Interactions and Functions of the Ubiquitin Specific Protease 7 in Human Cells

Anna-Marie Georges

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Molecular Genetics University of Toronto

i Interactions and Functions of the Ubiquitin Specific Protease 7 in Human Cells

Anna-Marie Georges

Doctor of Philosophy

Molecular Genetics University of Toronto

2019

ABSTRACT

The ubiquitin-specific protease 7 (USP7) is a deubiquitylating enzyme that regulates many important cellular processes and is highly studied for its contributions to cancer. Our lab has previously discovered a binding pocket in the USP7 N-terminal TRAF domain that mediates interactions with target proteins. In this thesis I demonstrate how I contributed to the identification of a second binding pocket located in the Ubl2 ubiquitin-like structure of the USP7

C-terminal domain. Furthermore, to gain a more comprehensive understanding of the interactions and functions of USP7, I used a proteomics approach to profile USP7 interactions in cancer cells.

This confirmed reported associations of USP7 with USP11, PPM1G phosphatase and TRIP12 and identified novel interactions with FBXO38 and two DEAD/DEAH-box RNA helicases,

DDX24 and DHX40. I show that USP11, PPM1G, DDX24, TRIP12 and FBXO38 bind USP7 through its TRAF binding pocket, while DHX40 interacts through the Ubl2 pocket. Motifs in

USP11 and DDX24 that are critical for USP7 binding were also identified. Modulation of USP7 expression levels and inhibition of USP7 catalytic activity showed that USP7 consistently stabilizes DDX24, DHX40, TRIP12 and FBXO38 dependent on its catalytic activity, while

USP11 and PPM1G levels were not consistently affected. Together these results better define the mechanisms of USP7 interactions and identify FBXO38, DDX24, and DHX40 as new USP7

ii targets. Furthermore, a BioID approach was used to profile the interactions and putative functions of FBXO38, revealing an interaction with KIF20B, a Kinesin-6 protein required for cytokinesis. I show that depletion of either FBXO38 or USP7 result in dramatic decreases in total

KIF20B levels and its localization to the midbody, which were manifested in cytokinetic defects.

Furthermore, cytokinetic defects associated with USP7 silencing were rescued by restoring

FBXO38 or KIF20B. Therefore, I have identified novel roles for USP7 and FBXO38 in the regulation of cytokinesis.

iii

ACKNOWLEDGEMENTS

First and foremost, I would like to express my deepest gratitude to my advisor Dr. Lori Frappier, for giving me the opportunity to work in such an incredible and supportive lab. You have been the most compassionate, patient, encouraging, approachable and supportive supervisor any grad student could ask for. I will always remember our fun conference trips (especially in Croatia and Montenegro!) and our mutual love of dancing at the MoGen retreats and Christmas parties! Through your mentorship, I have become a better writer, critical thinker and project manager, which will no doubt be instrumental in the success of my future scientific career. Thank you to my committee member Drs Anne-Claude Gingras and Sachdev Sidhu for their encouragement and support and for providing me with invaluable insight throughout my graduate career. Thank you for constantly challenging and motivating me to become a better researcher and scientist. I would also like to thank Dr. Vivian Saridakis for her collaboration and guidance for some of the more biochemical aspects of this project. I want to extend a huge thank you to the Frappier lab family, both past and present. A special shout out to my lab bestie and lunch buddy, Kathy Shire. Thank you for all your technical help with experiments (especially cloning!) and patiently listening to all my frustrations and failures, and sharing my excitement during the successes! I will miss our extensive discussions on Doctor Who (and the many other TV shows we shared in common), and I will especially miss your cakes, even the vegan ones. Thank you to Dr. Natasha Malik for being such an amazing mentor for my first few years, and helping with getting my project started. Jaime, Umama, Carlos, Ashley and Sam, I am so grateful to have met you all and I wish you all the best in your future research endeavors. I would like give a special thanks to my MoGen crew, who were a huge support during my entire graduate career and have become my life-long friends. I feel incredibly lucky to have met and bonded so strongly with such an amazing group of people. I love you all and look forward to the many more memories to come as we progress through the next chapter of our lives! A very special thank you to my incredibly supportive parents, who constantly remind me of how proud they are for my pursuit of graduate school and a career in science. Thank you for your unconditional love and support and for shaping me into the incredibly hard working and disciplined person I am today.

Finally, this thesis is dedicated to my best friend and life partner, Jonathan, who has been my biggest supporter and cheerleader during my entire graduate career and all other aspects of my life. Thank you for your undying love, emotional support, patience and constantly motivating me to grow professionally and to keep my head held high during the many rough patches of grad school. I couldn’t have done this without you!

TABLE OF CONTENTS

ABSTRACT ...... ii ACKNOWLEDGEMENTS ...... iv TABLE OF CONTENTS ...... vi LIST OF FIGURES ...... ix LIST OF TABLES ...... x LIST OF ABBREVIATIONS ...... xi CHAPTER 1 Introduction ...... 1 1.1 THE UBIQUITIN SYSTEM ...... 2 1.1.1 Ubiquitin and Ubiquitin conjugation ...... 2 1.1.2 Polyubiquitylation ...... 2 1.1.3 Monoubiquitylation ...... 4 1.1.4 E3 ligases ...... 5 1.1.5 Deubiquitylating enzymes ...... 7 1.2 UBIQUITIN-SPECIFIC PROTEASE 7 ...... 9 1.2.1 Deubiquitylation by USP7 ...... 10 1.2.2 USP7 protein interacting domains and mechanisms of USP7 interactions ...... 12 1.2.3 Roles of USP7 in tumor suppressor regulation ...... 14 1.2.3.1 USP7 plays a key role in regulating the p53 pathway ...... 14 1.2.3.2 Additional roles of USP7 in tumor suppressor and oncoprotein regulation ...... 15 1.2.4 Additional Cellular Functions of USP7 ...... 17 1.2.4.1 Roles of USP7 in cell cycle regulation ...... 17 1.2.4.2 USP7 in DNA replication, chromatin remodeling and transcription ..... 18 1.2.4.3 Functions of USP7 in DNA repair ...... 19 1.2.5 The development of USP7 inhibitors for anti-cancer therapies ...... 20 1.3 CYTOKINESIS ...... 21 1.3.1 The role of the kinesin family member 20B in cytokinesis and abscission ...... 23 1.4 THESIS OUTLINE AND RATIONALE ...... 24 CHAPTER 2 Identification and characterization of USP7 targets in cancer cells ...... 25 2.1 INTRODUCTION ...... 26 2.2 MATERIALS AND METHODS ...... 28

2.2.1 Cell Lines ...... 28 2.2.2 Plasmids and siRNA ...... 28 2.2.3 Affinity Purification coupled to Mass Spectrometry (AP-MS) ...... 29 2.2.4 Transfections and USP7 inhibitor treatment ...... 30 2.2.5 Western blotting ...... 31 2.2.6 Immunoprecipitation ...... 31 2.3 RESULTS ...... 32 2.3.1 Identification of the USP7 Ubl2 Binding pocket ...... 32 2.3.2 Identification of USP7 interactors in gastric carcinoma and nasopharyngeal carcinoma cells ...... 34 2.3.3 Identifying binding sites on USP7 ...... 38 2.3.4 Mapping the USP7 binding site on USP11 ...... 40 2.3.5 Mapping the USP7 binding site on DDX24 ...... 42 2.3.6 USP7 protects DDX24, DHX40 from proteasomal-mediated degradation ...... 42 2.3.7 The deubiquitylating activity of USP7 is required to stabilize DDX24, DHX40 and TRIP12 ...... 47 2.4 DISCUSSION ...... 47 CHAPTER 3 USP7 regulates cytokinesis through FBXO38 and KIF20B ...... 53 3.1 INTRODUCTION ...... 54 3.2 MATERIALS AND METHODS ...... 56 3.2.1 Cell Lines ...... 56 3.2.2 Plasmids and siRNA ...... 56 3.2.3 Transfections and USP7 inhibitor treatment ...... 57 3.2.4 Generation of Recombinant Adenovirus ...... 58 3.2.5 Affinity Purification coupled to Mass Spectrometry (AP-MS) ...... 58 3.2.6 Identification of FBXO38 Interactions by BioID ...... 59 3.2.7 Immunofluorescence microscopy ...... 61 3.2.8 Western blotting ...... 62 3.2.9 RNA extraction and KIF20B mRNA quantification ...... 62 3.2.10 Immunoprecipitation ...... 63 3.3 RESULTS ...... 63 3.3.1 USP7 interacts with and stabilizes FBXO38 ...... 63

vii

3.3.2 Identification of KIF20B as an FBXO38 interactor stabilized by FBXO38 and USP7 ...... 68 3.3.3 FBXO38 interacts with and stabilizes KIF20B by an SCF-independent mechanism...... 73 3.3.4 FBXO38 and USP7 regulate cytokinesis through KIF20B ...... 73 3.4 DISCUSSION ...... 80 CHAPTER 4 Summary, general discussion and future directions ...... 85 4.1 THESIS SUMMARY ...... 86 4.2 GENERAL DISCUSSION ...... 86 4.2.1 Insights into the USP7-FBXO38-KIF20B axis ...... 86 4.2.2 Functional significance of the USP7-mediated stabilization of DDX24 and DHX40 ...... 90 4.2.3 Functional significance of the USP7-USP11 and USP7-PPM1G interactions ..... 91 4.2.4 Regulation and mechanisms of USP7 interactions ...... 92 4.3 FUTURE DIRECTIONS ...... 94 4.3.1 Determining the functional significance of the USP7-DDX24 interaction ...... 94 4.3.2 Further characterization of the USP7-USP11 interaction ...... 96 4.3.3 Further characterization of the USP7-PPM1G interaction ...... 98 4.3.4 Insights into the regulation and functions of FBXO38 ...... 98 4.4 CONCLUSION ...... 103 REFERENCES ...... 105

viii

LIST OF FIGURES

Figure 1-1 Structural illustration of the SCF E3 Ubiquitin Ligase Complex ...... 6 Figure 1-2. The ubiquitin specific protease 7...... 11 Figure 1-3. Crystal structure of the EBNA1, p53 and Mdm2 peptides bound to the USP7 TRAF pocket...... 13 Figure 1-4. Schematic diagram illustrating the various stage of cytokinesis...... 22 Figure 2-1. The crystal structure of the Ubl123-ICP0 peptide complex ...... 33 Figure 2-2. The USP7 D762R/D764R mutation disrupts binding to ICP0, GMPS and UHRF1 in human cells...... 35 Figure 2-3. Expression of FLAG-USP7 delivered using an Adenovirus expression system...... 36 Figure 2-4. Coimmunoprecipitation of USP7 target proteins with WT and binding pocket mutations of USP7 ...... 39 Figure 2-5. Identification of the USP7 binding site in USP11 ...... 41 Figure 2-6. Identification of the USP7 binding site in DDX24 ...... 43 Figure 2-7. Effects of USP7 depletion on target protein levels ...... 46 Figure 2-8. The role of USP7 catalytic activity in stabilizing target proteins...... 48 Figure 3-1. USP7 interacts with and stabilizes FBXO38 ...... 67 Figure 3-2. Identification of KIF20B as an interactor of FBXO38...... 69 Figure 3-3. Depletion of FBXO38 or USP7 decreases KIF20B levels...... 72 Figure 3-4. FBXO38 interacts with and stabilizes KIF20B by an SCF-independent mechanism. 74 Figure 3-5. FBXO38 or USP7 depletion results in cytokinetic defects ...... 76 Figure 3-6. USP7 knockdown did not result in multipolar spindles ...... 77 Figure 3-7. Overexpression of USP7, KIF20B and FBXO38 rescues the cytokinetic defects caused by USP7 silencing ...... 79 Figure 3-8. FBXO38 and USP7 silencing reduces KIF20B levels at the midbodies...... 81 Figure 4-1. Proposed model for the USP7-FBXO38-KIF20B axis ...... 87 Figure 4-2. Amino acid sequence and schematic representation of FBXO38 domains showing putative USP7 binding motifs...... 102

LIST OF TABLES

Table 2-1. Affinity Purification-Mass Spectrometry Results for FLAG-USP7 in gastric carcinoma cells ...... 37 Table 3-1. Affinity Purification-Mass Spectrometry Results for FLAG-USP7 ...... 64

LIST OF ABBREVIATIONS

3’UTR 3’Untranslated region AP-MS Affinity purification-mass spectrometry ATM ataxia telangiectasia mutated ATP Adenosine triphosphate BioID proximity-dependent biotin identification CDK cyclin dependant kinase CHFR checkpoint with forkhead and ring finger Chk1 checkpoint kinase-1 CMV cytomegalovirus Co-IP Co-immunoprecipitation CRISPR Clustered regularly interspaced short palindromic repeats CTD C-terminal domain Cul1 Cullin-1 DAPI 4'-6-Diamidino-2-phenylindole DDR DNA damage response DDX24 DEAD-box helicase 24 DHX40 DEAH-box helicase 40 DNMT1 DNA methyltransferase 1 DUB Deubiquitylating enzyme E1 Ubiquitin activating enzyme E2 Ubiquitin conjugating enzyme E3 Ubiquitin ligase EBNA1 Epstein-Barr virus nuclear antigen 1 EBV Epstein-Barr virus ESCRT Endosomal sorting complex required for transport FBXO38 F-Box protein 38 FOXO4 Forkhead Box O4 GMPS Guanosine monophosphate synthase H2A Histone 2A H2B Histone 2B HECT Homologous to E6AP C-terminus

HSV-1 Herpes simplex virus 1 ICB Intercellular bridge ICP0 Infected cell polypeptide 0 (HSV protein) IP Immunoprecipitation KIF20B The kinesin family member 20B KLF7 Kruppel-like transcription factor 7 KSHV Kaposi’s Sarcoma associated Herpes Virus LC-MS/MS Liquid chromatography mass spectrometry LRRs leucine-rich repeats MCM-BP minichromosome maintenance binding protein NTD N-terminal domain PPM1G Protein phosphatase 1G PRC1 polycomb repressive complex 1 pre-rRNP pre-ribosomal ribonucleoprotein RING really interesting new gene RNI RNase inihibitor SCF Skp-Cullin F-box siRNA Short interfering RNA Skp1 S-phase kinase associated protein SMA spinal muscular atrophy TC-NER transcription coupled-nucleotide excision repair TRAF tumor necrosis factor-receptor associated factor TRIP12 Thyroid Hormone Receptor Interactor 12 Uba1 ubiquitin aldehyde Ubl ubiquitin-like UBP Ubiquitin binding protein USP11 Ubiquitin specific protease 11 USP7 Ubiquitin specific protease 7 vIRF4 viral interferon regulatory factor 4 β-gal β-galactosidase γH2AX Phosphorylated Histone 2AX

xii

CHAPTER 1

Introduction

1 2 1.1 THE UBIQUITIN SYSTEM The work discussed in this thesis focuses on the interactions and functions of the ubiquitin specific protease 7 (USP7), a deubiquitylating enzyme whose functions are heavily dependent on its ability to remove post-translational ubiquitin modifications from target proteins. This reversible process of ubiquitylation enables USP7 to play important roles in diverse cellular processes by regulating the stability and or function of a variety cellular proteins. In this section, I will review the process of ubiquitylation and its intricate role in regulating protein function.

1.1.1 Ubiquitin and Ubiquitin conjugation

Ubiquitin is a reversible post-translational modifier (8.5 kDa) that is ubiquitously expressed and highly conserved throughout eukaryotes (Wilkinson and Audhya, 1981, Kaiser and Huang, 2005). The ubiquitin monomer is a small 76-amino-acid polypeptide that adopts a compact β-grasp fold structure, characterized by a five stranded anti-parallel β-sheet that grasps a diagonal α helical segment (Vijay-Kumar et al., 1987). The covalent attachment of ubiquitin, also referred to as ubiquitylation, generally functions to target the modified proteins for proteasomal degradation, but can also serve to modulate their cellular localization, functions and protein-protein interactions (Glickman and Ciechanover, 2002, Hicke and Dunn, 2003, Hershko and Ciechanover, 1998, Chiu et al., 2009, Brinkmann et al., 2015). Ubiquitylation occurs in several steps, involving the sequential action of three enzymes (Hershko et al., 1983). In the first step, the E1 activating enzyme adenlyates the C-terminal glycine of ubiquitin through ATP hydrolysis, which is proceeded by the attachment of ubiquitin to the E1 active site cysteine through a thioester bond. The second step involves the transfer of the activated ubiquitin from the E1 to the active site cysteine of the E2 conjugating enzyme. Finally, the E3 ligase catalyzes the transfer of ubiquitin to the ε-amino group of the protein substrate lysine through the formation of an amide isopeptide bond.

1.1.2 Polyubiquitylation An important feature of ubiquitin is its ability to be conjugated to itself through its own seven lysines or its N-terminal methionine residue, to generate a diverse range of ubiquitin chains. This process, referred to as polyubiquitylation, occurs when the substrate-conjugated ubiquitin serves as an acceptor for subsequent ubiquitin molecules, resulting in the formation of polyubiquitin chains (Pickart and Eddins, 2004, Petroski and Deshaies, 2005). In polyubiquitylation, the C-terminal glycine of the donor ubiquitin forms an isopeptide bond with

3 either -amino or α-amino group of the acceptor lysine or methionine, respectively. These seven ubiquitin lysines are K6, 11, 27, 29, 33, 48 and 63, whereas Met-1 is the only known non-lysine that is capable of forming chains (Sadowski et al., 2012). K48 is the most abundant form of polyubiquitylation, representing nearly half of all linkages, and serves as a signal to target proteins for degradation by the multi-subunit protein complex known as the 26S proteasome (Thrower et al., 2000, Hershko and Ciechanover, 1998). Similarly, K11-linked chains can also result in the proteasomal degradation, however the anaphase promoting complex/cyclosome (APC/C) is the only known ligase complex capable of forming K11 chains (Jin et al., 2008). K63 chains are the second must abundant linkages, and in contrast to K48 and 11, they function in non-degradative process, including DNA damage response (DDR) and NFKβ signaling, intercellular trafficking and kinase activation (Passmore and Barford, 2004). The remainder of the atypical K6, K27, K29, K33 and Met1 chain types are less well studied, but have been implicated in mitochondrial homeostasis (Ordureau et al., 2014, Durcan et al., 2014, Cunningham et al., 2015), the DNA damage response (Gatti et al., 2015), epigenetics (Jin et al., 2016), post-Golgi membrane protein trafficking (Yuan et al., 2014b) and NFKβ signaling (Komander et al., 2009b, Rahighi et al., 2009), respectively. Polyubiquitin chains that comprise only a single type of linkage are referred to as homotypic chains, whereas heterotypic chains contain a combination of different lysine linkages that can adopt either mixed or branched topology (Akutsu et al., 2016, Yau and Rape, 2016). Mixed chains are unbranched, in that each ubiquitin molecule in a chain is ubiquitylated at a single lysine residue, whereas branched chains are formed when at least one ubiquitin molecule within a chain becomes ubiquitylated at two or more lysine residues. The importance of heterotypic chains and the mechanisms of their assembly remain poorly understood due to lack of efficient methods to monitor endogenous polymers in vivo (Yau et al., 2017). Furthermore, it remains unclear whether heterotypic chains confer unique signaling properties that are unattainable by homotypic chains (Nakasone et al., 2013). Examples of K48-K63 mixed and K48-K63 and K11-K48 branched chains have been reported, playing roles in receptor endocytosis (Boname et al., 2010), NFKβ signaling (Ohtake et al., 2016) and enhancing proteasomal degradation(Meyer and Rape, 2014), respectively. Finally, ubiquitin can be modified by other post-translational modifications, including acetylation (Ohtake et al., 2015) and phosphorylation (Kane et al., 2014, Kazlauskaite et al., 2014, Koyano et al., 2014) and ubiquitin-like molecules such as SUMO or NEDD8 (Galisson

4 et al., 2011, Lamoliatte et al., 2013, Hendriks et al., 2014, Singh et al., 2012), thus adding increasing complexity to ubiquitin biology. Acetylation of ubiquitin has been reported to inhibit polyubiquitin chain elongation, whereas phosphorylated ubiquitin has been shown to modulate enzymatic activity and protein subcellular localization. Although the existence of ubiquitin modifications by SUMO or NEDD8 have been reported, their functional roles remain equivocal.

1.1.3 Monoubiquitylation In contrast to polyubiquitylation, monoubiquitylation refers to the conjugation of a single ubiquitin to a target substrate lysine. In addition, multi-monoubiquitylation refers to single ubiquitin moieties conjugated on multiple substrate lysines. These types of modifications functions in modulating substrate activity, trafficking and protein-protein interactions and serve to regulate the DNA damage response, gene expression, epigenetics and receptor endocytosis in a non-degradative manner (Passmore and Barford, 2004, Haglund et al., 2003, Hicke, 2001). Histones H2A and H2B are both substrates of monoubiquitylation, which plays a pivotal role in regulating their functions in transcription and the DNA damage response. For example, monoubiquitylation of H2A by Ring1B of the polycomb repressive complex 1 (PRC1) results in transcriptional repression (Bravo et al., 2015), whereas this modification of H2B promotes its transcriptional initiation and elongation (Fleming et al., 2008, Minsky et al., 2008, Tanny et al., 2007, Zhu et al., 2005). In the DNA damage response, monoubiquitylation of H2B by RNF20/RFN40 results in the ATM dependent recruitment of repair factors and is required for the timely repair of double strand breaks whereas H2A is monoubiquitylated by RNF168, which is then recognized by the DNA repair factor 53BP1 (Moyal et al., 2011, Fradet-Turcotte et al., 2013). Monoubiquitylation has additionally been shown to regulate the functions of target proteins by modulating their subcellular localization. For example, monoubiquitylation of the p53 tumor suppressor inhibits its transcriptional activity by promoting its nuclear exclusion (Li et al., 2003). Conversely, monoubiquitylation of the FOXO4 transcription factor promotes its transcriptional activity through nuclear localization (van der Horst et al., 2006). More recently, several studies have shown that monoubiquitylation can serve as a degradative signal for a few small proteins consisting of less than 150 amino acids and several short-lived proteins such as p105, Pax3 and orphan ribosome subunits (Braten et al., 2016, Livneh et al., 2017, Ronai, 2016). Furthermore, recent studies have shown that selective autophagic degradation of surplus or

5 damaged peroxisomes is mediated by monoubiquitylation of the peroxisomal membrane receptor Pex5 (Zhang et al., 2015, Kim et al., 2008).

1.1.4 E3 ligases E3 ligases determine the substrate specificity for ubiquitylation, and therefore constitute a large class of proteins with over 600 putative E3s encoded in the human genome (Hanpude et al., 2015, Li et al., 2008). In contrast, only two E1s and around 40 E2s have been identified (Pelzer et al., 2007, Stewart et al., 2016). E3 ligases are categorized into one of three classes based on the presence of conserved E2-binding domains with the same name; RING (really interesting new gene), HECT (homologous to E6AP C-terminus) and the more recent RBR (RING- between-RING), the largest of the three classes being the RING E3s (Vittal et al., 2015, Buetow and Huang, 2016). The RING domain serves as a scaffold to recruit the E2-Ub conjugate to the substrate and stimulates the direct transfer of ubiquitin from the E2 to the target protein (Pruneda et al., 2012, Plechanovova et al., 2012, Dou et al., 2012). Structural studies revealed that upon binding to the RING E3, the isopeptide E2-Ub conjugate becomes stabilized in a closed conformation in which ubiquitin packs against the E2 via non-covalent interactions (Soss et al., 2013, Pruneda et al., 2012, Zheng and Shabek, 2017). These interactions are supported by a conserved RING E3 arginine residue that bridges the ubiquitin and E2 (Plechanovova et al., 2012, Dou et al., 2012, Zheng and Shabek, 2017). It is thought that this closed conformation induced by the RING E3 optimizes the arrangement of the thioster bond to favor the nucleophilic attack by the incoming substrate lysine. Proper RING domain folding and E3 ligase activity is largely dependent on the binding of two Zinc ions which are coordinated by domain cysteine and histidine residues within the domain (Buetow and Huang, 2016). RING E3s can exist as single polypeptides that contain both the catalytic RING and substrate recognition domains, or as multiprotein complexes in which these two domains are present as separate subunits. The largest family of these multiprotein E3 ligase complexes is the Skp-Cullin F-box (SCF) complex, which are responsible for promoting the degradation of around 20% of proteins that are regulated by the ubiquitin proteasome system (Soucy et al., 2009). The core components of the complex are the RING-containing subunit Rbx1, the scaffold protein Cul1 and the adaptor protein Skp1 (Figure 1-1). The variable component of the complex is a member of the F-box protein family, with approximately 70 members reported in mammals,

Figure 1-1 Structural illustration of the SCF E3 Ubiquitin Ligase Complex. Cul1 interacts with Skp1 through its N-terminal region and Rbx1 through its C-terminal region. Rbx1 contains the RING domain required for ubiquitin conjugation and serves as the docking site for an E2 enzyme. The F-box protein is the variable subunit that interacts with Skp1 via its F-box domain and recruits the substrate to the E3 ligase complex via its substrate interaction domain.

7 which determines substrate specify by binding the target protein (Nakayama and Nakayama, 2005, Petroski and Deshaies, 2005). SCF components Rbx1 and Cul1 form a catalytic core complex that recruits the E2 ligase, whereas Skp1 serves as an adaptor that links the F-box protein to Cul1 (Skowyra et al., 1999, Kamura et al., 1999, Seol et al., 1999, Skowyra et al., 1997). F-box proteins are characterized by an F-box motif that mediates direct interactions with Skp1 and are further classified into three subfamilies, FBXW, FBXL and FBXO, based on their type of protein-protein interacting domain: WD-40 repeats, leucine-rich repeats, and “other” domains, respectively (Randle and Laman, 2016, Jin et al., 2004). Interestingly, several F-box proteins can function independently from the SCF complex. For example, FBXO5 functions in an SCF-independent manner to negatively regulate APC/C activity, and is reported to perform this function by competing with the APC/C activators (Cdh1 and Cdc20) for substrate binding (Reimann et al., 2001, Di Fiore and Pines, 2008). Furthermore, FBXO7 regulates the levels and activity of the cell cycle progression Cyclin D/cdk6 complex, possibly by acting as a scaffold for complex assembly (Laman et al., 2005). Finally, FBXO38 (also known as MoKA), functions as a transcriptional co-activator of the Kruppel-like transcription factor 7 (KLF7) by binding to KLF7 through its F-box domain (Smaldone et al., 2004). Whereas the majority of the E3 ligases are RING E3s, approximately 28 belong to the HECT family of E3 ligases (Rotin and Kumar, 2009). All HECT E3s are comprised of an N-terminal substrate binding domain and a C-terminal HECT domain (Huang et al., 1999). Mechanisms of HECT E3 ligase ubiquitylation are quite distinct from RING E3s, in that the HECT active site cysteine forms a thioester intermediate with ubiquitin prior to the transfer of ubiquitin to the target protein (Scheffner et al., 1995). The HECT domain adopts a flexible bilobal structure consisting of a C-terminal lobe that contains the active site cysteine for ubiquitin binding and the N-terminal lobe that contains the E2 binding site (Huang et al., 1999).

