCTGC

AAGGCG-3') that is reverse and complimentary to the lacZ gene at approximately 50

nucleotides downstream of the /acZ-chromosomal DNA fusion point. The mycoplasma inserts

were sequenced by either isolating the insert from a gel or subcloning the fragment into pSP71,

because pKS also possessed lacZ sequences. The inserts isolated from a 0.6% Tris acetate

agarose gel were purified by GeneClean (San Diego, Calif.). The fragments were subcloned

into either the Clal or ClallHindSXL RE sites of pSP71. The plasmid pSP71 derivatives were

purified using Qiagen (Qiagen Inc., Chatsworth, Calif.) plasmid purification columns. Double-

stranded DNA was denatured in 0.2 M NaOH, 0.2 mM EDTA at 37°C for 30 min. Following

ethanol precipitation, the DNA was resuspended in 7 |J.I H2O. The sequencing reaction was

conducted as described by the manufacturer. Approximately 20 ng of the primer was used for

each sequencing reaction.

Primer Extension Analysis

The transcriptional start sites of the lacZ fusion constructs were determined by using primer extension following the protocol described elsewhere (4). Briefly, 10 jll total RNA

(containing 10 to 100 |ig RNA) were mixed with 1.5 |J,1 lOX hybridization buffer (1.5 M KCl,

0.1 M Tris, 0.01 M EDTA, pH 8.3) and 3.5 fil of primer end-labeled with [Y-32p]ATP. After 1 min at 90°C, the mixture was placed at 65°C for 90 min and then cooled slowly to room temperature. To each primer extension reaction a mixture containing 0.9 |il 1 M Tris (pH 8.0),

0.9 |il 0.5 MgCl2, 0.25 |ll 1 M dithiothreitol, 6.75 fll of 1 mg/ml actinomycin D, 1.33 )ll of 5 mM deoxynucleotide mix (all 4 deoxynucleotides), 20 |a,I H2O, and 0.2 |il of 25 U/|J.l avian 46

myeloblastosis virus (AMY) reverse transcriptase was added. After an 1 h incubation at 42°C,

RNase A was added to a final concentration of 15 |ig/ml and incubated for an additional 15 min

at 37°C. The DNA was resuspended in 3 to 5 |i.l of TE (0.01 M Tris, 0.001 M EDTA, pH 8.0)

buffer following ethanol precipitation. Three microliters of the primer extension product were

electrophoresed on an 8% acrylamide sequencing gel. As a reference, a sequencing reaction of

the upstream lacZ fusion region with the sequencing primer was loaded beside the primer

extension product The primer extension product was also compared to a sequencing ladder generated from pISM2083 using the sequencing primer.

Exo/Mung Deletion Analysis of the pISM2050.2 Insert

Plasmid pISM2050.2 was digested with Pstl and Smal restriction enzymes, and then subjected to Exonuclease HI and Mung Bean deletion analysis according to manufacturer's (Stratagene) instructions. Briefly, 20 ng of plasmid pISM2050.2 were first digested with Pstl then Smal. Following a 0 (no enzyme), 1, 2 or 3 min digestion with 20 U Exonuclease III/|J.g

DNA , the mixture was heated to 68°C and placed on dry ice. Fifteen units of Mung Bean nuclease were added to the mixture and incubated for 30 min at 30°C. Following a phenol- chloroform extraction, the deletion products were ligated and used to transform E. coli DH5a. 47 RESULTS

M, capricolum Promoter trp'-lacZYA Fusion Studies

Construction of lacZ translational fusions with the M. capricolum rrnA P2 promoter and P-gal activities

Initial studies were designed to explore the possibility of using the E. coli lacZ as a

reporter gene for studying genetic regulation in mycoplasmas. The study examined the ability

of a defined mycoplasma promoter to generate a translational fusion with the trp'-lacZYA

operon. Plasmids pISM2004 - 2006 and pISM2009 - 2011 were constructed and transformed

into Acholeplasma ISM1520 as described in the Materials and Methods. The resulting

Acholeplasma recombinants were analyzed for P-gal activity, and the results are shown in

Figure 1 A. The overall levels of p-gal activity in Acholeplasma were very low in comparison to

E. coli. The M. capricolum promoter was able to drive the expression of lacZ in both E. coli

and Acholeplasma ISM 1520. The M. capricolum promoter in the reverse orientation with

respect to lacZ (pISM2011), however, was not able to generate P-gal activity in either

Acholeplasma or E. coli. Slightiy higher levels of P-gal activity were generated in

Acholeplasma with the additional 700 bp region from the M. capricolum rrnB PI promoter

region in plasmid pISM2010 supporting an earlier observation that the region upstream of the

promoter influences transcriptional levels (87, 99).

Analysis of transcript levels

To examine the relative strengths of each promoter, transcript levels of Acholeplasma strains ISM2004, ISM2005, ISM2006, ISM2009, and ISM2010 were measured. Figure IB shows that the M. capricolum rrnA P2 promoter (ISM2005 and ISM2010) generated the

highest transcript levels of the lacZ gene in Acholeplasma. The transcript levels using Figure 1. Construction, message levels, and p-galactosidase activities of the trp'-lacZYA

fusion plasmids.(A) Construction of the trp'-lacZYA fusion plasmids and

definition of units of P-galactosidase activity are described in the Materials and

Methods. Single headed arrows show the direction of transcription. Double

headed arrow and hatched bar denotes the 700 base pair region upstream of the

M. capricolum rniB P2 promoter. Shaded boxes represent the trp'-lacZYA

operon (B). Slot blot analysis of the RNA levels from Acholeplasma ISM1499,

ISM 1520, ISM2004, ISM2005, ISM2006, ISM2009, and ISM2010 probed with

either 16S rRNA (left) or lacZ -specific (right) gene probe. The values shown on

the right hand side of the figure represent the counts in a defined volume after

subtracting background and adjusting for the relative amounts of total RNA

loaded into each slot. Levels of RNA used were adjusted by first normalizing the

relative amounts of RNA used in the rRNA slots then similarly adjusting the RNA

levels in the lacZ slots. Abbreviations: M. capricolum, M. cap', Ampicillin, Ap;

Gentamicin, Gm; and, origin of replication, ori. 49

trp'-lacZYA on Ap Gm p-Galactosidase Activity Plasmid Description E. coll ISIVI1520 -35 -10 2004 promoteriess 28 1

2005 M. cap rrnA P2 4,163 4

2006 E. coll rrnB PI 3,911 0

2009 [ E. coll rrnB PI 4,922 1

2010 [ M. cap rrnA P2 2,739 13

2011 E M. cap rrnA P2 2 0

M. cap rrnB

B rRNA lac

ISM1499 0

ISIVI1520 0

ISIVI20Q4 40,652 ISIVI2005 543,651

ISM2006 0

ISIVI2009 32,574

ISM2010 329,117

rRNA//ac 50

the E. coli promoter only (pISM2006) was negligible whereas the addition of the 700 bp M.

capricolum rrnB PI upstream sequences (1SM2009) did yield detectable, but low levels of the

lacZ transcript. Surprisingly, the E. coli consensus promoter was unable to drive expression of

lacZ in Acholeplasma despite close homology in the -10 and -35 sequences (67). Transcript

levels of ISM2004 were detectable and were probably due to read through from adjacent genes,

a common problem when using lacZ translational fusion vectors (221, 223).

Tn4001lac Promoter Probe Studies

Placement of unique Smal and BamHl RE sites in a 1S256 arm of Tn400I

In order to construct the Tn4001lac promoter probe transposon, unique RE sites were fust

placed into one of the IS2J6 arms o{Tn400J. The unique RE sites were then used as insertion

sites the lacZ gene. This was accomplished in several steps outlined in Figure 2. First, because

pKS" contains BamHl and Smal RE sites, these sites were removed, generating plasmid

pISM2046 Figure 2A). The Smal and BamHl RE sites were inserted 28 bases from the distal end of the IS25d arm by first cloning one IS256 arm into plasmid pISM2046 (Figure 2B) and then using PGR to create the desired mutation (Figure 2C). Because the inverted repeat region only spans the first 26 bp of the IS25(5 element (15), it was predicted that the transposase would recognize and bind to the modified inverted repeat normally (10,42).

In order to reduce the size of the Tn400J containing plasmid, and to have the mutated

Tn4001 eventually reside on a vector that does not possess the BamHl and Smal RE sites, the

5J-kh Pstl-Sall fragment containing Tn4001 was ligated into plasmid pISM2046, generating plasmid pISM2061 (Fig 2D). Subsequent analyses of transformation frequencies using the various Tn400J derivatives generated in this study were compared to the frequency obtained using plasmid pISM2061. The plasmids carrying the transposon derivatives cannot replicate Figure 2. Placement of unique BamHl and Sma\ RE sites in an IS256 arm of transposon

Tn4001 (A) Removal of BaniHl and Smal RE sites from plasmid pKS" by

digestion with Xbal and Smal followed by filling in with Klenow fragment of

DNA polymerase I and ligation to circularize, generating plasmid pISM2046. (B)

Insertion of the 1.3-kb Pstl-HindUl fragment from plasmid pISMlOOl containing

IS2J6 into plasmid pISM2046. A 1.3 kb fragment from a Pstl and HindlU digest

of plasmid pISMlOOl was isolated from a 0.6% agarose gel, purified using

Geneclean, and ligated into plasmid plSM2046, generating plasmid pISM2048.

(*) indicates that only the inserts of plasmids pISM2048 and plSM2048.5 are

shown. (C) The Smal and BamHl RE sites were placed into IS256 using

oligonucleotide-directed mutagenesis via PGR, generating plasmid pISM2048.5.

(D) The 5.7 kb Pstl-Sad fragment containing Tn400J was ligated into plasmid

pISM2046, generating plasmid pISM2061. (E) The mutant IS256 arm was used

to replace the wild type arm. The 1.3-kb Pstl-Hindlll fragment from plasmid

pISM2048.5 was inserted into plSM2061, generating plasmid plSM2062

(Tn4007mod). The double headed arrow spans the region encompassing Tn4001. 52

MCS of pKS- Smal PbtiE BamHI \ I EcoRI Hindm T7 priiDor NotI Xbal TAATACGACTCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTCT Smal BamHI FMI EcoRI Hindm AGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACC Sail Epnl T3 primer GTCGTCGACGACCTCGAGGGGGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTG AGGGTTAATT pISMlOOl 13.5 kb (A)

MCS of pISM2046 Hindm ;ciai T7 primer NotI Clal TAATACGACTCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTGG FMI EooRI Hindm SaU San GCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGTCGACGACCTCGAGGG Epnl T3 primer GGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATT

NoU FMI pISM2048* Ban NotI FMI Hindm I Kpnl IS2S6 indm T7 primer TSprimor pISM2061 8.7 kb Gm pISM2048.5* San NotI %tl Smal BamHI Hindm I Kpnl X—^ T7 primer T3 primer

Mu Smal NotI I I BamHI

Hindm

pISM2062 8.7 kb 53

in mycoplasmas. Thus, the selectable phenotype was generated by transposition of the

transposon from the plasmid to the chromosome following transformation.

The mutated 18256 arm was used to replace the wild type arm to generate Tn^OO/mod on

plasmid pISM2062 (Figure 2E). The mutation was confirmed by sequence analysis. The

transformation frequency of plasmid pISM2062 was similar to that of plasmid pISM2061 in

Acholeplasma ISM 1499 (Table 2). This suggested that the inverted repeat functions have not

been altered by the mutation.

Removal of the translational stop codons and the construction of Tn400Ilac

The 3.1-kb promoterless lacZ gene from pMC1871(16) was cloned into the BamHl site of plasmid pISM2062 to generate transposon Tn4001.2062lac (Figure 3). Although this construct transformed Acholeplasma ISM 1499, blue colonies did not appear on X-gal containing media. The lack of P-gal activity was expected because the 18256 sequence (15) shows that there are translational stop codons in all three reading frames contained within the inverted repeat (shown in bold letters in Figure 3). Thus, translation originating from adjacent mycoplasma chromosomal sequences would be terminated prior to lacZ.

To overcome premature translation termination, the translational stop codons were altered by inserting a pair of synthesized complimentary oligonucleotides that replaced the wild type

18256 inverted repeat region with an inverted repeat region possessing altered stop codons

(Figure 3). The mutant adapter was designed to alter two or three of the stop codons. The mutant adapter was ligated into plasmid pI8M2062 (Figure 3A) following Pstl and BamHl digestions to generate transposons Tn4001.2062.2 (two stop codons altered) and

Tx\4001.2062.3 (all three stop codons altered). This resulted in the loss of 300 bp of unnecessary plasmid DNA between the Pstl site of the cloning vector and the end of the IS256 arm. Alteration of the stop codons was confirmed by sequence analysis (data not shown). 54

Table 2. Transformation frequencies oiTn400I derivatives in Acholeplasma

Plasmid Tn400I Derivative Tfa % Blue'^

pISM2061 wild type 2.0 X 10-6 [1.3] 0 (0/2,796) pISM2062 TrAOOI mod 2.2 X 10-6 [1.3] 0 (0/2,963) pISM2062 lac 2062 lac 4.0 X 10-7 [2,3] 0 (0/599) pISM2062.2 2062.2 2.4 X 10-6 [1,3] 0 (0/573) pISM2062.3 2062.3 6.0 X 10-7 [1,4] 0 (0/573) pISM2062.2 lac 2062.2 lac 7.1 X 10-7 [2,3] 7.7 (575/7,510) pISM2062.2 lac{xQ\) 2062.2 /ac(rev) 9.6 X 10-7 [2,3] 0 (0/1,572) pISM2062.3 lac 2062.3 lac 1.0 X 10-7 [2,4] 4.1 (6/146) pISM2062.3 tac{xQv) 2062.3 laciiev) 1.2 X 10-8 [2,4] 0 (0/10) PISM2065 2065 2.5 X 10-8 [2,4] 8.8 (27/307)

^ Tf = transformation frequency. The values represent the average of at least three

experiments. Transformation frequencies were defined as the number of Gm-resistant

transformants divided by the number of viable cells used in the transformation mixture. The

data were analyzed by the Student t test to ascertain the effects of plasmid size, transposon size,

and alteration of the inverted repeat sequence (stop codons) on transformation frequency. The

standard error of the means = 1.89 x 10'^. Significance group differences are indicated by [].

Plasmid size had a significant effect on transformation frequency; group 1 is significantly

different from group 2 (f<0.002). Alteration of the third stop codon also had a significant

effect on transformation frequency; group 3 is significantly different from group 4 (f <0.001).

There were no significant differences for the effect of transposon size or alteration of the first

two stop codons.

b Numbers in parentheses indicate the total number of blue colonies divided by the total

number of white colonies. Transposons Tn4001.2062.2 and Tn4001.2062.3 were introduced into Acholeplasma

ISM1499, and the frequencies of transformation (Table 2) indicated that both functioned in

Acholeplasma. The frequency of transformation of plasmid pISM2062.3 carrying transposon

Tn400].2062.3 was reduced by 4-fold.

The Tn4001lac promoter probe transposon was constructed by cloning the 3.1-kb

promoterless lacZ gene from plasmid pMC1871 into transposons Tn4001.2062.2 and

Tn4001.2062.3 to generate the corresponding Tn4001.2062.2lac and "1x14001.2062.3lac

transposon derivatives. In addition, the lacZ was cloned in the reverse orientation to generate

transposons Tn40012062.2lacircv) and Tn4001.2062.3lac{xe.v). All of these Tn4001lac

derivatives were able to transform Acholeplasma (Table 2). The transformation frequencies of

plasmids pISM2062,2/ac and pISM2062.2/ac(rev) were 2- to 3-fold lower than that of the

control plasmid, pISM2061. The transformation frequencies of plasmids pISM2062.3/ac and

pISM2062.3/ac(rev) were 20- to 150-fold lower than pISM2061. Analysis of variance using

the Student's t test showed a significant {P< 0.002) effect of increasing the plasmid size (by the

addition of the 3.1-kb lacZ fragment) on transformation frequency. Alteration of the codon

nearest to the BamYil site in the IS256 inverted repeat also significantly (f<0.001) affected transformation frequency. There was no a significant difference for the effect of alteration of the first two stop codons on transformation frequency. It should be noted that pMBl-based plasmids do not replicate in mycoplasmas and only the transposition event can be observed.

These experiments were unable to distinguish between the uptake of plasmid DNA

(transformation) and transposition of Tn400/ into the chromosome. Thus, the combination of these two events are reported as transformation frequency in Table 2. Figure 3. Removal of the translational stop codons from the inverted repeat of an IS256 element and construction of

Tn4001lac. (A) Plasmid pISM2062 was digested with Pstl and BamHl to liberate the inverted repeat of IS256

and 300 bp of intervening plasmid sequences. Relevant sequences are shown adjacent to the corresponding

plasmid map. Bold letters indicate translational stop codons in IS256. Base changes are indicated by outlined

letters. (B) Complimentary oligonucleotides were annealed by mixing at equal molar ratios, heating to 70°C for

3 min, and slowly cooling to room temperature. The mutant oligonucleotide adapter was then ligated into the

Pstl and BamiQ. sites of plasmid pISM2062, generating plasmids pISM2062.2 (two stop codons altered) and

pISM2062.3 (three stop codons altered). (*) indicates that a 50/50 mixture of that base was used during

synthesis of the oligonucleotides. (C) The 3.1-kb BamHl fragment containing the promoterless lacZ from

plasmid pMC1871 was ligated into the BamHl sites of plasmids pISM2062.2 and pISM2062.3 generating

plasmids pISM2062.2 lac and pISM2062.3 lac, respectively. Psa Smal

pKS IS256 pISM2062 Sad NotI PkS SmalBamHI 8.7 kb j I Gm GGAGCTCCACCGCGGTGGCGGCCGCTCTAGGGGCTGCAG /3Q0{;_/GAI»AAGTCCGTA'MUlTTGTGiaXAAGTCCCGGGGATCC CCTCGAGGTGGCGCCACCGCCGGCGAGATCCCCGACGTC CT*ITTCAGGCATATTAACAC*ITriCAGGGCCCCTAGG

GGAT®*AGTCCGTATSATTGTGI**AAGTCCCGGG FM Smal ACGTCCTASITCAGGCATASIAACACATTTTCAGGGCCCCTAG

pKS IS256 U\ pISM2062.2/3 \ NotI @ Smal BamBI ori % 8.4 kb / I Gm GGAGCTCCACCGCGGTGGCGGCCGCTCTAGGGGCTGCAGGATeAAGTCCGTAT2àTTGTGT*»AAGTCCCGGGGATCC CCTCGAGGTGGCGCCACCGCCGGCGAGATCCCCGACGTCCTASTTCAGGCATAaTAACACATTTTCAGGGCCCCTAGG €

Ad Smal Notl

p-UicZ

pISM2062.2/3 lae 58 Analysis of mycoplasmal Lac fusions The testing of the Tn4001 constructs and the analysis of p-gal activity was performed

initially with Acholeplasma ISM 1499. Expression of [3-gal activity was observed with

transposons Tn4001.2062.2lac and Tn4001.2062.3lac at a frequency of 8 and 4 percent of the

Acholeplasma transformants, respectively (Table 2). Intensity of blue color on X-gal

containing media (data not shown) and |3-gal assays with this species showed that the

transposon had inserted downstream of promoters of varying strengths. Levels of |3-gal

activity of three independentTn4001.2062.2lac Acholeplasma transformants were 129, 276, and 1,020 units and levels of |3-gal activity of three Tn4001.2062.3lac transformants were 89,

297, and 790 units. The level of p-gal activity measured with each transformant was very reproducible varying less than 5% between cultures and experiments. Expression of P-gal activity was not observed in constructs in which lacZ was placed in the reverse orientation

(Table 2).

To examine the versatility of the Tn4001lac derivative Tn4001.2062.2lac, M. gallisepticum was transformed with plasmid pISM2062.2/flc and the transformants plated on

X-gal-containing media. Approximately 3% of the transformants appeared to be Lac+ based on blue colony formation on X-gal-containing media. Levels of p-gal activity of four independent transformants giving blue colonies were 37,44, 52, and 102 units. The level of P-gal activity of the white colonies was less than 1 unit.

Construction and use of the Tn400Ilac rescue transposons

Transposons Tn4001.2064 and Tn4001.2065 are derivatives of Tn4001.2062.2 and

Tn4001.2062.3, respectively, containing plasmid pISM205 within the \S256 arm of Tn400/.

Plasmid pISM205 is a 6-kb plasmid that was generated by cloning the 3.1-kb lacZ fragment from plasmid pMC1871 into plasmid pKS (Figure 4A). The BamHl site downstream of lacZ Figure 4. Construction of promoter probe transposons designed to rescue adjacent

chromosomal sequences. (A) Plasmid pISM2065 is a derivative of pISM2062.3,

containing plasmid pISM205 within the IS256 arm of Tn¥00/. Plasmid

pISM2065 was constructed by digesting plasmid pISM2062.3 with PvuU,

isolation of the 5.7-kb fragment, circularization with T4 DNA ligase, digestion

with BamHl, and ligating with BamHl digested plasmid pISM205. (B) The

rescue system permits the recovery of adjacent chromosomal DNA by first

digesting the chromosomal DNA with a unique enzyme in the multiple cloning

site (e. g., Pstl), followed by ligation and transformation in to E. coli. 60

Hindlll Pstl Smal Pvun \ / BamHI Smal ^ Hindni

pISM205 p- lacZ PISM2062.3 ) 1 Gm aoub J &4kb I

HIndlU

PvuII SaU p- lacZ Hindi!

pISM2065 lamlfl 11.7 kb

on Hindi! Kpn! BamHI pig'ndni

(B) 2065

Smal BamHI Xhol HlndUI Clal EooR! Kpnl ^ /Pstt HindUI HindUI

chr. Ap on Gm chr. T?-lacZ

Smal BamHI

chr. ori p- lacZ 61

transcription was removed by partial digestion, fill-in, and ligation. Plasmids plSM2064 and

pISM2065 were constructed by digesting plasmids pISM2062.2 and pISM2062.3,

respectively, with PvuU, isolation of the 5.7-kb fragment, circularization with T4 DNA ligase,

digestion with BamHl and ligating with the 5awHI-digested plasmid pISM205. Orientation of

the fragments in the resulting recombinant plasmid was confirmed by RE analysis, and the

function of these transposons was confirmed by transformation into Acholeplasma. Plasmid

pISM2065 transformed ISM 1499 equally as well as plSM2062.3/ûc and pISM2062.3/flc(rev).