1.1.5 Deubiquitylating enzymes Like most post-translational modifications, the ubiquitylation of cellular proteins is a reversible process. The hydrolysis of the isopeptide bond between ubiquitin and the target protein, also referred to as deubiquitylation, is facilitated and catalyzed by deubiquitylating enzymes (DUBs). There are 95 putative human DUBs, 79 of which have confirmed activity, which are classified into five distinct subfamilies (Nijman et al., 2005, Komander et al., 2009a, Pfoh et al., 2015b). Four of the families are thiol/cysteine-dependent proteases, which include

8 ubiquitin C-terminal hydrolases (UCH), the ubiquitin-specific proteases (USP/UBPs), Otubain domain ubiquitin-binding proteins (OTU) and the Josephin domain-containing (MJD) proteases. Members of the fifth family, the Jab1/Pab1/MPN domain-containing (JAMM) proteases, are zinc-dependent metaloproteases. Deubiquitylation is not only important for regulating the stability, localization and function of cellular proteins but also for maintaining a sufficient pool of free ubiquitin in the cell, which is essential for sustaining normal rates of protein ubiquitylation. For example, USP5 is responsible for recycling ubiquitin into the system by disassembling unanchored polyubiquitin chains that would otherwise inhibit ubiquitin-dependant processes (Wilkinson et al., 1995). Furthermore, DUBs such as USP14 and JAMM protease POH1 associate with the 26S proteasome and function in generating free ubiquitin, by preventing its proteasomal degradation along with the substrate (Borodovsky et al., 2001, Yao and Cohen, 2002). Finally, DUBs play essential roles in generating functional conjugation-competent ubiquitin from C-terminally extended ubiquitin precursors that are initially synthesized from ubiquitin-coding genes (Amerik and Hochstrasser, 2004, Hanpude et al., 2015). Aside from insuring an adequate pool of free ubiquitin, deubiquitylating enzymes function in fine tuning the ubiquitylation of cellular proteins by reversing the actions of ubiquitin ligases. Due to their large numbers and diverse substrate specificities, DUBs have been implicated in a variety of cellular processes including the DNA damage response and NFKβ signalling, apoptosis, cell cycle progression, immune responses, gene expression and endocytosis (Amerik and Hochstrasser, 2004, Reyes-Turcu et al., 2009, Eletr and Wilkinson, 2014, Song and Rape, 2008). For example, USP11 plays a role in the DNA damage response by regulating the recruitment of repair proteins to the damaged site through counteracting RNF8/168-mediated ubiquitylation of γH2AX (Yu et al., 2016). USP11 also functions in positively regulating nucleotide excision repair by deubiquitylating the DNA damage recognition component XPC and promoting its retention at DNA damage sites (Shah et al., 2017). Additionally, USP20 and USP29 function in the activation of the ATR-Chk1 DNA damage checkpoint by deubiquitylating the checkpoint adaptor Claspin, resulting in its stabilization (Martin et al., 2015, Yuan et al., 2014a). A number of DUBs, including CLYD, A20 and USP11 have been reported to downregulate NFKβ signalling by modulating the ubiquitylation status of pathway associated proteins (Wertz et al., 2004). Furthermore, deubiquitylation of the epidermal growth factor (EGFR) by USP8 and the JAMM protease ASMH inhibits its endosomal trafficking and prolongs

9 EGFR-associated signaling cascades (Wright et al., 2011). Finally, Otub1, OTUD5, USP29 and USP24 have been reported to regulate apoptosis, genome stability and cell cycle progression by deubiquitylating and stabilizing the p53 tumor suppressor protein (Sun et al., 2012, Luo et al., 2013, Liu et al., 2011, Zhang and Gong, 2016). USP7, which is the focus of this thesis, is the most extensively studied DUB and is involved in a number of key cellular processes which I will outline in detail below.

1.2 UBIQUITIN-SPECIFIC PROTEASE 7 USP7 is a 135 kD protein that was first identified as a binding partner of the herpes simplex virus 1 (HSV-1) ICP0 protein, an E3 ubiquitin ligase that is important for HSV-1 lytic infection and viral reactivation (Meredith et al., 1994, Meredith et al., 1995, Boutell and Everett, 2013, Lanfranca et al., 2014). Therefore, USP7 was first termed herpes virus associated ubiquitin specific protease (HAUSP) and is frequently referred to by this name. It was later determined that USP7 not only stabilizes ICP0 by interfering with its auto-ubiquitination, but that ICP0 conversely induces the degradation of USP7 (Canning et al., 2004, Boutell et al., 2005). Furthermore, the USP7-ICP0 interaction was shown to be crucial for effective HSV-1 infection (Everett et al., 1999, Everett et al., 2004). In addition to ICP0, USP7 has been shown to be bound by proteins from several other viruses, including Epstein-Barr Virus (EBV), Kaposi’s Sarcoma associated Herpes Virus (KSHV), cytomegalovirus (CMV) and adenovirus (Lee et al., 2011b, Holowaty et al., 2003c, Salsman et al., 2012a, Saridakis et al., 2005a, Sarkari et al., 2009a, Jager et al., 2012a, Ching et al., 2013a). Several of these interactions were shown to be important for viral replication and in promoting host cell survival. USP7 is one of the most extensively studied DUBs. Due to its numerous protein substrates and interactors, USP7 has been linked to the regulation of numerous cellular processes, including apoptosis, the cell cycle, DNA damage responses, immune responses and DNA replication and transcription (Pfoh et al., 2015b, Frappier and Verrijzer, 2011, Nicholson and Suresh Kumar, 2011, Kim and Sixma, 2017). USP7 is widely expressed in all tissue types, and is localized predominantly in the nucleus, with a fraction of it associating with promyelocytic leukemia nuclear bodies (PML-NB) (Bhattacharya et al., 2018, Everett et al., 1997). However, a portion of USP7 has also been shown to localize to the cytoplasm and the mitochondria (Fernandez-Montalvan et al., 2007, Marchenko et al., 2007). USP7 spans 1120 amino acids and is composed of three distinct structural domains; an N-terminal TRAF–like

10 domain, a central catalytic domain and a C-terminal domain composed of five ubiquitin-like (Ubl) motifs (Figure 1-2A). The study of USP7 functions is of particular interest as its misregulation has been associated with several cancers (Song et al., 2008, Yang et al., 2012, Zhang et al., 2016b, Qin et al., 2016, Zhao et al., 2015) and implicated in neurological disorders (Hao et al., 2015, Cheon and Baek, 2006) and diabetes (Hall et al., 2014).

1.2.1 Deubiquitylation by USP7 Cysteine proteases contain a catalytic triad consisting of Cys-His-Asp/Asn residues and despite the diversity of their structures, the catalytic triad of almost all cysteine proteases are nearly superimposable (Johnston et al., 1997, Storer and Menard, 1994, Komander et al., 2009a, Amerik and Hochstrasser, 2004). The Asp/Asn functions to stabilize the His, which in turn serves to deprotonate the Cys, priming it for nucleophilic attack on the on the carbonyl carbon of ubiquitin G76 at the isopeptide bond. For USPs, the catalytic triad is comprised of two highly conserved regions, the Cys-box (Cys) and His-Box (His and Asp/Asn) (Amerik and Hochstrasser, 2004). The crystal structure of the USP7 catalytic domain has been determined, both in isolation and in complex with ubiquitin aldehyde (Uba1; a ubiquitin derivative in which the C-terminal carboxylate is replaced by an aldehyde) (Hu et al., 2002). The USP7 catalytic domain is composed of three subdomains, and together their structures resemble the thumb, palm and fingers of an extended right hand (Figure 1-2B). The thumb and the palm meet to form the catalytic cleft which contains the catalytic triad consisting of C223, H464 and D481. In the unbound state the USP7 catalytic domain exists in an unproductive conformation in which the C223 is too far from the His-box to allow for hydrogen bonding and productive catalysis and is not within reasonable distance of any charged or polar side chain to allow direct interactions. However, upon binding to Uba1 USP7 undergoes conformational changes in the catalytic core in which the active side residues become realigned for productive catalysis. Namely, a shift in His464 and Cys224 towards the bound C-terminus of Uba1 brings the two amino acids closer together at a distance that would be favorable for hydrogen bonding. Furthermore, this switch to the active conformation brings about dramatic changes in a loop next to the active site, referred to as the “switching loop” (Faesen et al., 2011). Crystal structures revealed that the Uba1 C- terminus is bound deep in the catalytic cleft and makes direct interactions with the tip of the fingers and the cleft between the palm and the thumb (Hu et al., 2002).

Figure 1-2. The ubiquitin specific protease 7. (A) Domain organization of USP7, consisting of the N-terminal TRAF like domain (53-208), the catalytic domain (208-540) and the five ubiquitin like (Ubl) motifs that make up the C-terminal domain (540-1102). Also indicated is the catalytic cysteine (C223) required for the deubiquitylating activity of USP7. (B) Crystal structure of the catalytic domain of USP7 is shown (Hu et al., 2002, with permission from Elsvier). The structure resembles an extended right hand that is composed of three structural elements: fingers (green), palm (blue) and the thumb (red). Also indicated are the ubiquitin binding groove and the catalytic cleft.

12 Several studies have reported that full catalytic activity of USP7 requires its C-terminal domain (560-1102; CTD), which is composed of five ubiquitin-like (Ubl) modules (Fernandez- Montalvan et al., 2007, Ma et al., 2010, Faesen et al., 2011, Kim et al., 2016). Using a structural approach, Faesan et al determined that Ubls 4 and 5 (Ubl-45) form a flexible peptide that folds back on the USP7 catalytic domain to interact with the “switching loop” (Faesen et al., 2011). This interaction increased the activity of USP7 100-fold by mediating the rearrangement of the catalytic triad to the active conformation and enhancing ubiquitin binding. This activation state is stabilized allosterically by the guanosine monophosphate synthase (GMPS), a USP7 CTD interactor that was previously reported to stimulate the activity of Drosophila and human USP7 to cleave monoubiquitin from histone H2B (van der Knaap et al., 2005, Sarkari et al., 2009b). By binding to the first three Ubl domains (Ubl-123), GMPS increased the affinity between Ubl-45 and the switching loop, and consequently enhanced the activity of USP7 (Faesen et al., 2011). This study raises the possibility that other USP7 interactors may be capable of allosterically promoting the active state similar to GMPS or alternatively promoting the inactive state by sequestering Ubl-45 from the catalytic domain.

1.2.2 USP7 protein interacting domains and mechanisms of USP7 interactions The N-terminal and C-terminal domains that flank the USP7 catalytic domain, harbor distinct binding pockets that mediate protein-protein interactions and provide substrate specificity. USP7 amino acids 53-208 form the N-terminal tumor necrosis factor-receptor associated factor (TRAF) domain. The TRAF domain forms an eight stranded anti-parallel β- sandwich typical of the C-terminal binding domain of TRAF proteins, and is most similar in structure and identical in topology to TRAF 2, 3 and 6 (Saridakis et al., 2005b). The tumor suppressor protein p53 was the first USP7 interactor that was shown to bind specifically through the USP7 NTD (Hu et al., 2002). Subsequently, the USP7 binding partners Mdm2 and the Epstein Barr Virus (EBV) EBNA1 protein were also shown to interact through this domain (Holowaty et al., 2003a, Sheng et al., 2006). Biochemical and crystal structural studies on the interactions of USP7 with EBNA1, p53 and Mdm2 revealed that all three interactors bind to the same shallow groove on the surface of the USP7 TRAF domain, currently referred to as the TRAF pocket (Figure 1-3). These interactions are mediated by a combination of hydrophilic and hydrophobic interactions and predominantly involves strand β7 of the USP7 TRAF domain. In depth studies on these interactions further revealed that the TRAF pocket binds P/A/ExxS consensus motifs within EBNA1, p53 and Mdm2 through contacts with amino acids D164 and

Figure 1-3. Crystal structure of the EBNA1, p53 and Mdm2 peptides bound to the USP7 TRAF pocket. Transparent surface representation of USP7 bound to EBNA1 peptide 444EGPS447 (top left; image adapted from Saridakis et al., 2005 with permission), p53 peptide 359PGGS362 (top-right; image adapted from Sheng et al., 2006 with permission) and Mdm2 peptide 364AHSS367 (bottom; image adapted from Sheng et al., 2006 with permission).

14 W165 of USP7 (Saridakis et al., 2005b, Sheng et al., 2006, Hu et al., 2006). Consistent with these findings, a USP7 D164A/W165A mutant abrogated binding to this pocket. Importantly, 1H- N15 HSQC NMR spectroscopy analysis revealed that the D164A/W165A mutant did not affect the folding of the USP7 protein (Sheng et al., 2006). Furthermore, the terminal serine of the P/A/ExxS motif was shown to be essential for this interaction, since its mutation to an alanine is sufficient to impair binding to the TRAF pocket. A growing number of USP7 TRAF pocket interactors and their specific P/A/ExxS motifs have been identified over the years. These include Mdmx (Sarkari et al., 2010a), minichromosome maintenance binding protein (MCM-BP) (Jagannathan et al., 2014), telomeric shelterin component TPP1 (Zemp and Lingner, 2014), ubiquitin E2 UbE2E1 (Sarkari et al., 2013) and the KSHV proteins vIRF1 and vIRF4 (Chavoshi et al., 2016, Lee et al., 2011a). Through collaborations with Vivian Saridakis at York University, we have recently discovered the second USP7 binding pocket, which is located in the second of five Ubl motifs that comprise the USP7 CTD (Pfoh et al., 2015a). These Ubl motifs, which are found in a number of multidomain proteins and several USPs, share the β-grasp fold with ubiquitin but lack the terminal glycine residue required for conjugation to a target lysine (Faesen et al., 2011). The Ubl2 binding pocket is an acidic patch, and was identified through structural and biochemical studies on the interactions of USP7 and the HSV-1 protein ICP0, which is a previously identified USP7 CTD interactor (Pfoh et al., 2015a). Since discovery of this binding pocket is part of my thesis, it will be discussed in more detail in Chapter 2.

1.2.3 Roles of USP7 in tumor suppressor regulation 1.2.3.1 USP7 plays a key role in regulating the p53 pathway The first identified USP7 target for deubiquitylation was the tumor suppressor protein p53 (Li et al., 2002). p53 is a transcription factor that regulates the expression of a diverse set of genes that function in cell cycle arrest, apoptosis, and DNA repair (Ko and Prives, 1996, Levine, 1997, Bargonetti and Manfredi, 2002). Furthermore, p53 is one of the most frequently mutated genes in human cancers (Duffy et al., 2014, Klein and Vassilev, 2004). Initial studies showed that USP7 directly binds to and deubiquitylates p53, resulting in its stabilization. Consequently, USP7 can promote p53-dependent apoptosis and inhibition of cell growth. However, further studies revealed that the USP7-p53 dynamic is much more complex than originally proposed, since USP7 can also negatively regulate p53 stability. It was shown that partial reduction in

15 USP7 levels resulted in the expected decrease in p53, whereas complete ablation of USP7 led to p53 stabilization (Li et al., 2004b, Cummins et al., 2004, Cummins and Vogelstein, 2004). This phenomenon was largely due to the fact that USP7 directly deubiquitylates and stabilizes the dominant p53 E3 ligase Mdm2. Furthermore, USP7 was shown to directly deubiquitylate and stabilize Mdmx, an Mdm2 homologue that inhibits p53 transcriptional activity (Meulmeester et al., 2005a, Danovi et al., 2004). Under normal growth conditions USP7 predominantly binds and stabilizes Mdm2 and Mdmx, which in turn negatively regulate p53 stability and activity, respectively (Meulmeester et al., 2005a). This is further explained by the fact that Mdm2, Mdmx and p53 compete for the USP7 TRAF binding pocket and that Mdm2 exhibits a higher binding affinity for this pocket than p53 (Sheng et al., 2006). However, in the presence of DNA damage, ATM/ATR mediated-phosphorylation of Mdmx and Mdm2 decreases their interactions with USP7 and renders Mdm2 and Mdmx highly unstable, allowing for USP7 to bind and stabilize p53 (Meulmeester et al., 2005b). Several proteins have been shown to interfere with the USP7-mediated stabilization of p53. For example, TSPYL5 is a marker of poor outcome in breast cancer and was shown to reduce the activity of USP7 towards p53 by interfering with their interaction, resulting in decreased p53 function and enhanced cell proliferation (Epping et al., 2011). This action is functionally similar to that which was previously shown by our lab for the EBV protein EBNA1. Due to its high affinity for the USP7 TRAF binding pocket, EBNA1 outcompetes p53 for USP7 binding, resulting in destabilization of p53 and decreased p53 function in response to DNA damage (Saridakis et al., 2005b). This interference of p53 stability by EBNA1 may provide a mechanism by which EBV contributes to increased host cell survival. Further studies in our lab have shown that USP7 can regulate p53 activity through mechanisms that are independent of its deubiquitylating activity. By binding to the p53 regulatory region that is responsible for modulating p53-DNA interactions, USP7 promotes binding of p53 to its target promoters and consequently induces the expression of the p53 gene target p21 (Sarkari et al., 2010b). This function of USP7 is mediated through the USP7 CTD rather than the TRAF domain that was previously shown to bind p53.

1.2.3.2 Additional roles of USP7 in tumor suppressor and oncoprotein regulation In addition to p53, USP7 stabilizes and/or regulates the functions of several other tumor suppressor proteins, including retinoblastoma-associated protein (Rb), PTEN, FOXO4, promyelocytic leukemia (PML) protein and p16 (Bhattacharya and Ghosh, 2014, Maertens et al.,

16 2010, Sarkari et al., 2011, Song et al., 2008, van der Horst et al., 2006). Furthermore, USP7 was shown to positively regulate the oncoproteins PHF8 and c-myc (Wang et al., 2016b). Therefore, it is not surprising that both overexpression and downregulation of USP7 have been associated with several cancers. As expected, many of these cases are attributed to modulation of the p53 pathway (Sun et al., 2017, Masuya et al., 2006, Zhao et al., 2015). Conversely, the roles of USP7 in several cancers have been reported to be independent of p53, and instead through modulation of other USP7 targets. For example, USP7 deubiquitylates and stabilizes the histone demethylase PHF8 (Wang et al., 2016b), a highly recognized oncoprotein associated with several types of malignancies (Ma et al., 2015, Sun et al., 2013, Shen et al., 2014). USP7 is overexpressed in breast carcinomas and promotes breast cancer proliferation and carcinogenesis by upregulating PHF8 and the cell cycle regulator cyclin A2. A role for USP7 in glioma has also been identified through regulation of Rb (Bhattacharya and Ghosh, 2014). In normal cells, USP7 promotes G1 arrest by deubiquitylating and stabilizing Rb, whereas USP7 overexpression in glioma leads to Rb destabilization and facilitates glioma progression and cellular proliferation. The latter is attributed to an increase in the USP7 target and Rb E3 ligase, Mdm2, which is the crucial factor in Rb regulation in glioma cells. Another E3 ligase that links USP7 to cancer pathogenesis is the USP7 target TRIP12 (Cai et al., 2015). By deubiquitylating and stabilizing TRIP12, USP7 promotes degradation of the TRIP12 target ARF, contributing to hepatocellular carcinoma (HCC) cell growth and progression. In keeping with these findings, USP7 is overexpressed in HCC and this correlates with a malignant phenotype. Interestingly, the role of USP7 in cancer extends beyond the removal of degradative polyubiquitin chains. For instance, the cleavage of monoubiquitin from the PTEN tumor suppressor by USP7 leads to PTEN nuclear exclusion and consequently inhibits its tumor suppressive functions (Song et al., 2008). Furthermore, overexpression of USP7 in prostate cancer is associated with PTEN nuclear exclusion and is directly correlated with tumor aggressiveness. Similar to its effect on PTEN, USP7 also removes monoubiquitin from FOXO4, which promotes FOXO4 cytoplasmic translocation and inhibits its transcriptional activity (van der Horst et al., 2006). Studies in our lab have shown that USP7 can negatively regulate the PML tumor suppressor and its associated nuclear bodies through mechanisms that are independent of USP7 deubiquitylating activity and also independent of PML negative regulators CK2α and RNF4. Finally, USP7 and another DUB, USP11, indirectly function in repressing the INK4a

17 tumor suppressor by directly deubiquitylating and stabilizing members of the Polycomb repressive complex-1 (PRC1) (Maertens et al., 2010).

1.2.4 Additional Cellular Functions of USP7 1.2.4.1 Roles of USP7 in cell cycle regulation USP7 has been reported to play a role in regulating cell cycle progression during both interphase and mitosis. For example, multiple reports have shown that inhibition of USP7 in cancer cells results in G1/S arrest and apoptosis in a p53-dependant manner (Reverdy et al., 2012, Yi et al., 2016, Giovinazzi et al., 2013). p53 induces G1/S arrest in part by activating the transcription of the cyclin dependant kinase (CDK) inhibitor p21, which prevents the G1 to S transition by inhibiting CDK-cyclin complexes (Karimian et al., 2016, Jung et al., 2010). Furthermore, work in our lab has shown that USP7 can induce p21 expression by promoting the binding of p53 to the p21 promoter (Sarkari et al., 2010b). Collectively, these findings suggest that USP7 can regulate the G1/S transition through p53-mediated effects on p21. USP7 may also regulate p21-dependant G1/S arrest through deubiquitylation and stabilization of Chfr, a RING E3 ligase that promotes upregulation of p21 through degradation of HDAC1 (Nicholson and Suresh Kumar, 2011, Oh et al., 2007, Oh et al., 2009). Finally, by promoting the nuclear exclusion of FOXO4, USP7 inhibits FOXO4-mediated transcription of p27, a CDK inhibitor which activates G1/S arrest in a similar manner as p21 (van der Horst et al., 2006, Brenkman et al., 2008). USP7 has also been linked to the regulation of the G2/M checkpoint. Upon DNA damage induction, activated checkpoint kinase-1 (Chk1) promotes the degradation of Cdc25A and subsequent Cdk1/cyclin B inactivation and G2/M arrest (Mailand et al., 2000, Patil et al., 2013). The activation of Chk1is dependent on claspin, which in turn is deubiquitylated and stabilized by USP7 (Faustrup et al., 2009, Nicholson and Suresh Kumar, 2011). Furthermore, USP7 has been reported to directly stabilize Chk1 (Alonso-de Vega et al., 2014). Therefore, in response to genotoxic stress, USP7 may promote G2/M arrest by both stabilizing and activating Chk1. The mitotic checkpoint is a failsafe mechanism that ensures that chromosomes are properly segregated and attached to the spindle before progressing through subsequent stages of mitosis (Liu and Zhang, 2016, Musacchio, 2015). USP7 has been implicated in the regulation of this checkpoint by deubiquitylating and stabilizing the mitotic checkpoint proteins Bub3 and Chfr (Scolnick and Halazonetis, 2000, Oh et al., 2007, Giovinazzi et al., 2013, Nicholson and

18 Suresh Kumar, 2011, Oh et al., 2009). Consequently, USP7 depletion was shown to result in mitotic abnormalities, including abnormal chromosome segregation, micronuclei accumulation, increased aneuploidy and prolonged mitosis (Giovinazzi et al., 2014).

1.2.4.2 USP7 in DNA replication, chromatin remodeling and transcription In addition to regulating cell cycle progression, multiple studies have reported roles for USP7 in DNA replication. The first identified a role for USP7 in regulating the function of the minichromosome maintenance (MCM) complex. The MCM complex assembles at the origin of replication in early G1 and functions in origin licencing and replication elongation by providing the DNA helicase activity required for DNA unwinding (Ilves et al., 2010, Ishimi, 1997). Studies in our lab have revealed that USP7 works in conjunction with the MCM-binding protein to facilitate unloading of the MCM complexes from chromatin at the end of S phase and consequently promotes progression into G2 (Jagannathan et al., 2014). It was reported that active replication forks contain an enrichment of SUMOylated replication factors with diminished ubiquitylation levels (Lopez-Contreras et al., 2013). Interestingly, USP7 was recently implicated in preventing the displacement of these SUMOylated proteins from the replisomes by acting as a replisome-associated SUMO deubiquitylase (SDUB) (Lecona et al., 2016). Furthermore, USP7 was shown to be essential for replication fork progression and the firing of new origins, which may be attributed to its SDUB activity at the replisomes. Finally, USP7 is additionally linked to DNA replication through the deubiquitylation and stabilization of Geminin (Hernandez-Perez et al., 2017). By regulating the stability of the pre-replication complex (RC) protein Cdt1, Geminin both inhibits inappropriate origin firing in S-G2 and promotes pre-RC formation for the following cycle (Ballabeni et al., 2004, Wohlschlegel et al., 2000). However, it remains unknown whether USP7 controls pre-RC formation through Geminin. Studies on the functions of USP7 in Drosophila embryos led to the discovery of its role in chromatin remodeling. It was reported that USP7 forms a complex with GMPS to reverse the monoubiquitylation of histone H2B, thereby contributing to poly-comb mediated silencing of Drosophila homeotic genes (van der Knaap et al., 2005). Consistent with these results, studies in our lab revealed that GMPS forms a complex with USP7 in human cells and stimulates the ability of human USP7 to deubiquitylate histone H2B in vitro (Sarkari et al., 2009b). Accordingly, silencing of USP7 in human cells resulted in an increase in monoubiquitylated

19 H2B. Interestingly, our lab further determined that the EBV protein EBNA1 recruits the USP7- GMPS complex to the viral origin of replication, where they promote the deubiquitylation of histone H2B and consequently contribute to EBNA1-mediated transcriptional activation (Sarkari et al., 2009b). GMPS was later shown to bind to the USP7 CTD and enhance its deubiquitylating activity (Faesen et al., 2011). A transcriptional role of USP7 and GMPS was also reported in regulation of ecdysteroid target genes (van der Knaap et al., 2010). In addition to H2B, several reports have identified a role for USP7 in regulating the monoubiquitylation of histone H2A, a modification catalyzed by the polycomb repressive complex-1 (PRC1) and is associated with transcriptionally repressed chromatin (Endoh et al., 2012). In human cells, USP7 was found to indirectly promote monoubiquitylation of H2A by stabilizing several components of the PRC1 complex, including Ring1B, BMI1, Mel18 and SCML2 (Maertens et al., 2010, de Bie et al., 2010, Lecona et al., 2015). Accordingly, USP7 depletion was shown to result in the de-repression of the PRC1 target INK4a (Maertens et al., 2010). During male mouse meiosis however, SCML2-mediated recruitment of USP7 to the sex chromosomes is associated with reduced levels of H2A monoubiquitylation in the XY chromatin (Luo et al., 2015). This effect of USP7 on H2A is thought to be indirect since USP7 was unable to catalyze H2A deubiquitylation in vitro (van der Knaap et al., 2005, Sarkari et al., 2009b). In addition to modulating gene expression through chromatin remodelling, USP7 also regulates transcription of several genes by affecting the stability of their associated transcription factors. As previously mentioned, USP7 regulates the FOXO4 and p53-mediated transcription of p21 and p27, respectively (van der Horst et al., 2006, Sarkari et al., 2010b, Gavory et al., 2018). In addition, USP7 has been shown to attenuate neural precursor cell (NPC) differentiation by deubiquitylating and stabilizing the repressor element 1-silencing transcription factor (REST), a critical regulator of NPC self-renewal and lineage specification (Huang et al., 2011).

1.2.4.3 Functions of USP7 in DNA repair By regulating the stability of proteins involved in the DNA damage responses, USP7 plays a pivotal role in modulating DNA repair. For instance, USP7 deubiquitylates and stabilizes Tat interactive protein 60 (Tip60), a histone deacetylase that triggers the DNA damage response pathway by deacetylating and activating the DNA damage kinase ataxia telangiectasia mutated (ATM) (Cui et al., 2015, Sun et al., 2005, Sun et al., 2007). Furthermore, USP7 stabilizes CCDC6, a target of ATM-mediated phosphorylation that functions in DNA repair and

20 checkpoint recovery by regulating the dephosphorylation of histone γH2AX by the PP4C phosphatase (Morra et al., 2015, Merolla et al., 2012, Nakada et al., 2008). USP7 also promotes the ubiquitylation of γH2AX and H2A in response to dsDNA breaks by deubiquitylating and stabilizing their E3 ligase RNF168. As a result, USP7 promotes the recruitment of DNA repair factors BRCA1 and 53BP1 to the damaged sites (Zhu et al., 2015). USP7 was also shown to be important for transcription coupled-nucleotide excision repair (TC-NER), the sub pathway of NER that is restores gene expression through the removal of highly toxic RNA polymerase II blocking lesions in DNA. In this pathway, USP7 deubiquitylates and stabilizes the UV-sensitive syndrome protein UVSSA, which subsequently recruits USP7 to TC-NER complexes to further stabilize the TC-NER master organizing protein ERCC6 (Schwertman et al., 2012, Higa et al., 2016). USP7 also plays an important role in promoting Trans-lesion DNA synthesis (TLS), a DNA damage-tolerance mechanism in which damaged DNA is replicated by low-fidelity DNA polymerases. USP7 stabilizes DNA polymerase eta (Polη), leading to the recruitment of RAD18 to the stalled replication forks, which in turn monoubiquitylates proliferating cell nuclear antigen (PCNA) to initiate TLS (Qian et al., 2015). Interestingly, USP7 was also shown to induce monoubiquitylation of PCNA and mediate efficient DNA damage tolerance by deubiquitylating and stabilizing RAD18 (Zlatanou et al., 2016). Finally, USP7 has also been reported to be important for the repair of oxidative DNA lesions in the base excision repair pathway, however the mechanisms by which USP7 carries out this function is not fully understood (Khoronenkova et al., 2011).

1.2.5 The development of USP7 inhibitors for anti-cancer therapies Given the importance of USP7 in promoting oncogenesis, a number of USP7 small- molecule inhibitors have been developed for the purpose of cancer therapy. The first developed USP7 inhibitor is the cyano-indenopyrazine derivative HBX 41,108. Discovered using high throughput screening, HBX 41,108 (424 nM) was shown to stabilize p53, inhibit cell proliferation and induce p53-mediated apoptosis in cancer cells (Colland et al., 2009). However, HBX 41,108 has since been shown to have poor specificity towards USP7 and to inhibit several other DUBs, including UCHL3, USP5, USP10, and USP8 (Reverdy et al., 2012). Developed later that year, USP7 inhibitors HBX 19,818 and HBX 28,258 (IC50 28.1 and 22.6 μM, respectively) were proposed to have higher specificity than their predecessor (Reverdy et al.,

21 2012). However, the degree of their specificity is still questionable, since they were only tested against a small number of DUBs, Some of the more frequently used commercial USP7 inhibitors include nitrothiophene-based compounds P5091 and its analog P22077 (Altun et al., 2011, Chauhan et al., 2012). Regrettably, in addition to having poor solubility and general cytotoxicity, these compounds also inhibit USP47 with similar specificity to USP7 (Chen et al., 2017, Altun et al., 2011, Ritorto et al., 2014). Within the past year, more promising USP7 inhibitors have been developed, displaying higher potency and selectivity than the previous compounds (Zhang et al., 2017, Turnbull et al., 2017, Kategaya et al., 2017, Gavory et al., 2018). Rather than relying strictly on high-through put screening, the development of several of these superior inhibitors was based on rational design stemming from USP7-small molecule co-crystal structures. These structures provided insights into the binding and inhibitory mechanisms of specific compounds and allowed for better optimization and design. Of these new inhibitors, Compound 4 by Gavory et al (Gavory et al., 2018) seems to be the most potent and highly selective USP7 inhibitor, having an IC50 of 6 nM.

1.3 CYTOKINESIS Cytokinesis is the final stage of cell the cell cycle in which mitotic cells are physically separated into two daughter cells (Figure 1-4). Cytokinesis begins immediately after chromosome segregation in anaphase, when a narrow zone of bundled and overlapping microtubules of opposite polarity, called the central spindle, forms between the separating chromosomes (D'Avino et al., 2015, Green et al., 2012). A number of signalling proteins and complexes are required for the assembly of the central spindle, including the centralspindlin and chromosomal passenger complexes, the microtubule-associated protein regulator of cytokinesis 1 (PRC1), and the Kinase KIF4 (Glotzer, 2009, Ruchaud et al., 2007, Green et al., 2012). Following the formation of the central spindle, the RhoA pathway directs the assembly of the contractile ring, a filamentous network attached to the plasma membrane that is composed mainly of actin and septin filaments and myosin II (Basant and Glotzer, 2018, Eggert et al., 2006, Miller, 2011). Constriction of the contractile ring drives the ingression of the plasma membrane, partitioning the cytoplasm to form the cleavage furrow. During this process, the central spindle matures to form the midbody also known as the Flemming body, which organizes the intercellular bridge (ICB) that connects the two nascent daughter cells. The midbody then serves as a platform to anchor the ingressing plasma membrane and for the

Figure 1-4. Schematic diagram illustrating the various stage of cytokinesis. Cytokinesis begins with the formation of the central spindle (blue) between the separating chromosomes and the assembly of the actomyosin contractile ring (red). Constriction of contractile ring results in the formation of the cleavage furrow and the partitioning of the plasma membrane. The midbody forms from the central spindle and organizes the intercellular bridge (ICB) connecting the two daughter cells. Finally, ESCRT-III proteins (green) assemble at the midbody to promote abscission through severing of the ICB. Image is copyright to Cold Spring Harbor Laboratory Press (D'Avino et al., 2015).

23 assembly of the protein machinery required for abscission; the last (and least understood) step of cytokinesis that results in the detachment of the two daughter cells. A presumed abscission site in the form of a secondary ingression, also referred to as a constriction site, forms at the ICB on either side of the midbody bulge (Schiel et al., 2011). The endosomal sorting complex required for transport (ESCRT)-III complex is essential for abscission and has been reported to cooperate with the ATPase VSP4 to constrict and catalyze the severing of the ICB and disassemble the midbody microtubules (McCullough et al., 2013, Christ et al., 2016, Nahse et al., 2017).

1.3.1 The role of the kinesin family member 20B in cytokinesis and abscission The kinesin family member 20B (KIF20B; previously called MPHOSPH1 or MPP1) is a plus-end-directed Kineisin-6 family member protein that has been shown to be required for cytokinesis at the abscission step. Initial studies revealed that knockdown of KIF20B in HCT116 colon cancer cells resulted in a high proportion of cytokinetic failure, in which cells formed a midbody but did not undergo abscission (Abaza et al., 2003). In this case, the midbodies regressed to form multinucleate cells that eventually underwent apoptosis in the second round of mitosis. The accumulation of multinucleated cells and subsequent apoptosis upon KIF20B knockdown was further verified in several cell lines, including HeLa, hepatocellular carcinomas and bladder cancer cells (Janisch et al., 2018, Kanehira et al., 2007, Liu et al., 2014). Furthermore, overexpression of KIF20B in the latter two cell lines was shown to positively correlate with tumorigenesis and cell proliferation and has therefore been recognized as a therapeutic target for cancer. A recent study revealed that KIF20B depletion resulted in slower furrow ingression, decreased abscission timing and a smaller percentage of midbodies with a detectable constriction site (Janisch et al., 2018). From these results it was suggested that KIF20B functions in cytokinesis abscission by promoting efficient midbody maturation and timely abscission. However, the exact mechanisms by which this occurs is unknown. Analysis of the localization of KIF20B throughout the cell cycle revealed that it localizes to the central spindle during anaphase, and becomes highly concentrated at the midbody during telophase, which is consistent with its role in cytokinesis abscission (Abaza et al., 2003, Kanehira et al., 2007, Janisch et al., 2018). In contrast, KIF20B is pan-nuclear in interphase and diffused throughout the cell during prophase and metaphase.

24 1.4 THESIS OUTLINE AND RATIONALE The primary focus of this thesis is the ubiquitin specific protease 7 (USP7), a deubiquitylating enzyme that regulates many important cellular processes and plays important roles in oncogenesis. Numerous proteins have been reported to interact with USP7, however the mechanisms and functional consequences of many of these interactions are poorly understood. Studying the significance of these interactions is central to gaining a more complete picture of how USP7 regulates cellular processes and pathways and how its misregulation contributes to oncogenesis. The objective of my thesis was to gain a more comprehensive and unbiased understanding of the interactions of USP7 in cancer cells, as well as their mechanisms and function consequences. To this end, I used affinity purification coupled to mass spectrometry (AP-MS) to profile USP7 interactions in AGS gastric carcinoma cells (chapters 2 and 3). In addition to previously characterized USP7 interactors, I identified several interactors whose mechanisms of interaction and/or functional relationship to USP7 had not been characterized. In chapter 2, I characterize USP7 interactions with DDX24, DHX40, USP11 and PPM1G. This led to the discovery that the DDX24 and DHX40 RNA helicases are bound and stabilized by USP7. Furthermore, I determined the USP7 binding pocket used to interact with these four proteins and identified the specific binding motifs in USP11 and DDX24 that mediate the interaction with USP7. At the start of my thesis, the USP7 TRAF domain was the only defined binding pocket for USP7-targeted substrates. In chapter 2, I demonstrate how I aided in the identification of the USP7 Ubl2 binding pocket as part of a collaboration with Vivian Saridakis’s lab and provided insight into interactions with this pocket. Another uncharacterized USP7 interactor identified by AP-MS was the F-box protein FBXO38, which I show in chapter 3 is highly stabilized by USP7. Furthermore, a collaboration with Brian Raught’s lab led to the discovery of a novel interaction between FBXO38 and a key regulator of cytokinesis, KIF20B. Upon further investigating this interaction, I showed that USP7 and FBXO38 have unexpected functions in cytokinesis through the stabilization of KIF20B.

CHAPTER 2

Identification and characterization of USP7 targets in cancer cells

The work in Figures 2-1 and 2-2 are published in the following manuscript:

Pfoh, R., Lacdao, I. K., Georges, A. A., Capar, A., Zheng, H., Frappier, L.,Saridakis, V. (2015). Crystal Structure of USP7 Ubiquitin-like Domains with an ICP0 Peptide Reveals a Novel Mechanism Used by Viral and Cellular Proteins to Target USP7. PLoS pathogens, 11, e1004950.

The remaining figures in this chapter are published as:

Georges AA., Marcon E., Greenblatt G., and Frappier L. (2018). Identification and Characterization of USP7 Targets in Cancer Cells. Scientific Reports, 8, 15833.

The experiments in Figure 2-1 were performed by Roland Pfoh and Ida Lacdao. The mass spectrometry on FLAG-USP7 was performed by Edyta Marcon. I performed all other experiments in this chapter.

26 2.1 INTRODUCTION

The turnover and function of many proteins is regulated by ubiquitylation, often leading to proteasomal degradation. Ubiquitin Specific Proteases (USPs) reverse this ubiquitylation resulting in protein stabilization. USP7 has been shown to regulate the stability of a variety of cellular proteins playing important roles in DNA damage responses, apoptosis, immune responses, DNA replication and transcription (Pfoh et al., 2015b, Frappier and Verrijzer, 2011, Nicholson and Suresh Kumar, 2011, Kim and Sixma, 2017). It is also a key regulator of the p53 pathway; binding and stabilizing the p53 E3 ubiquitin ligases Hdm2 and HdmX to downregulate p53 under normal growth conditions, but also binding and stabilizing p53 in response to DNA damage (Li et al., 2004b, Cummins et al., 2004). In addition to its role in cleaving ubiquitin chains targeting proteins for degradation, USP7 can affect protein localization and function by reversing monoubiquitylation (Song et al., 2008, van der Horst et al., 2006, Sarkari et al., 2009b, van der Knaap et al., 2005). Due to its multiple roles in processes that impact viral infection, USP7 is targeted by proteins from several DNA viruses, particularly herpesviruses, enabling these viruses to evade antiviral responses and replicate efficiently (Ching et al., 2013b, Holowaty et al., 2003b, Jager et al., 2012b, Lee et al., 2011a, Salsman et al., 2012b, Saridakis et al., 2005b, Sarkari et al., 2009b, Everett et al., 1997, Everett et al., 1999, Everett et al., 1998, Gillen et al., 2015, Xiang et al., 2018, Chavoshi et al., 2016). Proteomic based studies on USP7 (Sowa et al., 2009), as well as individual specific studies, have identified numerous proteins that bind USP7. However, in many cases the mechanism by which USP7 binds these proteins and whether or not this binding stabilizes these proteins has not been determined. For example, USP7 has been reported to associate with USP11, leading to regulation of polycomb repressive complex 1 (PRC1), but little is known about the mechanism of this interaction (Sowa et al., 2009, Maertens et al., 2010). Like USP7, USP11 appears to have multiple cancer-associated roles, that could either promote or suppress oncogenesis (Zhang et al., 2018, Wu et al., 2017, Zhang et al., 2016a, Zhou et al., 2017, Lim et al., 2016) and therefore a better understanding of the USP7-USP11 interaction is warranted. An interaction of USP7 with the ATM-dependent phosphatase PPM1G has also been reported but not well characterized (Khoronenkova et al., 2012, Sowa et al., 2009). PPM1G has been reported to dephosphorylate USP7 in response to DNA damage, leading to downregulation of USP7 levels (Khoronenkova et al., 2012). However, the mechanism of this interaction and whether or not USP7 reciprocally regulates PPM1G protein levels has not been determined.

27 In keeping with the roles of USP7 in regulating several cancer-related pathways, upregulation of USP7 in several cancers has been shown to promote oncogenesis, identifying USP7 as an attractive target for cancer therapy (Song et al., 2008, Yang et al., 2012, Zhang et al., 2016b, Qin et al., 2016, Zhao et al., 2015, Hernandez-Perez et al., 2017). Accordingly, several USP7-specific inhibitors have been recently developed (Reverdy et al., 2012, Gavory et al., 2018, Jing et al., 2017, Di Lello et al., 2017, Lamberto et al., 2017, Kategaya et al., 2017, Turnbull et al., 2017). However, to better understand the contributions of USP7 to cancer, a more thorough understanding of its interactions in cancer cells is needed. USP7 has been shown to use two different binding pockets to recognize its target proteins, both of which are distinct from its central catalytic domain. The first binding pocket is within the N-terminal TRAF domain. This pocket was first identified as binding p53, Hdm2, Hdmx and the Epstein-Barr virus (EBV) EBNA1 protein (Saridakis et al., 2005b, Sheng et al., 2006, Hu et al., 2006, Sarkari et al., 2010a), and later shown to also mediate binding to minichromosome maintenance binding protein (MCM-BP) (Jagannathan et al., 2014), telomeric shelterin component TPP1 (Zemp and Lingner, 2014), ubiquitin E2 UbE2E1 (Sarkari et al., 2013) and the vIRF1 and vIRF4 proteins of Kaposi’s sarcoma associated herpesvirus (KSHV) (Chavoshi et al., 2016, Lee et al., 2011a). Structures and mutational analysis showed that a P/A/ExxS motif in all of these proteins mediated the interaction with the TRAF domain binding pocket and that USP7 amino acids D164 and W165 in this pocket are essential for mediating these interactions (Saridakis et al., 2005b, Chavoshi et al., 2016, Jagannathan et al., 2014, Sheng et al., 2006, Hu et al., 2006, Sarkari et al., 2010a). Through collaborations with Vivian Saridakis’s lab, I have contributed to the work that was involved in the identification of the second USP7 pocket, which is located within one of the ubiquitin-like structures (Ubl2) in the C- terminal domain. This pocket is bound by GMP synthetase (GMPS), DNMT1, UHRF1, RNF169 and the herpes simplex virus 1 (HSV-1) protein ICP0, and involves an interaction of KxxxK motifs in these proteins with USP7 amino acids D762 and D764 (Pfoh et al., 2015a, Holowaty et al., 2003a, Faesen et al., 2011, Ma et al., 2012, Pozhidaeva et al., 2015, An et al., 2017). In this chapter I demonstrate how I contributed to the identification of this pocket by validating the importance of the D762 and D764 for binding GMPS, DNMT1 and UHRF1 in vivo.

In addition to the identification of the Ubl2 binding pocket, I used affinity purification coupled to mass spectrometry (AP-MS) to identify USP7 interactions in gastric carcinoma cells. I then determined the USP7 binding pocket used to interact with several of the uncharacterized or

28 poorly characterized USP7 targets (specifically DEAD-box protein DDX24, DEAH-box helicase DHX40, USP11 and PPM1G), as well as the effect of USP7 on these protein levels. In addition, I identified the USP7 binding sites on USP11 and DDX24, defining the mechanism of the USP7 interaction.

2.2 MATERIALS AND METHODS 2.2.1 Cell Lines AGS human gastric adenocarcinoma and CNE2Z EBV-negative nasopharyngeal carcinoma cells (Sun et al., 1992) were maintained in RPMI 1640 and alpha-MEM (Gibco), respectively and supplemented with 10% fetal bovine serum (FBS, Wisent Inc). The HCT116 human colon carcinoma cells and USP7-null HCT116 cells (obtained from Bert Vogelstein) were maintained in alpha-MEM supplemented with 10% FBS.

2.2.2 Plasmids and siRNA Plasmids expressing myc-USP7 (pCDNA3), the myc-USP7 catalytic mutant (C223S) and myc-USP7 D762R/D764R (Ubl2) were described previously (Sarkari et al., 2011, Pfoh et al., 2015a). Myc-USP7 (DW) and myc-USP7 D164A/W165A/D762R/W764A (DW/Ubl2) were gifts from Yi Sheng and Vivian Saridakis, respectively (Sarkari et al., 2013). The mammalian ICP0 expression construct pCI-110 ICP0 was obtained from Roger Everett (Everett et al., 1999). The plasmid expressing FLAG-USP11 (pCMV) was generated by PCR amplification of the USP11 sequence in a USP11 pDEST-LPCX vector (a gift from Daniel Durocher) using forward primer: 5’−GATCGGTACCACCATGGACTACAAGGACGACGATGACAAGGCAGCCATGGCAGT AGCCCCGCGA −3’and reverse primer 5’−GATCGCGGCCGCTCAATTAACATCCATGAACTCAG −3’. The resulting PCR product was inserted between the KpnI and NotI sites of the pCMV 3FC vector (previously described (Salsman et al., 2011)), generating an N-terminal FLAG-tagged USP11 expression construct. The FLAG-USP11 P/AxxS mutants S562A, S671A and S687A and the triple mutant S562A/S671A/S687A (3xS/A) were generated using GeneArtTM StringsTM DNA Fragments (Invitrogen). The FLAG-DDX24 (pCMV) was generated by PCR amplification of the DDX24 sequence in a DDX24 pCDNA3 vector (a gift from Keiichi I. Nakayama (Yamauchi et al., 2014)) using forward primer: 5’−CATGGGTACCACCATGGACTACAAGGACGACGATGACAAGGCAGCCATGAAGTT

29 GAAGGACACAAAATCAAG−3’and reverse primer 5’−CATGGCGGCCGCTTAATTTGCACTTGTACTTGGCTG−3’. The resulting PCR product was inserted between the Kpn I and Not I sites of pCMV 3FC. The FLAG-DDX24 S342A (pCMV) mutant was generated using GeneArtTM StringsTM DNA Fragments. The FLAG-DDX24 S857A and S342A/S857A (2xS/A) mutants were generated by PCR amplification of the full length FLAG-DDX24 WT or S342A mutant, respectively, using the same forward primer described above and a reverse primer that contained the point mutant sequence: 5’−CATGGCGGCCGCTTAATTTGCTGCTGTACTTGGCTGTGGCTG −3. The resulting PCR products were inserted between the Kpn I and Not I sites of pCMV 3FC. All plasmids were verified by DNA sequencing. Stealth siRNA targeting USP7 (#1 5’−CCCAAAUUAUUCCGCGGCAAA−3’ and #2 5’−CCTCTAGCCGAAGTCTTCAGCAAGA −3’), TRIP12 (5’−GGGAUCCAUGGGAUCCACAACUUCA −3’) and USP11 were from Invitrogen. AllStar negative-control siRNA was obtained from Qiagen.

2.2.3 Affinity Purification coupled to Mass Spectrometry (AP-MS) AGS cells in 25 15-cm diameter plates at 70% confluence were transduced with the adenoviruses (minimum amount required to infect 70% of the cells) expressing USP7 or β-Gal with C-terminal Sequential Purification Affinity (SPA) tags (Zeghouf et al., 2004) and harvested 48 hours post-transduction. The generation of the adenoviruses is described in Georges et al (Georges, 2018). Cells were lysed and extracted by the “high salt extraction” method described in Georges and Frappier (Georges and Frappier, 2015b). The extract was incubated with 50 μl of anti-FLAG M2 resin (Sigma-Aldrich) 4 hours at 4ºC with end-over-end rotation. The resin was washed first in IPP buffer (10 mM HEPES pH 7.9, 100 mM NaCl, 0.1% Triton, 10% glycerol) followed by a second wash in 50 mM ammonium bicarbonate, 75 mM KCl. Bound proteins were eluted by three incubations in 150 μl 0.5 M ammonium hydroxide, pH 11. Eluates were dried by lyophilisation using a SpeedVac, washed once in high-performance liquid chromatography (HPLC)-grade water and further dried by lyophilisation. The lyophilized protein was resuspended in 50 mM ammonium bicarbonate containing 10 µg/µl proteomic grade trypsin (Sigma) and incubated overnight at 37°C followed by further incubation for 2 hours in freshly added trypsin. Samples were lyophilised again and the peptides were analyzed by liquid

30 chromatography-tandem mass spectrometry (LC-MS/MS) using a LTQ Orbitrap system (Thermo Finnigan) and identified using Mascot software (Matrix Science, United Kingdom).

2.2.4 Transfections and USP7 inhibitor treatment For the experiments on USP7-UHRF1 and USP7-GMPS interactions 293T cells at 70% confluence in a 10-cm-diameter dish were transfected with 10 μg of plasmid expressing WT USP7 or D762R/D764R USP7 or with pcDNA3.1 (negative control), in each case using 20 μl PolyJet (SignaGen Laboratories) transfection reagent. Cells were transferred to a 15-cm-diameter dish 24 h post-transfection and harvested 48 h post-transfection. For experiments on USP7-ICP0 interactions, 293T cells were co-transfected with 1 μg of plasmid expressing WT or D762R/D764R USP7 and either 1 μg pCI-110 ICP0 or 1 μg pcDNA3.1. For controls lacking USP7, 1 μg pCI-110 ICP0 was co-transfected with 1 μg pcDNA3.1. In each case 4 μl PolyJet (SignaGen Laboratories) transfection reagent was used. For experiments involving TRIP12, USP11, DDX24, DHX40 and PPM1G, AGS or CNE2Z cells at ~80% confluency in 10-cm dishes were transfected with 7 µg of the indicated plasmids using transfection grade Polyethylenimine (PEI, Polyscience 23966). In brief, 7 µg of DNA was diluted in 1 ml optimum media, followed by addition of 21 µl PEI reagent. The DNA- PEI complexes were mixed briefly by vortexing and incubated at room temperature for 15 minutes prior adding to the cells. Cells were harvested 48 hours post-transfection. For the FLAG- USP11 and Myc-USP7 co-transfection experiments, 3.5 µg of each of the co-transfected plasmids were used for a total of 7 µg. For the USP7 inhibitor experiments, cells at ~40% confluency were treated with a final concentration of 5 µM of USP7 inhibitor (Compound 4; also known as AD04) or the inactive enantiomer (gifts from Timothy Harrison (Gavory et al., 2018)). Cells were harvested 8 hours (CNE2Z cells) or 24 hours (AGS and HCT116 cells) post-inhibitor treatment. For siRNA silencing experiments, AGS or CNE2Z cells were plated in 10-cm dishes and immediately transfected with 100 pmol of small interfering RNA (siRNA) against USP7, TRIP12 or USP11 using 4 μl of Lipofectamine 2000. For USP7 and USP11 silencing, siRNA transfections were repeated two additional times after 24 and 48 h. Cells were harvested 48 h after the last round of transfection and processed for Western blotting. For proteasome inhibition, 10 µM final concentration of MG132 (Sigma) was added to the cells 12 hours before harvesting.