An analysis of variance for the effect of transposon size on transformation frequency showed the effect was not significant. Plasmid pISM2064 failed to transform ISM1499 despite confirmation by RE analysis that it was constructed properly.

A transposon rescue system was developed, similar to the Tn917lac rescue system (267), as a means of recovering mycoplasma chromosomal sequences containing promoters (Figure

4). The resulting Tn4001lac derivative, Tn4001.2065, possesses within one of its IS256 arms a plasmid capable of replication and selection in E. coli as well as the promoterless lacZ. Thus, mycoplasma chromosomal sequences that were able to drive P-gal expression can be recovered and cloned in E. coli as illustrated in Figure 4B. The rescued fragment can be sequenced directly by using the T3 or reverse primer that recognizes corresponding sequences within pKS. To test the functionality of this system, chromosomal DNA was obtained from different pISM2065 transformants, digested with PstI, diluted, ligated, and then transformed into E. coli. Recombinant plasmids obtained from these experiments contained chromosomal DNA sequences that drive P-gal expression in both Acholeplasma and E. coli. The transformation frequency by using pISM2065, however, was 2 logs lower than that of using the plasmid containing the wild type transposon. 62 Plasmid pISIVI2050 Promoter Probe Vector Studies

lacZ fusion library construction and analysis

Because of the relatively low levels of |3-gal activity resulting from the translational fusion

system described above, a transcriptional lacZ fusion system (16) was examined. This system

required that the DNA upstream of the truncated lacZ gene possess the translational start elements as well as the promoter to generate a p-gal fusion protein. Acholeplasma ISM 1499 chromosomal DNA and vector pISM2050 (Figure 5) were digested with Sau3Al or BamHl, respectively, ligated together, and the ligation mixtures were transformed into E. coli DH5a.

Approximately 20% of the E. coli transformants demonstrated the blue phenotype. Analysis of plasmid preparations from both blue and white colonies showed that all of the blue colonies contained mycoplasmal chromosomal DNA inserts while only 20-30% of the white colonies had plasmids with inserts. As a result, only plasmids from blue colonies were used for further study. Pools of plasmid DNA from five independent colonies were transformed into

Acholeplasma IS M1520 where integration of the plasmid occurred within plasmid sequences previously introduced into the chromosome (132). If mycoplasma transformants from these plasmid pools demonstrated P-gal activity based on blue colony formation on X-gal-containing media, individual plasmids were used to transform ISM 1520. Only 13 of 140 plasmid preparations giving promoter activity in E. coli were also positive for p-gal activity in

Acholeplasma.

The thirteen lacZ fusion constructs that demonstrated P-gal activity in ISM 1520 were also used to transform ISM 1499 (Table 3). In this experiment, the region of homology for integration of the plasmid into the chromosome was the cloned chromosomal fragment. Only 9 of the 13 fusions were able to transform ISM 1499. Constructs were confirmed by DNA-DNA hybridization analysis (data not shown). The lac fusion constructs were transformed into E. coli CSH50, a A{lac-pro) genotype, to simplify the interpretation of the P-gal assay data. 63

PttI EooRI BamHl BamHl Smal ItmHI Clal EcoRV

pISMIOOS Gm p- lacZ 5.5 kb orl orl

Hlndlll

:C0RI BamHl Tc BamHl

EcoRV Smal Hlndlll. BamHl ^Clal EcoRV Gm p- lacZ plSM2050

Hlndlll 8.55 kb Clal Kpnl orl EcoRI BamHl

Figure 5. Construction of the promoter probe vector, pISM2050. The vector was constructed

by ligating a 3.1-kb BamHl fragment containing the promoterless lacZ from plasmid

pMC1871 into ihtBamVil site of plasmid pISMI003. The arrow indicates the

direction of transcription of lacZ. The asterisk denotes the BamWl site that was

inactivated. Abbreviations: Promoterless lacZ, p- lacZ\ Ampicillin, Ap; Gentainicin,

Gm; Tetracycline, Tc; and origin of replication, ori. 64

Table 3. Insert size^ and P-gal activity^ of lacZ fusion constructs in Acholeplasma and E. coli

Strain Insert Plasmid Size (kb) ISM1520 ISM 1499 CSH50 NA 1 NA 1 pISM2050 2.8 17 12 493 pISM2050.1 0.9 1,428 ND 4,262 pISM2050.2 1.0 48 ND 2,365 pISM2050.8 0.9 48 30 76 pISM2050.18 1.5 375 167 4,112 pISM2050.19 0.8 211 188 676 pISM2050.25 1.0 172 196 3,188 pISM2050.39 1.7 37 70 688 pISM2050.40 2.0 35 158 434 pISM2050.66 2.5 131 53 941 pISM2050.69 2.3 186 138 4,083 pISM2050.70 2.2 39 ND 1,199 pISM2050.86 1.0 73 ND 24 pISM2050.89

Strain^

CSH50 NA NA NA 1

%289 NA NA NA 5,382

^ NA = Not applicable

^ ND = Not done

'•^E. coli strains CSH50 and %289 were fully induced with isopropyl P-D- thiogalactopyranoside. 65 Quantitation of Lac activity

Acholeplasma transformants containing lacZ fusions gave colonies of varying blue

intensity on X-gal-containing media. Figure 6 shows a mixture of strains ISM2050.1 (very

weak P-gal activity), ISM2050.2 (strong P-gal activity), and ISM2050 (vector only, no P-gal

activity), p-gal assays were performed on the lacZ fusion constructs that were introduced into

ISM 1520, IS M1499, and CSH50 (Table 3). The results showed that levels of p-gal production

varied by 100-fold between the various lacZ fusion constructs in Acholeplasma. Levels of p-

gal activity generated by integration of the lacZ fusions in either ISM1520 and ISM 1499 were

similar except with pISM2050.66 and pISM2050.69. Recombinants demonstrating high levels

of P-gal activity in Acholeplasma did not always generate high levels of activity in E. colL In

addition, pISM2050.89 generated more p-gal activity in Acholeplasma than in E. coli. Levels

of p-gal activity of whole cells when the SDS lysis step was omitted were also examined with

Acholeplasma strains ISM2050, ISM2050.2, ISM2050.25, and ISM2050.70. Their levels of

P-gal activity were 3, 68, 19, and 27 units, respectively. The cell-free, ISM 1499 cell, and

ISM 1520 cell controls in all experiments failed to generate any measurable p-gal activity.

Levels of the lacZ fusion transcripts were also measured for the ISM 1520 strains harboring the lacZ fusion plasmids (Figure 7). These results correlated with the results of the

P-gal assays in that strains demonstrating higher transcript levels generally had higher levels of p-gal activity. There were inconsistencies between p-gal and lacZ fusion transcript levels observed in Acholeplasma strains ISM2050.18, ISM2050.66, and ISM2050.69. These strains demonstrated higher transcript levels than the levels of P-gal assay would have predicted.

Immunoblot analysis was performed on several rtcombmani Acholeplasma strains to demonstrate the production of a P-gal fusion protein (Figure 8). Acholeplasma ISM 1520 strains with high levels of P-gal activity reacted more strongly with the anti-P-gal monoclonal antibody supporting the results of the p-gal assay. 66

Figure 6. Acholeplasma ISM 1520 transfonnants. Appearance of Acholeplasma ISM 1520

transformant colonies grown on mycoplasma media containing 80 |J.g per ml 5-

bromo-4-chloro-3-indolyl-P-D-galactoside (X-gal). Colonies with large dark centers

(i.e., blue color) are ISM2050.2, smaller dark centers, 1SM2050.1, and lightest

center are ISM2050 (vector only). Figure 7. Quantitation of lacZ transcript levels of the lacZ fusion vectors in Acholeplasma

ISM 1520. Slot blot analysis of the rnRNA levels from Acholeplasma ISM 1499,

IS M1520, ISM2050, ISM2050.1, ISM2050.2, ISM2050.8, ISM2050.18,

ISM2050.19, ISM2050.25, ISM2050.39, ISM2050.40, ISM2050.66,

ISM2050.69, ISM2050.70, ISM2050.86, and ISM2050.89 probed with either

16S rRNA (left) or lacZ -specific (right) gene probe. Plasmid pSP71 was

included as a negative control. The 3.1-kb DNA fragment containing lacZ or the

1.4-kb fragment containing the 16S rRNA gene were used as positive controls.

The values shown represent the counts in a defined volume after adjusting for the

relative amounts of total RNA loaded into each slot as described in Figure 1. 68

Strain 16S lacZ Counts/vol. 1499 66,517 1520 112,580 2050 77,006 2050.1 387,036 2050.2 1,941,175 2050.8 246,890 2050.18 595,954 2050.19 52,873 2050.25 661,166 2050.39 947,472 2050.40 66,904 2050.66 540,979 2050.69 803,629 2050.70 1,054,501 2050.86 312,903 2050.89 476,371 pSP71 ^es/lacz 69

AB CDEFGH I J

.Vwrwmwl

Figure 8. Immunoblot analysis of the lacZ fusions in Acholeplasma. Proteins were detected

with a monoclonal antibody to P-galactosidase. Lanes: A, ISM2050; B, ISM2050.70;

C, ISM2050.69; D, ISM2050.40: E, ISM2050.39; F, ISM2050.25; G,

ISM2050.19; H, ISM2050.2,1, ISM2050.1; and J, %289, fully induced with

isopropylthio- p-D-galactoside. 70

Analysis of Acholeplasma ISM1499 Promoters

Mapping of Acholeplasma IS M1499 promoters by primer extension

The transcriptional start sites for the promoters driving the expression of the lacZ in the fusion plasmids pISM2050.1, pISM2050.2, pISM2050.8, pISM2050.18, pISM2050.25, pISM2050.69, and pISM2050.70 were mapped by primer extension. The quality of the RNA was examined by first running 5 to 10 |ig of RNA in a 1.2% agarose gel containing formaldehyde and then staining the gel with acridine orange. If the bands corresponding to the

23S rRNA, 16S rRNA and tRNA were sharp the RNA was considered to be free from degradation by nucleases and was used for the primer extension reaction. RNA-DNA hybridization analysis, using the 16S rRNA as a probe, was also performed to confirm that the

16S rRNA band was not smeared.

Initial experiments were conducted with a primer that was 21 bp in length that was reverse and complimentary to a region approximately 45 bp upstream of the lacZ fusion point. The Tm of the oligonucleotide was determined to be 38.5°C. As a result, initial reactions gave the appearance of false-priming due to the appearance of many primer extension products. An oligonucleotide of 30 bp (30-mer) was then constructed that has a Tm of 85°C to reduce the amount of primer extension products. The use of this 30-mer did reduce the number of background bands detected in the reaction. It should be noted that the appearance of false- priming could be observed if the unbound 32p was not first removed by precipitating the primer 3 times with ethanol.

Preliminary studies showed that the primer extension product signals were weak for aU reactions excepts for those involving ISM2050.2. Because ISM2050.2 generated the highest level of lacZ fusion transcript (Figure 7), it was reasoned that the primer extension signal could be increased by increasing the amount of target transcript. Thus, the effects of increasing the total RNA up to 100 |j,g per reaction was examined. Reactions that used more than 50 |ig of 71

total RNA either did not generated any bands or yielded high levels of background as

demonstrated by the appearance of many distinct bands. The reactions that failed to generate

any primer extension products were probably due to the inability to completely resuspend 100

|ig of RNA in 10 p,l of H2O. Thirty to fifty micrograms of total RNA were found to be optimal

for the reaction.

The transcriptional start site for the promoter driving the expression of lacZ in

pISM2050.8 is shown in Figure 9. Each primer extension product was run adjacent to a

sequencing ladder generated by using the sequencing primer with plasmid pISM2083

(containing the insert of pISM2050.2 and the adjacent 800 bp of the lacZ ). The transcriptional start site was determined by first counting the number of bases between the lacZ fusion point on the ladder to the primer extension product. The number of bases was then compared to the sequence of the pISM2050.8 insert-/acZ fusion region. All promoters were mapped in this manner except for the promoter contained within the pISM2050.2 insert. This promoter was mapped by directly comparing the primer extension product with the pISM2050.2 insert-/acZ fusion sequence contained in pISM2083.

Exo/Mung deletion analysis of plasmid pISM2050.2

Plasmid pISM2050.2, which has a 900-bp chromosomal DNA fragment from ISM 1499, was shown to generate high levels of P-gal activity when introduced into Acholeplasma

ISM1520 (Table 3). Exo/Mung deletion analysis was performed on plasmid pISM2050.2 to determine the minimum upstream region required to drive the expression of lacZ. Following exonuclease HI and Mung Bean nuclease digestion, the products were ligated and used to transform E. coli DH5a. Both blue and white colonies were obtained from the 3 min

Exonuclease III reaction mixture. Five blue and five white colonies were selected and plasmid

DNAs prepared. Restriction enzyme analysis showed that the blue colonies possessed plasmids that were larger than those from the white colonies. Plasmid DNA was prepared with five of 72

G A T C 1

Figure 9. Primer extension analysis of the transcriptional start site of the lacZ fusion transcript

of ISM2050.8 . The primer extension product (indicated by the arrow) was run

against a sequencing ladder generated widi pISM2083. Lanes G = guanine, A =

adenine, T = thymine, C = cytosine, and 1 = the primer extension product from

ISM2050.8. 73

these clones and the DNA was used to transform ISM1520. Acholeplasma ISM1520 transformed with piasmid pISM2075 demonstrated no |5-gal activity by either a blue phenotype

on X-gal-containing media or by P-gal assay. Transformants possessing the other plasmids

demonstrated blue colony formation on X-gal containing media and p-gal assay. The levels of

P-gal activity of these transformants ranged from 861 to 1,080 units. All of the plasmids in the

transformants generating the Lac+ phenotype mapped to within 100 bp of each other (Figure

10). The deletion of the Lac" transformant included the entire 900-bp insert as well as part of

the lacZ. The mutation endpoints were mapped by sequence analysis. The sequence

downstream of the mutation endpoints represent the insert DNA remaining following the

Exonuclease IE/ Mung Bean digestions. The transformants generated by using the deletion

plasmids from the 0, 1, and 2 min Exonuclease IH digestions all gave the Lac+ phenotype on

X-gal-containing media.

Preliminary determination of an Acholeplasma ISM1499 consensus promoter sequence

The transcriptional start sites and upstream regions the lacZ fusion transcripts for seven of the ISM2050 derivatives are shown in Table 4. The upstream regions were aligned at the putative sequences encompassing the -10 and -35 promoter regions. The regions were defined based on their similarity to the E. coli consensus promoter (84). A consensus promoter sequence was derived based upon the frequency with which a particular base appeared in the same position in the -10 and -35 regions. Also shown in Table 4 are the putative -10 and -35 regions reported for the M. pnuemoniae PI operon (95), M. capricolum rniA P2, rniBl (160) and the E. coli consensus promoters. The average number of bases that align between the

IS M1499 promoter regions and the E. coli consensus promoter regions are 4.4 bp for the -10 region and 3 bp for the -35 region. Moreover, the spatial relationships between the 74

pISM2077 pISM2080 pISM2079

AAGTCTTGGATGAAGTCTTAAAGCACCACCGATACTCATACCTGAATTAATCCC

pISM2076

ATATTTTCTTGCTTTATAACTTGCAGTTGATATAACACCTCTTGCATATGAGGATT

GTCCTCCAACAACAAAAACCTTGTTTTTAAGGTAAGGTTCTTTAAGTATCGCGCA

TGTTGCAAAGAACGCATTTAAGTCGATATGAAAAATAATnTAGCCGTmTTTC

-35 -10 * ATCATTATCTTCCTTTAATrACTATTATATAGTATAATATAAAAAGTATAAGATTA

RBS start TTTGGAGTGATAAGATGGCACAAAATAAGACAGCAACAAAAGAAAAGGCAGTA

SauSAd AAGCCTGCTAAAAAAGAATCTTTAGTATTTAAAGATCCCGTCGTTTTACCAAC

pISM2075

GTCGTGACTGGGAAAACCCTGGCGTTAGGCA

Figure 10. Exo/Mung deletion analysis of the ISM1499 chromosomal DNA region of

ISM2050.2. Arrows indicate the point where deletion ends. The sequence to the

right of the arrows represent the downstream region remaining. The bases to the left

of the arrows have been deleted for each plasmid. The putative -35 and -10 regions

of the promoter, ribosomal binding site, translational start site, chromosomal DNA

-lacZ fusion point {Sau3Al site) are underlined. An asterisk indicates the

translational start site. The lacZ region is denoted in bold. 75

Table 4. Alignment and determination of the putative -10 and -35 promoter regions of the

promoters driving the expression of lacZ in the plasmid pISM2050 derivatives

Source of Promoter -35 -10

pISM2050.ia TCACTGCACC--TGAAGAACTACATAAATATAAACTTGAAGAA

pISM2050.2 TATrTTCCTT-TAATTACTATTATATAGTATAATATAAAAAGT

pISM2050.8 ACTTACGCTACAATCTAAAACCCAAATTGGTCAAGTACATGCTGA

pISM2050.18 AGAATTCATGCTTAAATCACCTTTATATTTAAATAATCCATCA

pISM2050.25 ATTGTTGATGTATTCATACATGATATAATATATACGCGAAAGT

PISM2050.69 TTAGTAATAGATCCCGTTTACACTCATGATATAATATAGTAGGG

pISM2050.70 TGGGTTCGATTGATAATGAATTTACAAGATATTTAGGACATAAC

Consensus^ TtcAtn 16 to 18 bp TATAaW 6 to 8 bp

M. pneumoniae TTGCTG 10 bp TAAACT 5 or 6 bp PI operonC M. capricolum TTGAAA 17 bp TATACT 7 or 8 bp rrnA P2^ M. capricolum TTAAAA 18 bp TAGAAT 7 or 8 bp rrnBl'^ E. coii TTGACW 16 to 18 bp TAtAaT 6 to 8 bp consensus®

^The sequences of the upstream regions of lacZ fusion constructs are aligned to the

putative -10 and -35 regions based on their similarity to the consensus E. coli promoter

sequence. Bold letters indicate transcriptional start sites. A = adenine, C = cytosine, G =

guanine, and T = thymine.

''Consensus sequence of the promoters driving the expression of lacZ in the pISM2050 fusion derivatives. Upper case letters in the consensus sequence denote that at least 5 of the 7 sequences contained that base in that position. Lower case letters indicate that at least 3 of the 7 sequences contained that base in that position. W = A or T, n = any base. 76

Table 4. (continued)

"-The sequence for the M. pneumoniae PI operon promoter was reported by Inamine et ai. (95).

•^The sequences for the M. capricolum mi A P2 and irnBl promoters were reported by

Muto et al. (160).

®The sequence for the E. coli consensus promoter was reported Hawley and McClure (84).

transcriptional start and the -10 region as well as between the -10 region and the -35 region

were similar to the E. coli consensus promoter.

The acholeplasma consensus -10 and -35 promoter regions were also similar to the M.

pneumoniae PI, M. capricolum rniA P2 and rrnBl promoters. The distance between the -35 and -10 regions of the M. pneumoniae PI promoter was least 6 bp less than the acholeplasma promoters. 77 DISCUSSION

The ability to examine gene regulation of mycoplasmas has been hampered by the lack of a

suitable genetic system to adequately assess the influence of their gene regulatory elements (67,

170). Because of the alternative codon usage (94, 265) and the potential differences between

regulatory proteins of mycoplasmas and other bacterial cloning hosts, it is important that

mycoplasma gene regulation be studied in its natural host. This laboratory has shown that the

transposon Tn4001 will transpose from suicide delivery vectors to the chromosome of

mycoplasmas (133). In addition, a plasmid-based cloning system which relies on the ability to

introduce foreign DNA into the chromosome via homologous recombination with plasmid

sequences previously introduced into the chromosome was developed in this laboratory (132,

134). Thus, the aims of the studies reported in this dissertation were to expand the

mycoplasmal cloning systems developed in this laboratory to include a useful reporter gene for

the examination of mycoplasma gene regulatory elements in vivo. Once the promoter probe vectors were developed, their ability to locate mycoplasma promoters was examined.

M. capricolum Promoter trp'-lacZYA Fusion Studies

Because the E. coli lacZ gene has been shown to be an effective reporter gene in other heterologous bacterial backgrounds (9, 113,229,268), initial studies were designed to examine whether lacZ could also be used as a reporter gene in mycoplasmas using defined promoters to drive the expression of a trp'-lacZ operon fusion. The generation of high levels of

P-gal in E. coli using the M. capricolum rrnA P2 promoter showed that the E. coli RNA polymerase recognized M. capricolum promoter sequences. In contrast, the E. coli rniB PI promoter was not recognized by the Acholeplasma RNA polymerase as evidenced by the lack of mRNA produced (Figure IB). Although the -35 and -10 regions of these promoters were 78

similar (67, 87), the Acholeplasma RNA polymerase was more stringent supporting previous

studies using in vitro transcription assays (87).

Low levels of P-gal activity in Acholeplasma were observed using the M. capricolum

promoter in a trp'-lacZ operon fusion (Figure 1 A). This could be accounted for, in part, by the

single copy insertion into the chromosome or by poor recognition of the M. capricolum

promoter by the Acholeplasma RNA polymerase. A more likely explanation, however, is that

the translation initiation region of the E. coli trp gene promoter was not efficiently recognized in

Acholeplasma. The trp'-lacZ mRNA transcript levels in ISM2005 and ISM2010 are relatively high (Figure IB) despite the low levels of P-gal being produced (Figure I A). 16S rRNA sequence homology suggests that mollicutes are more closely related to Gram-positive organisms than Gram-negative organisms (257). Thus, the differences in translational specificity that has been demonstrated between the Gram-negative and Gram-positive bacteria

(81) appears to include mycoplasmas as well. It was clear from these initial studies, however, that lacZ could be used as a reporter gene in mycoplasmas.

Tn400Ilac Promoter Probe Studies

The primary goal of these studies was to develop a transposon-based promoter probe vector for use in mycoplasmas. Because our laboratory had previously shown that Tn4001 could be introduced into mycoplasmas from a plasmid delivery vector (133), a study was undertaken to develop a Tn4001lac promoter probe transposon. In addition, a means of rescuing the promoter-containing sequences in the mycoplasma chromosome that drive the expression of the lacZ in the transposon was pursued.

The construction of the Tn4001lac promoter probe vector was initiated by inserting unique

BamHl and Smal RE sites into an 18256 arm ofTn4001, and then inserting the lacZ gene into one of these RE sites. The location of these RE sites in the IS2J6 element ofTa4001 was an 79

important consideration. The right and left \S256 elements were shown to possess identical

1,324-bp sequences (15). Therefore, the probability that only one of the arms encodes the

functional transposase, as shown with Tn5 (208), was unlikely. The IS2J6 element has 26-bp

terminal inverted repeats in which 17 bp match. In order to avoid interrupting the terminal

inverted repeats, the BamHl and Sntal RE sites were placed 28 bp from the end of the 1S256

element to generate plasmid pISM2062 (Figure 2).

The insertion of the BamHl and Smal RE sites, however, could have affected the

transposition activity of Tn400I as a consequence of interrupting the promoter for the transposase. The mutation resulted in the insertion of an additional 11 bp between the -10 and

-35 region of the predicted transposase promoter (15). There are two possible reasons that transformation frequency was not affected by the mutation. First, the change in the spatial relationship between the -10 and -35 region was tolerated and transcription still proceeded.

This is unlikely, however, because it has been shown that changing the distance between the

-10 and -35 region affects promoter strength (84). The second explanation is that the transposase produced from the unaltered 1S256 element was able to provide the necessary transposition capabilities. It has been shown in Tn5 and TnJO that the transposase was able to complement in cis when the inverted repeat regions were relatively close to the transposase gene (152, 174).

The 3.1-kb lacZ fragment was inserted into pISM2062 to generate plasmid plSM2062/ac.

Although this construct could transform Acholeplasma ISM1499, no blue colonies appeared on

X-gal-containing media. This was not unexpected because examination of the sequence between the end of the IS256 element and the lacZ fragment showed translational stop codons in all three reading frames (Figure 3) (15). Alteration of the stop codon nearest to the BamHl

RE site resulted in a significant (f<0.001) decrease in transformation frequency as compared to the wild type (Table 2). There was not a significant effect of altering the other two codons as compared to the wild type. 80

The decrease in transformation frequency as a result of altering the codon nearest to the

BamYil RE site may be explained in two ways. First, the site around this stop codon has the greatest base homology between the inside and outside terminal inverted repeat regions suggesting that this site may be involved in transposase binding or recognition. Byrne et al.

(15) have postulated that the transposase may recognize sequences common to both of the terminal inverted repeat regions. Second, this stop codon also lies within the predicted -35 region of the transposase (15). Thus, the reduction in transposition as measured by its effect on transformation frequency could either be a result of altering the transposase binding site or decreasing the promoter strength of the transposase.

The addition of the 3.1-kb lacZ gene to plasmids pISM2062, pISM2062.2, or pISM2062.3 (generating plasmids pISM2062/ac, pISM2062.2/ac and pISM2062.3/flc) also resulted in a significant (f<0.002) decrease (3- to 7-fold) in transformation frequency. This could have been due to an increase in plasmid size, or the placement of the lacZ gene in the

IS25Ô arm could have affected stability of the transposon. In a previous study with an integrative plasmid system in mycoplasmas (134), it was shown that larger plasmids have lower transformation frequencies than smaller plasmids.

In addition, Byrne et al. (15) have described a region of dyad symmetry encompassing the transposase promoter and ribosomal binding site able to form a stem-loop structure. Placement of the lacZ gene into the IS256 arm would have either eliminated the formation of the stem-loop structure or would have reduced its stability. The formation of the stem-loop structure is thought to be involved in protecting the transposon from the influence of adjacent active promoter sequences (15, 38, 112). The decreased transformation frequencies resulting from the placement of the lacZ fragment into the IS256 element may suggest that the stem-loop structure has a role in stabilizing the transposon in the chromosome.

The effects of increased plasmid size and altering the codon nearest to the BarnWl site appear to be independent. The additive effect of the modification of the third stop codon and the 81

increase in plasmid size is exemplified by the 50- to 100-fold difference in transformation

frequencies between plasmids pISM2061, pISM2062, or pISM2062.2 and pISM2062.3/flc,

pISM2062.3/ac(rev), or pISM2065 (Table 2). The insertion of lacZ or the altering of the third

stop codon only resulted in a 5- to 10-fold decrease in transformation frequency.

A Student's t test was conducted to examine for significant effects of transposon size on

transformation frequency. This was done by comparing the transformation frequencies

between pISM2065 and pISM2062.3/ac and pISM2062.3/flc(rev). All three of these plasmids

possess an 18256 element with all three stop codons altered and are similar in size. However,

pISM2065 has the 3-kb plasmid inserted into the IS256 arm. The results showed that

transposon size did not significantly affect transformation frequency.

P-galactosidase activity was observed in 7.7, 4.1, and 8.8 percent of the Acholeplasma

ISM 1499 transformants with transposons Tn4001.2062.2lac and Tn4001.20623lac, and

Tn40012065, respectively (Table 2). Blue color on X-gal-containing media (data not shown)

and P-gal assays indicated that the transposons had inserted in regions of active transcription in

the chromosome. Varying levels of P-gal activity were measured, however. This indicated that either the transposon had inserted downstream of promoters of varying strengths, the stability of the lacZ fusion transcript differed, or stability of the protein was altered. P-galactosidase activity was not observed in constructs in which lacZ was placed in the reverse orientation showing that the promoters driving the expression of lacZ lie outside the transposon. The versatility of the Tn400Ilac was tested by using plasmid pISM2062.2/ac to transform M. gallisepticum. The recovery of Lac+ transformants demonstrate that this transposon would be effective in locating promoters of other species of mycoplasmas.

Another aim of these studies was to develop a means of rescuing sequences adjacent to the transposon that are driving the expression of lacZ contained in the transposon. A transposon rescue system modeled after the Tn917lac rescue system developed by Youngman et al. (267) was developed with Tn400I (Figure 4). The resulting Tn4001lac derivative, Tn4001.2065, 82

possesses within one of its IS256 arms a plasmid capable of replication and selection in E. coli

as well as the promoterless lacZ. Thus, mycoplasma chromosomal sequences that are able to drive P-gal expression can be recovered and cloned in E. coli as illustrated in Figure 4B.

Acholeplasma chromosomal sequences have been successfully rescued using this system.

Plasmid pISM2065 has a major drawback in that it transforms Acholeplasma IS M1499 at a very low frequency (10"* transformants/CFU) probably due to the altered third stop codon.

Therefore, only 10 to 50 transformants can be expected to be recovered per transformation.

Unfortunately, plasmid pISM2064 did not transform ISM 1499. Based upon the transformation frequency results with its parent plasmid pISM2062.2, a 10-fold increase in transformation frequency would have been expected with pISM2064. Plasmids pISM2064 and pISM2065 have identical RE patterns, yet pISM2064 was not functional. The inability to transform

ISM1499 with plasmid pISM2064 cannot be explained at this time.

In summary, a Tn4001lac promoter probe vector for use in mycoplasmas has been developed. Placement of the BwwHI and Smal RE sites into the IS25d arm ofTn400I did not effect transformation frequency. Removal of all three stop codons and increasing the plasmid size appeared to reduce the transformation frequency. Nevertheless, these Tn4001lac derivatives are suitable for the detection and analysis of mycoplasma promoters and/or translational start elements in vivo. Moreover, the ability to rescue adjacent chromosomal sequences driving the expression of lacZ using transposon Tn4001.2065 should facilitate the rapid analysis of mycoplasma regulatory sequences.

Plasmid pISM2050 Promoter Probe Studies

Construction and use of the plasmid promoter probe vector pISM2050

A transcriptional fusion vector was constructed (Figure 5) in hopes of increasing [3-gal activity. This vector required both the transcriptional and translational sequences cloned 83 upstream of the promoterless lacZ for the expression of P-gal. Thus, unlike the M. capricolum studies described above, both the transcriptional and translational start regions were from

Acholeplasma. A library of cloned fragments was produced and screened in E. coli prior to introduction into Acholeplasma because of the large quantities of plasmid DNA (7 to 10 |ig) required for transformation into mycoplasmas (134). Interestingly, only 10% of the recombinants that demonstrated promoter activity in E. coli also showed activity in IS M1520.

This may be explained in two ways. First, pooled plasmid preparations were used to initially transform ISM1520, and it is possible that in some of the pooled preparations, promoter- containing constructs were under represented, did not transform, and thus, all transformed colonies would appear to have the Lac phenotype. In an attempt to prevent this, it was assumed that each plasmid of the pool would be represented in the transformed colonies if more than 50 transformants arose from the plasmid mixture. Second, the A + T-rich mycoplasma chromosome may have generated pseudo-promoter activity in E. coli. This is supported by similar studies in another A + T-rich organism, S. pneumoniae. Chen and

Morrison observed more strong promoter-acting sequences with randomly cloned S. pneumoniae DNA fragments in E. coli than with randomly cloned E. coli DNA fragments (27).

It is clear from these studies that random mycoplasma sequences can result in false promoter activity in E. coli thereby demonstrating the importance of examining gene regulation in the original mycoplasma host

The lacZ fusion constructs were introduced into two difierent Acholeplasma chromosomal locations to examine whether location would affect [3-gal activity levels. Integration was targeted to a single chromosomal site in ISM 1520 or to the original location of the cloned fragment in ISM1499. The levels of P-gal activity were similar whether the plasmid constructs were introduced into ISM 1520 or into ISM 1499 except for plasmids pISM2050.66 and pISM2050.69 (Table 3). The 3- to 5-fold change in levels of P-gal activity in these constructs 84

suggests that chromosomal location may influence gene expression. The inability to transform

ISM 1499 with plasmids pISM2050.2, pISM2050.8, pISM2050.86, and pISM2050.89 despite

repeated attempts, suggests that the integration of these plasmids into the chromosome at their

normal location may be lethal.

The difference in levels of P-gal between Acholeplasma and E. coli may be due to the lacZ

fusion construct copy number. In E. coli, the fusion construct exists as a high copy number

plasmid while in Acholeplasma the plasmid is integrated into the chromosome. The higher

levels of P-gal activity generated by the integration of plasmid pISM2050.89 in Acholeplasma

than in E. coli was unexpected. This may suggest that there is more than one class of

promoters in mycoplasmas. Hudson and Stewart (90) have isolated 2 classes of S. aureus

promoters; one that directs chloramphenicol acetyltransferase expression in both E. coli and S.

aureus, and another that only directs expression in Gram positive hosts. Their results suggest

that there is something unique about this second class of Gram positive bacterial promoters

such as the need for a regulatory factor or recognition by a specific class of sigma factors of the

RNA polymerase.

Transcript levels of the lacZ fusion products from the Acholeplasma IS M1520 strains

transformed with the pISM2050 derivatives were measured and compared to levels of P-gal

activity. Generally, strains demonstrating higher levels of P-gal activity (Table 3) also had

higher transcript levels (Figure 7). There were some exceptions, however. Strains

ISM2050.18, ISM2050.66, and 1SM2050.69 had relatively low levels of P-gal activity

compared to the relative level of transcript measured. This indicated that either the lacZ message

in these strains was unstable or the message was not efficiently translated.

Analysis of Acholeplasma ISM1499 promoters

The primer extension studies (Figure 9) showed that indeed the Acholeplasma ISM 1499 chromosomal sequences adjacent to lacZ in the plasmid derivatives of pISM2050 contained the 85

promoters that were driving the expression of lacZ. Unfortunately, 6 of the 13 promoters could

not be mapped. The promoters driving the expression of lacZ contained in 1SM2050.19 and

ISM2050.40 probably could not be mapped because of the low amount of lacZ fusion

transcript produced in these strains (Figure 7). The reason(s) that the other transcriptional start sites could not be determined remains an enigma at this time. One possible reason is that the transcriptional start is too far upstream from the point in which the primer binds the message.

Reverse transcriptase has a tendency to pause or stop in regions of high secondary structure and the enzyme is the most efficient when the 5' end of the mRNA is within 100 bp of the primer target region (213).

Exonuclease ni/Mung Bean nuclease deletion analysis of the promoter driving lacZ expression in ISM2050.2 (Figure 10) supported the primer extension mapping studies in that the translational start mapped within the sequences deleted in pISM2075 (Lac) and present in pISM2076 (Lac+). Unfortunately, there were not any deletion mutations that ended between these two constructs to precisely confirm the minimal upstream distance required for transcriptional activity.

The sequences upstream of the transcriptional start sites were aligned (Table 4). The -10 and -35 regions were assigned based upon their similarity to the E. coli consensus sequence as reported by Hawley and McClure (84). Defining a mycoplasma promoter by its similarity to the

E. coli consensus promoter could be misleading because mycoplasma DNA, like E. coli promoters, is A + T-rich. Therefore, it is especially important with mycoplasma promoters to correlate the sequence data with promoter mapping studies.

Alignment of the sequences upstream of the mapped transcriptional start sites suggested that the -10 regions were similar to the -10 region of the E. coli consensus promoter, but the

-35 regions were more variable. The average of 4.4 bp conserved at the -10 region is similar to the 4.2 bp conservation observed with the E. coli and phage promoters examined by Hawley and McClure (84). There was only a 3 bp conservation at the -35 region of the acholeplasma 86

promoters which is about 1 bp less than the 3.9 bp observed with the E. coli and phage

promoters. The observation that the -10 region was more like the E. coli consensus promoter

than the -35 region is consistent with previous reports examining the putative mycoplasma

promoter regions (29, 30, 95, 160).

The result that the Acholeplasma promoters were similar to the E. coli consensus promoter

is not unexpected because the lacZ fusion constructs were initially screened in E. coli for their

ability to give the Lac+ phenotype. Thus, only the Acholeplasma upstream regions that are

recognized by E. coli RNA polymerase were considered for future analysis in Acholeplasma.

The putative -10 and -35 regions were also similar to the E. coli consensus promoter

region with respect to distance from the transcriptional start site (6 to 8 bp) and the intervening distance between the regions (16 to 18 bp). The Acholeplasma promoter sequence was different from the putative M. pneumoniae PI promoter (95) with respect to the distance

between the -10 and -35 regions (Table 4). The shorter intervening distance suggests that the

PI gene promoter may be regulated differently; perhaps the promoter is recognized by a different sigma factor. In E. coli, the genes that respond to nitrogen starvation possess promoters in which the intervening distance is only 6 bp and are recognized by the rpoN gene (formally ntrA) product, a^O (gg).

Should mycoplasma promoter regions be defined by their similarity to the E. coli consensus sequence? Just because all mycoplasma promoters have been defined in this manner

(160), does not validate this approach. It could be argued that if the parameters for locating a promoter region are limited to their similarity to the E. coli consensus sequence, then naturally only E. coli consensus-like sequences will be assigned as promoter regions.

The studies described above demonstrate that Acholeplasma promoter-containing DNA have E. co/z-like promoter regions that may or may not function as RNA polymerase recognition sequences in Acholeplasma. Additional studies involving fine structure mapping, deletion analysis, and site-directed mutagenesis will be required to answer this question. The 87 ideal method in which to define a mycoplasma consensus promoter would be to align many

upstream regions by their confirmed translational start sites and correlate that information with the fine structure mapping studies. Unfortunately, only a few mycoplasma transcriptional start sites have been actually mapped. Thus, as more mycoplasma upstream regions are confirmed, an analysis for a "true" consensus mycoplasma promoter sequence should be undertaken.

Summary of the plasmid pISM2050 promoter probe vector studies

In summary, these data demonstrate the need to be able to examine mycoplasma gene regulation in a homologous system. Clearly, E. coli was less stringent in its promoter recognition sequences than Acholeplasma, and therefore the use of E. coli in studying mycoplasmal promoter structure and function should be limited to an initial screening. These studies also showed that the promoter probe vector, pISM2050, can identify cloned mycoplasmal chromosomal fragments containing transcriptional and translational control sequences. The levels of gene expression from cloned fragments vary by 100-fold indicating that gene regulation is occurring at the transcriptional and/or translational level in

Acholeplasma. Immunoblot analysis (Figure 8), measurement of message levels (Figure 7), and the intensity of blue color on X-gal-containing media (Figure 6) confirm this conclusion.

Primer extension studies showed that the promoter driving the expression of lacZ was from acholeplasma. Moreover, the putative promoter regions resemble the E. coli consensus promoter at the -10 region but were more variable at the -35 region.

Summary

The integrative plasmid system lends itself to analysis of gene regulatory elements in mycoplasmas by offering the ability to identify gene regulatory elements, to introduce defined mutations in promoter sequences, and has the potential to identify and study transcriptional 88 regulators. These studies showed that lacZ could be used as a reporter gene in mycoplasmas.

These studies also demonstrated the need to be able to examine mycoplasma gene regulation in its natural host, the mycoplasma, because of the pseudo-promoter activity in E. coli. In addition, mycoplasmas regulate levels of gene expression because differing levels of P-gal activity were generated between the various lacZ fusion constructs. The transposon studies showed that Tn4001lac could integrate and detect sites of active transcription in both

Acholeplasma and Mycoplasma. Thus, this vector should be useful for the detection of promoters for a variety of different mycoplasmas. Finally, the regions upstream of 7 transcriptional start sites were sequenced, and the putative promoters were determined. The -10 regions oi Acholeplasma promoters were similar to the -10 region of the E. coli consensus promoter. The putative -35 regions of the Acholeplasma promoters were more variable. 89

REFERENCES

1. Amikam, D., G. Glaser, and S. Razin. 1984. Mycoplasmas (mollicutes) have a low

number of rRNA genes. J. Bacteriol. 158:376-378.

2. Andachi, Y., F. Yamao, M. Iwami, A. Muto, and S. Osawa. 1987. Occurrence of

unmodified adenine and uracil at the first position of anticodon in threonine tRNAs in

Mycoplasma capricolum. Proc. Natl. Acad. Sci. USA 84:7398-7402.

3. Andachi, Y., F. Yamoa, A. Muto, and S. Osawa. 1989. Codon recognition patterns as

deduced from sequences of the complete set of transfer RNA species in Mycoplasma

capricolum. Resemblance to mitochondria. J. Mol. Biol. 209:37-54.

4. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith,

and K. Struhl. 1989. Book Current protocols in molecular biology. John Wiley and Sons,

New York.

5. Barlev, N. A., and S. N. Borchsenius. 1990. Gradual distribution of mycoplasma

genome sizes. lOM Lett. 1:238-239.

6. Barroso, G., and J. Labarere. 1988. Chromosomal gene transfer in Spiroplasma citri.

Science 241:959-961.

7. Barroso, G., J.-C. Salvado, and J. Labarere. 1990. Influence of genetic markers and of

the fusing agent polyethylene glycol on chromosomal gene transfer in Spiroplasma citri.

Curr. Microbiol. 20:53-56.

8. Bautsch, W. 1988. Rapid physical mapping of the Mycoplasma mobile genome by two-

dimensional field inversion gel electrophoresis techniques. Nucleic Acids Res. 16:11461-

11467.

9. Bellofatto, V., L. Shapiro, and D. A. Hodgson. 1984. Generation of a Tn5 promoter

probe and its use in the study of gene expression in Caulobacter crescentus. Proc. Natl.

Acad. Sci. USA 81:1035-1039. 10. Berg, D. 1989. Transposon Tn5, p. 185-210. In D. E. Berg and M. M. Howe (ed.),

Mobile DNA. American Society for Microbiology, Washington, D. C,

11. Bergemann, A. D., J. C. Whitley, and L. R. Finch. 1989. Homology of mycoplasma

plasmid pADB201 and staphylococcal plasmid pE194. J. Bacteriol. 171:593-595.

12. Bhakoo, M., and R. N. McElhaney. 1988. The effect of variations in growth temperature,

fatty acid composition and cholesterol content on the lipid polar headgroup composition of

Acholeplasma laidlawii B membranes. Biochim. Biophys. Acta 945:307-314.

13. Blanchard, A. 1990. Ureaplasma urealyticum urease genes: use of a UGA tryptophan

codon. Mol. Microbiol. 4:669-676.

14. Bove, J. M., P. Carle, M. Garnier, F. Laigret, J. Renaudin, and C. Saillard. 1989.

Molecular and cellular biology of spiroplasmas, p. 243-364. In R. F. Whitcomb and J. G.

Tully (ed.). The Mycoplasmas. Academic Press, Inc., New York.

15. Byrne, M. E., D. A. Rouch, and R. A. Skurray. 1989. Nucleotide sequence analysis of

IS25d from the Staphylococcus aureus gentamicin-tobramycin- kanamycin-resistance

transposon Tn400I. Gene 81:361-367.

16. Casadaban, M., A. Arias-Martinez, S. Shapira, and J. Chou. 1983. P-galactosidase gene

fusions for analyzing gene expression in Escherichia coli and yeast. Methods Enzymol.

100:293-308.

17. Casadaban, M. J., J. Chou, and S. N. Cohen. 1980. In vitro gene fusions that join an

enzymatically active (i-galactosidase segment to amino-terminal fragments of exogenous

proteins: Escherichia coli plasmid vectors for the detection and cloning of translational

initiation signals. J. Bacteriol. 143:971-980.