31 2.2.5 Western blotting Cells were lysed in 9 M urea, 10 mM Tris-HCl pH 6.8, sonicated and clarified by centrifugation. 80 µg of protein was subjected to SDS-PAGE and transferred to nitrocellulose. Membranes were blocked in 5% non-fat dry milk in TBS-T (TBS with 0.1% Tween), then incubated with primary antibodies FLAG M2 (F1804 from Sigma; 1:5000 dilution) or rabbit anti-FLAG (PA1-984B from Invitrogen; 1:5000 dilution), or antibodies against myc (Santa Cruz 789; 1:5000), USP7 (Bethyl laboratories A300-033A; 1:10000), USP11 (Bethyl laboratories A301-613A; 1:5000), TRIP12 (Bethyl A301-814A; 1:2000), DDX24 (Bethyl A300-698A; 1:5000), DHX40 (ThermoFisher PA5-60685; 1:1000), PPM1G (Bethyl A300-881A; 1:5000), p53 (Santa Cruz sc-126; 1:1000), ICP0 (H1A027 from Virusys Corporation; 1:5000 dilution), UHRF1 (A301-470A from Bethyl Laboratories; 1:1000 dilution), GMPS (rabbit serum raised against full-length GMPS (Sarkari et al., 2009b); 1:5000 dilution) or actin (Santa Cruz 1615; 1:1000 dilution). Membranes were then washed three times in TBS-T, followed by incubation with goat anti-mouse HRP (Santa Cruz 2005) or goat anti-rabbit HRP (Sigma SAB3700878) at 1:5000 dilution. Membranes were developed using chemiluminescence reagents (ECL, Clarity ECL or ECL-prime; Santa Cruz, Bio-Rad or Amersham). Bands in Western blots were quantified using ImageQuantTL (GE healthcare Sciences), and normalized to actin bands.

2.2.6 Immunoprecipitation Cells transfected with the indicated mammalian expression plasmids were lysed on ice for 30 min in 4X volume of radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl pH 8, 150 mM NaCl, 0.1% sodium deoxycholate, 0.5% NP-40) with complete protease inhibitors (Sigma P8340), followed by sonication and clarification by centrifugation. 4 mg of each clarified lysate was incubated with 20 μl of M2 anti-FLAG resin (Sigma) or anti-Myc resin (sc-40 AC Santa Cruz), overnight at 4°C with end-over-end rotation. Resins were harvested by centrifugation, washed 4 times in lysis buffer, then boiled in 2x SDS loading buffer. Recovered proteins and 60 µg of the input were separated by SDS-PAGE and analyzed by Western blotting, as described above.

32 2.3 RESULTS 2.3.1 Identification of the USP7 Ubl2 Binding pocket Several USP7 interactors bind through the CTD, including UHRF1, GMPS and the HSV protein ICP0, however the molecular mechanisms of these interactions have not been characterized (Holowaty et al., 2003a, Faesen et al., 2011, Ma et al., 2012). The five Ubl motifs that make up the USP7 CTD organize in a 2-1-2 architecture, where Ubl1 and Ubl2, as well as Ubl4 and Ubl5, form di-Ubl units. The interfaces between the di-Ubls are mediated by hydrogen bonds, electrostatic interactions and extensive hydrophobic contacts. In contrast, Ubl3 engages in limited contacts with the other Ubl motifs (Faesen et al., 2011). Previous reports have shown that ICP0 and GMPS bind the USP7 CTD within a region that corresponds to Ubl123 (Holowaty et al., 2003a, Faesen et al., 2011). Furthermore, the USP7 binding region on ICP0 is between residues 594–633, where K620 was found to be essential for the interaction (Kalamvoki et al., 2012, Everett et al., 1999). The fact that several USP7 interactors bind to the USP7 CTD, prompted us to identify and characterize the molecular mechanisms of these interactions. Using GST pull-down assays, the ICP0 region that binds the USP7 CTD was further narrowed down to 617GPRKCARKTRH627 (Data not shown). Furthermore, GST pull-down assays with various USP7 CTD fragments (Ubl12, Ubl123, Ubl345, Ubl45) revealed that the interaction with this ICP0 peptide is contained within Ubl12. The crystal structure of Ubl123- ICP0 peptide complex demonstrated that the ICP0 peptide binds to the negatively charged USP7 sequence 758DELMDGD764 on Ubl2 (Figure 2-1A and B). The two ICP0 lysine residues belonging to the central part of the peptide (KCARKT; K620 and K624) function like a pair of tongs by forming salt-bridges with two buried aspartate residues of USP7 (D762 and D764) (Figure 2-1C and D). GST pull-down assays revealed that mutations in either K620 or K624 of ICP0 was enough to disrupt binding to USP7 Ubl123. Furthermore, a similar assay was used to show that mutating USP7 D762 and D764 to alanines (individually or in combination) is sufficient to abolish the interaction with ICP0. The identification of this KxxxK sequence in ICP0 led to the identification of similar motifs in the USP7 CTD interactors GMPS (321KRISK325) and UHRF1 (644KGKWK648) that were subsequently shown to bind the Ubl2 pocket in vitro. Moreover, in vitro binding studies revealed the USP7 D762A and D764A mutants, in addition to mutations in the two lysines of the GMPS and UHRF1 peptides, were sufficient to disrupt the USP7-GMPS and USP7-UHRF1 interactions. These results mimic the

Figure 2-1. The crystal structure of the Ubl123-ICP0 peptide complex. (A) Interaction between Ubl123 and ICP0 peptide shown in cartoon representation (Ubl123) and in stick representation (ICP0 peptide). (B) Electrostatic surface representation with acidic regions shown in red and basic regions in blue. (C) Front view of the ICP0 binding site. Interactions between Ub123 and ICP0 are highlighted by dashed lines. (D) Surface representation of the binding pocket with stick model of ICP0

34 effects on ICP0 binding and confirm that the GMPS and UHRF1 peptide binds USP7 through the Ubl2 binding pocket. While the in vitro data indicate that ICP0, GMPS and UHRF1 can contact USP7 through the Ubl2 binding pocket, we wanted to determine the degree of importance of this interaction in human cells in the context of full length USP7. To this end, I expressed myc-tagged USP7 with or without a D762R/D764R mutation in the Ubl2 binding pocket (referred to here as Ubl2) in 293T cells along with ICP0, immunoprecipitated USP7 by virtue of the myc tag and examined recovery of ICP0. As shown in Figure 2-2A, the recovery of ICP0 was decreased but not abrogated by the Ubl2 mutation, suggesting that, while these Ubl2 contacts contribute to USP7 binding, additional contacts of ICP0 with USP7 must also occur. Such additional contacts are also suggested by the fact that both WT USP7 and the Ubl2 mutant had a stabilizing effect on ICP0 (compare input levels of ICP0 with and without USP7). I also expressed the myc-tagged WT and Ubl2 mutant USP7 proteins in the absence of ICP0, immunoprecipitated USP7 and examined recovery of endogenous GMPS and UHRF1 by western blotting. As shown in Figure 2-2B, both GMPS and UHRF1 were efficiently recovered with WT USP7 but recovery was significantly decreased by the Ubl2 mutation. Quantification from multiple experiments indicated that the Ubl2 mutation reduced GMPS binding to 35% (± 16%) and UHRF1 binding to 21% (± 6%) relative to recovery with WT USP7. The results confirm the importance of the Ubl2 binding pocket for USP7 interaction with ICP0, GMPS and UHRF1.

2.3.2 Identification of USP7 interactors in gastric carcinoma and nasopharyngeal carcinoma cells To characterize new functions of USP7 through the identification of novel interactors, I performed affinity purification coupled to mass spectrometry (AP-MS) on FLAG-tagged USP7 that was expressed in AGS gastric carcinoma cells. To keep USP7 levels low, potentially avoiding artifacts of overexpression, I delivered FLAG-USP7 in an adenovirus expression system at low multiplicity of infection that resulted in expression in ~70% of the cells at levels close to endogenous (Figure 2-3A). FLAG-tagged β-galactosidase (β-gal) was used as a negative control and was similarly delivered. Bait proteins were recovered on anti-FLAG resin and similar recoveries of β-gal and USP7 were confirmed by Western blot (Figure 2-3B). Co-purifying proteins were identified by LC-MS/MS of tryptic peptides. Table 2-1 shows the peptide recovery

Figure 2-2. The USP7 D762R/D764R mutation disrupts binding to ICP0, GMPS and UHRF1 in human cells. (A) 293T cells were transfected with plasmid expressing myc-tagged USP7 WT or the D762R/D764R mutant (Ubl2) and ICP0 or with WT USP7 or ICP0 expression plasmids alone. USP7 was immunoprecipitated with anti-myc antibody and recovered proteins were detected by Western blotting with antibodies against myc and ICP0. (B) 293T cells were transfected with plasmid expressing myc-tagged WT or D762R/D764R (Ubl2) USP7 or with a vector control (VC). USP7 was immunoprecipitated with anti-myc antibody and recovered proteins were detected by Western blotting with the indicated antibodies.

Figure 2-3. Expression of FLAG-USP7 delivered using an Adenovirus expression system. (A) AGS cells were transduced with increasing amount of virus expressing FLAG-tagged USP7 (FLAG-USP7 AV). Cells harvested 48 hours post-transduction were analyzed by western blotting using an anti-USP7 antibody to compare the levels of FLAG-USP7 to endogenous USP7. Bands corresponding to FLAG-USP7 (AV) and endogenous USP7 (E) are indicated by arrow heads. The viral titre used for the AP-MS experiment is indicated by a * under the gel (far right lane). (B) AGS cells transduced with adenovirus expressing FLAG-tagged USP7 at the viral titre indicated in (A) were harvested 48 hours post-transduction, fixed and stained for FLAG (right) and nuclei (DAPI; left). DAPI stained cells expressing FLAG-USP7 are indicated with white arrow heads. (C) Cells in (B) along with those transduced with adenovirus expressing FLAG-tagged β-gal were lysed using a high-salt extraction method and FLAG-proteins were recovered on Anti-FLAG resin. 10% of the input and elution for each IP were analyzed by western blotting using an antibody against FLAG. The remainder of the elution was processed by LC-MS/MS

37 Table 2-1. Affinity Purification-Mass Spectrometry Results for FLAG-USP7 in gastric carcinoma cells

Total Spectral Counts*

Identified CRAPome Protein ID FLAG-USP7 FLAG-β GAL proteins (Average) USP7 Q93009 1010 | 922 3 | 2 USP11 P51784 98 | 122 0 | 0 3.2 DDX24 Q9GZR7 73 | 57 0 | 0 3.4 PPIL4 Q8WUA2 62 | 60 0 | 0 4.7 MAGED2 Q9UNF1 52 | 24 0 | 0 2.7 GMPS P49915 50 | 48 0 | 0 3.6 PPM1G O15355 49 | 22 0 | 0 2 DHX40 Q8IX18 27 | 33 0 | 0 2 CCDC55 Q9H0G5 19 | 17 0 | 0 2.1 TCEAL4 Q96EI5 19 | 18 0 | 0 2 FBXO38 Q6PIJ6 18 | 32 0 | 0 0 TRIP12 Q14669 17 | 16 0 | 0 4.3 DNMT1 P26358 5 | 20 0 | 0 3.7

* total number of tryptic peptides identified in individual experiments. Spectral counts from two independent experiments are separated by a line

38 (total spectral counts) of USP7 specific interactors, determined by comparison of recoveries with β-gal as well as to average values in the Containment Repository for Affinity Purification database (http://www.crapome.org/), a repository of results of over 400 AP-MS experiments (Mellacheruvu et al., 2013). The top USP7 interactions identified in two independent experiments are shown in Table 2-1. Consistent with previous reports, the USP7 interactors included USP11 (Sowa et al., 2009, Maertens et al., 2010, Stockum et al., 2018), PPIL4 (Sowa et al., 2009), GMP synthetase (GMPS) (van der Knaap et al., 2005, Faesen et al., 2011, Sarkari et al., 2009b), PPM1G phosphatase (Sowa et al., 2009, Khoronenkova et al., 2012), TRIP12 E3 ubiquitin ligase (Cai et al., 2015, Liu et al., 2016) and DNMT1 (Felle et al., 2011, Qin et al., 2011, Cheng et al., 2015). In addition, I identified previously unreported interactions with two DEAD/DEAH-box RNA helicases, DDX24 and DHX40, as well as with Melanoma-associated antigen D2 (MAGED2), coiled coil domain-containing protein 55 (CCDC55) and Transcription Elongation Factor A Like 4 (TCEAL4). DDX24 has several important roles in RNA-mediated innate immune signaling, p53 regulation and human immunodeficiency virus type-1 (HIV-1) infection (Shi et al., 2016, Ma et al., 2008, Ma et al., 2013), while DHX40 is largely uncharacterized. We chose to further investigate the novel interactions of USP7 with DDX24 and DHX40, along with the poorly characterized interactions with USP11 and PPM1G. TRIP12 was also included in our study as an example of a characterized USP7 interactor that binds through the USP7 TRAF domain (Cai et al., 2015, Liu et al., 2016). I first validated the interactions of USP7 with USP11, PPM1G, DHX40, DDX24 and TRIP12 in AGS cells by transiently expressing myc-tagged USP7 (or empty myc plasmid) followed by myc immunoprecipitation and Western blotting for the endogenous proteins as shown in Figure 2-4A. This confirmed that USP11, PPM1G, DHX40, DDX24 and TRIP12 were all specifically recovered with USP7. I then repeated this experiment in a nasopharyngeal carcinoma cell line (CNE2Z) to determine if these interactions occurred in the context of other cancer cell lines. As shown in Figure 2-4B, USP11, PPM1G, DHX40, DDX24 and TRIP12 were all recovered with myc-USP7 but not with myc alone, confirming these USP7 interactions in this cell background.

2.3.3 Identifying binding sites on USP7 As previously mentioned, USP7 contains two binding pockets that recognize specific target proteins; one in the N-terminal TRAF domain involving contacts with residues D164 and

Figure 2-4. Coimmunoprecipitation of USP7 target proteins with WT and binding pocket mutations of USP7. (A) AGS cell were transfected with a plasmid expressing myc-tagged USP7 or an empty myc plasmid control (VC). Myc-USP7 was immunoprecipitated with anti-myc resin and recovered proteins were analyzed by Western blotting using antibodies against myc and the indicated endogenous proteins. (B) CNE2Z cells were transfected with empty vector control (VC) plasmid or plasmids expressing myc-tagged USP7 with WT sequence or with mutations in the TRAF (DW), or Ubl2 binding pocket or both binding pockets (DW/Ubl2). Myc-USP7 was recovered by Myc immunoprecipitation, followed by Western blotting as in (A).

40 W165, and a second in the C-terminal Ubl2 domain involving contacts with D762 and D764 (Saridakis et al., 2005b, Chavoshi et al., 2016, Jagannathan et al., 2014, Sheng et al., 2006, Hu et al., 2006, Sarkari et al., 2010a, Pfoh et al., 2015a). To determine which binding pocket was used to mediate the interactions with USP11, PPM1G, DHX40, DDX24 and TRIP12, I repeated the myc-USP7 co-IP experiments in CNE2Z cells, using USP7 mutants with D164A,W165A mutations to disrupt the TRAF binding pocket (referred to as DW) or D762R,D764R mutations to disrupt the Ubl2 pocket (referred to as Ubl2). I also combined these mutations to disrupt both binding pockets (referred to as DW/Ubl2). As shown in Figure 2-4B, the DW/Ubl2 mutations disrupted binding to all of the tested USP7 target proteins, indicating that all of the proteins bind to one of the two previously defined USP7 binding pockets. Comparison of protein recoveries with individual DW and Ubl2 USP7 mutants showed that interactions with PPM1G, USP11, DDX24 and TRIP12 were greatly affected by the DW mutation and much less affected by the Ubl2 mutation, indicating that these proteins all interact with USP7 predominantly through the TRAF binding pocket. The results with TRIP12 are consistent with previous reports that TRIP12 binds the TRAF domain of USP7 (Liu et al., 2016). In contrast, the DHX40 interaction was abrogated by the Ubl2 mutation and only partly affected by the DW mutation, indicating that this protein binds predominantly through the Ubl2 pocket.

2.3.4 Mapping the USP7 binding site on USP11 Since USP7 and USP11 are reported to have a functional connection (Sowa et al., 2009, Maertens et al., 2010), I further investigated the mechanism of this interaction. The above experiments showed that USP11 binds USP7 through the TRAF binding pocket. The Frappier lab previously identified a P/A/ExxS motif in other USP7 binding partners that mediates the interaction with the TRAF binding pocket, and showed that mutating the serine in this motif to alanine is sufficient to disrupt the interaction (Saridakis et al., 2005b, Sheng et al., 2006, Sarkari et al., 2010a). Therefore I searched USP11 for this motif. USP11 contains an insert in the middle of its catalytic domain consisting of a Ubl and additional sequences (Harper et al., 2014). Three P/A/ExxS motifs (559PLSS562, 668PGPS671 and 684AGPS687) were present in this insert (as shown in Figure 2-5A), representing potential USP7 binding sites. I changed the S to A in each of these motifs individually to generate S562A, S671A and S687A point mutants and also combined these three mutations to generate a S562A/S671A/S687A (3xS/A) triple mutant. I then expressed

Figure 2-5. Identification of the USP7 binding site in USP11. (A) Schematic representation of the USP11 protein indicating the location of the P/AxxS motifs that were mutated in this study. DUSP: domain present in ubiquitin specific proteases; UBL: ubiquitin-like domain. (B) AGS cells were transfected with empty FLAG plasmid (VC) or plasmids expressing FLAG-tagged USP11 with WT sequence or the indicated point mutations or triple mutation (S562A/S671A/S687A; 3xS/A). FLAG-tagged proteins were immunoprecipitated with anti- FLAG resin and recovered proteins were analyzed by Western blotting using antibodies against FLAG and USP7. (C) CNE2Z cells were co-transfected with plasmids expressing Myc-tagged USP7 and the set of FLAG-tagged USP11 constructs as in (A) or with empty FLAG plasmid (VC). FLAG-tagged proteins were immunoprecipitated as in (A) and recovered proteins were analyzed by Western blotting using antibodies against FLAG and myc.

42 FLAG-tagged USP11 containing either WT sequence or the mutations in AGS cells, followed by immunoprecipitation with anti-FLAG resin and Western blotting for USP7 (Figure 2-5B). I also co-expressed myc-USP7 with FLAG-tagged USP11 containing either WT sequence or the mutations followed by FLAG-IP and Western blotting for myc. In both cases, USP7 binding by USP11 was greatly decreased by the S687A mutation but not the S562A and S671A mutations. In addition, USP7 binding was abrogated by the triple (3xS/A) mutation. These results indicate that the USP11 684AGPS687 motif is the major site recognized by USP7 (although in its absence there may be some propensity to interact with 559PLSS562 and 668PGPS671).

2.3.5 Mapping the USP7 binding site on DDX24 DDX24 is known to have several important functions but its interaction with USP7 has not been previously investigated. Since I found that DDX24 bound to the USP7 TRAF binding pocket, I examined DDX24 for P/A/ExxS motifs that typically mediate this interaction. Two of the 15 putative P/A/ExxS motifs in DDX24 (339EGPS342 and 854PSTS857; Figure 2-6A) are identical to previously characterized USP7 binding sites. Namely, 339EGPS342 is identical to the EGPS motifs that mediate USP7 binding in EBV EBNA1 and KSHV vIRF122,29, and 854PSTS857 is identical to the PSTS USP7 binding sequences in MDM2 and MCM-BP (Jagannathan et al., 2014, Sheng et al., 2006, Sarkari et al., 2010a). Therefore I tested whether these two motifs mediated DDX24 binding to USP7 by generating S342A and S857A point mutations as well as a S342A/S857A double mutant (2xS/A). FLAG-DDX24 containing these mutations or WT sequence was expressed in AGS and CNE2Z cells, followed by FLAG immunoprecipitation and Western blotting for endogenous USP7 (Figure 2-6B and C). DDX24 binding to USP7 was abrogated in the S342A/S857A double mutant, greatly decreased in the S342A single mutant and unaffected in the S857A mutant. These results indicate that the 339EGPS342 sequence of DDX24 is the main site of interaction with USP7.

2.3.6 USP7 protects DDX24, DHX40 from proteasomal-mediated degradation USP7 is known to deubiquitylate and stabilize many of its binding partners. To investigate whether the USP7 interactors that I identified were stabilized by USP7, I first silenced USP7 with two different siRNAs in both AGS and CNE2Z cells and performed Western blots on endogenous DDX24, DHX40, PPM1G, USP11 and TRIP12 to determine whether their levels were decreased, as expected if they were stabilized by USP7. In addition, to determine

Figure 2-6. Identification of the USP7 binding site in DDX24. (A) Full length DDX24 protein sequence indicating the two P/ExxS (339EGPS342 and 854PSTS857) motifs that were mutated in this study (underlined) (B and C) AGS cells (B) and CNE2Z cells (C) were transfected with an empty FLAG plasmid control (VC) or plasmids expressing FLAG-tagged DDX24 with WT sequence or S342A, S857A or S342A/S857A (2xS/A) mutations. FLAG-tagged proteins were immunoprecipitated using anti-FLAG resin and recovered proteins were analyzed by Western blotting using antibodies against FLAG and USP7.

44 whether any decrease in protein levels was due to proteasomal-mediated degradation (as expected if stabilization by USP7 is due to deubiquitylation) one set of USP7-silenced samples was treated with the proteasome inhibitor, MG132. Sample experiments and quantification of the bands from multiple experiments are shown in Figure 2-7A (AGS cells) and 2-7B (CNE2Z cells). The results show that the levels of DDX24 and DHX40 were greatly decreased by USP7 silencing in both cell lines and that these levels were restored with MG132 treatment. Similarly TRIP12 was consistently decreased by USP7 silencing, although in most cases there was little to no rescue of the levels with MG132 treatment. This may indicate that the autophagy-lysosomal pathway plays a more prominent role in TRIP12 degradation than the proteasomal pathway. The levels of USP11 and PPM1G were inconsistently affected by USP7 silencing; both proteins were decreased upon USP7 silencing in AGS cells but not in CNE2Z cells. Since USP11 levels in AGS cells were restored by MG132 treatment, the difference in USP7 effects in the two cell lines might reflect different turnover rates of USP11 in the two cell backgrounds, which could be caused by different levels of USP11-targeted ubiquitin ligases. However, the decreased PPM1G levels in AGS cells after USP7 silencing were not affected by MG132, suggesting that any effects of USP7 silencing were not due to proteasomal-mediated degradation, but rather could involve autophagy-lysosomal pathway degradation or an indirect effect on PPM1G expression. In addition, I compared the levels of DDX24, DHX40, PPM1G, USP11 and TRIP12 in HCT116 cell lines with and without a USP7 knockout (Figure 2-7C). Consistent with the silencing experiments, DDX24, DHX40 and TRIP12 levels were all greatly decreased in the USP7 knockout cells, whereas the levels of USP11 and PPM1G were not obviously affected. Together these results indicate that USP7 binds and stabilizes DDX24, DHX40 and TRIP12 by protecting them from proteasomal-mediated degradation. USP11 levels were affected in AGS cells but not the other cell lines examined, suggesting that its stabilization by USP7 is cell type specific. Since, USP11 and TRIP12 can also affect protein stability through ubiquitylation, I examined whether these proteins might affect the stability of USP7. To this end, I silenced USP11 or TRIP12 in AGS and CNE2Z cells and performed Western blots for endogenous USP7 Figure 2-7D). I found no obvious effect on USP7 levels, suggesting that these proteins are not major factors in regulating the turnover of USP7. The TRIP12 result is consistent with previous reports that showed that knockdown of TRIP12 by shRNA does not affect USP7 levels in hepatocellular carcinoma cells (Cai et al., 2015).

46 Figure 2-7. Effects of USP7 depletion on target protein levels. (A and B) AGS (A) or CNE2Z (B) cells were transfected with two different siRNAs targeting USP7 (#1 or #2) or a negative control siRNA (siControl) followed by treatment with the MG132 proteasome inhibitor (+) or DMSO as a negative control (−). Cell lysates were analyzed by Western blotting using the indicated antibodies. For each condition, the protein bands for TRIP12, DDX24, USP11, DHX40 and PPM1G were quantified in three independent USP7 silencing experiments (+/-MG132) and normalized to actin. The bar graphs to the right of the Western blots show the average values relative to the silencing control for each protein. P values for siUSP7#1 or 2 are indicated relative to siControl and p values for siUSP7 #1/2+MG132 are indicated relative to siUSP7#1/2 without MG132 (* = 0.01

47 2.3.7 The deubiquitylating activity of USP7 is required to stabilize DDX24, DHX40 and TRIP12 Next I tested whether the stabilization of target proteins by USP7 required the deubiquitylation activity of USP7. This question was addressed in two ways. First, I determined whether overexpression of USP7 stabilized the proteins dependent on its catalytic cysteine (C223). Overexpression of WT USP7, but not the C223S catalytically inactive mutant of USP7, was found to increase the levels of DDX24, DHX40 and USP11 (Figure 2-8A). Consistent with the USP7 silencing experiments, PPM1G levels were not affected by USP7 overexpression. Surprisingly, TRIP12 levels, which were affected by USP7 silencing, were unchanged upon overexpression of USP7 WT. This might indicate that endogenous USP7 levels are already in excess over TRIP12 levels. In the second approach to assess the importance of the USP7 deubiquitylation activity for protein stabilization, I treated cells with a highly specific inhibitor of USP7 catalytic activity (Compound 4, also known as AD04) recently developed by Gavory et al. (Gavory et al., 2018) or an inactive enantiomer of this compound, and examined effects on the level of endogenous USP7 target proteins. The experiment was performed in three cell lines (AGS, CNE2Z and HCT116) and results are shown in Figure 2-8B. p53 was examined as a positive control for USP7 inhibition, which is known to result in increased p53 levels due to destabilization of the p53 E3 ubiquitin ligases, Hdm2 and Hdmx (Gavory et al., 2018, Li et al., 2004b, Chauhan et al., 2012, Altun et al., 2011). p53 levels were increased by compound 4 in all three cell lines, confirming its inhibition of USP7. Consistent with the USP7 silencing and knockout experiments, the USP7 inhibitor resulted in decreased levels of DDX24, DHX40 and TRIP12 in all three cell lines, whereas PPM1G and USP11 levels were only decreased by the inhibitor in AGS cells. Together, the results indicate that USP7 stabilizes DDX24, DHX40 and TRIP12 by deubiquitylation in multiple cell lines, whereas stabilization of USP11 and PPM1G by USP7 varies in different cell backgrounds.