18. Casadaban, M. J., and S. N. Cohen. 1979. Lactose genes fused to exogenous promotors

in one step using a Mu-lac bacteriophage: In vivo probe for transcriptional control

sequences. Proc. Natl. Acad. Sci. USA 76:4530-4533. 91

19. Cashel, M., and K. Rudd. 1987. The stringent response, p. 1410-1438. In F. C.

Neidhardt, J. L. Ingraham, B. Magasanik, K. B. Low, M. Schaechter and H. E.

Umbarger (ed.), Escherichia coli and Salmonella typhimuriwn: Cellular and Molecular

Biology. American Society for Microbiology, Washington, D.C.

20. Caskey, C. T. 1977. Peptide chain termination, p. 443-465. In H. Weissback and S.

Pestka (ed.). Molecular Mechanisms of Protein Biosynthesis. Academic Press, Inc., New

York.

21. Cerone-McLernon , A. M., and G. Furness. 1980. The preparation of transforming DNA

from Mycoplasma hominis strain Sprott tet(r) and quantitative studies of the factors

affecting the genetic transformation of Mycoplasma salivarium strain S 9 tet(s) to

tetracycline resistance. Can. J. Microbiol. 26:1147-1152.

22. Chang, C. 1984. Vitamin requirements of three spiroplasmas. J. Bacteriol. 160:488-490.

23. Chang, C. 1989. Nutrition and cultivation of spiroplasmas, p. 201-243. In R. F.

Whitcomb and J. G. Tully (ed.). The Mycoplasmas. Academic Press, San Diego, Calif.

24. Chang, C.-J., and T. A. Chen. 1982. Spiroplasmas: cultivation in chemically defined

medium. Science 215:1121-1122.

25. Chang, S., and S. N. Cohen. 1979. High frequency transformation of Bacillus subtilis

protoplasts by plasmid DNA. Mol. Gen. Genet. 168:111-115.

26. Chanock, R. M., L. Hayflick, and M. F. Barile. 1962. Growth on artificial medium of an

agent associated with atypical pneumonia and its identification as PPLO. Proc. Natl. Acad.

Sci. USA 48:41-49.

27. Chen, J., and D. Morrison. 1987. Cloning of Streptococcus pneumoniae DNA fragments

in Escherichia coli requires vectors protected by strong transcriptional terminators. Gene

55:179-187.

28. Chevalier, C., C. Saillard, and J. M. Bove. 1990. Organization and nucleotide sequences

of the Spiroplasma citri genes for ribosomal protein S2, elongation factor Ts, spiralin. 92

phosphofructokinase, pyruvate kinase, and an unidentified protein. J. Bacteriol.

172:2693-2703.

29. Christiansen, C. 1987. The mycoplasma genome: Part 1. Microbiol. Sci. 4:168-172.

30. Christiansen, C. 1987. The mycoplasma genome: Part 2. Microbiol. Sci. 4:292-295.

31. Cocks, B. G., F. A. Brake, A. Mitchell, and L. R. Finch. 1985. Enzymes of intermediary

carbohydrate metabolism in Ureaplasma urealyticum and Mycoplasma mycoides subsp.

mycoides. J. Gen. Microbiol, 131:2129-2135.

32. Cocks, B. G., L. E. Pyle, and L. R. Finch. 1989. A physical map of the genome of

Ureaplasma urealyticum 960T with ribosomal RNA loci. Nucleic Acids Res. 17:6713-

6719.

33. Cole, R. M., W. O. Mitchell, and C. F. Garon. 1977. Spiroplasmavirus citri. 3.

Propagation, purification, proteins, and nucleic acid. Science 198:1262-1263.

34. Crick, F. H. C. 1966. Codon-anticodon pairing: The wobble hypothesis. J. Mol. Biol.

19:548-555.

35. Dahl, J. 1988. Uptake of fatty acids by Mycoplasma capricolum. J. Bacteriol. 170:2022-

2026.

36. Dallo, S. F„ C. F. Su, J. R. Norton, and J. B. Baseman, 1988, Identification of PI gene

domain containing epitope(s) mediating Mycoplasma pneumoniae cytadherence. J. Exp.

Med. 167:718-723.

37. Dascher, C, C,, and J. Maniloff, 1992, Heat shock response, p, 349-354, In J, Maniloff,

R, N. McElhaney, L. R. Finch and J. B. Baseman (ed.). Mycoplasmas: molecular

biology and pathogenesis. American Society for Microbiology, Washington, D.C.

38. Davis, M, A,, R. W. Simons, and N. Kleckner. 1985. TnJO protects itself at two levels

from fortuitous activation by external promoters. Cell 43:379-387.

39. Davis, P. J., A. Katznel, S. Razin, and S. Rottem. 1985. Spiroplasma membrane lipids.

J. Bacteriol, 161:118-122, 93

40. de Crombrugghe, B., and I. Pastan. 1980. Cyclic AMP, the cyclic AMP receptor protein,

and their dual control of the galactose operon, p. 303-324. In J. H. Miller and W. S.

Reznikoff (ed.). The Operon. Cold Spring Harbor Laboratory, Cold Spring Harbor, New

York.

41. De Reuse, H., E. Touati, P. Glaser, and A. Danchin. 1986. Low copy number plasmid

vectors for gene cloning and for monitoring gene expression. FEMS Microbiol. Letters

37:193-197.

42. Derbyshire, K. M., L. Hwang, and N. D. F. Grindley. 1987. Genetic analysis of the

interaction of the insertion sequence IS903 transposase with its terminal inverted repeats.

Proc. Natl. Acad. Sci. USA 84:8049-8053.

43. Desantis, D., V. V. Tryon, and D. Pollack. 1989. Metabolism of mollicutes: the Embden-

Meyerhof-Parnas pathway and the hexose monophosphate shunt. J. Gen. Microbiol.

135:683-691.

44. Dienes, L., and G. EdsaU. 1937. Observations on the L-organism of Klieneberger. Proc.

Soc. Exp. Biol. Med. 36:740-744.

45. Dorman, C. J. 1991. DNA supercoUing and environmental regulation of gene expression

in pathogenic bacteria. Infect. Immun. 59:745-749.

46. Dudler, R., C. Schmidhauser, R. W. Parish, E. H. Wettenhall, and T. Schmidt. 1988. A

mycoplasma high-affinity transport system and the in vitro invasiveness of mouse

sarcoma cells. EMBO J. 7:3963-3970.

47. Dunny, G., B. Brown, and D. B. Clewell. 1978. Induced cell aggregation and mating in

Streptococcusfaecalis. Proc. Natl. Acad. Sci. USA 75:3479-3483.

48. Dunny, G. M. 1990. Genetic functions and cell-cell interactions in the pheromone-

inducible plasmid transfer system of Enterococcus faecalis. Mol. Microbiol. 4:689-696.

49. Dybvig, K. 1989. Transformation of Acholeplasma laidlawii with streptococcal plasmids

pVA868 and pVA920. Plasmid 21:155-160. 94

50. Dybvig, K. 1990. Genetic manipulations of mycoplasmas, p. 43-46. In G. Stanek, G. H.

Cassell, J. G. Tully and R. F. Whitcomb (ed.). Recent Advances in Mycoplasmology.

Gustav Fischer Verlag, Stuttgart.

51. Dybvig, K. 1990. Mycoplasmal Genetics. Annu. Rev. Microbiol. 44:81-104,

52. Dybvig, K. 1992. Gene Transfer, p. 355-361. In J. Maniloff, R. N. McElhaney, L. R.

Finch and J. B. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis.

American Society for Microbiology, Washington, D.C.

53. Dybvig, K., and J. Alderete. 1988. Transformation of Mycoplasma pulmonis and

Mycoplasma hyorhinis: transposition of Tn9/6 and formation of cointegrate structures.

Plasmid 20:33-41.

54. Dybvig, K., and G. H. Cassell. 1987. Transposition of gram-positive transposon Tn976

in Acholeplasma laidlawii and Mycoplasma pulmonis. Science 235:1392-1394.

55. Dybvig, K., K. King, and M. Khaled. 1990. Mycoplasma plasmids. lOM Letters 1:209-

210.

56. Dybvig, K., and A. Woodard. 1992. Cloning and DNA sequence of a mycoplasmal recA

gene. J. Bacteriol. 174:778-784.

57. Edward, D. G. f. 1950. An investigation of pleuropneumonia-like organisms isolated

from the bovine genital tract. J. Gen. Microbiol. 4:4-15.

58. Edward, D. G. f., and E. A. Freundt. 1956. The classification and nomenclature of

organisms of the plwouropneumoniae group. J. Gen. Microbiol. 14:197-207.

59. Edward, D. G. f., and E. A. Freundt. 1970. Ammended nomenclature for strains related

to Mycoplasma laidlawii. J. Gen. Microbiol. 62:1-2,

60. Ehrlich, S. D., P. Noirot, M. A. Petit, L. Janniere, B. Michel, and H. te Riele. 1986.

Structural instability of Bacillus subtilis plasmids, p. 71-83. In J, Setlow and A.

Hollander (ed.). Genetic Engineering. Plenum Publishing Corporation, New York. 95

61. Fenske, J. D., and G. E. Kenny. 1976. Role of arginine deiminase in growth of

Mycoplasma hominis. J. Bacteriol. 126:501-510.

62. Finch, L. R., and A. Mitchell. 1992. Sources of nucleotides, p. 211-230. In J. Maniloff,

R. N. McElhaney, L. R. Finch and J. B. Baseman (ed.). Mycoplasmas: molecular

biology and pathogenesis. American Society for Microbiology, Washington, D.C.

63. Fischer, R. S., B. E. Fischer, and R. A. Jensen. 1992. Sources of amino acids, p. 201-

209. In J. Maniloff, R. N. McElhaney, L. R. Finch and J. B. Baseman (ed.).

Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology,

Washington, D.C.

64. Fujita, M. Q., H. Yoshikawa, and N. Ogasawara. 1992. Structure of the dnaA and DnaA-

box region in Mycoplasma capricolum chromosome: conservation and variations in the

course of evolution. Gene 110:17-23.

65. Fumess, G., and A. M. Cerone. 1979. Preparation of competent single-cell suspensions

of Mycoplasma hominis tet(s) and Mycoplasma salivarium tet(s) for genetic transformation

to tetracylcine resistance by DNA extracted from Mycoplasma hominis tet(r). J. Infect.

Dis. 139:444-451.

66. Gadeau, A., C. Mouches, and J. Bove. 1986. Probable insensitivity of mollicutes to

rifampin and characterization of spiroplasmal DNA-dependent RNA polymerase. J.

Bacteriol. 166:824-828.

67. Gafny, R., H. C. Hyman, S. Razin, and G. Glaser. 1988. Promoters of Mycoplasma

capricolum ribosomal RNA opérons: identical activities but different regulation in

homologous and heterologous cells. Nucleic Acids Res. 16:61-76.

68. Gallagher, S. R. 1991. GUS protocols: using the GUS gene as a reporter of gene

expression. Academic Press, Inc., San Diego, Calif. 96

69. Gardella, R. S., and R. A. Del Giudice. 1983. Optimal temperature and atmospheric

conditions for growth, p. 211-218. In S. Razin and J. G. Tully (ed.). Methods in

Mycoplasmology. Academic Press, Inc., New York.

70. Garnier, T., C. Bruno, and S. T. Cole. 1991. Cloning, mapping, and molecular

characterization of the rRNA opérons of Clostridium petfringens. J. Bacteriol. 173:5431-

5438.

71. Gawron-Burke, C., and D. B. Clewell. 1982. A transposon in Streptococcus faecalis with

fertility properties. Nature 300:281-282.

72. Gilbert, W. 1976. Starting and stopping sequences for the RNA polymerase, p. 193-206.

In R. Losick and M. Chamberlin (ed.), RNA Polymerase. Cold Springs Harbor

Laboratory, Colds Springs Harbor, New York.

73. Gobel, U., G. H. Butler, and J. Stanbridge. 1984. Comparative analysis of mycoplasma

ribosomal RNA opérons. Isr. J. Med. Sci. 20:762-764.

74. Greenway, S. D., and D. A. J. Wase. 1982. Two chemiclally defined media for the

growth of Acholeplasma laidlawii strain A. Biotechnol. Lett. 4:217-222.

75. Gronenborn, B., and J. Messing. 1978. Methylation of single stranded DNA in vitro

introduces new restriction endonuclease sites. Nature 272:375-377.

76. Gruss, A., and S. D. Ehrlich. 1988. Insertion of foreign DNA into plasmids from gram-

positive bacteria induces formation of high-molecular-weight plasmid multimers. J.

Bacteriol. 170:1183-1190.

77. Gruss, A., and S. D. Ehrlich. 1989. The family of highly interelated single-stranded

deoxyribonucleic acid plasmids. Microbiol. Rev. 53:231-241.

78. Guan, C., B. Wanner, and H. Inouye. 1983. Analysis of regulation of phoB expression

using a. phoB-cat fusion. J. Bacteriol. 156:710-717.

79. Hackett, K., A. Ginsberg, S. Rottem, R. Henegar, and R. Whitcomb. 1987. A defined

medium for a fastidious spiroplasma. Science 237:525-527. 97

80. Hager, P. W., and J. C. Rabinowitz. 1985. Inefficient translation of T7 late mRNA by

Bacillus subtilis ribosomes. J. Biol. Chem. 260:15163-15167.

81. Hager, P. W., and J. C. Rabinowitz. 1985. Translational specificity in Bacillus subtilis,

p. 1-32. In D. A. Dubnau (ed.). The Molecular Biology of the Bacilli. Academic Press,

New York.

82. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol.

Biol. 166:557-580.

83. Hanahan, D. 1985. Techniques for transformation of E. coli. DNA Cloning 1:109-135.

84. Hawley, D. K., and W. R. McClure. 1983. Compilation and analysis of Escherichia coli

promoter DNA sequences. Nucleic Acids Res. 11:2237-2255.

85. Hayflick, L. 1969. Fundamental biology of the class Mollicutes, order Mycoplasmatales,

p. 15-47. In L. Hayflick (ed.), The mycoplasmatales and the L-phase of bacteria.

Appleton-Century-Crofts, New York.

86. Helmann, J. D., and M. J. Chamberlin. 1988. Structure and function of bacterial sigma

factors. Annu. Rev. Biochem. 57:839-872.

87. Herrmann, R. 1990. University of Heidelberg, Department of Microbiology. Heidelberg,

Germany. Personal communication.

88. Hirschman, J., P.-K. Wong, K. Sei, J. Keener, and S. Kustu. 1985. Products of

nitrogen regulatory genes ntrA and ntrC of enteric bacteria activate glnA transcription in vitro: evidence that the ntrA product is a c factor. Proc. Natl. Acad. Sci. USA 82:7525-

7529.

89. Hopwood, D. A. 1981. Genetic studies with bacterial protoplasts. Annu. Rev. Microbiol.

35:237-272.

90. Hudson, M. C., and G. C. Stewart. 1986. Differential utilization of Staphylococcus

aureus promoter sequences by Escherichia coli and Bacillus subtilis. Gene 48:93-100.

91. Hungate, R. E. 1966.The rumen and its microbes. Academic Press, Inc., New York. 98

92. Igo, M., M. Lampe, C. Ray, W. Schafer, C. P. Moran, and R. Losick. 1987. Genetic

studies of a secondary RNA polymerase sigma factor in Bacillus subtilis. J. Bacteriol.

169:3464-3469.

93. Inamine, J. M., T. P. Denny, S. Loechel, U. Schaper, C.-h. Huang, K. F. Bott, and P.

Hu. 1988. Nucleotide sequence of the PI attachment protein gene oi Mycoplasma

pneumoniae. Gene 64:217-229.

94. Inamine, J. M., K.-c. Ho, S. Loechel, and P.-c. Hu. 1990. Evidence that UGA is read as

a tryptophan codon rather than as a stop codon by Mycoplasma pneumoniae, Mycoplasma

genitalium and Mycoplasma gallisepticum. J. Bacteriol. 172:504-506.

95. Inamine, J. M., S. Loechel, and P.-c. Hu. 1988. Analysis of the nucleotide sequence of

the PI operon of Mycoplasma pneumoniae. Gene 73:175-183.

96. Inamine, J. M., S. Loechel, and P.-c. Hu. 1989. Nucleotide sequence of the tuf gene

from Mycoplasma gallisepticum. Nucleic Acids Res. 17:10126.

97. Iwami, M., A. Muto, F. Yamao, and S. Osawa. 1984. Nucleotide sequence of the rrnB

16S ribosomal RNA gene from Mycoplasma capricolum. Mol. Gen. Genet. 196:317-

322.

98. Jarvis, E. D., R. L. Widom, G. La Fauci, Y. Setoguchi, I. R. Richter, and R. Rudner.

1988. Chromosomal organization of rRNA opérons in Bacillus subtilis. Genetics

120:625-635.

99. Josaitis, C. A., T. Gaal, W. Ross, and R. L. Gourse. 1990. Sequences upstream of the

-35 hexamer of rrnB PI affect promoter strength and upstream activation. Biochim.

Biophys. Acta 1050:307-311.

100. Kawauchi, Y., A. Muto, and S. Osawa. 1982. The protein composition of Mycoplasma

capricolum. Mol. Gen. Genet. 188:7-11.

101. Kim, M. F., M. B. Heidari, S. J. Stull, M. A. Mcintosh, and K. S. Wise. 1990.

Identification and mapping of an immunogenic region of Mycoplasma hyopneumoniae I

99

p65 surface lipoprotein expressed in Escherichia coli from a cloned genomic fragment.

Infect. Immun. 58:2637-2643.

102. King, K., and K. Dybvig. 1991. Nucleotide sequence analysis of Mycoplasma mycoides

subspecies mycoides plasmid pKMKl. American Society for Microbiolgy 137.

103. King, K. W., and K. Dybvig. 1991. Plasmid transformation of Mycoplasma mycoides

subspecies mycoides is promoted by high concentrations of polyethylene glycol. Plasmid

26:108-115.

104. King, K. W., and K. Dybvig. 1992. Nucleotide sequence of Mycoplasma mycoides

subspecies mycoides plasmid pKMKl. Plasmid 28:86-91.

105. Kiss, A., B. Sain, and P. Venetiainer. 1977. The number of rRNA genes in Escherichia

coli. FEES Lett. 79:77-79.

106. Kleckner, N., D. Morisato, D. Roberts, and J. Bender. 1984. Mechanism and regulation

of Tn/0 transposition. Cold Spring Harbor Symp. Quant. Biol. 49:235-244.

107. Klinkert, M., R. Herrmann, and H. Schaller. 1985. Surface proteins of Mycoplasma

hyopneimoniae identified from an Escherichia coli expression plasmid library. Infect.

Immun. 49:329-335.

108. Komeda, Y., and T. lino. 1979. Regulation of expression of the flagellin gene (hag) in

Escherichia coli K-12: analysis of hag-lac gene fusions. J. Bacteriol. 139:721-729.

109. Komine, Y., Y. Adachi, H. Inokuchi, and H. Ozeki. 1990. Genomic organization and

physical mapping of the transfer RNA genes in Escherichia coli K12. J. Mol. Biol.

211:579-598.

110. Kondo, K., H. Sone, H. Yoshida, T. Toida, K. Kanatani, Y.-M. Hong, N. Nishino,

and J.-i. Tanaka. 1990. Cloning and sequence analysis of the arginine deiminase gene

from Mycoplasma arginini. Mol. Gen. Genet. 221:81-86.

111. Krause, D. C., and D. Taylor-Robinson. 1992. Mycoplasmas which infect humans, p.

417-444. In J. Maniloff, R. N. McElhaney, L. R. Finch and J. B. Baseman (ed.). 100

Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology,

Washington, D. C.

112. Krebs, M. P., and W. S. Reznikoff. 1986. Transcriptional and translational initiation

sites in IS50. J. Mol. Biol. 192:781-791.

113. Kroos, L., and D. Kaiser. 1984. Construction of Tn5 lac, a transposon that fuses lacZ

expression to exogenous promoters, and its introduction into Myxococcus xanthus. Proc.

Natl. Acad. Sci. USA 81:5816-5820.

114. Labarere, J. 1992. DNA replication and repair, p. 309-323. In J. Maniloff, R. N.

McElhaney, L. R. Finch and J. B. Baseman (ed.). Mycoplasmas: molecular biology and

pathogenesis. American Society for Microbiology, Washington, D.C.

115. Ladefoged, S. A., and G. Chrisdanssen. 1992. Physical and genetic mapping of the

genomes of five Mycoplasma hominis strains by pulsed-field gel electrophoresis. J.

Bacteriol. 174:2199-2207.

116. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of

bacteriophage T4. Nature 227:680-685.

117. Laidlaw, P. P., and W. J. Elford. 1936. A new group of filterable organisms. Proc. R.

Soc. Lond. Biol. Sci. 120:292-303.

118. Lederberg, J., and J. St. Clair. 1958. Protoplasts and L-type growth of Escherichia coli.

J. Bacteriol. 75:143-160.

119. Lee, I., and R. E. Davis. 1989. Serum-free media for cultivation of spiroplasmas. Can.

J. Microbiol. 35:1092-1099.

120. Lee, L, and R. E. Davis. 1992. Mycoplasmas which infect plants and insects, p. 379-

390. In J. Maniloff, R. N. McElhaney, L. R. Finch and J. B. Baseman (ed.),

Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology,

Washington, D.C. 101

121. Lee, I. M., and R. E. Davis. 1980. DNA homology among diverse spiroplasma strains

representing several serological groups. Can. J. Microbiol. 26:1356-1363.

122. Lelong, I., B. Luu, M. Mersel, and S. Rottem. 1988. Effect of 7p-hydroxycholesterol

on growth and membrane composition of Mycoplasma capricolum. FEB S Lett. 232:354-

358.