2.4 DISCUSSION Through studies of its numerous binding partners and substrates, USP7 has emerged as a key regulator of many important cellular process and oncogenic pathways. Here I describe a collaborative study that led to the discovery a novel binding site in the C-terminal ubiquitin-like

Figure 2-8. The role of USP7 catalytic activity in stabilizing target proteins. (A) CNE2Z cells were transfected with plasmids expressing myc-USP7 with WT sequence or C223S mutation or with an empty vector control (VC). 48hrs later, cell lysates were analyzed by Western blotting using the indicated antibodies. (B) AGS, HCT116 or CNE2Z cells were treated with 5 µM of compound 4 (USP7 inhibitor) or an inactive enantiomer and harvested 8 hours (CNE2Z) or 24 hours (AGS and HCT116) post-treatment. The shorter time was necessary in CNE2Z cells due to toxicity. Whole cell lysates were analyzed by Western blotting using the indicated antibodies.

49 domains of USP7 that is distant to the previously characterized N-terminal TRAF binding pocket. Using biochemical and structural approaches, it was shown that a negatively charged region on Ubl2 preferentially interacts with specific KxxxK motifs within a polybasic region on the USP7 CTD interactors ICP0, GMPS and UHRF1. Structural analysis indicates that the two lysines in the ICP0 motif (K620 and K624) form direct contacts with D762 and D764 located on the acidic patch on Ubl2. Mutagenesis of the lysine residues in the ICP0, GMPS and UHRF1 KxxxK motifs resulted in decreased binding to USP7, revealing that these residues are essential for the interaction. This also indicates that the mode binding of GMPS and UHRF1 to Ubl2 is mediated via similar contacts as was seen with ICP0. Mutagenesis of both D762 and D764 on USP7 resulted in decreased binding to ICP0, GMPS and UHRF1 in vitro as well as in vivo, indicating that these aspartate residues engage in important contacts with USP7 binding partners that interact via the Ubl2. Therefore, a USP7 expression construct harboring mutations in D762 and D764 can be used in identifying other USP7 interactors that bind through this pocket. Furthermore, the novel KxxxK Ubl2 binding motif should be useful for the identification of binding sites in other USP7-CTD interacting proteins. The fact that the Ubl2 D762R/D764R mutation did not completely abrogate the interaction with ICP0, UHRF1 and GMPS suggests that additional contacts with USP7 also occur. However, it is currently unknown whether the additional contacts are the same or different among these Ubl2 interactors. In this study I also used a proteomics approach to further identify specific USP7 targets in the context of gastric carcinoma cells. This confirmed some previously reported functional USP7 interactions, including one with TRIP12 E3 ubiquitin ligase, that we further showed binds USP7 through the TRAF binding pocket and is stabilized by USP7. In addition, I identified novel interactions with two DEAD/DEAH box RNA helicases, DDX24 and DHX40, both of which are stabilized by USP7 dependent on its deubiquitylating activity. I further show that USP7 binds these proteins through two different binding pockets; the DDX24 interaction is mediated by the TRAF domain binding pocket, while the DHX40 interaction occurs predominantly through the Ubl2 binding pocket. Experiments involving USP7 depletion, overexpression and inhibition of its catalytic activity in multiple cell lines, all indicated that USP7 stabilizes DDX24 and DHX40 through its catalytic activity, preventing their proteasomal degradation. This suggests that USP7 can regulate the functions associated with these proteins by affecting their abundance. DExH/D-box RNA helicases are ATP-dependent RNA helicases that play important roles in many RNA processes,

50 including ribosome biogenesis, pre-mRNA splicing, RNA export and RNA turnover (Tanner and Linder, 2001, Rocak and Linder, 2004). The functional roles of DHX40 in RNA processes have yet to be identified, although it has been reported to be similar to human DDX8, as well as Prp22 and Dhr1 from Saccharomyces cerevisiae (Xu et al., 2002). DHX40 is also ubiquitously expressed in a wide variety of tissues, suggesting it has a general function in RNA metabolism (Xu et al., 2002). While most of the protein targets that are stabilized by USP7 are bound through the USP7 TRAF domain, I found that DHX40 is preferentially bound through the USP7 Ubl2 binding pocket. DHX40 thus joins a short list of USP7 interactors that bind through this site, including GMPS, UHRF1, DNMT1, RNF169 and the HSV-1 protein ICP0 (Pfoh et al., 2015a, Pozhidaeva et al., 2015, An et al., 2017). We have shown that this USP7 pocket recognizes KxxxK motifs (Pfoh et al., 2015a), and the DHX40 protein sequence contains four such motifs that might be responsible for this interaction. In contrast to DHX40, several functions have been identified for DDX24. These include a role in regulating pre-rRNA processing (Yamauchi et al., 2014) as well as a role in the interferon pathway as a negative regulator of RIG-I-like receptors (Ma et al., 2013). The ability of USP7 to stabilize DDX24 suggests that USP7 may also impact these processes. In addition, DDX24 was recently reported to inhibit the transcriptional activity of the p53 tumor suppressor by antagonizing its acetylation (Shi et al., 2016). As a result, DDX24 negatively regulates p53- dependant cell cycle arrest and senescence and promotes tumor cell growth. This is consistent with reports that DDX24 depletion inhibits the growth of multiple cancer cell lines and that its overexpression correlates with a lower survival rate in gastric and HER2-positive breast cancer patients (Oliver et al., 2017). USP7 is also known to regulate p53 activity; by deubiquitylating and stabilizing p53 in response to DNA damage or by destabilizing p53 through stabilization of Hdm2 and Hdmx under normal growth conditions (Li et al., 2004b, Cummins et al., 2004). Our findings that USP7 stabilizes DDX24 suggests an additional mechanism by which USP7 interferes with p53 activity and contributes to oncogenesis. Finally, DDX24 has been found to contribute to HIV-1 infectivity by interacting with the HIV-1 Rev protein and affecting mRNA nuclear export(Ma et al., 2008). USP7 has also been shown to promote HIV-1 infection by deubiquitylating and stabilizing the HIV-1 Tat protein (Ali et al., 2017). Our studies suggest that USP7 may play an additional role in HIV-1 infection through its stabilization of DDX24. I investigated the mechanism of the USP7-DDX24 interaction and showed that USP7 binds DDX24 predominantly through its TRAF binding pocket. The Frappier lab has previously

51 shown that the USP7 TRAF domain recognizes P/A/ExxS motifs in target proteins, with the EGPS motif that occurs in EBV EBNA1 and KSHV vIRF4 proteins being the strongest interactions so far identified (Saridakis et al., 2005b, Chavoshi et al., 2016). Here I show that amino acids 339-342 of DDX24 also contains an EGPS motif and that mutation of S342 disrupts USP7 binding. DDX24 is the first cellular protein found to bind USP7 using an EGPS motif, and the interaction through this motif suggests a high affinity direct interaction that would effectively compete with many other cellular protein interactions for this USP7 site. Our proteomics experiments also identified physical interactions of USP7 with USP11 and PPM1G; associations which were known but not well characterized. Like the DDX24 interaction, I showed that interactions with USP11 and PPM1G occurred predominantly through the USP7 TRAF domain. PPM1G was previously reported to bind and dephosphorylate USP7 in response to DNA damage, leading to decreased USP7 levels (Khoronenkova et al., 2012). However, the fact that I identified the USP7-PPM1G interaction under normal cell growth conditions, suggests that this interaction may have additional functions that are independent of the DNA damage pathway. This could involve PPM1G-mediated dephosphorylation of USP7 but might also involve USP7-mediated relocalization of PPM1G to other substrates to impact its many functions, including regulation of cell cycle progression (Sun et al., 2016), transcription (Gudipaty and D'Orso, 2016, Gudipaty et al., 2015) and translation (Liu et al., 2013, Xu et al., 2016). For USP11, we identified 684AGPS687 as the major site that mediates the interaction with USP7. The USP7 substrate TPP1 has also been reported to bind USP7 using an AGPS motif (Zemp and Lingner, 2014). Since the AGPS sequence matches P/A/ExxS motifs known to bind USP7 directly, our results suggest that USP7 binds directly to USP11. USP11 684AGPS687 is located within the C-terminal region (503-920) that mediates interactions with its targets p21, VGLL4 and XIAP (Deng et al., 2018, Zhang et al., 2016a, Zhou et al., 2017), raising the possibility that these interactions might physically impede each other. Although I saw some evidence of USP7-mediated stabilization of USP11 in AGS cells, the results in CNE2Z and HCT116 cells suggest that USP7 does not consistently stabilize this protein. Similarly, I did not find evidence that USP11 stabilized USP7. This does not exclude the possibility that USP7 and USP11 could remove non-degradative ubiquitin signals from one another that might affect protein interactions and functions. In support of this possibility, USP11 has been shown to have a preference for the non-degradative K63 ubiquitin chain

52 linkages over degradative K48 chains (Harper et al., 2014). Interestingly, USP11 and USP7 have been reported to have some protein targets in common, including the xeroderma pigmentosum complementation group C (XPC) protein and multiple components of the polycomb repressive-1 (PRC1) complex (He et al., 2014, Shah et al., 2017, Maertens et al., 2010). Furthermore, the promyelocytic leukemia protein (PML) is regulated by both USP7 and USP11, although they have opposite effects (Wu et al., 2014, Sarkari et al., 2011). Our finding that USP7 and USP11 physically interact raise the possibility that they function as a complex to regulate the levels and activities of their shared binding partners. The USP7- binding point mutant of USP11 that I have generated (S687A) will be a useful tool to investigate the importance of USP7 binding for the various functions of USP11. In summary, I have identified DHX40 and DDX24 as novel targets of USP7 that are both bound and stabilized by USP7, implicating USP7 as a regulator of RNA metabolism through effects on these proteins and providing an additional potential mechanism of p53 regulation by USP7. I also reveal the mechanisms of USP7 interactions with USP11, PPM1G, DHX40 and DDX24, including the development of USP7-binding point mutants of USP11 and DDX24 that will be useful for function studies.

CHAPTER 3

USP7 regulates cytokinesis through FBXO38 and KIF20B

A version of this chapter has been submitted for publication as:

Georges AA., Coyaud E., Marcon E., Greenblatt G., Raught B. and Frappier L. USP7 Regulates Cytokinesis Through FBXO38 and KIF20B. Scientific Reports

The BioID experiment in Figure 3-2A was performed by Etienne Coyaud. The mass spectrometry on FLAG-USP7 was performed by Edyta Marcon. I performed all other experiments in this chapter.

54 3.1 INTRODUCTION The ubiquitin specific protease 7 (USP7) also known as HAUSP (Herpesvirus Associated Ubiquitin Specific Protease) is a deubiquitylating enzyme (DUB) that removes ubiquitin from specific target proteins, often resulting in their stabilization due to protection from proteasomal- mediated degradation. Due to its wide variety of substrates, USP7 has been found to be an important regulator of many cellular processes, including apoptosis, the cell cycle, gene expression, DNA damage responses and DNA replication (Pfoh et al., 2015b, Frappier and Verrijzer, 2011, Nicholson and Suresh Kumar, 2011, Kim and Sixma, 2017). USP7 misregulation is also associated with several cancers (Song et al., 2008, Yang et al., 2012, Zhang et al., 2016b, Qin et al., 2016, Zhao et al., 2015). For example, USP7 overexpression has been shown to correlate with poor prognosis in lung and ovarian cancer and with tumor aggressiveness in prostate cancer (Masuya et al., 2006, Zhao et al., 2015, Zhang et al., 2016b). However, both overexpression and downregulation of USP7 have been observed in breast and colon cancer (Yang et al., 2012, Hussain et al., 2009, Wang et al., 2016b, Hernandez-Perez et al., 2017). The association of USP7 with cancer has sparked a major interest in the development of USP7 inhibitors as anti-cancer therapies (Reverdy et al., 2012, Gavory et al., 2018, Jing et al., 2017, Di Lello et al., 2017, Lamberto et al., 2017, Kategaya et al., 2017, Turnbull et al., 2017). USP7 was first identified as a binding partner of the herpes simplex virus 1 (HSV-1) ICP0 protein, and later shown to be the target of multiple proteins from several different viruses, particularly herpesviruses (Ching et al., 2013b, Holowaty et al., 2003b, Jager et al., 2012b, Lee et al., 2011a, Salsman et al., 2012b, Saridakis et al., 2005b, Sarkari et al., 2009b, Everett et al., 1997, Everett et al., 1999, Everett et al., 1998, Gillen et al., 2015, Xiang et al., 2018, Chavoshi et al., 2016). The first cellular functions identified for USP7 were in the regulation of the p53 pathway. Studies showed that, upon DNA damage induction, USP7 directly deubiquitylates and stabilizes the p53 tumor suppressor protein (Li et al., 2002, Brooks et al., 2007). Alternatively, under normal cellular conditions USP7 can act as a negative regulator of p53 by deubiquitylating and stabilizing the dominant p53 E3 ubiquitin ligases Hdm2 and HdmX (Li et al., 2004b, Cummins et al., 2004). Since then, USP7 has been shown to deubiquitylate and stabilize numerous other proteins with a variety of functions (Dar et al., 2013, Bhattacharya and Ghosh, 2014, van Loosdregt et al., 2013, Giovinazzi et al., 2014, Faustrup et al., 2009, Alonso-de Vega et al., 2014, Maertens et al., 2010). In addition to cleaving polyubiquitin chains that target proteins for degradation, USP7 can cleave monoubiquitin to alter protein localization or function. For example, USP7 cleaves monoubiquitin from histone H2B to impact gene expression and

55 similarly removes monoubiquitin from FOXO4 to regulate its transcriptional activity (Song et al., 2008, van der Horst et al., 2006, Sarkari et al., 2009b, van der Knaap et al., 2005). Finally, USP7 has also been found to negatively regulate promyelocytic leukemia (PML) proteins and nuclear bodies through a mechanism independent of its deubiquitylating activity (Sarkari et al., 2011). A number of reports have demonstrated the importance of USP7 in regulating progression through the cell cycle. First, studies have shown that depletion of USP7 in cancer cells is positively correlated with a G1 arrest, which can be triggered in some cases by p53 accumulation (Reverdy et al., 2012, Yi et al., 2016, Giovinazzi et al., 2013). In other cases, USP7 depletion may result in G1 arrest due to destabilization of USP7 targets UHRF1 and Chk1, which are required for G1/S transition (Jenkins et al., 2005, Mousli et al., 2003, Felle et al., 2011, Qin et al., 2011, Sanchez et al., 1997, Alonso-de Vega et al., 2014). The Frappier lab has have previously shown that USP7 also promotes late S phase and G2 progression by facilitating unloading of the Minichromosome Maintenance protein (MCM) complex from chromatin during DNA-replication termination (Jagannathan et al., 2014). Further supporting its role in DNA replication, USP7 was shown to be a SUMO deubiquitylase that functions to maintain high concentrations of SUMOylated factors at replication forks, which is necessary for replication- fork progression (Lecona et al., 2016). In addition, USP7 was recently found to stabilize Geminin; a protein that inhibits replication origin licensing by Cdt1 (Hernandez-Perez et al., 2017). USP7 also regulates early mitotic progression by stabilizing the mitotic checkpoint protein CHFR, which is responsible for delaying entry into metaphase in response to mitotic stress (Scolnick and Halazonetis, 2000, Oh et al., 2007, Giovinazzi et al., 2013). The numerous roles of USP7 stem from its ability to specifically bind multiple target proteins. USP7 uses two different binding pockets to recognize its target proteins, both of which are distinct from its central catalytic domain (Kim and Sixma, 2017). The first identified binding pocket is within the N-terminal TRAF domain (NTD). Many USP7 targets bind this pocket including p53, Hdm2, HdmX, MCM-BP, Epstein-Barr virus EBNA1 and Kaposi’s sarcoma associated herpesvirus (KSHV) vIRF1 and vIRF4 (Saridakis et al., 2005b, Sheng et al., 2006, Hu et al., 2006, Sarkari et al., 2010a, Jagannathan et al., 2014, Chavoshi et al., 2016, Lee et al., 2011a). Structures and mutational analyses of these interactions identified a P/A/ExxS motif in all of these targets that is responsible for the USP7 interaction, and showed that USP7 amino acids D164 and W165 are essential for mediating these interactions (Saridakis et al., 2005b,

56 Chavoshi et al., 2016, Jagannathan et al., 2014, Sheng et al., 2006, Hu et al., 2006, Sarkari et al., 2010a). More recently, a second binding pocket was identified in USP7, found within one of the ubiquitin-like structures (Ubl2) in the C-terminal domain (CTD). This pocket is bound by GMP synthetase (GMPS), DNMT1, UHRF1 and the HSV-1 protein ICP0 through KxxxK motifs that contact USP7 residues D762 and D764 (Pfoh et al., 2015a, Holowaty et al., 2003a, Faesen et al., 2011, Ma et al., 2012, Pozhidaeva et al., 2015). The above discoveries of USP7 functions have come from studies on the specific target proteins. To gain a more comprehensive understanding of USP7 interactions and potentially identify novel targets, I used an affinity purification-mass spectrometry (AP-MS) approach to profile interactions with USP7. This identified a novel interaction with a poorly characterized F- box protein, FBXO38, whose stability is dependent on USP7. A BioID proteomics method was then used to identify interactors and potential functions of FBXO38, revealing an interaction with KIF20B, a key regulator of cytokinesis. I show that FBXO38 has an important role in stabilizing KIF20B, thereby contributing to cytokinesis, and that USP7 indirectly regulates KIF20B and cytokinesis through FBXO38. Therefore, I have identified previously unknown roles for USP7 and FBXO38 in the regulation of cytokinesis.

3.2 MATERIALS AND METHODS 3.2.1 Cell Lines AGS human gastric adenocarcinoma cells were maintained in in RPMI 1640 supplemented with 10% fetal bovine serum (FBS, Wisent Inc). HEK 293Tand HEK293A human embryonic kidney cells were maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FBS. The HCT116 human colon carcinoma cells (received from Daniel Durocher) and USP7- null HCT116 cells (obtained from Bert Vogelstein) were maintained in minimal essential medium (MEM alpha) supplemented with 10% FBS. All media was purchased from Life Technologies Inc.

3.2.2 Plasmids and siRNA Plasmids expressing myc-USP7 (pCDNA3), the myc-USP7 catalytic mutant (C223S) and myc- USP7 D762R/D764R (UBL2) were described previously (Sarkari et al., 2011, Pfoh et al., 2015a). Myc-USP7 (DW) and myc-USP7 D164A/W165A/D762R/W764A (DW/Ubl2) were gifts from Yi Sheng and Vivian Saridakis, respectively (Sarkari et al., 2013). pME-HA-KIF20B and

57 PCDNA6:FLAG-FBXO38 were gifts from Masatoshi Hagiwara and Charlotte Sumner, respectively and were described previously (Kamimoto et al., 2001, Sumner et al., 2013). The FLAG-FBXO38 mutant lacking the first 77 amino acids that contains the F-Box domain (FLAG- FBXO38∆FBX) was generated by PCR amplification of the FBXO38 sequence in PCDNA6:FLAG-FBXO38 using forward primer: 5’−CATGGCGATCGCACCATG GCAGGGCGCTGGTGGGAATATATG−3’ and reverse primer: 5’−CATGACGCGTAATGTAGTCGTCTTCAACTGGCTC−3’. The resulting PCR product was inserted between the Sgf1 and Mlu1 sites of the original FLAG-FBXO38 pcDNA6 vector. The FBXO38 WT and ∆FBX plasmids were verified by DNA sequencing. Stealth siRNA targeting FBXO38 ( #1 5’−GGUGGUGGCCGAGAGUGGAAAUAAU−3’ and #2 5’−CCACAGCCAUUUAAAGACUUCCUUU−3’) and USP7 (#1 5’−CCCAAATTATTCCGCGGCAAA−3’ and #2 5’−GGAAGAUUUCUACUCUCCCUGGAAA−3’) were from Invitrogen. A previously characterized siRNA targeting KIF20B (GTGAAGAAGTGCGACCGAA (Kanehira et al., 2007)) was synthesized by SIGMA. AllStar negative-control siRNA was obtained from Qiagen.

3.2.3 Transfections and USP7 inhibitor treatment Approximately 6×105 AGS or HCT116 cells in 10-cm dishes or on coverslips (for microscopy) were transfected with 100 pmol of small interfering RNA (siRNA) against USP7, FBXO38 or KIF20B using 4 μl of Lipofectamine 2000. For USP7 and FBXO38 silencing, siRNA transfections were repeated two additional times after 24 and 48 h. Cells were harvested 48 h after the last round of transfection and processed for Western blotting, microscopy or mRNA quantification as described below. For proteasome inhibition, 10 µM final concentration of MG132 (Sigma) was added to the cells 12 hours before harvesting. For overexpression experiments, 293T or AGS cells at ~80% confluency in 10-cm dishes were transfected with 7 µg of the indicated plasmids using transfection grade Polyethylenimine (PEI, Polyscience 23966). In brief, 7 µg DNA was diluted in 1 ml optimum media, followed by addition of 21 µl PEI reagent. The DNA-PEI complexes were mixed briefly by vortexing and incubated at room temperature for 15 minutes prior adding to the cells. Cells were harvested 48 hours post-transfection. For the rescue experiments after USP7 silencing, 7 hours after the last round of USP7 siRNA transfection, AGS cells were transiently transfected with plasmids expressing myc-USP7, HA-

58 KIF20B and FLAG-FBXO38 or FLAG-FBXO38∆FBX as described above, then harvested 48 hours post-transfection and processed for microscopy or Western blotting. For the USP7 inhibitor experiments, cells at ~40% confluency were treated with a final concentration of 5 µM of USP7 inhibitor (Compound 4; also known as AD04) or the inactive enantiomer (gifts from Timothy Harrison (Gavory et al., 2018)). Cells were harvested 8 hours (CNE2Z cells) or 24 hours (AGS and HCT116 cells) post-inhibitor treatment.

3.2.4 Generation of Recombinant Adenovirus To generate adenovirus expressing USP7 or LacZ (negative control) with C-terminal sequential peptide affinity (SPA)-tag (Zeghouf et al., 2004), the coding sequence for the SPA tag was first inserted between the EcoRI and NotI sites of the multicloning site of pENTR4 (Life Technologies). The USP7 or LacZ coding sequences were then individually inserted between the BamHI and KpnI sites of the multicloning sites to generate constructs expressing C-terminally tagged USP7 or β-Gal. USP7-SPA and LacZ-SPA were transferred to the pAd⁄CMV⁄V5-DEST adenovirus expression vector using the ViraPower™ Adenoviral Gateway™ expression kit (Invitrogen). Adenovirus was generated and amplified in HEK293A cells as per the manufacturer’s instructions. The virus was titred onto AGS cells, followed by immunofluorescence microscopy and Western blotting using antibody against the FLAG epitope in the SPA tag (F1804 from Sigma; 1:800 dilution) to verify expression of the full length proteins and determine the minimum amount of virus that could be used to infect most of the cells.

3.2.5 Affinity Purification coupled to Mass Spectrometry (AP-MS) AGS cells in 25 15-cm diameter plates at 70% confluence were transduced with the adenoviruses expressing USP7 or LacZ (minimum amount required to infect 70% of the cells) and harvested 48 hours post-transduction. Cells were lysed and extracted by the “high salt extraction” method that was previously described (Georges and Frappier, 2015a). In brief, cells were resuspended in

1.33 pellet volumes of TpA (10 mM HEPES pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT and P8340 protease inhibitor) followed by 10 strokes in a dounce homogenizer. 1 pellet volume of TpB (50 mM HEPES pH 7.9, 1.5 mM MgCl2, 0.5 mM DTT, 1.26 M potassium acetate and 75% glycerol) was added to the lysate followed by 10 additional strokes in the homogenizer. After incubation on ice for 30 minutes, the extract was clarified by centrifugation and

59 subsequently dialyzed against 10 mM HEPES pH 7.9, 0.1 M potassium acetate, 0.1 mM EDTA, 0.1 mM DTT, 10% glycerol. After dialysis, the extract was incubated with 50 μl of anti-FLAG M2 resin (Sigma-Aldrich) 4 hours at 4ºC with end-over-end rotation. The resin was washed first in IPP buffer (10 mM HEPES pH 7.9, 100 mM NaCl, 0.1% Triton, 10% glycerol) followed by a second wash in 50 mM ammonium bicarbonate, 75 mM KCl. Immunoprecipitated proteins were eluted three times in 150 μl 0.5 M ammonium hydroxide, pH 11. Eluates were dried by lyophilisation using a SpeedVac, washed once in high-performance liquid chromatography (HPLC)-grade water and further dried by lyophilisation. The lyophilized protein was resuspended in 50 mM ammonium bicarbonate containing 10 µg/µl proteomic grade trypsin (Sigma) and incubated overnight at 37°C followed by further incubation for 2 hours in freshly added trypsin. Samples were lyophilised again and the peptides were analyzed by liquid chromatography-tandem mass spectrometry (LC-MS/MS) using a LTQ Orbitrap system (Thermo Finnigan) and identified using Mascot software (Matrix Science, United Kingdom).

3.2.6 Identification of FBXO38 Interactions by BioID BioID (Roux et al., 2012) was carried out essentially as described previously (Comartin et al., 2013). In brief, full length FBXO38 (BC050424) coding sequence was amplified by PCR, and cloned into our pcDNA5 FRT/TO FLAGBirA* expression vector. Using the Flp-In system (Invitrogen), HEK293TREx Flp-In cells stably expressing FLAGBirA* alone or FLAGBirA*– FBXO38 were generated. After selection (DMEM + 10% FBS + 200 μg/ml hygromycin B), five 150 cm2 plates of sub-confluent (60%) cells were incubated for 24 hrs in complete media supplemented with 1 µg/ml tetracycline (Sigma), 50 µM biotin (BioShop). Cells were collected and pelleted (2,000 rpm, 3 min), the pellet was washed twice with PBS, and dried pellets were snap frozen. The cell pellet was resuspended in 10 ml of lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 0.1% SDS, 1:500 protease inhibitor cocktail (Sigma-Aldrich), 1:1000 benzonase nuclease (Novagen) and incubated on an end-over-end rotator at 4°C for 1 hour, briefly sonicated to disrupt any visible aggregates, then centrifuged at 16,000g for 30 min at 4°C. Supernatant was transferred to a fresh 15 mL conical tube. 30 μl of packed, pre-equilibrated Streptavidin Sepharose beads (GE) were added and the mixture incubated for 3 hours at 4°C with end-over-end rotation. Beads were pelleted by centrifugation at 2000 rpm for 2 min and transferred with 1mL of lysis buffer to a fresh Eppendorf tube. Beads were washed once with 1 mL lysis buffer and twice with 1 ml of 50 mM

60 ammonium bicarbonate (pH 8.3). Beads were transferred in ammonium bicarbonate to a fresh centrifuge tube, and washed two more times with 1 ml ammonium bicarbonate buffer. Tryptic digestion was performed by incubating the beads with 1 µg MS-grade TPCK trypsin (Promega, Madison, WI) dissolved in 200 μl of 50 mM ammonium bicarbonate (pH 8.3) overnight at 37°C. The following morning, 0.5 μg MS-grade TPCK trypsin was added, and beads were incubated 2 additional hours at 37°C. Beads were pelleted by centrifugation at 2000xg for 2 min, and the supernatant was transferred to a fresh Eppendorf tube. Beads were washed twice with 150 µl of 50 mM ammonium bicarbonate, and these washes were pooled with the first eluate. The sample was lyophilized, and resuspended in buffer A (0.1% formic acid). 1/5th of the sample was analyzed per MS run. High performance liquid chromatography was conducted using a 2 cm pre-column (Acclaim PepMap 50 mm x 100 um inner diameter (ID)), and 50 cm analytical column (Acclaim PepMap, 500 mm x 75 um diameter; C18; 2 um; 100 Å, Thermo Fisher Scientific, Waltham, MA), running a 120 min reversed-phase buffer gradient at 225nl/min on a Proxeon EASY-nLC 1000 pump in-line with a Thermo Q-Exactive HF quadrupole-Orbitrap mass spectrometer. A parent ion scan was performed using a resolving power of 60,000, then up to the twenty most intense peaks were selected for MS/MS (minimum ion count of 1,000 for activation) using higher energy collision induced dissociation (HCD) fragmentation. Dynamic exclusion was activated such that MS/MS of the same m/z (within a range of 10 ppm; exclusion list size = 500) detected twice within 5 sec were excluded from analysis for 15 sec. For protein identification, Thermo .RAW files were converted to the .mzXML format using Proteowizard (Kessner et al., 2008), then searched using X!Tandem (Craig and Beavis, 2004) and Comet (Eng et al., 2013) against the human Human RefSeq Version 45 database (containing 36,113 entries). Search parameters specified a parent ion mass tolerance of 10 ppm, and an MS/MS fragment ion tolerance of 0.4 Da, with up to 2 missed cleavages allowed for trypsin. Variable modifications of +16@M and W, +32@M and W, +42@N-terminus, and +1@N and Q were allowed. Proteins identified with an iProphet cut-off of 0.9 (corresponding to ≤1% FDR) and at least two unique peptides were analyzed with SAINT Express v.3.6. Sixteen control runs (from cells expressing the FlagBirA* epitope tag) were collapsed to the two highest spectral counts for each prey, and compared to the two technical of each of the two biological replicates of FBXO38 BioID. High confidence interactors were defined as those with BFDR≤0.01.

61 3.2.7 Immunofluorescence microscopy For identification of multinucleated cells, cells transfected with siRNA targeting KIF20B, USP7 or FBXO38 or the silencing control were grown on coverslips and fixed with 3.7% formaldehyde in phosphate-buffered saline (PBS) for 20 min, rinsed once in PBS and permeabilized with 1% Triton X-100 in PBS for 5 min. Samples were blocked with 4% bovine serum albumin (BSA) in PBS followed by incubation with Phalloidin Alexa Fluor 647 (Invitrogen A22287; 1:1000 dilution) in 4% BSA. Coverslips were mounted on slides using ProLong Gold antifade medium with DAPI (4′,6-diamidino-2-phenylindole) (Invitrogen). Images were obtained using the 40x oil objective on a Leica inverted fluorescence microscope and processed using the Leica Application Suite X (LAS X, version 3.3.0) software program. ~1500 cells per sample were examined for the number of multinucleated cells (cells containing two or more nuclei) in three independent experiments. Averages and standard deviations were calculated in Excel. P values were determined using two-tailed t-tests in Excel. For the multinuclei rescue experiment, cells transfected with siRNA targeting USP7 or the silencing control were fixed, permeabilized and blocked as described above, followed by incubation with primary antibodies against HA (Santa Cruz 805; 1:500 dilution), FLAG (F1804 from Sigma; 1:800 dilution) and myc (Santa Cruz 789; 1:500 dilution) in 4% BSA. After washing in PBS, cells were incubated with Phalloidin Alexa Fluor 647 (Invitrogen A22287; 1:1000 dilution) and secondary antibodies goat anti-rabbit or goat anti-mouse Alexa Fluor 488 (Invitrogen; 1:800 dilution) in 4% BSA. Coverslips were mounted and images were obtained and processed as described above. For quantification of KIF20B florescence intensity at the midbodies, cells silenced for FBXO38 or USP7 or transfected with the silencing control were fixed in 100% methanol for 15 minutes at -20ºC. After blocking, cells were incubated with antibodies against KIF20B (Santa Cruz 515194; 1:50) and acetylated tubulin (Santa Cruz 82557; 1:800). After washing in PBS, cells were incubated with secondary antibodies goat-anti mouse IgG1 Alexa Fluor 488 and goat-anti mouse IgG2b Alexa Fluor 594 (Invitrogen; 1:800 dilution) in 4% BSA. Coverslips were mounted and images were obtained and processed as described above using a 60x oil objective. Exposure times used were the same for all samples and images were taken on the same day. The fluorescence intensity of KIF20B was quantified using Fiji/ImageJ (http://imagej.net/Fiji/Downloads) for 30 midbodies per sample for each of three independent experiments, and values were normalized to the acetylated tubulin staining at the midbodies.

62 3.2.8 Western blotting Cells were lysed in 9 M urea, 10 mM Tris-HCl pH 6.8, sonicated and clarified by centrifugation. 80 µg of protein was subjected to SDS-PAGE and transferred to nitrocellulose. Membranes were blocked in 5% non-fat dry milk in TBS-T (TBS with 0.1% Tween), then incubated with primary antibodies: mouse FLAG M2 (F1804 from Sigma; 1:5000 dilution), rabbit anti-FLAG (PA1- 984B from Invitrogen; 1:5000 dilution), rabbit anti-HA (Santa Cruz 805; 1:200 dilution), rabbit anti-myc (Santa Cruz 789; 1:5000 dilution), rabbit anti-USP7 (Bethyl laboratories A300-033A; 1:10000 dilution), mouse anti-KIF20B (Santa Cruz 515194; 1:200 dilution), rabbit anti-FBXO38 (Bethyl laboratories A302-378A; 1:5000 dilution), rabbit anti-SKP1 (Santa Cruz 7163; 1:200 dilution), goat anti-actin (Santa Cruz 1615; 1:1000 dilution). Membranes were washed three times in TBS-T, followed by incubation with goat anti-mouse HRP (Santa Cruz 2005), goat anti- rabbit HRP (Sigma SAB3700878) or donkey anti-goat HRP (Sigma SAB3700285) at 1:5000 dilution. Membranes were developed using chemiluminescence reagents (ECL or ECL-prime; Santa Cruz or Amersham). Protein bands were quantified using ImageQuantTL (GE Healthcare Sciences) and normalized to actin bands.

3.2.9 RNA extraction and KIF20B mRNA quantification Total RNA was isolated from cells transfected with the silencing control or FBXO38 siRNA (as described above) using TRIzol (Invitrogen). The quantity and quality of the extracted RNA were determined by reading the optical densities at 260 and 280 nm using a NanoDrop spectrophotometer (Thermo Scientific). To quantify the KIF20B or actin (control) mRNA, 1 μg of total RNA was reverse transcribed in a 20 μl reaction mixture using SuperScript III reverse transcriptase (Life Technologies) and random hexamer primers according to the manufacturer's instructions. Quantitative real-time PCR was performed using 0.2 μl of the cDNA and SsoFast EvaGreen Supermix (Bio-Rad) on the CFX384 Touch Real Time PCR Detection System (Bio- Rad). Primers used were: KIF20B forward 5’– AGA AAC CAA CAG GCA AGA AAC- 3’, KIF20B reverse 5’– CTC ATC ACG CAT TAC AGA TAC C-3’, actin forward 5’– GGACTTCGAGCAAGAGATGG–3’ and actin reverse 5’–AGCACTGTGTTGGCGTACAG– 3’. Experiments were performed in triplicate and KIF20B mRNA signals in each sample was normalized to the actin mRNA signal.

63 3.2.10 Immunoprecipitation Cells co-transfected with the FLAG-FBXO38 and the myc-USP7 expression constructs or the myc-USP7 construct alone were lysed on ice for 30 min in 4X volume of radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl pH 8, 150 mM NaCl, 0.1% sodium deoxycholate, 0.5% NP-40) with complete protease inhibitors (Sigma P8340), followed by sonication and clarification by centrifugation. For the co-expression experiments, 2 mg of each clarified lysate was incubated with 10 μl of M2 anti-FLAG resin (Sigma) overnight at 4°C with end-over-end rotation. Cells with myc-USP7 constructs alone were lysed in RIPA buffer and incubated with 10 μl of anti-Myc resin (c-myc AC – sc-40 AC Santa Cruz) overnight at 4°C with end-over-end rotation. For immunoprecipitation of FLAG-FBXO38 with HA-KIF20B or endogenous KIF20B, cells were lysed in 4X volume of lysis buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 10 % glycerol and 0.1% NP-40). FLAG-tagged FBXO38 was immunoprecipitated using anti-FLAG M2 resin as described above. All resins were harvested by centrifugation, washed 4 times in lysis buffer, then boiled in 2x SDS loading buffer. Recovered proteins were separated by SDS-PAGE and analyzed by Western blotting, as described above.

3.3 RESULTS 3.3.1 USP7 interacts with and stabilizes FBXO38 To gain a better understanding of USP7 interactions in cancer, I expressed FLAG-tagged USP7 in AGS gastric carcinoma cells and performed AP-MS experiments, in which USP7 and associated proteins were recovered on anti-FLAG resin and recovered proteins were identified by tandem mass spectrometry (LC-MS/MS). USP7-FLAG was delivered to the cells by adenovirus infection at titres resulting in expression levels close to endogenous USP7. To eliminate nonspecific interactions, total spectral counts of each protein recovered with USP7 were compared to that with the β-GAL-FLAG negative control, as well as to the Containment Repository for Affinity Purification (http://CRAPome.org), a database of interactors from over 400 AP-MS experiments. The top USP7 interactions identified in two independent experiments are shown in Table 3-1. Previously characterized USP7 interactors, including GMPS, the ATM- dependant phosphatase PPM1G, DNA methyltransferase DNMT1 and the E3 ligase TRIP12 were among the most abundantly recovered proteins, providing validation of our method

64 Table 3-1. Affinity Purification-Mass Spectrometry Results for FLAG-USP7

Total Spectral Counts Identified CRAPome FLAG-USP7 FLAG-β GAL proteins (Average)

USP7 2307 0

GMPS 303 0 3.6

USP11 159 0 3.2

TRIP12 133 0 4.3 DNMT1 188 0 3.7 DDX24 126 0 3.4 PPIL4 80 0 4.7 DHX40 68 0 2 PPM1G 49 0 2 TMPO 68 0 13.6 FBXO38 54 0 0 TCEAL4 24 0 2

65 (van der Knaap et al., 2005, Sarkari et al., 2009b, Pfoh et al., 2015a, Faesen et al., 2011, Khoronenkova et al., 2012, Du et al., 2010, Qin et al., 2011, Felle et al., 2011, Cheng et al., 2015, Cai et al., 2015, Liu et al., 2016). A number of uncharacterized USP7 interactors were also identified, including the F-box protein FBXO38, the deubiquitylating enzyme USP11, DEAD- box helicase DDX24, Peptidylprolyl Isomerase PPIL4, DEAH-Box Helicase DHX40, Lamina- associated polypeptide TMPO and the transcription elongation factor TCEAL4. The interactions with USP11, PPIL4 and FBXO38 were also previously identified (Sowa et al., 2009, Maertens et al., 2010, Stockum et al., 2018), but have not been characterized. In this study, I focused on the USP7-FBXO38 interaction. F-box proteins typically form Skp1-cullin- F-box (SCF) E3 ubiquitin ligase complexes. However, the only reported function for FBXO38 is a co-activator of the KLF7 transcription factor and this is independent of an SCF complex (Smaldone et al., 2004, Sumner et al., 2013, Smaldone and Ramirez, 2006). To investigate the significance of the USP7-FBXO38 interaction, I first validated the interaction by transiently expressing myc-tagged USP7 in AGS cells, performing myc immunoprecipitation and immunoblotting for endogenous FBXO38 (Figure 3-1A). USP7 but not empty plasmid recovered FBXO38. The interaction was also verified by co-expressing myc-USP7 and FLAG-FBXO38 in 293T cells, followed by FLAG IP (Figure 3-1B). Myc-USP7 was efficiently recovered in samples containing FLAG-FBXO38 but not empty FLAG plasmid. I then used these expression systems to determine how USP7 binds FBXO38. The Frappier lab and others previously defined two USP7 binding pockets, one in the N-terminal TRAF domain (NTD) that is disrupted by D164A,W165A mutations (referred to here as DW) and a second in the Ubl2 ubiquitin-like domain that is disrupted by D762R,D764R mutations (referred to here as Ubl2) (Pfoh et al., 2015a, Saridakis et al., 2005b, Sheng et al., 2006, Sarkari et al., 2010a, Hu et al., 2006). I compared the recovery of endogenous FBXO38 with myc-USP7 containing WT sequence or DW or Ubl2 mutations (individually and in combination) or mutation in the USP7 catalytic cysteine (C223S) (Figure 3-1A). Both the DW and Ubl2 mutations decreased FBXO38 recovery to some degree, with the DW mutation having the more major effect. The effect of these binding pocket mutations was also assessed by co-expression with FLAG-FBXO38 in 293T cells followed by FLAG IP (Figure 3-1B). The Ubl2 mutant of USP7 was clearly recovered with FLAG-FBXO38, whereas the DW and DW/Ubl2 mutations abrogated the interaction. Together the results indicate that, while both the NTD and Ubl2 pockets contribute to FBXO38 binding, the NTD binding pocket is the major binding site.

67 Figure 3-1. USP7 interacts with and stabilizes FBXO38. (A) AGS cells were transfected with a plasmid expressing myc-tagged USP7 WT, the USP7 catalytic mutant (C223S), the USP7 NTD pocket mutant (DW), the USP7 Ubl2 pocket mutant (Ubl2), the USP7 double pocket mutant (DW/Ubl2) or an empty vector control (VC). Myc-USP7 constructs were immunoprecipitated with anti-myc antibody and recovered proteins were analyzed by Western blotting using antibodies against myc and endogenous FBXO38. The band corresponding to FBXO38 is indicated with arrow heads. (B) HEK293T cells were transfected with a plasmid expressing myc-tagged USP7 WT or co-transfected with plasmids expressing FLAG-tagged FBXO38 and each of the indicated myc-tagged USP7 plasmids. FBXO38 was immunoprecipitated using anti- FLAG M2 resin and recovered proteins were analyzed by Western blotting using antibodies against FLAG and myc. (C) HEK293T cells were co-transfected with plasmids expressing FLAG-tagged FBXO38 and either myc-USP7 WT, C223S or an empty vector control (VC). Cells were harvested 48h post transfection and cell lysates were analyzed by Western blotting using antibodies against FLAG, Myc and actin. Quantification of the FLAG-FBXO38 bands (normalized to actin) from two independent experiments is shown on the right. (D) AGS cells were transfected with an siRNA targeting USP7 (+) or a negative control siRNA (−) followed by treatment with the MG132 proteasome inhibitor (+) or DMSO as a negative control (−) for 12 hours. Cell lysates were analyzed by Western blotting using antibodies against FBXO38, USP7 and actin. Quantification of the FBXO38 bands (normalized to actin) from three independent USP7 silencing experiments are shown on the right. ***P<0.001

68 Another interesting finding of the experiment in Figure 3-1B, was that the level of FLAG- FBXO38 was significantly increased when it was co-expressed with myc-USP7 (compare lanes 2 and 3) and that the degree of increase of FLAG-FBXO38 paralleled the degree of binding of the USP7 mutants; DW and DW/Ubl2 mutants that did not bind FBXO38 did not upregulate it and the Ubl2 mutant that had decreased binding had an intermediate effect on FBXO38 levels. These results suggest that USP7 binding to FBXO38 stabilizes it, possibly by deubiquitylation. To investigate this further, I asked whether upregulation of FBXO38 required the catalytic activity of USP7. Comparison of FLAG-FBXO38 levels co-expressed with WT or catalytically inactive (C223S) USP7 or empty plasmid showed that the catalytic activity of USP7 was required to upregulate FBXO38, consistent with FBXO38 stabilization by deubiquitylation (Figure 3-1C). I also tested whether silencing of USP7 with siRNA affected the level of endogenous FBXO38 and found a dramatic reduction in FBXO38 upon USP7 depletion (Figure 3-1D). To determine if this loss of FBXO38 was due to proteasomal-mediated degradation, I repeated the USP7 silencing in the presence of the MG132 proteasome inhibitor and found that this restored FBXO38 levels. Together the results indicate that USP7 binds and stabilizes FBXO38 through deubiquitylation, protecting it from proteasomal-mediated degradation.

3.3.2 Identification of KIF20B as an FBXO38 interactor stabilized by FBXO38 and USP7 Little is known about the functions of FBXO38, other than it can act as a transcriptional coactivator with KLF7. To more comprehensively identify FBXO38 interactions that could reflect its functions, proximity-dependent biotin identification (BioID) was performed on FLAG- FBXO38 (FLAGBirA*–FBXO38) expressed at close to endogenous levels from an inducible integrate cassette in 293T cells and compared the interactions to the FLAGBirA* negative control. Selected high-confidence interactors with FLAGBirA*–FBXO38 in two independent experiments are shown in Figure 3-2A. Interestingly, USP7 was the most prevalent FBXO38 interactor. Skp1 and Cul1, the two core components for the SCF complex were also among the top hits, indicating that FBXO38 can form an SCF complex. In addition, several novel interactions were identified, including one with the Kinesin Family member 20B (KIF20B), a plus-end-directed motor enzyme that is required for the completion of cytokinesis (Abaza et al., 2003, Janisch et al., 2013, Kanehira et al., 2007, Janisch et al., 2018).

Figure 3-2. Identification of KIF20B as an interactor of FBXO38. (A) Expression of FLAGBirA*–FBXO38 or FLAGBirA* negative control from integrated cassettes in 293T cells was induced with tetracycline in the presence of 50 µM biotin for 24 hrs. Bioitinylated proteins were purified on Streptavidin Sepharose beads and recovered proteins were identified by LC- MS/MS. Total spectral counts for two biological replicates (Exp-1 and -2) with two technical replicates each (separated by |) are shown for high-confidence FBXO38 interactors (based on Bayesian False Discovery Rate (BFDR) <0.01). Spectral counts for cells expressing FLAGBirA* tag alone (Control) are shown for 16 experiments (B) AGS cells were transfected with a plasmid expressing FLAG-tagged FBXO38 (FBXO38) or an empty vector control (VC) for 48 hours. FBXO38 was immunoprecipitated using anti-FLAG M2 resin and recovered proteins were analyzed by Western blotting using antibodies against FLAG and KIF20B, respectively.

70 The interaction between FBXO38 and KIF20B was validated in AGS cells by transient expression and IP of FLAG-FBXO38 and immunoblotting for endogenous KIF20B (Figure 3- 2B). The finding that FBXO38 can form an SCF complex, which would be expected to induce the degradation of specific targets, prompted me to examine whether FBXO38 regulated the levels of KIF20B. To this end, I silenced FBXO38 in AGS cells with two different siRNAs and examined effects on endogenous KIF20B (Figure 3-3A). Surprisingly, both siRNAs resulted in a dramatic reduction in KIF20B levels (without affecting USP7 levels), suggesting that FBXO38 stabilized KIF20B, rather than destabilizing it as expected if FBXO38 was acting as part of the SCF complex. Since FBXO38 levels are controlled by USP7, I also examined the effect of USP7 silencing on KIF20B in AGS cells. As expected, USP7 depletion (with two different siRNAs) greatly decreased both FBXO38 and KIF20B levels (Figure 3-3B). Quantification of these effects from multiple experiments showed a ~25 fold decrease in KIF20B upon FBXO38 silencing and ~5-fold decrease upon USP7 silencing (Figure 3-3C). While both FBXO38 and USP7 control KIF20B levels, this effect was not reciprocal as silencing of KIF20B did not affect the levels of FBXO38 or USP7 (Figure 3-3D). I also tested the possibility that the decrease in KIF20B upon FBXO38 silencing was due to loss of KIF20B transcripts (Figure 3-3E). However, FBXO38 silencing only slightly decreased the level of KIF20B transcripts (~30% decrease) as opposed to the ~25-fold decrease seen at the protein level. Together the results support a model in which FBXO38 binds and stabilizes KIF20B and USP7 stabilizes KIF20B indirectly by stabilizing FBXO38. To determine the generality of these effects, I repeated the FBXO38 and USP7 silencing experiments in HCT116 cells (Figure 3-3F). Consistent with the results in AGS cells, depletion of either FBXO38 or USP7 greatly decreased KIF20B levels. HCT116 cells with USP7 knockout have been previously generated (Cummins et al., 2004), and the findings thus far predict that these cells should have reduced levels of FBXO38 and KIF20B. A comparison of the levels of these proteins in HCT116 cells with and without the USP7 knockout confirmed that FBXO38 and KIF20B cells are considerably reduced in the absence of USP7 (Figure 3-3G). To further verify the importance of the USP7 deubiquitylation activity on the stabilization of both FBXO38 and KIF20B, cells were treated with a USP7 catalytic inhibitor (Compound 4, also known as AD04) recently developed by Gavory et al. (Gavory et al., 2018) or its inactive enantiomer (Figure 3-3H). The results of this experiment in AGS and HCT116 cell lines verify those in

72 Figure 3-3. Depletion of FBXO38 or USP7 decreases KIF20B levels. AGS cells were transfected with two different siRNAs targeting FBXO38 (A) or USP7 (B) or with negative control siRNA (siControl) and whole cell lysates were analyzed by Western blotting using the indicated antibodies. Bands corresponding to FBXO38 are indicated with arrow heads. (C) KIF20B protein bands were quantified in three independent FBXO38 and USP7 silencing experiments in AGS cells and normalized to actin. The average values are shown relative the silencing control. ***P<0.001 (D) AGS cells were transfected with an siRNA targeting KIF20B, and whole cell lysates were analyzed by Western blotting as in (A). (E) KIF20B mRNA levels were determined by RT-qPCR in AGS cells transfected with siRNA targeting FBXO38 or with negative control siRNA. The experiment was performed in triplicate and values normalized to actin. Average values and standard deviations are shown relative to the silencing control. (F) HCT116 cells were transfected with siRNA targeting FBXO38 or USP7 or with negative control siRNA (siControl) and whole cell lysates were analyzed by Western blotting as in (A). (G) Whole cell lysates of HCT116 USP7 KO or the WT parental cell line (USP7 WT) were analyzed by Western blotting as in (A). (H) AGS or HCT116 cells were treated with 5 µM of compound 4 (USP7 inhibitor) or an inactive enantiomer and harvested after 24 hours. Whole cell lysates were analyzed by Western blotting using the indicated antibodies.

73 Figure 3-1C, in that the stabilization of FBXO38 is dependent on the deubiquitylation activity of USP7. Furthermore, the decrease in the levels of KIF20B in AGS and HCT116 cells upon USP7 inhibition is consistent with the USP7 silencing and knockout experiments and is likely attributed to the decrease in FBXO38 levels.

3.3.3 FBXO38 interacts with and stabilizes KIF20B by an SCF-independent mechanism. While the role of FBXO38 in stabilizing KIF20B is not what is expected of an SCF complex, it is possible that an FBXO38-containing SCF complex may be affecting KIF20B indirectly by inducing degradation of a KIF20B destabilizing protein. Alternatively, FBXO38 might be acting independently of an SCF complex. I addressed these possibilities by comparing the effects of overexpression of FBXO38 on KIF20B levels to that of an FBXO38 mutant that lacks the F-box sequence needed to form the SCF complex. The F-box sequence in FBXO38 is located between amino acids 33 to 65 (Smaldone et al., 2004) and therefore I generated an F-box deletion mutant of FBXO38 (FBXO38ΔFBX) by truncating the first 77 amino acids. Co- expression of HA-KIF20B and either FLAG-FBXO38, FLAG-FBXO38ΔFBX or empty FLAG plasmid in AGS and 293T cells showed that both FBXO38 proteins greatly increased the levels of HA-KIF20B in both cell lines (Figure 3-4A,B). Furthermore, immunoprecipitation of the FBXO38 proteins showed that FBXO38ΔFBX recovered similar amounts of KIF20B as WT FBXO38 but, unlike WT FBXO38, did not recover Skp1 (Figure 3-4B). These results indicate that the F-box of FBXO38 (that is needed to form an SCF complex) is dispensable for KIF20B binding and stabilization, and therefore FBXO38 is acting independent of an SCF complex. In keeping with an SCF-independent effect of FBXO38, treatment of the cells with the MG132 proteasome inhibitor did not restore KIF20B levels caused by FBXO38 silencing (Figure 3-4C).

3.3.4 FBXO38 and USP7 regulate cytokinesis through KIF20B Previous reports have shown that KIF20B depletion results in the accumulation of multinucleated cells, due to defects in cytokinetic abscission (Kanehira et al., 2007, Giovinazzi et al., 2013, Abaza et al., 2003, Janisch et al., 2018). To test the functional significance of USP7 and FBXO38 in stabilizing KIF20B, I treated AGS cells with siRNA targeting each of the three proteins (see Figure 3-3A, B, D for degree of silencing), or with a negative control siRNA and

Figure 3-4. FBXO38 interacts with and stabilizes KIF20B by an SCF-independent mechanism. (A) AGS cells were cotransfected with plasmids expressing HA-tagged KIF20B and FLAG-tagged FBXO38 (WT), the FBXO38 F-box deletion mutant (∆FBX) or an empty vector control (VC). Cell lysates were analyzed by Western blotting using antibodies against FLAG and HA. (B) 293T cells were cotransfected as in (A), followed by coimmunoprecipitation using anti-FLAG M2 resin. Recovered proteins were analyzed by Western blotting using antibodies against FLAG, HA and Skp1 and myc. Bands corresponding to FBXO38 WT or ∆FBX are indicated with arrow heads. (C) AGS cells were transfected with an siRNA targeting FBXO38 (+) or a negative control siRNA (−) followed by 12 hr treatment with the MG132 proteasome inhibitor (+) or DMSO (−). Cell lysates were analyzed by Western blotting using antibodies against FBXO38, KIF20B and actin.