123. Lewin, B. 1987. Genes IIL John Wiley & Sons, New York.

124. Lim, P. -O., and B. B. Sears. 1991. The genome size of a plant-pathogenic

mycoplasmalike organism resembles those of animal mycoplasmas. J. Bacteriol.

173:2128-2130.

125. Lo, S. 1992. Mycoplasmas and AIDS, p. 525-545. In J. Maniloff, R. N. McElhaney, L.

R. Finch and J. B. Baseman (ed.). Mycoplasmas: molecular biology and pathogenesis.

American Society for Microbiology, Washington, D.C.

126. Lo, S.-C. 1986. Isolation and identification of a novel virus from patients with AIDS.

Am. J. Trop. Med. Hyg. 35:675-676.

127. Lo, S.-C., J. W.-K. Shih, P. B. I. Newton, D. M. Wong, M. M. Hayes, J. R. Benish,

D. J. Wear, and R. Y. Wang. 1989. Virus-like infectious agent (VLIA) is a novel

pathogenic mycoplasma: Mycoplasma incognitus. Am. J. Trop. Med. Hyg. 41:586-600.

128. Loechel, S., J. M. Inamine, and P. Hu. 1991. A novel translation initiation region from

Mycoplasma genitalium that functions in Escherichia coli. Nucleic Acids Res. 19:6905-

6911.

129. Loechel, S., J. M. Inamine, and P.-C. Hu. 1989. Nucleotide sequence of the deoC gene

of Mycoplasma pneumoniae. Nucleic Acids Res. 17:801.

130. Lorenz, A., W. Just, M. da Silva Cardoso, and G. Klotz. 1988. Electroporation-

mediated transfection of Acholeplasma laidlawii with mycoplasma virus LI and L3 DNA.

J. Virol. 62:3050-3052. 131. Mahairas, G. G., J. Cao, and F. C. Minion. 1990. Genetic exchange of transposon and

integrative plasmid markers in Mycoplasma pulmonis. J. Bacteriol. 172:2267-2272.

132. Mahairas, G. G., C. Jian, and F. C. Minion. 1990. Development of a cloning system for

Mycoplasma pulmonis. Gene 93:61-65.

133. Mahairas, G. G., and F. C. Minion. 1989. Random insertion of the gentamicin

resistance transposon Tn'/OO/ in Mycoplasma pulmonis. Plasmid 21:43-47.

134. Mahairas, G. G., and F. C. Minion. 1989. Transformation of Mycoplasma pulmonis:

demonstration of homologous recombination, introduction of cloned genes, preliminary

description of an integrating shuttie system. J. Bacteriol. 171:1775-1780.

135. Maniloff, J. 1983. Evolution of wall-less prokaryotes. Annu. Rev. Microbiol. 37:477-

499.

136. Maniloff, J. 1992. Phylogeny of mycoplasmas, p. 549-559. In J. Maniloff, R. N.

McElhaney, L. R. Finch and J. B. Baseman (ed.). Mycoplasmas: molecular biology and

pathogenesis. American Society for Microbiology, Washington, D.C.

137. Maniloff, J., K. Dybvig, and T. L. Sladek. 1992. Mycoplasma DNA restriction and

modification, p. 325-330. In J. Maniloff, R. N. McElhaney, L. R. Finch and J. B.

Baseman (ed.). Mycoplasmas: molecular biology and pathogenesis. American Society

for Microbiology, Washington, D.C.

138. Manoil, C., J. J. Mekalanos, and J. Beckwith. 1990. Alkaline phosphatase fusions:

sensors of subcellular location. J. Bacteriol. 172:515-518.

139. Manolukas, J. T., M. F. Barile, D. K. F. Chandler, and D. Pollack. 1988. Presence of

anaplerotic reactions and transaminations, and the absence of the tricarboxylic acid cycle

in mollicutes. J. Gen. Microbiol. 134:791-800.

140. Marais, A., J. Renaudin, J. B. Baseman, and J. M. Bove. 1992. Expression in

Spiroplasma citri of an epitope carried on the G fragment of cytadhesin PI gene from 103

Mycoplasma pneumoniae. 9th International Congress of the International Organization

for Mycoplasmology 2:66.

141. McCarthy, J. E. G., and C. Gualerzi. 1990. Translational control of prokaryotic gene

expression. Trends in Genetics 6:

142. McElhaney, R. N. 1992. Lipid incorporation, biosynthesis, and metabolism, p. 231-

258. In J. Maniloff, R. N. McElhaney, L. R. Finch and J. B. Baseman (ed.).

Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology,

Washington, D.C.

143. McLaughlin, J. R., C. L. Murray, and J. C. Rabinowitz. 1981. Unique features in the

ribosome binding site sequence of the gram-positive Staphylococcus aureus (^-lactamase

gene. J. Biol. Chem. 256:11283-11291.

144. Miles, R. J. 1992. Cell nutrition and growth, p. 23-40. In J. Maniloff, R. N.

McElhaney, L. R. Finch and J. B. Baseman (ed.). Mycoplasmas: molecular biology and

pathogenesis. American Society for Microbiology, Washington, D.C.

145. Miles, R. J., A. E. Beezer, and D. H. Lee. 1986. Growth of Mycoplasma mycoides

subspecies mycoides on media containing various sugars and amino sugars: an ampoule

microcalorimetric study. Microbios. 45:7-19.

146. Miles, R. J., B. J. Wadher, C. L. Henderson, and K. Mohan. 1988. Increased yields of

Mycoplasma spp. in the presence of pyruvate. Lett. Appl. Microbiol. 7:149-151.

147. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor, Cold Spring

Harbor.

148. Miller, J. H. 1980. The lad gene: Its role in lac operon control and its use as a genetic

system, p. 31-88. In J. H. Miller and W. S. Reznikoff (ed.). The Operon. Cold Spring

Harbor Laboratory, Cold Spring Harbor, New York. 104

149. Minion, F. C., and J. D. Goguen. 1985. Identification and preliminary characterization

of a membrane-bound endonuclease in Mycoplasma pulmonis. Infect. Immun. 51:352-

354.

150. Mitchell, A., and L. R. Finch. 1977. Pathways of nucleotide biosynthesis in

Mycoplasma mycoides subsp. mycoides. J. Bacteriol. 130:1047-1054.

151. Moran, C. P., Jr., M. Lang, S. F. J. LeGrice, M. Stephens, A. L. Sonenshein, J. Pero,

and R. Losick. 1982. Nucleotide sequences that signal initiation of transcription and

translation in Bacillus subtilis. Mol. Gen. Genet. 186:339-346.

152. Morisato, D., J. C. Way, H.-J. Kim, and N. Kleckner. 1983. TnlO transposase acts

preferentially on nearby transposon ends in vivo. Cell 32:799-807.

153. Morowitz, H. J. 1967. Biological self-replicating systems. Prog. Theoret. Biol. 1:35-58.

154. Morowitz, H. J., H. R. Bode, and G. R. Kirk. 1967. The nucleic acids of

mycoplasmas. Ann. N.Y. Acad. Sci. 143:110-114.

155. Morowitz, H. J.; and D. C. Wallace. 1973. Genome size and life cycle of the

mycoplasmas. Ann. N. Y. Acad. Sci. 225:62-73.

156. Morrison, D. A., and B. Jaurin. 1990. Streptococcus pneumoniae possesses canonical

Escherichia coli (Sigma 70) promoters. Mol. Microbiol. 4:1143-1152.

157. Mouches, C., T. Candresse, G. Barroso, C. Saillard, H. Wroblewski, and J. Bove.

1985. Gene for spiralin, the major membrane protein of the helical mollicute Spiroplasma

citri: cloning and expression in Escherichia coll. J. Bacteriol. 164:1094-1099.

158. Mulligan, M. E., D. K. Hawley, R. Entriken, and McClure. 1984. Escherichia coli

sequences predict in vitro RNA polymerase selectivity. Nucleic Acids Res. 12:789-900.

159. Mulligan, M. E., and W. R. McClure. 1986. Analysis of the occurrence of promoter

sites in DNA. Nucleic Acids Res. 14:109-126.

160. Muto, A., Y. Andachi, F. Yamao, R. Tanaka, and S. Osawa. 1992. Transcription and

translation, p. 331-347. In J. Maniloff, R. N. McElhaney, L. R. Finch and J. B. 105

Baseman (éd.), Mycoplasmas: molecular biology and pathogenesis. American Society

for Microbiology, Washington, D.C.

161. Muto, A., Y. Andachi, H. Yuzawa, F. Yamao, and S. Osawa. 1990. The organization

and evolution of transfer RNA genes in Mycoplasma capricolum. Nucleic Acids Res.

18:5037-5043.

162. Muto, A., Y. Kawauchi, F. Yamao, and S. Osawa. 1984. Preferential use of A- and U-

rich codons for Mycoplasma capricolum ribosomal proteins S8 and L6. Nucleic Acids

Res. 12:8209-8217.

163. Muto, A., and S. Osawa. 1987. The guanine and cytosine content of genomic DNA and

bacterial evolution. Proc. Natl. Acad. Sci. USA 84:166-169.

164. Nagai, H., H. Yuzawa, and T. Yura. 1991. Regulation of the heat shock response in E.

coli: Involvement of positive and negative cis-acting elements in translational control of

sigma-32 synthesis. Biochimie 73:1473-1479.

165. Naglich, J. G., and R. E. Andrews Jr. 1988. Tn9/6-dependent conjugal transfer of

pC194 and pUBl 10 from Bacillus subtilis into Bacillus thuringiensis subsp. israelensis.

Plasmid 20:113-126.

166. Neale, G., A. Mitchell, and L. Finch. 1984. Uptake and utilization of deoxynucleoside

5'-monophosphates by Mycoplasma mycoides subsp. mycoides. J. Bacteriol. 158:943-

947.

167. Neimark, H. 1979. Phylogenetic relationships between mycoplasmas and other

prokaryotes, p. 43-61. In M. F. Barile and S. Razin (ed.), The Mycoplasmas. Academic

Press, Inc., New York.

168. Neimark, H. C., and J. London. 1982. Origins of the mycoplasmas: sterol-nonrequiring

mycoplasmas evolved from streptococci. J. Bacteriol. 150:1259-1265.

169. Nocard, E., and E. R. Roux. 1898. Le microbe de la peripneumonie. Ann. Inst. Pasteur

Paris 12:240-262. 170. Notarnicola, S. M., M. A. Mcintosh, and K. S. Wise. 1990. Multiple translation

products from a Mycoplasma hyorhinis gene expressed in Escherichia coli. J. Bacteriol.

172:2986-2995.

171. O'Neill, M. C., and F. Chiafari. 1989. Escherichia coli promoters. II. A spacing class-

dependent promoter search protocol. J. Biol. Chem. 264:5531-5534.

172. Ohkubo, S., A. Muto, Y. Kawauchi, F. Yamao, and S. Osawa. 1987. The ribosomal

protein gene cluster of Mycoplasma capricolum. Mol. Gen. Genet. 210:314-322.

173. Oliphant, A. R., and K. Struhl. 1988. Defining the consensus sequences of E. coli

promoter elements by random selection. Nucleic Acids Res. 16:7673-7683.

174. Phadnis, S. H., C Saskawa, and D. E. Berg. 1986. Localization of action of the IS50-

encoded transposase protein. Genetics 112:421-427.

175. Piatt, T. 1986. Transcription termination and the regulation of gene expression. Annu.

Rev. Biochem. 55:339-372.

176. Pollack, J. D. 1992. Carbohydrate metabolism and energy conservation, p. 181-200. In

J. Maniloff, R. N. McElhaney, L. R. Finch and J. B. Baseman (ed.). Mycoplasmas:

molecular biology and pathogenesis. American Society for Microbiology, Washington,

D.C.

177. Poulson, D., and B. Sakaguchi. 1961. Nature of "sex-ratio" agent in Drosophilia.

Science 133:1489-1490.

178. Pruss, G. J., and K. Drlica. 1989. DNA supercoiling and prokaryotic transcription. Cell

56:521-523.

179. Pyle, L. E., T. Taylor, and L. R. Finch. 1990. Genomic maps of some strains within the

Mycoplasma mycoides cluster. J. Bacteriol. 172:7265-7268.

180. Raibaud, O., and M. Schwartz. 1984. Positive control of transcription initiation in

bacteria. Annu. Rev. Genet. 18:173-206. 107

181. Razin, S. 1969. Structure and function in mycoplasmas. Annu. Rev. Microbiol. 23:317-

356.

182. Razin, S. 1978. The mycoplasmas. Microbiol. Rev. 42:414-470.

183. Razin, S. 1982. Sterols in mycoplasma membranes, p. 183-205. In S. Razin and S.

Rottem (ed.). Current topics ub membranes and transport. Volume 17: Membrane lipids

of prokaryotes. Academic Press, Inc., New York.

184. Razin, S. 1985. Molecular biology and genetics of mycoplasmas (Mollicutes). Microbiol.

Rev. 49:419-455.

185. Razin, S. 1992. Mycoplasma taxonomy and ecology, p. 3-22. In J. Maniloff, R. N.

McElhaney, L. R. Finch and J. B. Baseman (ed.), Mycoplasmas: molecular biology and

pathogenesis. American Society for Microbiology, Washington, D.C.

186. Razin, S., and E. A. Freundt. 1984. The Mollicutes, Mycoplasmatales and

Mycoplasmaataceae, p. 740-793. In N. R. Krieg and J. G. Holt (ed.), Bergey's Manual

of Systematic Bacteriology. Williams & Wilkins, Baltimore.

187. Renaudin, J. 1992. Single-stranded circular DNA viruses of spiroplasmas. 9th

International Congress of the International Organization for Mycoplasmology 2:6.

188. Renaudin, J., P. Aullp, J. C. Vignault, and J. M. Bove. 1990. Complete nucleotide

sequence of the genome of Spiroplasma citri virus SpVl-R8A2B. Nucleic Acids Res.

18:1145-1152.

189. Renbaum, P., D. Abrahamove, A. Fainsod, G. G. Wilson, S. Rottem, and A. Razin.

1990. Cloning, characterization, and expression in Escherichia colt of the gene cosing for

the CpG DNA methylase from Spiroplasma sp. strain MQl(M.Sssl). Nucleic Acids Res.

18:1145-1152.

190. Reznikoff, W. S. 1992. Catabolite gene activator protein activation of lac transcription. J.

Bacteriol. 174:655-657. 191. Reznikoff, W. S., and J. N. Abelson. 1980. The lac promoter, p. 221-243. In J. H.

Miller and W. S. Reznikoff (ed.). The operon. Cold Spring Harbor Laboratory, Cold

Spring Harbor, New York.

192. Reznikoff, W. S., and W. R. McClure. 1986. E. coli promoters, p. 1-33. In W. S.

Reznikoff and L. Gold (ed.). Maximizing gene expression. Butterworths, Boston.

193. Riabaud, O., and M. Schwartz. 1984. Positive control of transcription initiation in

bacteria. Annu. Rev. Genet. 18:173-206.

194. Roberts, M. C. 1990. Characterization of the Tet M determinants in urogenital and

respiratory bacteria. Antimicrob. Agents Chemother. 34:476-478.

195. Roberts, M. C., and G. E. Kenny. 1986. Dissemination of the tetM tetracycline

resistance to Ureaplasma urealyticum. Antimicrob. Agents Chemother. 29:350-352.

196. Roberts, M. C., and G. E. Kenny. 1987. Conjugal transfer of transposon Tn9/(5 from

Streptococcus faecalis to Mycoplasma hominis. J. Bacteriol. 169:3836-3839.

197. Roberts, M. C., L. A. Koutsky, K. K. Holmes, D. J. LeBlanc, and G. E. Kenny. 1985.

Tetracycline-resistant Mycoplasma hominis strains contain streptococcal tetM sequences.

Antimicrob. Agents Chemother. 28:141-143.

198. Robertson, J. A., L. E. Pyle, G. W. Stemke, and L. R. Finch. 1990. Human

ureaplasmas show diverse genome sizes by pulse-field electrophoresis. Nucleic Acids

Res. 18:1451-1455.

199. Robinson, I. M. 1973. Isolation and characterization of anaerobic mycoplasmas from the

rumen. M. S. Thesis. Iowa State University, Ames, Iowa.

200. Robinson, I. M., and M. J. Allison. 1975. Transfer of Acho leplasma bactoclasticum

Robinson and Hungate to the genus Anaeroplasma {Anaeroplasma bactoclasticum

[Robinson and Hungate] comb, nov.) Emended description of the species. Int. J. Syst.

Bacteriol. 25:182-186. 109

201. Robinson, I. M., M. J. Allison, and P. A. Hartman. 1975. Aneroplasma bactoclasticum

gen. nov., sp. nov.: An obligately anaerobic mycoplasma from the rumen. Int. J. Syst.

Bacteriol. 25:173-181.

202. Rodwell, A. W. 1969. A defined medium for mycoplasma strain Y. J. Gen. Microbiol.

58:39-47.

203. Rodwell, A. W. 1969. Nutrition and metabolism of the mycoplasmas, p. 413-449. In L.

Hayflick (ed.). The Mycoplasmatales and L-Phase of bacteria. Appleton-Century-Crofts,

New York.

204. Rodwell, A. W. 1983. Defined and partly defined media, p. 163-172. In S. Razin and J.

G. Tally (ed.), Methods in Mycoplasmology. Volume I. Mycoplasma Characterization.

Academic Press, New York.

205. Rodwell, A, W., and A. Mitchell. 1979. Nutrition, growth and reproduction, p. 103-

109. In M. F. Barile and S. Razin (ed.). The Mycoplasmas. Academic Press, Inc., New

York.

206. Rogers, M. J., A. A. Steinmetz, and R. T. Wolker. 1986. The nucleotide sequence of a

tRNA gene cluster from Spiroplasma melliferum. Nucleic Acids Res. 14:3145.

207. Romano, N., S. Rottem, and S. Razin. 1976. Biosynthesis of saturated and unsaturated

fatty acids by a T-strain mycoplasma (Ureaplasma). J. Bacteriol. 128:170-173.

208. Rothstein, S. J., R. A. Jorgensen, K. Postle, and W. S. Reznikoff. 1980. The inverted

repeats of Tn5 are functionally different Cell 19:795-805.

209. Rottem, S., Adar, L., Gross, Z., Ne'eman, Z., and Davis, P.J. 1986. Incorporation and

modification of exogenous phosphatidylcholines by mycoplasmas. J. Bacteriol.

167:299-304.

210. Rymond, B. R., R. S. Zitomer, D. Schumperli, and M. Rosenberg. 1983. The

construction and expression in yeast of CYCI-galK fusion genes. Gene 25:249-262. 110

211. Saglio, P., M. Lhospital, D. LaFPche, G. Dupont, J. M. Bove, J. G. Tully, and E. A.

Freundt. 1973. Spiroplasma citri gen. and sp. n.: A mycoplasma-like organism

associated with "stubborn" disease of citrus. Int. J. Syst. Bacteriol. 23:191-204.

212. Salvado, J., G. Barroso, and J. Labarere. 1989. Involvement of a Spiroplasma citri

plasmid in the erythromycin-resistance transfer. Plasmid 22:151-159.

213. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning; a laboratory

manual. Cold Spring Harbor Laboratory, Cold Spring Harbor.

214. Samuelsson, T., Y. Guindy, F. Lustig, T. Boren, and U. Lagerkvist. 1987. Apparent

lack of discrimination in the reading of certain codons in Mycoplasma mycoides. Proc.

Natl. Acad. Sci, USA 84:3166-3170.

215. Sawada, M., A. Muto, M. Iwami, F. Yamao, and S. Osawa. 1984. Organization of

ribosomal RNA genes in Mycoplasma capricolum. Mol. Gen. Genet. 196:311-316.

216. Sawada, M., S. Osawa, H. Kobayashi, H. Hori, and A. Muto. 1981. The number of

ribosomal RNA genes in Mycoplasma capricolum. Mol. Gen. Genet. 182:502-504.

217. Schleif, R. F., and P. C. Wensink. 1981. Practical methods in molecular biology.

Springer-Verlag, New York.

218. Shepard, M. C. 1954. The recovery of pleuropneumonia-like organisma from negro men

with and without nongonococcal urethritis. Am. J. Syph. Gonnorrhea Vener. Dis.

38:113-124.

219. Shepard, M. C., C. D. Lunceford, D. K. Ford, R. H. Purcell, D. Taylor-Robinson, S.

Razin, and F. T. Black. 1974. Ureaplasma urealyticum gen. nov., sp. nov: proposed

nomenclature for the human T (T-strain) mycoplasma. Int. J. Syst. Bacteriol. 24:160-

171.

220. Shepard, M. C., and G. K. Masover. 1979. Special features of ureaplasmas, p. 451-

494. In M. F. Barile and S. Razin (ed.), The mycoplasmas. Cell biology. Academic

Press, Inc., New York. 221. Silhavy, T. J., and J. R. Beckwith. 1985. Uses of lac fusions for the study of biological

problems. Microbiol. Rev. 49:398-418.

222. Simecka, J. W., J. K. Davis, M. K. Davidson, S. E. Ross, C. T. K. Stadtlander, and

G. H. Cassell. 1992. Mycoplasma diseases of animals, p. 391-415. In J. Maniloff, R.

N. McElhaney, L. R. Finch and J. B. Baseman (ed.). Mycoplasmas: molecular biology

and pathogenesis. American Society for Microbiology, Washington, D. C.

223. Simons, R., F. Houman, and N. Kleckner. 1987. Improved single and multicopy /de­

based cloning vectors for protein and operon fusions. Gene 53:85-96.

224. Sladek, T. L., and J. Maniloff. 1983. Polyethylene glycol-dependent transformation of

Acholeplasma laidlawii with mycoplasma virus L2 DNA. J. Bacteriol. 155:734-741.

225. Sladek, T. L., and J. Maniloff. 1983. Polyethylene glycol-dependent transformation of

Acholeplasma laidlawii with mycoplasma virus L2 DNA. J. Bacteriol. 155:734-741.

226. Smith, P. F. 1971. Dynamics of reproduction and growth, p. 99-161. In P. F. Smith

(ed.), The Biology of Mycoplasmas. Academic Press, Inc., New York.

227. Smith, P. F. 1992. Membrane lipid and lipopolysaccharide structures, p. 79-91. In J.

Maniloff, R. N. McElhaney, L. R. Finch and J. B. Baseman (ed.). Mycoplasmas:

molecular biology and pathogenesis. American Society for Microbiology, Washington,

D.C.

228. Sohaskey, C. D., H. Im, and A. T. Schauer. 1992. Construction and application of

plasmid- and transposon-based promoter-probe vectors for Streptomyces spp. that

employ a Vibrio harveyi luciferase reporter cassette. J. Bacteriol. 174:367-376.

229. Stachel, S. E., G. An, C. Flores, and E. W. Nester. 1985. A Ta? lacZ transposon for

the random generation of P-galactosidase gene fusions: application to the analysis of gene

expression in Agrobacterium. EMBO J. 4:891-898. 112

230. Stamburski, C., J. Renaudin, and J. M. Bove. 1990. Characterization of a promoter and

a transcription terminator of Spiroplasma melliferum virus Spv4. J. Bacteriol. 172:5586-

5592.

231. Stamburski, C., J. Renaudin, and J. M. Bove. 1991. First step towards a virus-derived

vector for gene cloning and expression in spiroplasmas, organisms which read UGA as a

tryptophan codon: synthesis of chloramphenicol acetyltransferase in Spiroplasma citri. J.

Bacteriol. 173:2225-2230.

232. Stamburski, C., J. Renaudin, and J. M. Bove. 1992. Mutagenesis of a tryptophan codon

from TGG to TGA in the cat gene does not prevent its expresson in the helical moUicute

Spiroplasma citri. Gene 110:133-134.

233. Stefano, J. E., and J. D. Gralla. 1982. Spacer mutations in the lac p^ promoter. Proc.

Natl. Acad. Sci. USA 79:1069-1072.

234. Stormo, G. D., T. D. Schneider, and L. Gold. 1986. Quantitative analysis of the

relationship between nucleotide sequence and functional activity. Nucleic Acids Res.

14:6661-6679.

235. Stragier, P., and R. Losick. 1990. Cascades of sigma-factors revisited. Mol. Microbiol.

4:1801-1806.

236. Su, C. J., and J. B. Baseman. 1990. Genome size of Mycoplasma genitalium. J.

Bacteriol. 172:4705-4707.

237. Su, C. J., V. V. Tyron, and J. B. Baseman. 1987. Cloning and sequence analysis of

cytadhesion PI gene from Mycoplasma pneumoniae. Infect. Immun. 55:3023-3029.

238. Sueoka, N. 1962. On the genetic basis of variation and heterogeneity of DNA base

composition. Proc. Natl. Acad. Sci. USA 48:582-592.

239. Sundstrom, T. K., and A. Wieslander. 1990. Plasmid transformation and replica filter

plating of Acholeplasma laidlawii. FEMS Microbiol. Lett. 72:147-152. 113

240. Tadayyon, M., and J. K. Broome-Smith. 1992. TnhlaM: transposon for directly tagging

bacterial genes encoding cell envelope and secreted proteins. Gene 111:21-26.

241. Tanaka, R., A. Muto, and S. Osawa. 1989. Nucleotide sequence of tryptophan tRNA

gene in Acholeplasma laidlawii. Nucleic Acids Res. 17:5842.

242. Taschke, C., and R. Herrmann. 1985. Analysis of transcription and processing signals

in the 5'-regions of the two Mycoplasma capricolum rRNA opérons. Mol. Gen. Genet.

212:522-530.

243. Taschke, C., M.-Q. Klinkert, J. Wolters, and R. Herrmann. 1986. Organization of the

ribosomal RNA genes in Mycoplasma hyopneumoniae: the 5S rRNA gene is separated

from the 16S and 23S rRNA genes. Mol. Gen. Genet. 205:428-433.

244. Taylor-Robinson, D., G. W. Csonka, and M. J. Prentice. 1977. Human intra-urethral

inoculation of ureaplasmas, Q. J. Med. 46:309-326.

245. Tennent, J. M., S. Hultgren, B. Marklund, K. Forsman, M. Goransson, B. E. Uhlin,

and S. Normark. 1990. Genetics of adhesion expression in Escherichia coli, p. 79-110.

In B. H. Iglewski and V. L. Clark (ed.). Molecular Basis of Bacterial Pathogenesis.

Academic Press, Inc., San Diego.

246. Tourtellotte, M. E., H. J. Morowitz, and P. Kasimer. 1964. Defined medium for

Mycoplasma laidlawii. J. Bacteriol. 88:11-15.

247. Towbin, H., T. Starhelim, and J. Gordon. 1979. Electrophoretic transfer of proteins

from polyacrylamide gels to nitrocellulose sheets: procedure and some application. Proc.

Natl. Acad. Sci. USA 76:4350-4354.

248. Travers, A. A. 1984. Conserved features of coordinately regulated E. coli promoters.

Nucleic Acids Res. 12:2605-2618.

249. Tryon, V. V., and J. B. Baseman. 1987. The acquisition of human lactoferrin by

Mycoplasma pneumoniae. Micro. Pathog. 3:437-443. 250. Tully, J. G. 1984. Family II. Acholeplasmataceae, p. 775-781. In R. Krieg and J. G.

Holt (ed.), Bergey's manual of systematic bacteriology. Williams & Wilkins, Baltimore.

251. Tully, J. G. 1989. Class Mollicutes: new perspectives from plant and arthropod studies,

p. 1-31. In R. F. Whitcomb and J. G. Tully (ed.), The Mycoplasmas. Spiroplasmas,

Acholeplasmas, and Mycoplasmas of Plants and Arthropods. Academic Press, Inc., San

Diego, Calif.

252. Velazquez, L., L. Camarena, J. L. Reyes, and F. Bastarrachea. 1991. Mutations

affecting the shine-dalgamo sequences of the untranslated region of the Escherichia coli

gltBDF operon. J. Bacteriol. 173:3261-3264.

253. Voelker, L. L., S. Hirsch, K. E. Weaver, and L. R. Washburn. 1992. Identification of a

Mycoplasma arthritidis extrachromosomal DNA element 9th International Congress of

the International Organization for Mycoplasmology 2:105.

254. Void, B. S. 1985. Structure and organization of genes for transfer ribonucleic acid in

Bacillus subtilus. Microbiol. Rev. 49:71-80.

255. Wallace, D. C., and H. J. Morowitz. 1973. Genome size and evolution. Chromosoma

40:121-126.

256. Way, J. C., M. A. Davis, D. Morisato, D. E. Roberts, and N. Kleckner. 1984. New

Tn70 derivatives for transposon mutagenesis and for construction of lacZ operon fusions

by transposition. Gene 32:369-379.

257. Weisburg, W. G., J. G. Tully, D. L. Rose, J. L. Petzel, H. Oyaizu, D. Yang, L.

Mandelco, J. Sechrest, T. G. Lawrence, J. V. Etten, J. Maniloff, and C. R. Woese.

1989. A phylogenetic analysis of the mycoplasmas: basis for their classification. J.

Bacteriol. 171:6455-6467.

258. Wenzel, R., and R. Herrmann. 1989. Cloning of the complete Mycoplasma pneumoniae

genome. Nucleic Acids Res. 17:7029-7043. 115

259. Whitcomb, R. F., and J. G. Tully. 1984. Family III. Spiroplasmataceae., p. 781-787.

In N. R. Krieg and J. G. Holt (ed.), Sergey's manual of systematic bacteriology.

Williams and Wilkins, Baltimore.

260. Whitley, J. C., and L. R. Finch. 1989. Location of sites of transposon Tn9I6 insertion

in the Mycoplasma mycoides genome. J. Bacteriol. 171:6870-6872.

261. Williams, M. V., and J. D. Pollack. 1990. A moUicute (mycoplasma) DNA repair

enzyme: purification and characterization of uracil-DNA glycosylase. J. Bacteriol.

172:2979-2985.

262. Yager, T. D., and P. H. von Hippel. 1987. Transcription elongation and termination in

Escherichia coli, p. 1241-1275. In F. C. Niedhardt, J. L. Ingraham, B. Magasanik, K.

B. Low, M. Schaechter and H. E. Umbarger (ed.), Escherichia coli and Salmonella

typhimurium: Cellular and Molecular Biology. American Society for Microbiology,

Washington, D.C.

263. Yamao, F., Y. Andachi, A. Muto, T. Ikemura, and S. Osawa. 1991. Levels of transfer

RNAs in bacterial cells as affected by amino acid usage in proteins. Nucleic Acids Res

19:6119-6122.

264. Yamao, F., S. Iwagami, Y. Azumi, A. Muto, S. Osawa, N. Fujita, and A. Ishihama.

1988. Evolutionary dynamics of tryptophan tRNAs in Mycoplasma capricolum. Mol.

Gen. Genet. 212:364-369.

265. Yamao, F., A. Muto, Y. Kawauchi, M. Iwami, S. Iwagami, Y. Azumi, and S. Osawa.

1985. UGA is read as tryptophan in Mycoplasma capricolum. Proc. Natl. Acad. Sci.

USA 82:2306-2309.

266. Yanofsky, C. 1981. Attenuation in the control of expression of bacterial opérons. Nature

289:751-758. 116

267. Youngman, P. 1987. Plasmid vectors for recovering and exploiting Tn9/7 transpositions

in Bacillus and other Gram-positive bacteria, p. 79-103. In K. Hardy (éd.), Plasmids: a

practical approach. IRL Press, Oxford.

268. Youngman, P., P. Zuber, J. B. Perkins, K. Sandman, M. Igo, and R. Losick. 1985.

New ways to study developmental genes in spore-forming bacteria. Science 228:285-

291. 117

APPENDIX A: SEQUENCES UPSTREAM OF LACZ IN THE pISM2050 FUSION

PLASMIDS 118

Frame 2 Pro Val UKN Leu UKN Leu Ser Met Lys Asn Ser Gin lie Leu Val Lys UKN CCA GTG GNC CTC ATN CTG AGT ATG AAA AAC TCC CAA ATC TTG GTC AAG NAG 10 19 28 37 46

Val UKN Tyr Tyr TER Tyr Leu Thr Leu Pro UKN Leu Asn Lys Lys Val TER UKN Asn GTA CNT TAT TAT TAG TAT CTG ACT CTA CCA ATN CTG AAC AAG AAG GTT TGA NTC AAT 61 70 79 88 97 106

Leu Asn Leu Lys Leu Val Asn Pro Leu Thr Asn Ser Ser Gin Glu Phe Gin Asp Val CTG AAT CTA AAG TTG GTA AAT CCA TTA ACG AAC TCT TCA CAA GAA TTC CAG GAC GTA 118 127 136 145 154 163

Leu Leu Leu Gin Pro Leu His Pro Thr Cys Ile Glu Phe Asn Lys Leu Leu Lys His TTA TTA TTG CAA CCT TTG CAT CCA ACT TGT ATC GAA TTC AAC AAA TTA TTG AAG CAT 175 184 193 202 211 220

Leu Asn TER Gin Val Glu Lys Leu Leu Phe Leu Asp Val Leu Trp Asn Val Leu Leu CTG AAT TAA CAG GTA GAA AAG TTG CTG TTT TTG GAC GTT CTA TGG AAC GTG CTA TTG 232 241 250 259 268 277

-35 Arg Leu Asp Asn Asn Gin Ala Ile Leu Asn Leu Glu Lys Val His Ser Leu His Leu AGG CTG GAC AAC AAT CAG GCT ATA TTA AAC CTA GAA AAG GTA CAT TCA CTG CAC CTG 289 298 307 316 325 334

-10 * Lys Asn Tyr Ile Asn Ile Asn Leu Lys Lys Leu Val Phe Trp Leu Leu Val Pro Lys AAG AAC TAC ATA AAT ATA AAC TTG AAS AAA CTT GTA TTT TGG TTA CTG GTT CCC AAG 346 355 364 373 382 391

rbs start Val Asn His Leu Gin His Tyr Gin Glu Leu Leu Met Asp Pro Val Val GTG AAC CAC TTG CAG CAT TAT C^A GAA TTG CTA ATG GAT CCC GTC GTT TT 403 412 421 430 439

Figure Al. Sequence upstream of the lacZ gene in pISM2050.1. The lacZ- chromosomal DNA

fusion is shown in bold (GATC). The putative -35 and -10 promoter regions are

underlined and the translational start site is indicated by an (*). The potential

ribosomal binding site (rbs) and translational start site (start) is also underlined. The

potential ribosomal binding site was determined by aligning the sequence with the

last 15 bp at the 3' end of the 16S rRNA gene of A. laidlawii. 119

Frame 3 Val Leu Asp Glu Val Leu Lys His His Arg Tyr Ser Tyr Leu Asn TER Ser GTC TTG GAT GAA GTC TTA AAG CAC CAC CGA TAC TCA TAC CTG AAT TAA TCC 11 20 29 38 47

His lie Phe Leu Leu Tyr Asn Leu Gin Leu lie TER His Leu Leu His Met Arg lie CAT ATT TTC TTG CTT TAT AAC TTG CAG TTG ATA TAA CAC CTC TTG CAT ATG AGG ATT 62 71 80 89 98 107

Val Leu Gin Gin Gin Lys Pro Cys Phe TER Gly Lys Val Leu TER Val Ser Arg Met GTC CTC CAA CAA CAA AAA CCT TGT TTT TAA GGT AAG GTT CTT TAA GTA TCG CGC ATG 119 128 137 146 155 164

Leu Gin Arg Thr His Leu Ser Arg Tyr Glu Lys TER Phe TER Pro Phe Phe Ser Ser TTG CAA AGA ACG CAT TTA AGT CGA TAT GAA AAA TAA TTT TAG CCG TTT TTT TCA TCA 176 185 194 203 212 221

-35 -10 * rbs Leu Ser Ser Phe Asn Tyr Tyr Tyr lie Val TER Tyr Lys Lys Tyr Lys Ile Ile Trp TTA TCT TCC TTT AAT TAC TAT TAT ATA GTA TAA TAT AAA AAG TAT AAG ATT ATT TGG 233 242 251 260 269 278

rbs start Ser Asp Lys Met Ala Gin Asn Lys Thr Ala Thr Lys Glu Lys Ala Val Lys Pro Ala AGT GAT AAG ATG GCA CAA AAT AAG ACA GCA ACA AAA GAA AAG GCA GTA AAG CCT GCT 290 299 308 317 326 335

Lys Lys Glu Ser Leu Val Phe Lys Asp Pro Val Val AAA AAA GAA TCT TTA GTA TTT AAA GAT CCC GTC GTT TT 347 356 365 374

Figure A2. Sequence upstream of the lacZ gene in pISM2050.2. The lacZ- chromosomal DNA

fusion is shown in bold (GATC). The putative -35 and -10 promoter regions are

underlined and the translational start site is indicated by an (*). The potential

ribosomal binding site (rbs) and translational start site (start) is also underlined. The

potential ribosomal binding site was determined by aligning the sequence with the

last 15 bp at the 3' end of the 16S rRNA gene of A. laidlawii. 120

Frame 2 Arg Val Ser Asn lie lie Asn Tyr Val Thr Thr Ser Leu Ala lie Val Lys CGA OTA ACT .AAC ATT ATT AAC TAT GTA ACA ACA TCC TTA CCA ATT GTC AAA 10 19 28 37 46

Asp Asn Asp Phe Ala lie Val Glu Ser Phe Lys Arg Glu Val Met TER Phe Ile Gin GAT AAT GAT TTC GCA ATT GTA GAA TCA TTT AAA CGA GAG GTT ATG TAA TTT ATC CAA 61 70 79 88 97 106

Thr Phe Lys Gly lie UKN Val Ser Ser Gly Val Ala lie Pro Lys Ile His His Leu ACA TTT AAA GGC ATT GNG GTC TCC AGT GGA GTT GCA ATT CCA AAA ATA CAT CAC TTA 118 127 136 145 154 163

Ala Glu Thr Thr Gin Met Ser Leu Lys Lys Phe Ser Thr Asp Lys Asn Val Glu Leu GCT GAA ACC ACT CAG ATG AGC TTA AAA AAG TTT TCA ACG GAT AAA AAT GTT GAA CTT 175 184 193 202 211 220

-35 Asn Arg Phe Asn Glu Thr lie Lys Glu Ala Val Ser Gin Leu Glu Leu Leu Thr Leu AAT CGT TTT AAT GAA ACG ATT AAA GAA GCT GTT TCT CAA TTA GAA TTA CTT ACG CTA 232 241 250 259 268 277

-10 * rbs Gin Ser Lys Thr Glu Ile Gly Gin Val His Ala Glu Ile Phe Ser Ala Gin Thr Leu CAA TCT AAA ACC GAA ATT GGT CAA GTA CAT GCT GAA ATC TTT AGT GCA CAA ACA CTG 289 298 307 316 325 334 start Met Leu Lys Asp Pro Val Val ATG TTA AAA GAT CCC GTC GTT TT 346 355

Figure A3. Sequence upstream of the lacZ gene in pISM2050.8. The lacZ- chromosomal DNA

fusion is shown in bold (GATC). The putative -35 and -10 promoter regions are

underlined and the transladonal start site is indicated by an (*). The potential

ribosomal binding site (rbs) and translational start site (start) is also underlined. The

potential ribosomal binding site was determined by aligning the sequence with the

last 15 bp at the 3' end of the 16S rRNA gene of A. laidlawii. 121

Frame 2 Ser UKN lie Thr Gin Pro lie UKN UKN Glu Val Ser UKN UKN Ser Phe Glu AGT AGN ATC ACT CAA CCA ATA ATN NTT GAA GTC TCT NAA NCC AGT TTT GAA 10 19 28 37 46

Tyr Val Asn Thr UKN UKN lie UKN UKN Asp Ala Asn lie Pro Arg Gly Ser Phe Tyr TAT GTG AAT ACN CNA NAC ATT ATN NAA GAT GCT AAT ATT CCA AGA GGG TCT TTT TAC 61 70 79 88 97 106

Gin Tyr Phe Glu Asp Lys UKN Asp Met Tyr Glu Tyr lie Met Asp Tyr lie Ser Ser CAG TAC TTT GAA GAT AAG NCG GAT ATG TAT GAA TAT ATC ATG GAT TAT ATT AGT TCA 118 127 136 145 154 163

lie Lys Arg Tyr Tyr Phe Lys Ser lie Phe Glu Ala Val Asn Leu Asn Phe lie Glu ATA AAA AGA TAT TAT TTT AAA AGT ATA TTT GAA GCA GTG AAT CTG AAT TTT ATA GAG 175 184 193 202 211 220

Arg lie Glu Ala lie Tyr Leu Ala Gly Val Lys Phe Lys Ser Glu Asn Pro Asp Phe CGA ATA GAG GCA ATT TAT TTA GCG GGT GTA AAA TTT AAG TCC GAG AAC CCT GAT TTT 232 241 250 259 268 277

-35 -10 * Val Arg Ala Gly Glu Phe Met Leu Lys Ser Pro Leu Tyr Leu Asn Asn Pro Ser Val GTA AGA GCA GGA GAA TTC ATG CTT AAA TCA CCT TTA TAT TTA AAT AAT CCA TCA GTA 289 298 307 316 325 334

rbs start UKN Lys Gly Leu Glu Gin Met lie Ser lie Tyr Glu Ser Trp lie lie Asn Asp Pro NCC AAA GGT TTA GAA CAA ATG ATT TCA ATC TAC GAG TCT TGG ATT ATC AAT GAT CCC 346 355 364 373 382 391

Figure A4. Sequence upstream of the lacZ gene in pISM2050.18. The lacZ- chromosomal

DNA fusion is shown in bold (GATC). The putative -35 and -10 promoter regions

are underlined and the translational start site is indicated by an (*). The potential

ribosomal binding site (rbs) and translational start site (start) is also underlined. The

potential ribosomal binding site was determined by aligning the sequence with the

last 15 bp at the 3' end of the 16S rRNA gene of A. laidlawii. 122

Frame 1 Thr UKN UKN Arg UKN Gly Gly UKN Ser Lys Thr UKN UKN Val TER Asn Val ACC CNG CNN AGG NCN GGG GGN ANA TCA AAG ACA MGG GNC GTC TAG AAT GTA 9 18 27 36 45

TER Arg UKN TER Arg Val Arg TER UKN UKN Leu TER TER Arg Val Cys Ile Tyr Tyr TAG AGG AGN TGA AGA GTC AGA TAG TNC TNC TTA TAA TGA AGG GTA TGT ATC TAT TAC 60 69 78 87 96 105

UKN Phe Thr Val UKN Pro Tyr Gly Leu Ser Lys UKN Lys Ile Tyr His Gly Phe Lys NCC TTT ACA GTT TGN CCG TAC GGA CTT AGT AAA AAN AAA ATC TAT CAT GGA TTT AAA 117 126 135 144 153 162

rbs start His Leu Lys Thr Arg lie Lys Ile Gly Val Tyr Met Ser His Phe Phe Leu His Phe CAC TTA AAA ACT AGA ATT AAG ATT GGA GTT TAT ATG AGT CAT TTC TTT TTA CAT TTT 174 183 192 201 210 219

rbs start UKN UKN Glu Lys Ser Arg Val Leu Asp Met Glu Glu Val Ile Glu Phe Phe Asp Pro NTC NAA GAA AAA TCT AGA GTA CTT CAT ATG GAA GAA GTT ATT GAG TTT TTT GAT CCC 231 240 249 258 267 276

Val Val GTC GTT TT

Figure A5. Sequence upstream of the lacZ gene in pISM2050.19. The lacZ- chromosomal