75 determined the number of multinucleated cells by microscopy of DAPI-stained cells. To differentiate multinucleated cells from overlapping single cells, I also stained for F-actin using fluorescently-labelled phalloidin to mark the outer edges of the cell. ~1500 cells in each sample were then counted and the percentage of cells containing two or more nuclei was determined. Sample images and quantification from three independent experiments are shown in Figure 3- 5A. Consistent with previous reports, KIF20B silencing resulted in a 13-fold increase in the frequency of multinucleated cells when compared to the silencing control. In addition, silencing of FBXO38 had almost an identical effect as silencing KIF20B on inducing multinucleated cells. USP7 silencing also greatly increased the percentage of multinucleated cells (~6-fold) relative to the silencing control. The results confirm that both FBXO38 and USP7 affect the cytokinetic function of KIF20B. The more modest effect of USP7 silencing (as compared to KIF20B and FBXO38 silencing) is consistent with the model that USP7 regulates KIF20B indirectly through FBXO38. To further confirm the cytokinetic defect associated with USP7 the number of multinucleated cells in HCT116 USP7 knockout cells was compared to that of parental HCT116 cells. USP7 knockout cells exhibited a 4-fold higher frequency of multinucleated cells as the parental cells, in good agreement with the results of USP7 silencing in AGS cells (Figure 3-5B). Since USP7 is known to regulate the levels of multiple proteins, it is possible that the multinucleated phenotype that was found to be associated with USP7 depletion is independent of FBXO38 and KIF20B. For example, USP7 has been reported to affect Aurora A, whose loss of function is associated with a multipolar spindle phenotype that can lead to multinucleated cells (Giovinazzi et al., 2013, Marumoto et al., 2003, Hoar et al., 2007). I examined the possibility that USP7 silencing in AGS cells increased the incidence of multipolar spindles but found no cells with multipolar spindles in over 100 metaphase cells examined (Figure 3-6). In addition, I tested whether the multinucleated phenotype associated with USP7 silencing was caused by loss of FBXO38 and KIF20B by performing rescue experiments. To this end, AGS cells were treated with siRNA targeting the 3’UTR of USP7 or a negative control siRNA, then transfected with a plasmid expressing myc-USP7, HA-KIF20B, FLAG-FBXO38 or an empty plasmid. Cells were then stained with antibodies against FLAG, HA or myc to identify cells expressing the transfected plasmid and also stained with DAPI and fluorescently-labelled phalloidin to identify multinucleated cells (Figure 3-7A and B). As expected, USP7 silencing (which was confirmed by western blotting; Figure 3-7C) in the presence of the control plasmid

Figure 3-5. FBXO38 or USP7 depletion results in cytokinetic defects. (A) AGS cells were transfected with siRNA targeting KIF20B, FBXO38 or USP7 or with negative control siRNA (siControl). Cells were then fixed, stained with Phalloidin and DAPI, then imaged by fluorescence microscopy. The number of multinucleated cells in ~1500 cells were counted. Average values and standard deviation from three independent experiments are shown in the bar graph on the right. P values relative to siControl are indicated (* = 0.01

Figure 3-6. USP7 knockdown did not result in multipolar spindles. AGS cells transfected with an siRNA targeting USP7 (siUSP7) or a negative control siRNA (siControl) were fixed in 100% methanol, stained with an anti-acetylated tubulin antibody and DAPI and then imaged by fluorescence microscopy. Cells in metaphase were analyzed/examined for a multipolarity phenotype that has been previously reported upon USP7 inhibition due to an accumulation of Aurora A. A total of 47 and 69 metaphase cells for two independent siUSP7 and siControl experiments, respectively, were analyzed. siUSP7: Experiment1=26 cells, Experiment 2=21 cells, silencing control: Experiment1=37 cells, Experiment 2=32 cells. All of these cells exhibited a normal dipole phenotype, and there was no evidence of any multipolarity phenotype. The figure shows representative images of cells in metaphase for either siControl or siUSP7.

79 Figure 3-7. Overexpression of USP7, KIF20B and FBXO38 rescues the cytokinetic defects caused by USP7 silencing. (A) AGS cells were transfected with siRNA targeting USP7 followed by transfection with plasmids expressing HA-KIF20B, myc-USP7, FLAG-FBXO38 WT, FLAG-FBXO38∆FBX or an empty vector control (VC). Alternatively, cells were transfected with negative control siRNA (siControl) followed by transfection with the VC. Cells were then fixed, stained with DAPI and Phalloidin and with antibodies against either HA, myc or FLAG as indicated, then imaged by fluorescence microscopy. Cells expressing the tagged protein are indicated with white arrow heads in the left panel. The number of multinucleated cells (out of ~1500 cells/sample) in the silencing control or in USP7 silenced cells expressing the indicated tagged proteins or containing the VC were counted and plotted in (B). Average values from three independent experiments are shown along with standard deviations. P values are indicated for siUSP7 samples relative to siUSP7 with VC (* = 0.01

80 resulted in an increase in multinucleated cells when compared to the silencing control (Figure 3- 7B). Also as expected, this phenotype was greatly reduced (compared to the empty vector control) in cells in which myc-USP7 was expressed. In addition, USP7 silenced cells expressing HA-KIF20B or FLAG-FBXO38 exhibited greatly reduced numbers of multinucleated cells, with HA-KIF20B almost completely rescuing the phenotype. These data strongly suggest that the cytokinetic defect observed upon USP7 silencing is a result of decreased KIF20B levels. The same rescue experiments were also performed with FBXO38ΔFBX, giving almost identical results to WT FBXO38 and further confirming that FBXO38 is functioning independently from an SCF complex in its regulation of KIF20B levels and function. Finally, since KIF20B function in cytokinesis involves its localization to midbodies (Janisch et al., 2018, Abaza et al., 2003, Kanehira et al., 2007), I determined whether silencing FBXO38 and USP7 affected the level of KIF20B at midbodies. To this end, AGS cells treated with siRNA targeting FBXO38 or USP7 or negative control siRNA (Figure 3-8A) were fixed and stained for KIF20B and acetylated tubulin to mark the midbody (Figure 3-8B,C), and the level of KIF20B staining was quantified for 30 midbodies per sample in three independent experiments (Figure 3-8D). Silencing of either FBXO38 or USP7 resulted in a significant decreased in KIF20B at the midbodies, supporting the model that FBXO38 and USP7 silencing results in cytokinesis defects by affecting KIF20B function.

3.4 DISCUSSION USP7 is known to bind and deubiquitylate multiple proteins with diverse functions, thereby regulating a variety of cellular pathways relevant for oncogenesis. To gain additional insight into the protein interactions and functions of USP7, an AP-MS proteomics approach was used to identify USP7 binding partners in the context of gastric carcinoma cells. This led to the identification of a previously uncharacterized interaction with FBXO38. The USP7-FBXO38 interaction was also observed by Sowa et al (Sowa et al., 2009) in a global analysis of deubiquitylating enzymes. However, the functional significance of this interaction was unclear since, FBXO38 itself is not well characterized. This study led to the identification of a novel role of FBXO38 in cytokinesis which is regulated by USP7.

Figure 3-8. FBXO38 and USP7 silencing reduces KIF20B levels at the midbodies. AGS cells transfected with an siRNA targeting FBXO38, USP7 or a negative control siRNA were either lysed and analyzed by Western blotting using the indicated antibodies to confirm FBXO38 and USP7 silencing (A) or fixed and stained with DAPI and antibodies against KIF20B and acetylated tubulin. Representative fluorescence microscopy images of KIF20B localization at the midbodies after FBXO38 silencing (B) or USP7 silencing (C) are shown. (D) The fluorescence intensity of KIF20B at the midbodies in B and C was quantified for 30 midbodies in three independent experiments and values were normalized to the intensity of acetylated tubulin at the midbodies. Average values with standard deviations were plotted with P values (***P<0.001) for either FBXO38 or USP7 silencing shown relative to silencing control.

82 I have shown that FBXO38 interacts with USP7, predominantly through the USP7 NTD binding pocket, that is also known to bind p53, Hdm2, HdmX, MCM-BP, Epstein-Barr virus EBNA1 and Kaposi’s sarcoma associated herpesvirus (KSHV) vIRF1 and vIRF4 (Saridakis et al., 2005b, Sheng et al., 2006, Hu et al., 2006, Sarkari et al., 2010a, Jagannathan et al., 2014, Chavoshi et al., 2016, Lee et al., 2011a). The Frappier lab previously defined a P/A/ExxS motif that is used to bind this NTD binding pocket (Saridakis et al., 2005b, Sheng et al., 2006, Sarkari et al., 2010a), and FBXO38 has 8 such motifs that might be responsible for this interaction. I also observed that mutation of the USP7 Ubl2 binding pocket consistently decreased FBXO38 binding, suggesting that part of FBXO38 might also contact this pocket. Other proteins that bind the Ubl2 pocket do so using a polybasic KxxxK motif (Pfoh et al., 2015a), and FBXO38 contains five of these motifs that may contribute to USP7 binding. The interaction of USP7 with FBXO38 prompted me to examine a role of USP7 in stabilizing FBXO38 through deubiquitylation. In support of this hypothesis, I found that FBXO38 levels increased upon overexpression of WT USP7 but not the USP7 catalytic mutant (Figure 3-1C) as well as upon treatment with the MG132 protease inhibitor (Figure 3-4C). Furthermore, depletion of USP7 in several cell lines dramatically decreased endogenous levels of FBXO38, an effect that could be reversed upon inhibition of the proteasome (Figure 3-1D). Together these findings suggest that FBXO38 is an unstable protein that is stabilized by USP7 through deubiquitylation preventing its proteasomal degradation. FBXO38 has not been extensively studied but has been found to be a coactivator of the KLF7 transcription factor, which is a regulator of neuronal differentiation (Smaldone et al., 2004, Sumner et al., 2013, Smaldone and Ramirez, 2006). FBXO38 (also called MoKA) was shown to bind KLF7 through its F-box domain and to enhance transcription of KLF7 target genes, including p21Waf/Cip (Smaldone et al., 2004). Furthermore, a dominant mutation in FBXO38 that renders it unable to bind KLF7 causes spinal muscular atrophy (SMA), an inherited disorder characterized by progressive muscle weakness (Sumner et al., 2013). FBXO38 has also been found to shuttle between the nucleus and the cytoplasm, suggesting that it also has cytoplasmic functions (Smaldone and Ramirez, 2006, Smaldone et al., 2004). To gain a more comprehensive profile of the protein interactions of FBXO38 that might reflect additional functions, a BioID experiment was performed with FBXO38. This revealed several novel interactions including one with KIF20B. In addition, the SCF complex components, Skp1 and Cul1, were prominent interactors showing that FBXO38, like other F-box proteins, is capable of forming an SCF

83 ubiquitin ligase complex. This suggests that FBXO38 may have roles in the ubiquitylation and degradation of specific target proteins, which may include some of the proteins identified as FBXO38 interactors in the BioID experiment. Follow up experiments on the FBXO38-KIF20B interaction, not only confirmed the interaction but showed that KIF20B protein levels were dependent on FBXO38. Consistent with these observations, USP7 silencing or knockout, which greatly decreased FBXO38 levels, also led to loss of KIF20B. These results suggested that FBXO38 was acting independently from an SCF complex, since an SCF complex typically induces the loss of the target protein. This hypothesis was confirmed by showing that FBXO38 did not require its F-Box motif to bind and stabilize KIF20B.Together, the results of this study support a model where USP7 binds and stabilizes FBXO38, which in turn, binds and stabilizes KIF20B. Our finding that FBXO38 acts independently of an SCF complex to stabilize KIF20B, is consistent with the KLF7 co-activator function of FBXO38, which was also shown to be independent of an SCF complex (Smaldone et al., 2004). Furthermore, SCF-independent functions have been reported for ~12% of human F-box proteins (Nelson et al., 2013). This includes FBXO7, which has both SCF-dependent and independent functions, and resembles FBXO38 in that it binds and stabilizes specific proteins (p27 and Cdk6 complexes) (Meziane el et al., 2011, Laman et al., 2005, Nelson et al., 2013). Although there are currently no known SCF-dependant functions of FBXO38, the fact that we showed it could interact with Skp1 and Cul1 suggests that, like FBXO7, it might have additional SCF-dependant functions. While FBXO38 functions with KLF7 and KIF20B are both SCF-independent, the mechanisms of these interactions are distinct; FBXO38 binds KLF7 through its F-box sequence (Smaldone et al., 2004), while FBXO38 lacking this sequence binds KIF20B, indicating that the KIF20B binding site is elsewhere in the protein. FBXO38 contains a central RNase Inihibitor (RNI)-like domain, similar to that of leucine-rich repeats (LRRs) in placental RNase inhibitor (Jin et al., 2004). LRRs are protein interaction domains (Kobe and Kajava, 2001, Bella et al., 2008) and therefore this domain might mediate the KIF20B interaction. KIF20B (previously called MPHOSPH1 or MPP1) is one of three members of the Kinesin-6 family and is a critical regulator of cytokinesis (Abaza et al., 2003, Kanehira et al., 2007, Janisch et al., 2013, Liu et al., 2014, Janisch et al., 2018). In cytokinesis a contractile ring drives the ingression of a cleavage furrow that partitions the cytoplasm between the daughter cells that are connected through an intercellular bridge. A midbody forms at the center of the

84 intercellular bridge and serves as both the anchor for the ingressed cleavage furrow and a platform for the assembly of the machinery that drives abscission. KIF20B has been shown to promote cytokinesis by temporally regulating both cytokinetic furrow ingression and abscission and also by promoting efficient midbody maturation and microtubule stabilization (Janisch et al., 2018). In keeping with these important roles, multiple studies have shown that knockdown of KIF20B in bladder, liver and HCT116 colon cancer cells results in cytokinetic defects that are reflected in accumulation of multinucleated cells that eventually undergo apoptosis (Scolnick and Halazonetis, 2000, Chavoshi et al., 2016, Kanehira et al., 2007, Janisch et al., 2018). The major effect of FBXO38 and USP7 on KIF20B levels prompted me to investigate whether these two proteins are also important for cytokinesis. As predicted, silencing of USP7 or FBXO38 or USP7 knockout significantly increased the percentage of multinucleated cells. Furthermore, rescue experiments showed that multinucleated cells caused by lack of USP7 could be prevented by providing KIF20B or FBXO38, confirming that cytokinetic defects associated with USP7 depletion are a result of decreased FBXO38 and KIF20B levels. The decreased levels of KIF20B observed at the midbodies upon depletion of FBXO38 or USP7 further supports the contention that these proteins are affecting cytokinesis through disruption of KIF20B function. In conclusion, I have identified novel roles for USP7 and FBXO38 in cytokinesis through the stabilization of KIF20B, an important player in cytokinesis abscission and completion. While USP7 has several identified roles in cell cycle progression (Reverdy et al., 2012, Hernandez- Perez et al., 2017, Yi et al., 2016, Giovinazzi et al., 2013, Jagannathan et al., 2014, Lecona et al., 2016, Oh et al., 2007), to our knowledge, this is the first report of a role for USP7 in cytokinesis. Overexpression of KIF20B has been found to positively correlate with tumorigenesis and cell proliferation in bladder and liver cancer (Kanehira et al., 2007, Liu et al., 2014). Consequently, KIF20B is recognized as a potential therapeutic target for these cancers, since depletion of KIF20B in these cells leads to mitotic arrest, through failure of cytokinesis, and subsequent apoptosis. Similarly, the overexpression of USP7 that has been reported in many cancer cells may also induce their proliferation by upregulating KIF20B and promoting cytokinesis. The findings of this study suggest that USP7 and FBXO38 may both be useful targets for inhibiting the growth of cancer cells with KIF20B overexpression.

CHAPTER 4

Summary, general discussion and future directions

86 4.1 THESIS SUMMARY I have studied the interactions of USP7 with several cellular proteins to gain insight into the mechanisms of these interactions, identify potential novel targets of USP7 and to ultimately build on our current knowledge on the cellular functions of USP7. In doing so, I identified FBXO38 and the RNA helicases DDX24 and DHX40 as novel USP7 targets that are stabilized by USP7. In addition, I confirmed the interactions of USP7 with USP11, PPM1G and TRIP12, and validated previous findings that TRIP12 is stabilized by USP7. I also contributed new insights into FBXO38, by showing that it upregulates the Kinesin-6 family member, KIF20B, independently of an SCF complex. My studies on the functional significance of the USP7- FBXO38 interaction identified a novel role for USP7 and FBXO38 in cytokinesis, which involves their stabilization of KIF20B. In addition, I contributed to the identification the USP7 Ubl2 pocket, and determined that several known USP7 CTD interactors bind through this pocket. Furthermore, I determined that FBXO38, DDX24, USP11, PPM1G and TRIP12 all preferentially interact with the USP7 TRAF pocket, whereas the interaction with DHX40 is mediated primarily through the Ubl2 pocket. Moreover, I gained further insight into USP11 and DDX24 interaction mechanisms, by identifying the P/A/ExxS motifs in these proteins that are required for USP7 binding.

4.2 GENERAL DISCUSSION 4.2.1 Insights into the USP7-FBXO38-KIF20B axis In this study I determined that USP7 binds and stabilizes FBXO38 dependent on is deubiquitylating activity, protecting it from proteasomal degradation (see Figure 4-1 for model). Upon discovering that USP7 plays a key role in stabilizing FBXO38, I was interested in determining if USP7 also regulates the downstream functions of FBXO38. Fortunately, the identification of FBXO38 interactors in the BioID experiment provided me with the opportunity to identify novel FBXO38 functions that could then be assessed for regulation by USP7. One of these novel interactors was KIF20B, a key regulator of cytokinesis at the abscission step. Upon investigating this interaction I determined that FBXO38 subsequently binds and stabilizes the Kinesin-6 KIF20B through a mechanism that is independent of its association with the SCF E3 ubiquitin ligase complex. Furthermore, I have shown that USP7 also positively regulates KIF20B levels, which may be occurring indirectly through its stabilization of FBXO38. Finally, I have identified novel roles for USP7 and FBXO38 in promoting cytokinesis through KIF20B. Based on my initial findings on the USP7-mediated stabilization of FBXO38, I

Figure 4-1. Proposed model for the USP7-FBXO38-KIF20B axis. USP7 binds and stabilizes FBXO38 dependent on is deubiquitylating activity, protecting it from proteasomal degradation. Therefore, I propose that USP7 is stabilizing FBXO38 through the removal of degradative ubiquitin chains. FBXO38 subsequently binds and stabilizes the Kinesin-6 KIF20B through a mechanism that is independent of its association with the SCF E3 ubiquitin ligase complex. Furthermore, I have shown that USP7 also positively regulates KIF20B levels, which may be occurring indirectly through its stabilization of FBXO38. Finally, I have identified novel roles for USP7 and FBXO38 in promoting cytokinesis through KIF20B.

88 Based on my initial findings on the USP7-mediated stabilization of FBXO38, I hypothesize that USP7 removes degradative ubiquitin chains from FBXO38 through direct interactions. Interestingly, the FBXO38 BioID experiment revealed an interaction with the HECT-domain E3 ligase UBR5, which may therefore be a potential candidate that counteracts USP7 deubiquitylation and targets FBXO38 for proteasomal-mediated degradation. The fact that KIF20B was not identified in the USP7 AP-MS suggests that USP7 does not interact with and deubiquitylate KIF20B. However, it is possible that solubility of the KIF20B protein or its indirect interaction with USP7 through FBXO38 may have prevented its identification in the AP-MS experiment. Therefore, I propose two possible scenarios by which USP7 and FBXO38 promote the stabilization of KIF20B. First, through its interaction with FBXO38, USP7 may be recruited to KIF20B where it can stabilize KIF20B through deubiquitylation. Second, USP7 may not be interacting with KIF20B at all, but may indirectly promote its stabilization by simply binding to and stabilizing FBXO38. These hypothesis can be tested by determining the USP7 and KIF20B binding sites on FBXO38, which will provide insight into whether USP7 and KIF20B can bind FBXO38 at the same time. I believe another way by which FBXO38 can stabilize KIF20B is by blocking the interaction between KIF20B and an E3 ligase that ubiquitylates and targets KIF20B for proteasomal degradation. It is also possible that FBXO38 mediates an interaction between KIF20B and another deubiquitylating enzyme (not USP7) that stabilizes KIF20B through the cleavage of degradative ubiquitin chains. It is not completely clear how KIF20B regulates cytokinesis abscission, however a recent publication by Janisch et al suggested that KIF20B is responsible for efficient timing of furrow ingression and abscission, since knockdown of KIF20B resulted in a delay in both events (Janisch et al., 2018). In addition, they proposed that KIF20B promotes cytokinesis by regulating the late steps of midbody maturation, such as ESCRT-III recruitment and the formation of constriction sites. The fact that USP7 and FBXO38 stabilize KIF20B and promote its midbody localization, suggests that they also regulate cytokinesis through these same mechanisms. Furthermore, I did not identify any other cytokinesis-related proteins in either the USP7 AP-MS or FBXO38 BioID experiments, suggesting that KIF20B might be the only avenue by which USP7 and FBXO38 regulate this stage of the cell cycle. The only other known function of FBXO38 is that it acts as a transcriptional co-activator of the krüppel-like factor 7 (KLF7) transcription factor (Smaldone et al., 2004, Sumner et al., 2013, Smaldone and Ramirez, 2006). KLF7 transactivates genes involved in cell differentiation

89 and cell cycle regulation (ex. p21Waf/Cip and p27kip) in addition to genes that regulate neuronal differentiation (Smaldone et al., 2004, Laub et al., 2005, Kajimura et al., 2007, Caiazzo et al., 2010). I therefore hypothesize that USP7 acts upstream of FBXO38 to promote the transcription of KLF7-target genes. A FBXO38 dominant mutant that impairs KLF7-mediated transactivation was shown to cause Spinal muscular atrophy (SMA), a neuromuscular disorder characterized by loss of motor neurons and progressive muscle wasting (Sumner et al., 2013). Therefore, it would be interesting to determine if downregulation of USP7 (as seen in many cancers) is also implicated in SMA. The fact that both Skp1 and Cul1 of the SCF complex were among the top hits in the BioID experiment, suggests that FBXO38 is capable of acting as part of the complex to target its interactors for proteasomal degradation. Therefore, it would be of interest to determine if FBXO38 regulates the stability of other hits from the BioID data, which could lead to identification of other novel functions of FBXO38, and ultimately USP7. Interestingly, FAM172A appeared in both the BioID and the USP7 AP-MS experiment, suggesting that it may be acting as part of a complex with FBXO38 and USP7. Although the cellular functions of FAM172A are poorly understood, it is thought to play a role in the p38-mitogen activated protein kinase (MAPK) and Notch signalling pathways (Li et al., 2016b, Feng et al., 2013). Furthermore, FAM172A has more recently been found to have both tumor suppressive and oncogenic roles in cancer (Cui et al., 2017, Cui et al., 2016, Li et al., 2016b, Feng et al., 2013, Liu et al., 2017). Also identified as FBXO38 interactors by BioID were the Death Effector Domain Containing proteins, DEDD and DEDD2, which are potent inducers of apoptosis that function in the classical caspase-dependent apoptosis pathway (Alcivar et al., 2003, Lee et al., 2002, Arai et al., 2007). The identification of both these proteins was particularly intriguing since they form a nuclear complex, suggesting that they may form a functional complex with FBXO38. Finally, the transformation/transcription domain-associated protein (TRRAP), a histone acetyltransferase component that regulates various biological functions such as cell cycle progression (Herceg et al., 2001, Li et al., 2004a, Tapias et al., 2014, Ichim et al., 2014), DNA repair (Murr et al., 2006, Robert et al., 2006) and oncogenic transformation (McMahon et al., 1998, McMahon et al., 2000, Wang et al., 2016a, Wurdak et al., 2010), was also identified as an FBXO38 interactor. Interestingly, USP7 was shown to stabilize TRRAP and consequently promote c-myc expression (Bhattacharya and Ghosh, 2015). Together, these BioID hits suggest a role for FBXO38 in apoptotic and cell proliferation pathways. Another interesting FBXO38 interactor

90 was the Retinitis Pigmentosa GTPase Regulator Interacting Protein 1 Like protein (RPGRIP1L). RPGRIP1L localizes to cilia and plays an essential role in cilia assembly (Wiegering et al., 2018a, Jensen et al., 2015, Li et al., 2016a). Mutations in RPGRIP1L result in ciliopathies, which are life-threatening diseases caused by defective cilia, including Meckel syndrome (MKS), Joubert syndrome (JBTS), Retinitis Pigmentosa (RP) and Nephronophtisis (NPHP). Furthermore, mutations in RPGRIP1L affect the development of almost every organ and limb in the body (reviewed in (Wiegering et al., 2018b)). Therefore, if FBXO38 regulates RPGRIP1L, this would suggest a novel role for FBXO38 in cilia assembly and organ development.

4.2.2 Functional significance of the USP7-mediated stabilization of DDX24 and DHX40 RNA helicases of the DEAD box and related DExD/H proteins function in essentially all processes involving RNA metabolism, including ribosome biogenesis, pre-mRNA splicing and processing, translation, and RNA export and turnover (Tanner and Linder, 2001, Rocak and Linder, 2004). To my knowledge, there are currently no identified roles of USP7 in RNA metabolism. In this study, I determined that USP7 binds and stabilizes the RNA helicases DHX40 and DDX24, strongly suggesting that USP7 plays a role in regulating RNA metabolism through these proteins. Although the role of DHX40 in RNA metabolism is currently unknown, DDX24 was shown to function in ribosomal synthesis (Yamauchi et al., 2014). Assembly of eukaryotic ribosomes begins with the generation of a large polycistronic pre-ribosomal RNA (47S rRNA) by RNA polymerase I (pol I) (Henras et al., 2015, Popov et al., 2013). The 47S pre- rRNA undergoes multiple processing steps to generate mature RNAs (18S, 28S and 5.8S) that form the 40s and 60s ribosomal subunits. It was found that DDX24 is responsible for pre-RNA processing that results in mature 28S rRNA, ultimately leading to the synthesis of the 60S ribosomal subunit (Yamauchi et al., 2014). MAK5, the Saccharomyces cerevisiae ortholog of human DDX24, was also shown to contribute to 60S ribosome biosynthesis (Zagulski et al., 2003). It was suggested that DDX24 elicits these functions by acting as part of pre-ribosomal ribonucleoprotein (pre-rRNP) processing complexes, which are required for the early steps of pre-rRNA processing (Yamauchi et al., 2014). Interestingly, Hdm2 polyubiquitylates DDX24, and this was shown to be required for the association of DDX24 with pre-rRNA complexes. This polyubiquitylated form of DDX24 is not targeted for proteasomal degradation, but instead binds to ubiquitin interacting motifs on pre-rRNP complex components.