DNA fusion is shown in bold (GATC). The potential ribosomal binding site (rbs)

and translational start site (start) is underlined. The potential ribosomal binding site

was determined by aligning the sequence with the last 15 bp at the 3' end of the 16S

rRNA gene of A. laidlawii. 123

Frame 3 Lys Phe Phe Tyr His Phe Asp Phe Glu Leu Phe Cys Leu Ser lie Ser Leu AAG TTT TTT TAT CAC TTT GAC TTT GAA CTC TTC TGC TTG TCT ATT TCA TTG 11 20 29 38 47

-35 -10 * rbs start Met Tyr Ser Tyr Met lie TER Tyr lie Arg Glu Ser TER Gly lie Gin Met Lys Tyr ATG TAT TCA TAC ATG ATA TAA TAT ATA CGC GAA ACT TGA GGA ATA CAA AIS AAA TAC 62 71 80 89 98 107

Leu Val Gly Thr Tyr Thr Lys Asn Leu Ser Glu Gly lie Tyr Leu Val Asp Glu Asp TTA GTT GGC ACT TAT ACT AAA AAT CTA TCC GAA GGT ATT TAC TTA GTT GAT GAG GAT 119 128 137 146 155 164

Lys Val Ser Leu His Met Arg Leu Phe Asn Pro Thr Tyr Phe Thr Leu Gin Glu Gly AAA GTC TCT TTA CAT ATG AGA TTA TTT AAT CCA ACT TAT TTT ACT TTA CAA GAA GGT 176 185 194 203 212 221

His Leu Phe Thr lie Ala Arg Gly Gly lie Glu Ile Tyr Gin Asp CAT TTA TTT ACA ATT GCT AGA GGA GGT ATT GAA ATA TAT CAG GAT C 233 242 251 260 269

Figure A6. Sequence upstream of the lacZ gene in pISM2050.25. The lacZ- chromosomal

DNA fusion is shown in bold (GATC). The putative -35 and -10 promoter regions

are underlined and the translational start site is indicated by an (*). The potential

ribosomal binding site (rbs) and translational start site (start) is also underlined. The

potential ribosomal binding site was determined by aligning the sequence with the

last 15 bp at the 3' end of the 16S rRNA gene of A. laidlawii. 124

Frame 1 Val Cys TER Lys Asp Gin Leu Tyr Met Ser Gly Met Arg Leu Phe Thr Val GTC TGC TGA AAG GAC CAG TTA TAT ATG AGT GGG ATG CGT CTG TTC ACG GTA 9 18 27 36 45

rbs start Gly Gly Leu Gly Glu Asn Gly Gly Asn Met Tyr Val Ile Asp Val Asp Lys Gin Tyr GGT GGA TTG GGT GAG AAC GGA GGA AAC ATG TAT GTC ATC GAT GTT GAC AAA CAA TAT 60 69 78 87 96 105

rbs Phe Ile Leu Asp Ala Gly Val Lys Tyr Pro Thr Gin Ala Leu Tyr Gly Val Asp Glu TTT ATT TTG GAT GCT GGT GTA AAG TAT CCC ACT CAA GCA CTC TAT GGA GTC G^T GAA 117 126 135 144 153 162

start Ile Ile Pro Asn Tyr Arg Met Leu Ile Asn Ile Lys Asp Arg Ile Lys Gly Ile Phe ATT ATT CCT AAT TAT AGA ATG TTA ATT AAT ATT AAA GAC CGT ATC AAA GGT ATC TTT 174 183 192 201 210 219

Leu Thr His Ala His Glu Asp Pro Val Val Leu Gin Arg Arg Asp Trp Glu Asn Pro TTA ACG CAT GCC CAT GAG GAT CCC GTC GTT TTA CAA CGT CGT GAC TGG GAA AAC CCT 231 240 249 258 267 276

Gly Val Ala GGC GTT GCC C 288

Figure Al. Sequence upstream of the lacZ gene in pISM2050.39. The lacZ- chromosomal

DNA fusion is shown in bold (GATC). The potential ribosomal binding site (rbs)

and translational start site (start) is underlined. The potential ribosomal binding site

was determined by aligning the sequence with the last 15 bp at the 3' end of the 16S

rRNA gene of A. laidlawii. 125

Frame 3 Gin Tyr Pro Asn UKN Leu Ser Pro Arg Val Gly Arg Phe lie Asn Ala Gly CAA TAC CCA AAC CNC CTC TCC CCG CGC GTT GGC CGA TTC ATT AAT GCA GGT 11 20 29 38 47

TER Pro Gly Leu Ser Lys Leu UKN Arg Leu Thr lie Gly Arg Pro Ala Ser Ser Ser TAA CCT GGC TTA TCG AAA TTA ATN CGA CTC ACT ATA GGG AGA CCG GCC TCG AGC AGC 62 71 80 89 98 107

TER Ser Phe lie Lys Arg Ala Leu Glu Ile Ile Glu Phe His His Glu Lys Tyr Asp TGA AGC TTT ATT AAA AGA GCA CTA GAA ATT ATA GAG TTC CAT CAT GAA AAA TAT GAT 119 128 137 146 155 164

rbs Gly Thr Gly Tyr Pro Lys Gly Leu Lys Gly Glu Asp lie Pro Leu Pro Gly Arg Leu GGA ACA GGA TAT CCT AAA GGG TTA AAG GGA GAA GAT ATT CCA TTA CCA GGA AGG TTG 176 185 194 203 212 221 start Met Ala lie lie Asp Val Phe Asp Ala Leu lie Asn Glu Arg Val Tyr Lys Lys Ala ATG GCA ATT ATT GAT GTC TTT GAT GCA CTG ATT AAT GAA AGA GTC TAT AAA AAA GCA 233 242 251 260 269 278

Tyr Thr Val Glu Glu Ser Val Lys Ile Ile Lys Glu Asn Ile Gly Lys His Phe Asp TAT ACA GTA GAA GAA TCT GTA AAA ATA ATT AAA GAG AAC ATA GGG AAA CAT TTT GAT 290 299 308 317 326 335

Pro Val Val CCC GTC GTT TT 347

Figure A8. Sequence upstream of the lacZ gene in pISM2050.40. The lacZ- chromosomal

DNA fusion is shown in bold (GATC). The potential ribosomal binding site (rbs)

and translational start site (start) is underlined. The potential ribosomal binding site

was determined by aligning the sequence with the last 15 bp at the 3' end of the 16S

rRNA gene of A. laidlawii. 126

Frame 2 Ser Arg Gin Glu UKN Pro TER Lys Arg His Thr lie Ala Leu Leu Asn Val TCC CGN CAA GAA TNC CCC TAA AAG CGA CAC ACT ATT GCA CTN CTT AAT GTG 10 19 28 37 46

Cys Glu Asn Ser Gin Gly Ser Asn Asp Asp Gly UKN Pro Ser UKN UKN UKN Gly UKN TGT GAA AAC TCT CAA GGT TCT AAT GAT GAT GGT GAN CCN AGC NAA NCA TNG GGT GNN 61 70 79 88 97 106

Pro He Leu Glu UKN UKN UKN His His Gin UKN Thr UKN Cys UKN UKN Val UKN Val CCN ATA CTT GAG ANN CNT AAN CAT CAT CAA NTA ACG NAN TGT NTT NCA GTC GNT GTG 118 127 136 145 154 163

Arg Tyr He Gly Gly Met Lys Pro Gly UKN Gly Gly Leu He UKN Ala Tyr Ala Lys AGA TAC ATT GGT GGT ATG AAA CCT GGT NCC GGT GGA TTA ATC NGN GCC TAT GCT AAA 175 184 193 202 211 220

rbs start? Ala Thr Lys Glu Ala UKN Asn Asp UKN UKN Leu Ser UKN Lys Val Thr Gin Thr UKN GCA ACC AAA GAA GCG CNA AAT GAT NCC NAA CTC TCT NAA AAG GTC ACT CAA ACC ANN 232 241 250 259 268 277

Tyr Glu UKN Val UKN Thr Tyr Glu UKN He Ser Lys He Asp Pro Val Val TAT GAA GNC GTA NTT ACC TAT GAA AAN ATT TCN AAA ATT GAT CCC GTC GTT TT 289 298 307 316 325

Figure A9. Sequence upstream of the lacZ gene in pISM2050.66. The lacZ- chromosomal

DNA fusion is shown in bold (GATC). The potential ribosomal binding site (rbs)

and translational start site (start) is underlined. The potential ribosomal binding site

was determined by aligning the sequence with the last 15 bp at the 3' end of the 16S

rRNA gene of A. laidlawii. 127

-35 Frame 1 Lys Val Val UKN His Lys Met Pro Thr UKN UKN Ala UKN UKN UKN TER Ile AAG GTT GTT TNA CAT AAA ATG CCA ACC CNG NAA GCC TNT TNG NAA TAG ATC 9 18 27 35 45 '

-10 * start rbs Pro Phe Thr Leu Met Ile TER Tyr Ser Arg Asp Arg TER Val Met Arg Cys Val Lys CCG TTT ACA CTC ATG ATA TAA TAT AGT AGS GAT AGA TAA GTG ATG AGG TGT GTG AAG 60 69 78 87 96 105

start start start Ser Met Ser Val Met Leu Asn Met UKN UKN Asn Lys Glu Ala Leu Ser Met Ala Glu TCA ATG AGT GTA ATG CTA AAT ATG CNT NAA AAT AAA GAA GCA CTT AGT ATG GCC GAG 117 126 135 144 153 162

Arg Ile Val Leu Asp Tyr Leu Ile Glu Asn Lys Thr Ile Leu Lys Asp Phe Ser Val AGA ATT GTT TTA GAT TAC TTG ATA GAA AAT AAG ACA ATC CTG AAG GAT TTT AGT GTT 174 183 192 201 210 219

Glu Lys Ile Ala Glu Ala Ala TVr Thr Ser Pro Ala Ser Val Val Arg Met Cys Lys GAA AAA ATT GCG GAA GCT GCT TAT ACA TCA CCC GCA TCT GTT GTT AGA ATG TGT AAG 231 240 249 258 267 276

Lys Leu Gly Tyr Lys Gly Phe UKN Asp Phe Lys Ile Asp Phe Ile Leu Ala Asn Ser AAA CTT GGA TAT AAA GGA TTC NAA GAT TTT AAA ATT GAT TTT ATT TTA GCA AAT TCT 288 297 306 315 324 333

Lys Val Glu Ile Pro Glu Thr Ser Glu Tyr Thr Asp Ile Ile Leu Ile Lys Asp Pro AAA GTA GAA ATA CCA GAA ACA TCT GAG TAT ACG GAC ATT ATT TTA ATT AAA GAT CCC 345 354 363 372 381 390

Val UKN GTC GNT TT

Figure A10. Sequence upstream of the /acZ gene in pISM2050.69. The /acZ- chromosomal

DNA fusion is shown in bold (GATC). The putative -35 and -10 promoter

regions are underlined and the translational start site is indicated by an (*). The

potential ribosomal binding site (rbs) and translational start site (start) is also

underlined. The potential ribosomal binding site was determined by aligning the

sequence with the last 15 bp at the 3' end of the 16S rRNA gene of A. laidlawii. 128

Frame 2 Ser TER Ile Lys TER UKN Ile Glu Tyr Gly Ile Ile Tyr TER Cys Ile UKN AGC TAG ATT AAG TAA NAT ATA GAA TAT GGT ATA ATT TAT TGA TGT ATA NCC 10 19 28 37 46

Gin UKN Asn Leu Tyr Ile Phe Ser Ile Ile UKN Asn Ile Tyr Leu Ile UKN Leu Tyr CAA NAC AAT TTA TAT ATT TTT TCA ATC ATT NNA AAT ATA TAT TTA ATA NTG CTT TAT 61 70 79 88 97 106

Gly Ile Met Ile Trp UKN UKN Lys TER Asn Ile Lys Gly Ala Trp TER Val Ala Lys GGT ATT ATG ATA TGG TNN CNN AAA TAG AAC ATA AAA GGA GCA TGG TAA GTG GCT AAA 118 127 136 145 154 163

Leu Asp Gin Thr Lys Thr Pro Phe Phe Asp Lys Ile Arg Ala Tyr Gly Val Ser Gly CTC GAT CAA ACA AAA ACC CCA TTT TTT GAT AAA ATT AGA GCA TAT GGA GTC TCA GGA 175 184 193 202 211 220

-35 UKN UKN Ala Leu Asp Val Pro Gly His Lys Leu Gly Ser Ile Asp Asn Glu Phe Thr NCG NCG GCT TTA GAT GTT CCT GGT CAT AAA CTG GGT TCG ATT GAT AAT GAA TTT ACA 232 241 250 259 268 277

-10 * start Arg Tyr Leu Gly His Asn Val Phe Ser Met Asp UKN Asn Ala Pro Arg Gly Leu Asp AGA TAT TTA GGA CAT AAÇ GTT TTT TCT ATG GAT NCA AAT GCA CCA AGA GGA CTT GAT 289 298 307 316 325 334

Asn Leu Ser Lys Pro Lys Gly Val Ile Lys Glu Ala Gin Ala Leu Ala Ala Asp Ala AAT TTA TCN AAA CCT AAA GGT GTC ATT AAG GAA GCA CAA GCA CTC GCA GCA GAT GCT 346 355 364 373 382 391

Phe Gly Ala Asp Pro Val UKN TTT GGT GCG GAT CCC GTC GNT TT 403 412

Figure All. Sequence upstream of the lacZ gene in pISM2050.70. The lacZ- chromosomal

DNA fusion is shown in bold (GATC). The putative -35 and -10 promoter

regions are underlined and the translational start site is indicated by an (*). A

potential ribosomal binding site was not found. 129

Frame 3 Asp Ser Arg Tyr Arg Val Lys Pro Glu Ile Val Ser His Ser UKN Leu Thr GAT AGT CGC TAT AGG GTA AAA CCT GAA ATT GTA TCA CAC AGT NTA TTA ACT 11 20 29 38 47

Glu Asp Ala Ile Leu UKN UKN Glu Ala Ser Glu Ile Leu Pro Tyr Ile Thr Asp Asp GAG GAT GCG ATA TTA ANT NAA GAA GCA AGT GAG ATA CTG CCA TAT ATT ACA GAT GAT 62 71 80 89 98 107

Leu Asp Ala Val Ile Ile Asp Glu Ala Gin Phe Phe Asp Lys Ala Ile Ile Gin Ile TTA GAT GCT GTC ATT ATT GAT GAG GCA CAG TTC TTT GAT AAA GCA ATC ATC CAA ATT 119 128 137 146 155 164

Ala Asp Asp Leu Ala Asp Arg Gly Leu Arg Val Ile Ile Gly Gly Leu Asp Arg Asp GCA GAT GAT TTA GCA GAC CGA GGG CTC AGA GTT ATT ATT GGT GGA CTG GAT AGA GAC 176 185 194 203 212 221

Phe Lys Gly Glu Pro Phe Gly Pro Met Pro Glu Leu Leu Ala Leu Ala Glu Phe Val TTT AAA GGT GAA CCT TTT GGT CCA ATG CCT GAG TTA TTA GCA CTT GCA GAG TTT GTG 233 242 251 260 269 278

rbs? start Thr Lys Leu Thr Ala lie Cys Val Lys Thr Gly Met Pro Ala Thr Arg Thr Gin Arg ACT AAA CTT ACT GCA ATC TGT GTT AAA ACA GGA ATG CCA GCA ACC AGA ACC CAA AGA 290 299 308 317 326 335

lie lie Asp Gly Lys Pro Ala Ser Tyr Lys Asp Pro Val Val ATC ATT GAT GGA AAA CCT GCA AGT TAT AAA GAT CCC GTC GTT TT 347 356 365 374

Figure A12. Sequence upstream of the lacZ gene in pISM2050.86. The lacZ- chromosomal

DNA fusion is shown in bold (GATC). The potential ribosomal binding site (rbs)

and translational start site (start) is underlined. The potential ribosomal binding

site was determined by aligning the sequence with the last 15 bp at the 3' end of

the 16S rRNA gene of A. laidlawii. 130

Frame 3 TER Val Phe UKN Lys Lys Gly UKN Val UKN Leu Thr Phe Tyr UKN Leu Val TGA GTA TTT AAN AAA AAG GGG NNA GTG AAN CTG ACT TTT TAC NCT TTG GTG 11 20 29 38 47

Glu UKN Gly UKN Ser Leu Ser Leu Glu Glu Glu Ala His Leu Leu Gly Arg Met His GAA GNA GGT ATN TCT TTA TCA CTT GAG GAA GAA GCG CAT TTA TTA GGA CGT ATG CAT 62 71 80 89 98 107

Ile Ser Pro Tyr UKN UKN Met Phe Ile UKN Lys Asp Glu Asp Leu Ile Ile Gly Ala ATA AGT CCT TAT NCA NAA ATG TTT ATC NCA AAA GAC GAG GAT TTA ATT ATT GGG GCG 119 128 137 146 155 164

Ala Ser Ile His Thr Ser Thr Lys Pro Arg UKN Lys His Lys Ala Glu Leu Gly Ile GCA TCC ATT CAT ACA TCT ACC AAA CCT AGA ANT AAA CAT AAA GCA GAA CTT GGA ATA 176 185 194 203 212 221

Ser Val Leu Lys Ser UKN Trp Gly Lys Gly Val Ser Lys Leu Leu Met Asp UKN UKN TCT GTT TTA AAG TCA TNC TGG GGT AAA GGT GTA TCT AAG CTA TTA ATG GAT NAA ATN 233 242 251 260 269 278

rbs start Ile Glu Tyr Ala Lys Thr Ser Gly Phe Ile Glu Met Ile Leu Leu Glu Val Ala Thr ATA GAA TAC GCT AAA ACT TCA GGA TTT ATT GAA ATG ATT TTA TTA GAG GTT GCA ACA 290 299 308 317 326 335

Thr Asn Thr Arg Ala Ile Lys Phe Tyr Glu Ser Tyr Gly Phe Lys Ser UKN Gly Val ACC AAT ACA AGA GCC ATC AAA TTC TAT GAA TCC TAT GGC TTT AAG TCT TNC GGA GTT 347 356 365 374 383 392

rbs? start Ala Arg Asn Ala Val Lys Met Asp Pro Val Val GCN AGA AAT GCA GTA AAA ATG GAT CCC GTC GTT TT 404 413 422

Figure A13. Sequence upstream of the lacZ gene in pISM2050.89. The lacZ- chromosomal

DNA fusion is shown in bold (GATC). The potential ribosomal binding site (rbs)

and translational start site (start) is underlined. The potential ribosomal binding

site was determined by aligning the sequence with the last 15 bp at the 3' end of

the 16S rRNA gene of A. laidlawii. 131 APPENDIX B: IMMUNE RESPONSE OF A FOREIGN GENE

EXPRESSED IN ACHOLEPLASMA ISMI499

Rationale and Experimental Design

The goal of this experiment was to determine whether a foreign gene expressed in

mycoplasmas could induce a specific immune response. The overall goal of my research has

been to develop an expression cloning system for use in mycoplasmas. A consensus promoter

sequence was to be derived from the promoter probe studies and an expression vector for use

in mycoplasmas was to be generated. Finally, the expression cloning system was to be tested

by placing a foreign gene downstream of the consensus promoter and determine whether an

immune response could be induced to that gene upon challenge. Because the promoter probe

studies showed that the E. coli lacZ was expressed in Acholeplasma, an experiment to

determine whether mice would mount an immune response to P-galactosidase was conducted.

Twenty specific pathogen free HE GuJ mice that were 4 months of age were used in the

study. They were grouped as shown in Table Bl. Following a prebleed, each mouse was

injected i.p. with 100 p,g of whole cells (killed by repeated freezing and thawing) resuspended

in incomplete Freund's adjuvant After 7 days, blood was obtained via an orbital puncture. The

mice were boosted with another 100 |ig of whole cells resuspended in incomplete Freund's

adjuvant 9 days following the primary challenge. Five days later blood was obtained via an

orbital puncture. Serum was separated from the RBCs by centrifugation in a microfuge and the samples were frozen at -20°C until they were assayed for anti-P-galactosidase activity by

ELISA.

The ELISA was performed by first coating a 96-well flat bottom plate with 100 fil of 10

|Lig/ml P-galactosidase suspended in 0.1 M Na2C03, pH 9.6. Following a blocking step overnight with PBS containing 5% BSA, 100 fil of the test serum diluted 1:250 was added to 132 each well. After a 5 h incubation at room temperature, the wells were washed with 0.9% NaCl containing 0.05% Tween-20. One hundred microliters of the conjugate, horse radish peroxidase labeled goat anti-mouse Ig, diluted 1:1,000 were added to each well. Following a 4 h incubation at room temperature, 100 |li1 of the TMB substrate was added. The reaction was stopped by adding 100 fxl of I M phosphoric acid, and the plate was read with a microtiter plate reader at an absorbance of 415 nm. The positive control was a monoclonal antibody to p- galactosidase diluted 1:100. The negative controls for the ELIS A assay included wells in which either no Ag (P-galactosidase), test antisera, or conjugate was added. All samples and controls were performed in triplicate.

Table B1. Experimental design of the Acholeplasma

challenge study

Group Sex P-gal activity^

PBS 3 F n.a.

ISM2050.1 5 M 19

ISM2050.2 4 M 1,193

ISM2050.70 4 M 201

ISM2050 4 F 1

= number of mice.

^Units of p-gal activity defined as the

number of monomers of the enzyme per CPU

generated in one min. (See Materials and

Methods of dissertation. 133 Results and Discussion

The results of the ELISA assay are shown in Table B2. The values shown in Table B2 represent the average absorbance values of the triplicate measurements for each mouse as well as the average for all mice within a group. The results show that a low level antibody response to P-galactosidase as indicated by absorbance levels was akeady present in these mice and introduction of more antigen in the form of a recombinant bacteria did not induce a greater antibody response. The ELISA controls worked as expected. The absorbance values of the positive control (Mab to P-galactosidase) were not remarkably high but were nevertheless positive. There were not any differences in antibody levels between the negative control groups

(PBS and ISM2050) and the groups (ISM2050.2 and ISM2050.70) that would have been predicted to induce the highest levels of antibody response. Moreover, there was not an increase in antibody response as a result of the primary and secondary injections of the antigen. Because there already appeared to be a low level antibody response to (3-galactosidase, the primary and secondary injections should have induced an amnestic response if the |3- galactosidase protein was being recognized by the mice. P-galactosidase levels (Table 1) were determined for these Acholeplasma strains prior to the repeated freezing and thawing process to kill the bacteria. Therefore, strains ISM2050.2 and ISM2050.70 were producing relatively high levels of P-galactosidase that could have been recognized by the mouse.

The inability to induce an antibody response was probably due the choice of antigen used in this experiment. An existing antibody response to P-galactosidase was not unexpected because other bacteria (e. g., E. coli) that the mouse was exposed to produce this enzyme. The levels of P-galactosidase introduced with these recombinant strains was probably not high enough to induce a higher antibody response. Thus, this experiment suggested that a killed

Acholeplasma recombinant vaccine was not effective in inducing an immune response to the foreign antigen, P-galactosidase. 134

Table B2. Absorbance values of an ELISA examining the antibody

response to xzcomh\mni Acholeplasmas expressing the

E. coli lacZ.

A415

Group Day 0 Day 7 Day 14

PBS 0.122 0.119 0.100

ISM2050.1 0.129 0.134 0.121

ISM2050.2 0.138 0.133 0.121

ISM2050.70 0.118 0.106 0.136

ISM2050 0.140 0.156 0.143

Mab 0.479

No Ag 0.044

No Ab 0.032

No conjugate 0.013 135

APPENDIX C: DEVELOPMENT OF A VACCINE TO MYCOPLASMA

HYOPNEUMONIAE

Introduction

Mycoplasmal pneumonia of swine, as a result of Mycoplasma hyopneumoniae infection,

is considered to be one of the most economically important causes of disease-associated loss in

swine. Although M. hyopneumoniae infections rarely result in mortality, depressed growth

rate, depressed feed consumption, and predisposition to secondary infection can result. Efforts

to combat this disease have not proven to be entirely effective. Antibiotics have been shown to

improve mycoplasma pneumonia; however, they do prevent the establishment of infection and

subsequent lesions. Live, attenuated, bacterin, subunit, and M. hyopneumoniae supernatant

vaccines have been tested, but have met with limited success.

The goal of this study was to employ a recombinant DNA approach to construct an

effective vaccine to M. hyopneumoniae. Monoclonal antibodies (Mab) have been produced in

the laboratory of Dr. R. Ross to a 65-kDa major surface antigen of M. hyopneumoniae. These

Mabs inhibit hemagglutination by M. hyopneumoniae. Therefore, the approach was to locate

the gene encoding this 65 kDa protein by screening a M. hyopneumoniae genomic library with

these Mabs. Once the gene was mapped by restriction analysis, it would be placed into an expression vector and transformed into a vaccine strain of Salmonella. The recombinant

Salmonella vaccine strain would be given orally to swine to induce a mucosal immune response to M. hyopneumoniae. It was hoped that the recombinant approach would enhance the immune response to mycoplasma antigens on mucosal surfaces and thus provide protection. 136

Materials and Methods

Preparation of the M. hyopneumoniae genomic library

M. hyopneumoniae chromosomal DNA was partially digested with SauiAl and separated

by size via sucrose density gradient centrifugation. Fractions possessing 9- to 22-kb fragments

were pooled and ligated into XFIX cloning vector according to manufacturer's (Stratagene)

instructions. Once the inserts were ligated into XFEX and packaged in vitro, the recombinant

phage was plated on E. coli strain Q359, a P2 lysogen. The spi(-) selection prevented the

growth of nonrecombinant phage. Approximately 1,200 independent recombinant phage were

obtained and amplified in E. coli strain JM105.

Monoclonal antibody production

Two hybridoma cell lines producing Mabs to the 65-kDa protein of M. hyopneumoniae

were a gift from Dr. R. Ross. The lines designated 80.1 and 27.10 were grown in RPMI

medium containing 15% fetal bovine serum. Ten million cells were injected into pristane-

primed mice and ascites fluid was collected 4 to 7 days later. The antibody-containing ascites

fluid was aliquoted and stored at -70°C.

Screening of the M. hyopneumoniae genomic libraries

One hundred microliters of 4 x 10^ pfu/ml were mixed with 100 |il of approximately 10^0

JM105 cells/ml. After 15 to 20 min incubation at 37°C, the mixture was placed into 3 ml of soft agar and poured onto phage agar plates. Following incubation for 16 h at 37°C, the plaques were transferred to nitrocellulose filters. The filters were blocked with 3% BSA in Tris-saline for 30 min and then incubated for 1.5 h at room temperature with a 1:100 or 1:1,000 dilution of ascites fluid (80.1 or 27.10). The filters were washed (Tris-saline, 10 min; Tris-saline w/

0.05% NP-40, 15 min, 2 times; Tris-saline, 10 min). The second antibody, ^^^I-labeled goat 137

anti-mouse immunoglobulin was added for I h at room temperature. The filters were washed

as previously described, dried, and exposed to film.

Immunoblot blot analysis Approximately 50 |lg of E. coli %I91S, M. hyopneumoniae, and recombinants clones in

E. coli lysates were loaded onto 10% SDS polyacrylamide gels. Following electrophoresis, the

protein was transferred to nitrocellulose with a Hoeffer electroblotting transfer unit. Antigen

detection on nitrocellulose was the same as the procedure used to screen the libraries.

Results and Discussion

Construction of the M. hyopneumoniae genomic library Ten- to twenty-kilobase M. hyopneumoniae DNA fragments were ligated into A,FIX,

packaged in vitro, and plated on E. coli Q359. Approximately 1,200 independent recombinant

phage were obtained. Because of the small size of the M. hyopneumoniae genome (ca. 800

kb), it was determined that only 300 independent recombinant phage containing 15-kb inserts

would be required to obtain a complete genomic library at the 99% confidence level. Thus, the

1,200 independent clones in this library should represent the entire genome.

Monoclonal antibody characterization

The Mabs 80.1 and 27.10 both recognize a 65-kDa band when M. hyopneumoniae whole cell lysates are used in immunoblot analysis. The 80.1 Mab appeared to bind with greater

affinity than did the 27.10 Mab. ELISA analysis showed that the 80.1 Mab was over 10 times

more effective in recognizing whole cells than the 27.10 Mab. As a result, the 80.1 Mab was

used to screen die M. hyopneumoniae genomic library. 138

Screening the M. hyopneumoniae genomic library

The phage library was plated on JM105 at a density of 500 plaques per plate and screened

with Mab 80.1 at a dilution of 1:100. Initially there was high background, but it was eliminated

by using the Mab 80.1 at a dilution of 1:1,000. Potentially positive clones were picked and

stored at 4°C. Three microliters of the positive phage lysate was spotted onto soft agar

containing JM105 cells and screened with both Mabs 80.1 and 27.10. Differing amounts of the

ascites fluid of each Mab (1;1,000 for 80.1 and 1:50 for 27.10) were required to obtain a

positive reaction, however. Eleven of the potentially positive clones continued to be positive

upon rescreening.

Two of the positive clones were used by immunoblot analysis. The Mab 80.1 recognized a

39.5-kDa protein, but the Mab 27.10 failed to recognize any protein using this approach. The

observation that Mab 27.10 weakly recognized the same positive plaques as Mab 80.1, but did

not recognize the 39.5-kDa recombinant protein upon immunoblot analysis may indicate that

this epitope is not very stable in E. coli. Thus, the epitope recognized by this Mab may have

been lost during the immunoblot analysis procedure. It should be noted that the Mab 27.10

binds strongly to the 65-kDa antigen in immunoblot analysis of mycoplasmal whole cells.

The observation that the Mab 80.1 recognized a 39.5-kDa band indicated that either the

protein was expressed in a truncated form in E. coli or only part of the gene was cloned.

Expression of truncated gene products in E. coli is a possibility because of the alternate codon

usage between E. coli and mycoplasmas. Mycoplasmas use the UGA codon for a tryptophan

while it is a stop codon in E. coli. Thus, mycoplasma proteins containing a tryptophan encoded by a UGA would be prematurely truncated in E. coli during translation.

The truncation of the 65-kDa protein in E. coli may also be a result of improper post- translational modification such as the linkage of the protein antigen to a lipid component. A protein of identical molecular weight was characterized as a lipoprotein in M. hyopneumoniae by another laboratory (K S. Wise, Univ. of Missouri). 139 APPENDIX D. DEVELOPMENT OF A RECOMBINANT VACCINE TO

SERPVLINA HYODYSENTERIAE

Description and Rationale

The etiologic agent of swine dysentery, Serpulina hyodysenteriae (formerly Treponema hyodysenteriae), causes a mucohemorrhagic diarrhea in swine. Although the disease has been recognized since 1921, the mechanism(s) of pathogenesis of this disease has not been determined. The endotoxin and hemolysin, however, have been implicated as major virulence factors. The goal of the project, therefore, was to produce an effective vaccine to S. hyodysenteriae based on inducing an immune response to the lipopolysaccharide 0 antigen.

This would be accomplished by using a recombinant DNA approach in which the genes producing the S. hyodysenteriae G antigen would be cloned and expressed using an alternative vaccine delivery system developed in Salmonella spp. Previous work in the laboratory of Dr.

Wannemuehler with murine and porcine challenge studies showed that the antibody response in both convalescent and immunized animals appeared to be against the serotype antigen. In addition, it was shown that mice could be protected from S. hyodysenteriae infection by using an a monoclonal antibody to the S. hyodysenteriae LPS. Unfortunately, there are at least seven

S. hyodysenteriae serotypes. Thus, the possibility of using a multivalent approach was considered.

Initial experiments in the laboratory of Dr. Roy Curtiss HI (Washington University, St.

Louis) indicated that they had developed an avirulent Salmonella vaccine delivery system for swine. The Salmonella could colonize in the intestine of the pig for at least ten days without producing any obvious signs of disease. Moreover, a significant antibody response was detected one week after challenge.

Thus, in order to develop an effective vaccine against S. hyodysenteriae, the following approach was taken. First, the gene(s) encoding the S. hyodysenteriae LPS 0 antigen would 140

be cloned into Escherichia coli. Contiguous and noncontiguous S. hyodysenteriae genomic libraries were constructed in X.ZAP or in cosmid pISM24. A contiguous library consisted of

large genomic inserts while the noncontiguous library was composed of small randomly

associated genomic DNA fragments. The noncontiguous approach was taken because it has

been shown that the LPS genes for other bacteria are located at a number of sites in the

genome. Therefore, it was hoped that the noncontiguous library could generate a cassette in

which the 5. hyodysenteriae LPS would be produced. The libraries were screened with

hyperimmune rabbit antisera or a monoclonal antibody to the LPS of S. hyodysenteriae.

Second, once a positive clone was detected the genes related to the O antigen would be

mapped. The O antigen coding sequence would then be cloned into the Salmonella expression

vector, pYA804. Third, the recombinant Salmonella would be tested to determine whether an O antigen-specific immune response could be induced in mice and swine. And fourth, the vaccine

would be tested to determine whether oral immunization could give protection against S. hyodysenteriae.

Materials and Methods

Preparation of S. hyodysenteriae chromosoma! DNA

Two liters of 5. hyodysenteriae B78 grown in a modified trypticase soy broth were washed once with PBS and resuspended in 1/200th of the original volume in NET buffer

(0.1 M Tris, 0.15M NaCl, and 0.08M EDTA, pH 7.5). Lysozyme was added to a final concentration of 100 mg/ml and incubated for 2 h at 37°C. Proteinase K (100 mg/ml) was then added and incubated at 65°C for an additional 2 h. The cells were then lysed with a lysis buffer

(1% Triton X-100,1% NP-40, and 1% deoxycholate) and proteinase K was immediately added and the lysate was incubate at 65°C for 2 h. The DNA was extracted with phenol and 141

phenol-chloroform, ethanol-precipitated and dialyzed against TE. Some of the DNA

preparation was placed on a CsCl gradient for further purification.

The chromosomal DNA was partially digested with SauSAl and the fragments were

separated over a sucrose density gradient. The fragments were pooled into 1- to 5-kb, 5- to 10-

kb, 10- to 20-kb, and 20- to 50-kb pools for use in the appropriate cloning vector.

Preparation of S. hyodysenteriae genomic libraries

Preparation of genomic libraries In lambda. The S. hyodysenteriae libraries were constructed in the lambda vectors XZAP (Stratagene) and XGEM-11 (Promega) according

to manufacturer's instructions. To prepare the genomic library in XZAP, 5- to 10-kb fragments

were ligated into the BamYïl site, packaged using Gigapack (Stratagene), and allowed to infect

E. coli BB4 or XL1-blue cells. The library was amplified one time. To prepare the genomic library in A,GEM-11, 10- to 20-kb fragments were partially filled in with Klenow and ligated

into the Xhol site, packaged using Packagene, and used to infect E. coli LE392 cells.

Preparation of genomic libraries in cosmid pISM24. The 20- to 50-kb fragments were ligated into the unique BamiH site of cosmid pISM24 to generate the contiguous genomic library. The noncontiguous library was generated by using the 5- to 10-kb fragments. The ligation mixes were packaged using Gigapack and used to infect E. coli strains

HBlOl, BB4, LE392, and XL1-blue. The colonies were picked and grown up in 200 |il volumes in a 96-well plate. One half of the culture was placed in 40% glycerol and stored at

-20°C and to other half of the culture was placed in 15% glycerol and stored at -70°C in 96-well plates. Forty-eight or 96-pin replicators were used to inoculate plates for subsequent screening. 142

Screening the S. hyodysenteriae genomic libraries

The genomic libraries were screened with either pooled rabbit antisera to S.

hyodysenteriae B78 whole cells or a monoclonal antibody (B78.18.2) to the S. hyodysenteriae

B78 O antigen. Lambda libraries were screened from plaque lifts from plates containing about

1000 plaques. The membranes were blocked overnight with TSB (0.05M Tris, 0.15 M NaCl, and 3% BSA, pH 7.5) at either 4°C, room temperature, or 37°C. Rabbit hyperimmune antisera that was diluted 1:250 in TSB and absorbed with lysed E. coli cells was added to the filters and gently shaken for 2 h at room temperature. The filters were washed (1 time with TS, 10 min; 2 times with TSN (TS with 0.05% NP-40), 20 min; and 1 time with TS, 10 min) then secondary antibody (^^^I-Protein G, approx. 10^ cpm/ml) diluted in TSB was added and incubated at room temperature for 2 h. Autoradiography was used to detect reactive plaques.

The cosmid libraries were screened by first inoculating LB containing 100 |Lig/ml ampicillin with a 48-pin replicator from the 96-well plate stocks. Colony lifts were performed and the cells were either lysed with chloroform and placed in TSB containing 100 |ig/ml lysozyme and 1 |ig/ml DNase or were not lysed at all. The rest of the screening protocol was the same as above.

Results and Discussion

Construction of 5. hyodysenteriae genomic libraries

Two XZAP libraries were constructed from 2 different ligation mixes. It was predicted that

I,500 to 3,000 independent plaques would be necessary to be 99% confident that the entire genome (estimated to be 3,300 kb) would be cloned using 5- to 10-kb inserts. The 8,000 and

II,000 independent clones obtained with the two libraries should be sufficient to contain the entire S. hyodysenteriae genome. Scoring for the blue/white phenotype on plates containing X- gal and IPTG showed that less than 1% of the plaques were blue indicating that most of the 143

clones possessed insert DNA. Fifteen plaques from each library were picked and DNA was

prepared. Restriction enzyme analysis showed that 15 of 15 clones in one library and 14 of 15 clones in the other library appeared to possess inserts. Each library was amplified one time to give libraries with titers of 1 x 10^ and 1.4 x 10* pfu/ml. No plaques were generated using the XGEM-11 vector probably due to the inability to effectively partially fill-in the insert DNA prior to ligation with the XGEM-11 vector. Thus, only the AZAP library was used to screen for the

O antigen gene(s).

The cosmid libraries were generated by ligating S. hyodysenteriae genomic fragments into the cosmid pISM24. Cosmid pISM24 is a derivative of cosmid pJB8 in which the multiple cloning site from pBluescript was inserted into the EcoRI site of pJB8. The contiguous library was constructed with inserts that were greater than 20-kb whereas the noncontiguous library was constructed with 5-to 10-kb fragments. Eight colonies from each library were picked and plasmids were prepared. Restriction enzyme analysis showed that the library was composed of large inserts of ca. 40-kb and the differing restriction patterns indicated that the inserts were different. DNA-DNA hybridization analysis using S. hyodysenteriae genomic DNA as a probe showed that the insert DNA was S. hyodysenteriae. These results indicated that a S. hyodysenteriae genomic library had been constructed using cosmid pISM24. Therefore, approximately 1,750 contiguous and 2,600 noncontiguous independent recombinant clones were picked and stored in 96-well plates for future analysis.

Screening the S. hyodysenteriae libraries generated using XZAP

The amplified S. hyodysenteriae libraries were initially screened with rabbit hyperimmune antisera. High background was encountered in the initial attempts. The high background was alleviated by first absorbing both the primary and secondary antibodies with lysed E. coli

HBlOl cells prior to the screening procedure. The positive control in these experiments was 144

lysed S. hyodysenteriae B78 cells and the negative control was lysed E. coli HBlOl cells. No

positive clones were generated but both the positive and negative controls reacted as predicted.

The screening of these libraries was repeated with the monoclonal B78.18.2 as the primary

antibody. Again, no positive clones were detected despite both controls working as expected.

It would have been predicted that some positive clones would have been detected if S.

hyodysenteriae genes were being expressed. The amplified library was rechecked and the

clones did not appear to have inserts. Therefore, the inability to detect positive clones at this

point was due to the lack of recombinants containing S. hyodysenteriae DNA.

The packaging mixes were then reexamined to ensure that 5. hyodysenteriae DNA

fragments were indeed inserted into A,ZAP. Restriction enzyme analysis as well as DNA-DNA

hybridization analysis using 5. hyodysenteriae genomic DNA as a probe confirmed previous

observations that the unamplified library contained in the packaging mix had S. hyodysenteriae inserts. The probe did not bind to the XZAP DNA negative control or to the bands that

corresponded to the vector in the recombinant lanes. The unamplified library was then screened

with both the rabbit hyperimmune antisera and the monoclonal antibody B78.18.2. Again, no

positive clones were detected and the controls worked as expected.

The inability to detect positive clones, especially with the rabbit hyperimmune antisera, is difficult to explain. One possibility is that the gene products were lethal to the E. coli cell. This is unlikely because it could be reasoned that some S. hyodysenteriae gene products would be stably maintained and expressed in E. coli, yet the antisera failed to detect anything.

Screening the 5. hyodysenteriae libraries generated using pISM24

Because efforts to detect the S. hyodysenteriae O antigen were unsuccessful using lambda vectors, cosmid vectors were examined. In E. coli, multiple genes from different regions of the genome are required for the expression of the O antigen. Thus, it was predicted that the genes 145

required for the expression of the S. hyodysenteriae LPS would be similarly spread around the

genome.

One of the reasons for trying to express the O antigen in E. coli K-12 is that E. coli K-12

does not express the O antigen in its LPS. Thus, it was hoped that the gene product in the cosmid clones would complement the O antigen mutation and permit expression on the surface of the E. coli cell. This was demonstrated previously with Neisseria gonorrhoeae in that the O antigen from N. gonorrhoeae was expressed on the surface of HBIOI.

Therefore, one screening approach was to determine whether the S. hyodysenteriae O antigen was being expressed on the surface of the E. coli HBlOl by using unlysed cells.

Twenty-six potentially positive clones were detected with both the rabbit hyperimmune rabbit antisera and the monoclonal antibody. The positive reactions were weak, however. None of the

26 clones continued to give a positive reaction upon reexamination. Immunoblot analysis was tried in an attempt to increase the amount of the gene product so it could be detected by the antisera. In addition, ten of the potentially positive clones were treated with Proteinase K prior to the lysis step to try to enhance the detection process and to examine whether Proteinase K treatment alters the antigen recognized by the antisera to S. hyodysenteriae. All attempts to detect the O antigen by immunoblot analysis were unsuccessful. ELIS A analysis was also performed and no positive reaction was detected. It should be noted that in the colony lifts, immunoblot analyses, and ELIS A analyses that both the positive (lysed S. hyodysenteriae cells) and negative (lysed HBlOl cells) controls worked as expected.

To determine why these clones were no longer reacting positively with the antisera, DNA was prepared by the Triton lysis procedure. Restriction enzyme analysis of these clones showed that most of the inserts were now less than 12-kb. DNA-DNA hybridization analysis with S. hyodysenteriae genomic DNA confirmed that about 10-kb of each clone continued to be present. Apparently the inserts in these cosmids were very unstable. 146

It should be noted that the cosmids could only be grown in HBlOl and not in BB4, XLl-

blue, or LE392 E. coli cells. This suggested a possible restriction/modification barrier to the

cloned inserts. None of the clones from the contiguous library gave a positive reaction with either the hyperimmune rabbit andsera or the monoclonal antibody. A total of 17 attempts were made to locate positive clone from both the contiguous and noncontiguous genomic libraries.

In summary, the attempts to clone the gene(s) responsible for S. hyodysenteriae O antigen production were unsuccessful. Apparently, the cosmid clones were very unstable because after several rounds of amplification and growth the insert size was greatly reduced. Instability of cosmid inserts has been noted in other systems. As an effort to reduce cosmid instability the possibility of using a low copy number cosmid, pPR691, was considered. The inability to detect any S. hyodysenteriae gene products in E. coli with the rabbit hyperimmune antisera despite confirmation of cloned inserts remains an enigma. Perhaps the S. hyodysenteriae gene regulatory regions (i. e., promoters and translation initiation regions) are not recognized in E. coli.