91 Interestingly, p53 was shown to negatively regulate pre-rRNA synthesis and ribosome biosynthesis by repressing pol I transcription (Budde and Grummt, 1999, Grummt, 2003, Zhai and Comai, 2000). This inhibition of cellular rRNA synthesis is thought to be one of the many mechanism by which p53 induces cell cycle arrest. Since USP7 regulates DDX24, Hdm2 and p53, I propose that USP7 also functions in the regulation of ribosomal synthesis through these proteins. My hypothesis is that, in response to DNA damage, USP7-mediated stabilization of p53 promotes cell cycle arrest through inhibition of ribosome biosynthesis. Alternatively, under normal cellular conditions, USP7 would promote ribosome biosynthesis and thus cell proliferation by stabilizing both Hdm2 (which leads to destabilization of p53) and DDX24. The fact that DDX24 and DHX40 bind to different USP7 binding pockets, suggests that these three proteins could form a complex that might be important for regulating RNA metabolism. Finally, the discovery that USP7 stabilizes DHX40 may be useful in future studies aimed at determining the upstream factors that regulate the cellular functions of DHX40.

4.2.3 Functional significance of the USP7-USP11 and USP7-PPM1G interactions PPM1G was previously shown to induce S18 dephosphorylation of USP7 in response to DNA damage, leading to a reduction in USP7 levels (Khoronenkova et al., 2012). However it had not been determined whether USP7 reciprocally regulates PPM1G levels and therefore its functions. In addition to PPM1G, USP7 had been shown to interact with USP11 in a number of cell lines, both in this and other published studies (Sowa et al., 2009, Maertens et al., 2010, Stockum et al., 2018). Furthermore, the fact that USP11 binds to USP7 using a P/A/ExxS motif suggests that the interaction is direct. This observation led to my initial hypothesis that USP7 functions to deubiquitylate and stabilize USP11, or vice versa. However I found that, in all but one cell line (AGS), USP7 did not contribute to the stabilization of either PPM1G or USP11. I also did not find any evidence suggesting that USP11 regulates the stabilization of USP7. Therefore the functional significance the USP11-USP7 interaction is unclear. In addition, it is not known if there other functional implications of the PPM1G-USP7 interaction besides that reported by Khoronenkova et al (Khoronenkova et al., 2012). I propose that USP7 regulates the functions of USP11 and PPM1G, or vice versa through mechanisms that are distinct from regulating their stability. One possibility is that USP7 acts as a scaffold to recruit USP11 or PPM1G to their targets, or that USP11 and PPM1G reciprocally regulate USP7 functions in this manner. Secondly, USP7 might regulate the subcellular

92 localisation of USP11 or PPM1G through the removal of monoubiquitylation. This has been previously shown for the PTEN and FOXO4 proteins, in which cleavage of monoubiquitylation from these proteins by USP7 results in their cytoplasmic localization (Song et al., 2008, van der Horst et al., 2006). One of the functions of K63-polyubiquitin chains is to promote interactions between proteins that contain ubiquitin-binding domains. Protein-protein interactions induced by K63-polyubiquination play a key role in NFkβ pathway and DNA damage signaling, two processes that have been found to be largely regulated by USP11 (Sun et al., 2010, Yamaguchi et al., 2007, Yu et al., 2016, Shah et al., 2017, Deng et al., 2018, Schoenfeld et al., 2004). It is therefore possible that USP7 regulates the interactions of PPM1G and USP11 with their targets through the cleavage of non-degradative K63-linked ubiquitin chains on these proteins. Interestingly, USP7 was recently reported to undergo K63-ubiquitylation in response to hypoxic stress. This modification was shown to enhance its interaction with and subsequent stabilization of the hypoxia-inducible factor-1α (HIF-1α) transcription factor, thereby activating HIF-1α target gene expression (Wu et al., 2016). Furthermore, K63-ubiquitylated USP7 interacts with the CREB-binding protein (CPB) and promotes CBP-mediated acetylation of HIF-1α target genes. The factors involved in regulating USP7 K63-ubiquitylation are currently unknown. USP11 has been found to have a higher activity towards K63-linked chains than K48-linked chains (Harper et al., 2014), suggesting that USP11 can remove K63-linked ubiquitin from USP7 and mediate USP7 protein interactions in this manner. Finally, it would be interesting to determine if PPM1G-mediated dephosphorylation of USP7 modulates USP7 cellular interactions.

4.2.4 Regulation and mechanisms of USP7 interactions USP7 plays important roles in numerous cellular processes by regulating the stabilization or activities of its many substrates and binding partners. Through the experiments in this thesis, I have contributed to the continuously growing list of USP7 interactors and substrates. Considering USP7 appears to have only two binding sites for its specific target proteins, how USP7 coordinates binding and regulation all of its substrates is an interesting question. One way USP7 can achieve this is by temporally regulating its interactions, in which USP7 will exclusively bind certain proteins over others during specific cellular events, such as different stages of the cell cycle or various points in the DNA damage response or DNA replication. For example, USP7 has been shown to temporally regulate p53, Mdm2 and Mdmx. During cell homeostasis, USP7 preferentially binds and stabilizes Mdm2 and Mdmx, which in turn directly destabilize and inhibit the activity of p53, respectively (Meulmeester et al., 2005a) . However,

93 during the DNA damage response, phosphorylation of Mdm2 and Mdmx prevents their association with USP7, and subsequently permits USP7 to bind and stabilize p53 (Meulmeester et al., 2005b). I believe that numerous other USP7 interactions can be temporally regulated by post-translational modifications on the target protein such as phosphorylation, acetylation and non-degradative ubiquitylation. Interestingly, USP7 itself can be phosphorylated at S18 and S963 (Fernandez-Montalvan et al., 2007, Beausoleil et al., 2004), acetylated at K1084 and K1099 (Choudhary et al., 2009), K63 ubiquitylated at K443 (Wu et al., 2016) and polyneddylated (Lee et al., 2005), which may play substantial roles in regulating its interactions. In addition to temporal regulation, USP7 interactions can be spatially regulated. For instance, relocalization of certain substrates to different subcellular compartments may determine whether they are accessible to USP7. USP7 can to localize to the nucleus (Bhattacharya et al., 2018, Everett et al., 1997), cytoplasm (Fernandez-Montalvan et al., 2007) and even the mitochondria (Fernandez- Montalvan et al., 2007, Marchenko et al., 2007), where it can engage in interactions that are specific to these compartments. USP7 interactions can also be regulated by competing with one another for the same binding pocket. This stems from differences in the affinities of the TRAF and Ubl2 binding pockets for different P/A/ExxS or KxxxK motifs, respectively. For example, the Mdm2 P/A/ExxS motif (226AGVS229) exhibits a much higher binding affinity for the TRAF pocket than the p53 motif (359PGGS362), and efficiently outcompetes p53 for binding as a result (Hu et al., 2006). This might explain why USP7 preferentially stabilizes Mdm2 during cell homeostasis, and only binds p53 once the USP7-Mdm2 interaction is disrupted. The strongest known TRAF pocket interactors are the herpesvirus proteins EBNA1 (EBV) and vIRF4 (KSHV), which bind the pocket with Kd values of 0.9 µM and 2 µM, respectively (Saridakis et al., 2005b, Chavoshi et al., 2016). Accordingly, previous work in the Frappier lab has shown that EBNA1 can efficiently outcompete p53 for binding to the TRAF pocket and consequently interferes with the USP7- mediated stabilization of p53 in response to DNA damage (Saridakis et al., 2005b). By lowering p53 levels in this manner, EBNA1 can protect cells from apoptotic challenge which may contribute to EBV-associated cell immortalization. Furthermore, it was recently shown that vIRF1 also promotes p53 destabilization by interacting with the USP7 TRAF pocket. Similarly, the HSV protein ICP0 was shown to have a higher affinity for the USP7 Ubl2 binding pocket when compared to two other cellular Ubl2 pocket interactors; GMPS and UHRF1. This suggests that ICP0 can obstruct these and other interactions that occur through this site. Together, these

94 observations indicate a high probability that these viral proteins interfere with multiple USP7 functions by blocking cellular interactions that occur through the TRAF or Ubl2 pockets. In this study I have identified FBXO38, DDX24, USP11 and PPM1G as USP7 TRAF pocket interactors and DHX40 as a Ubl2 pocket interactor. Elucidating the interaction dynamics of these proteins will be important for gaining a more complete understanding of how the overall functions of USP7 are regulated. In this thesis I proposed that USP7 negatively regulates p53 acetylation and promotes ribosome biosynthesis through its stabilization of DDX24. Therefore, I hypothesize that the USP7-DDX24 interaction is somehow disrupted during cellular stress, when p53 activation and decreases in ribosome biosynthesis are required. Furthermore, I believe that the FBXO38-USP7 interaction might be prominent during cytokinesis to allow for KIF20B stabilization and midbody localization. It would be interesting to determine if EBNA1 and vIRF4 abrogate binding of USP7 to FBXO38, DDX24, USP11 and PPM1G. This would have a profound effect on the function of USP7 in stabilizing FBXO38 and DDX24. DDX24 interacts with USP7 using an EGPS motif, which is the same sequence used by EBNA1 and vIRF4 to bind the TRAF pocket. This suggests that DDX24 might have a similar binding affinity for USP7 as these viral proteins and may be able to outcompete other USP7 cellular protein interactions for this site. This might also imply that EBNA1 and vIRF4 are unable to efficiently outcompete DDX24 for binding to the TRAF pocket. Finally, it would be of interest to determine if ICP0 inhibits the USP7-mediated stabilization of DHX40 by outcompeting DHX40 for the Ubl2 pocket. The results of the co-IP experiments with the USP7 TRAF and Ubl2 mutants indicate that, although FBXO38, DDX24, USP11 and PPM1G predominantly interact through the TRAF pocket they are also capable of making contacts with the Ubl2 pocket. Furthermore, DHX40 also seems to have the ability to make contacts with the TRAF pocket. It is therefore possible that the ability of these proteins to bind through either pocket might be a way to evade competition with other proteins.

4.3 FUTURE DIRECTIONS 4.3.1 Determining the functional significance of the USP7-DDX24 interaction It has been reported that DHX40 associates with pre-rRNP processing complexes and drives the synthesis of the 60S ribosome by processing pre-rRNA transcripts into mature 28S rRNA (Yamauchi et al., 2014, Zagulski et al., 2003). Furthermore, non-proteolytic ubiquitylation

95 of DDX24 by Mdm2 is crucial for this process. Considering that USP7 stabilizes both Mdm2 and DDX24, I hypothesize that USP7 also functions in pre-rRNA processing and the synthesis of the 60S ribosomes through these proteins. To tests this, I would carry out similar experiments to those in Yamauchi et al that showed the specific functions of DDX24 in pre-rRNA processing and 60S ribosomal synthesis (Yamauchi et al., 2014). For example, the effect of USP7 silencing, catalytic inhibition and overexpression on the levels of 28S rRNA can be examined by autoradiography using cells that have been pulse-labelled with 32P. As demonstrated in Yamauchi et al., the in vivo levels of the 40S, 60S and 80S ribosomal subunits can be quantified by fractionating the ribosomal particles from cell lysates using sucrose density gradient centrifugation and measuring the absorbance of the fractions at 254nm. This method can therefore be used to determine if USP7 depletion or catalytic inhibition results in a decrease in 60S ribosome levels, which would be expected if USP7 is acting through DDX24 (and Mdm2) to promote 60S ribosomal synthesis. As mentioned in the discussion, it is also possible that USP7 functions in RNA processing through its regulation of p53, which inhibits pre-rRNA processing by repressing RNA Pol I transcription (Budde and Grummt, 1999, Grummt, 2003, Zhai and Comai, 2000). Therefore, any observed effects on the levels of pre-rRNA and 60S ribosomes upon USP7 modulation may also be attributed to changes in p53 levels. To circumvent this issue, the above assays can be performed in H1299 p53 null cells. Furthermore, to test whether USP7 is regulating these processes specifically through DDX24 and not just through Mdm2, the same experiments proposed above can be performed in H1299 cells that express Mdm2 from an ecdysone-inducible promoter that was previously generated (Frum et al., 2014). If USP7 is in fact regulating pre-rRNA processing specifically through DDX24, USP7 knockdown would result in a similar reduction in 28S rRNA and 60s ribosomal levels in both Mdm2-induced and uninduced cells. In addition to its role in RNA metabolism, DDX24 has also been shown to negatively regulate p53 transcriptional activity by suppressing its p300-mediated acetylation on K382 and K164 (Shi et al., 2016). Therefore, I hypothesize that USP7 also plays a role in negatively regulating p53 acetylation through its stabilization of DDX24. This can be tested by determining if USP7 knockdown or overexpression results in the expected increase (silencing) or decrease (overexpression) in p53 acetylation, which can be examined by western blotting using commercially available antibodies against acetylated p53 at K382 and K164. Furthermore, cells

96 used for these experiments will be treated with the histone deacetylase (HDAC) inhibitor Trichostatin A (TSA) and Sirtuin inhibitor Nicotinamide to enrich for p53 acetylation and the MG132 proteasome inhibitor to equalize p53 abundance (Shi et al., 2016). To confirm that the resulting decrease in p53 acetylation upon USP7 overexpression is due to effects on DDX24, the same experiment can be performed in the presence of DDX24 siRNA silencing, in which the observed increase in p53 acetylation would be abrogated. It is important to note that PML-NBs promote p53 acetylation and that USP7 negatively regulates PML-NB. To insure that the effect on p53 acetylation by USP7 is not due to effects on PML-NB levels, the USP7 modulation experiment can be conducted in in CNE2 PML null cells that have been previously generated in our lab (Sarkari et al., 2011). The USP7 binding mutant of DDX24 (S342A) that was generated in this study can also be used to assess the importance of USP7 on the downstream functions of DDX24. I propose to use the CRISPR-Cas9 genome editing system to replace endogenous DDX24 with the S342A mutant sequence in human cells. Since USP7 will be unable to efficiently bind and stabilize DDX24 S342A, I would expect the mutant cells to have decreased DDX24 levels when compared to the WT parental cell line. Accordingly, I hypothesize that cells expressing DDX24 S342A would exhibit lower levels of 28S rRNA and 60S ribosomes and higher levels of acetylated p53 when compared to WT cells.

4.3.2 Further characterization of the USP7-USP11 interaction In the discussion, I proposed that USP7 and USP11 regulate the functions of one another by modulating their individual protein-protein interactions. Non-degradative ubiquitin signals, such as K63-linked polyubiquitin chains, can promote-protein interactions by binding to ubiquitin binding motifs on the interaction partner. Therefore, it is possible that USP7 and USP11 negatively regulate each other’s interactions and functions through the removal of non- degradative ubiquitin signals from one another. Alternatively, USP7 and USP11 may positively regulate each other’s interactions and functions by acting as scaffolds to recruit the other to their respective targets. Therefore, disrupting the USP7-USP11 interaction might abrogate or enhance one another’s respective cellular interactions. These two possibilities can be tested in the context of USP11 by using AP-MS to compare the cellular protein interactions with USP11 WT and the USP11 mutant that is defective in binding to USP7 (S562A/S761A/S678A; 3xS/A). Our lab has successfully used this method of comparative proteomics to identify interactions with CK2β that

97 are abrogated by a mutation in a CK2β binding motif (Cao et al., 2014). I would expect USP11 interactors that are positively regulated by USP7 (i.e USP7 acting as a scaffold) to have a higher recovery with USP11 WT than the USP11 3xS/A mutant, whereas interactors that are negatively regulated by the USP11-USP7 interaction (i.e removal of non-degradative ubiquitin signals) would have a higher recovery with the USP11 mutant. Finally, this comparative proteomics approach can be performed on USP7 in the presence or absence of USP11 silencing to identify potential USP7 interactors that are positively or negatively regulated by the USP11-USP7 interaction. Functional consequences of disrupting the USP7-USP11 interaction can also be monitored in human cells by using CRISPR/Cas9 to generate cells expressing the USP11 3xS/A mutant in place of the WT sequence in the genome. If USP7 regulates the association of USP11 with several of its targets, I would expect to see changes in the stability or ubiquitylation levels of these USP11 target proteins when comparing USP11 3xS/A mutant and WT cells. Maertens et al (Maertens et al., 2010) reported that both USP7 and USP11 deubiquitylate and stabilize the Polycomb Repressive Complex-1 (PRC1) proteins MEL18 and BMI1. It is currently unknown whether these two USPs act independently of one another or if they act as part of a complex to regulate these proteins. Therefore, it would be interesting to determine if the interaction between USP7 and USP11 is necessary for them to bind and stabilize MEL18 and BMI1. This can be tested by using co-IP experiments to compare the recovery of the PRC1 proteins with the two USPs in USP11 3xS/A and WT cells. The hypothesis would be supported if the interaction of the PRC1 proteins with USP7 or USP11 is abrogated in USP11 3xS/A cells. Furthermore, a decrease in the stability of MEL18 and BM11 (and an increase in their ubiquitylation levels) in USP11 3xS/A cells would also suggest a requirement for USP7 and USP11 to bind one another to regulate these proteins. One can also use the USP11 3xS/A mutant cells to determine if disrupting the USP7-USP11 interaction leads to misregulation of known USP11 functions in DNA repair, and NFKβ and TGFβ signalling. The ability of USP7 and USP11 to remove non-degradative ubiquitin signals from one another can be tested by performing in vivo deubiquitylation assays. A common approach would be to co-express tagged ubiquitin with recombinant USP11 (for example) in the presence or absence of recombinant USP7 in human cells and compare recovery of ubiquitylated USP11 by IP of the tag under denaturing conditions. Alternatively, one could express the tagged ubiquitin and compare the recovery of ubiquitylated endogenous USP11 by

98 IP in the presence or absence of USP7 silencing. To determine whether USP7 has a preference for K63-linked ubiquitin chains on USP11, the assay can be performed using a ubiquitin mutant construct that can only form K63 chains (all lysines mutated to alanines except for K63) or it can be analyzed by immunoblotting with a commercial antibody against K63-linked ubiquitin chains. These same in vivo deubiquitylation assays can also be performed to identify the types of ubiquitin linkages (if any) that are removed from USP7 by USP11.

4.3.3 Further characterization of the USP7-PPM1G interaction Previous reports have shown that that PPM1G dephosphorylates USP7, which results in destabilization of USP7 in response to DNA damage and a subsequent decrease and increase in Mdm2 and p53, respectively (Khoronenkova et al., 2012). In the same study, it was found that PPM1G is capable of dephosphorylating USP7 during normal cellular conditions, however the significance of this discovery was never further investigated. Furthermore, I have verified previous findings that USP7 and PPM1G interact during normal cellular conditions, and not just during the DNA damage response. Based on these observations, I hypothesize that there are additional functions associated with the USP7-PPM1G interaction that may be independent of the DNA damage pathway. One possibility is that the PPM1G-mediated dephosphorylation of USP7 at S18 plays a role in regulating the cellular interactions of USP7. This can be tested by performing AP-MS on the USP7 S18A mutant and comparing the recovery of its interactions with WT USP7. Alternatively, USP7 may play a role in regulating the association of PPM1G with its targets via similar mechanisms as was proposed for USP11; by acting as a scaffold or through the removal of non-degradative ubiquitin chains. The potential effect that the USP7- PPM1G interaction has on the binding of PPM1G to its cellular interactors can be studied using a PPM1G mutant that is impaired in binding to USP7. Although I have not generated such a mutant, it is achievable by using mutational analysis to determine the specific PPM1G P/A/ExxS motifs that are important for USP7 binding. If USP7 is found to play a role in regulating PPM1G interactions, the next step would be to determine if USP7 promotes the removal of non- degradative ubiquitin chains from PPM1G and whether these chains play a role in regulating PPM1G interactions.

4.3.4 Insights into the regulation and functions of FBXO38 FBXO38 is a poorly characterized protein that functions in co-activating KLF7 gene expression and in promoting cytokinesis through KIF20B (Smaldone et al., 2004, Sumner et al.,

99 2013, Smaldone and Ramirez, 2006). The result of the FBXO38 BioID experiment suggests that FBXO38 may regulate a number of its interactors by acting as part of an SCF complex. Furthermore, the identity of several of the BioID hits suggest that FBXO38 may function in oncogenic-related pathways and organ development. Therefore, I am interested in performing experiments that would lead to the identification of additional functions of FBXO38 and its upstream regulators. In this study I have determined that in the absence of USP7, FBXO38 is targeted for proteasomal degradation and this is likely facilitated by an E3 ubiquitin ligase. Interestingly, the E3 ligase UBR5 was identified in the FBXO38 BioID, leading to the hypothesis that UBR5 is responsible for counteracting the deubiquitylation of FBXO38 by USP7 and targeting it to the proteasome. This can be readily tested by determining if siRNA knockdown or overexpression of UBR5 leads to an increase or decrease, respectively, in the levels of FBXO38. If it were found that UBR5 negatively regulates FBXO38, one can then perform in vivo ubiquitylation assays to determine if UBR5 overexpression leads to an increase in FBXO38 ubiquitylation levels. Furthermore, I hypothesize that the addition of recombinant USP7 in this experiment would, to some extent, counteract the UBR5-mediated ubiquitylation of FBXO38. FBXO38 has the potential to both negatively regulate its interactors as part of an SCF complex and promote their stabilization, as was seen for KIF20B. Therefore, it is possible that FBXO38 regulates the stability, and therefore the downstream functions, of several of the hits from the BioID experiment featured in Figure 3-2A. A straight forward approach to test this hypothesis would be to determine if the levels of various BioID hits are modulated upon knockdown or overexpression of FBXO38. The functions of several of these hits have been characterized, including DEDD/DEDD2, TRRAP, UBR5, RPGRIP1L and Bag6. Therefore, if FBXO38 was found to modulate the stability of any one of these interactors, one could then perform functional assays to determine if FBXO38 regulates their downstream functions. Furthermore, it would be of interest to address whether USP7 acts upstream of FBXO38 to regulate these interactors, which may reveal potential novel functions of USP7. One of the most surprising discoveries during the course of this work has been that FBXO38 promotes that stabilization of KIF20B, and this is independent of an FBXO38 SCF complex. Therefore, future experiments will be aimed at determining the mechanism by which FBXO38 stabilizes KIF20B. Based on the finding that USP7 stabilizes both FBXO38 and KIF20B, I propose two hypothesis: 1) USP7 indirectly stabilizes KIF20B by simply binding to

100 and stabilizing FBXO38 or 2) FBXO38 recruits USP7 to KIF20B, leading to USP7-mediated deubiquitylation and stabilization of KIF20B. The second hypothesis can only be true if USP7 and KIF20B interact simultaneously with FBXO38 by binding to different sites on the FBXO38 protein. Therefore, I propose to identify the USP7 and KIF20B binding sites on FBXO38. The FBXO38 protein has several structural domains which are shown in Figure 4-1A. Based on the Structural Classification of Proteins (SCOP) database and Phyre2, FBXO38 has a predicted RNI- like domain between amino acids (a.a.) 202-461, which proceeds the F-Box domain located between a.a. 33-65 (Smaldone et al., 2004). The RNI-like domain forms a similar structure to leucine-rich repeats (LRR) and is therefore a predicted interacting domain. This domain is followed by a long region (a.a. 461-925) that lacks predicted secondary structure, whereas the region between a.a 958 to the end of the protein (a.a 1188) is made up of a mixture of alpha helices and beta sheets that has no structural homology to any known protein domain. FBXO38 also harbours 11 putative P/A/ExxS and 5 putative KxxxK USP7 binding motifs (Figure 4-1A), the majority if which are located within the heavily unstructured region between a.a. 461-925. To narrow down the KIF20B and USP7 binding regions on FBXO38, I would begin by generating a series of FBXO38 N-terminal deletion mutants that progressively lack each of the structural domains described above, and compare the recovery of endogenous USP7 or KIF20B with these mutants and WT FBXO38. Examples of the FBXO38 truncations that can be used as a starting point are shown in Figure 41-C. Once the USP7 and KIF20B binding regions have been identified, they can be further confirmed by showing in co-IP experiments that FBXO38 truncations consisting of these regions alone are sufficient to recover similar amounts of USP7 or KIF20B as FBXO38 WT. The identification of the USP7 binding region might also narrow down the number of possible P/A/ExxS and KxxxK motifs. The specific P/A/ExxS and KxxxK motifs that bind USP7 can then be identified by individually mutating the motifs that are confined within the USP7 binding region and then performing co-IP experiments to compare the recovery of endogenous USP7 with these FBXO38 mutants and FBXO38 WT. Another approach to test the possibility that FBXO38 is recruiting USP7 to KIF20B is to perform co-IP experiments with USP7 and KIF20B in the presence or absence of FBXO38. If FBXO38 is mediating the interaction, one would expect that any detected interaction between USP7 and KIF20B would be abrogated in the absence of FBXO38. If USP7 and KIF20B bind to the same site on FBXO38 or do not appear to co-IP even in the presence of FBXO38, this would suggest that FBXO38 stabilizes KIF20B by another mechanism that does not involve USP7. One

101

102 Figure 4-2. Amino acid sequence and schematic representation of FBXO38 domains showing putative USP7 binding motifs. A) Top: Full length FBXO38 sequence (Accession Q6PIJ6.3) indicating the amino acids representing the F-box motif (a.a 33-65) highlighted in blue, the RNI-like domain (202-461) highlighted in purple and a C-terminal portion made up of α helices and β-strands highlighted in yellow. Amino acids representing the putative P/A/ExxS and KxxxK USP7 binding motifs are bolded and in red font, respectively. The region between a.a 461-958 lacks predicted secondary structure. Bottom: Schematic of full length FBXO38 indicating the positions of the F-box motif, the RNI-like domain, the unstructured region and the C-terminal domain using the same color scheme as the above amino acid sequence. B) Example of FBXO38 truncation mutations that can be used to narrow down the USP7 and KIF20B binding regions.

103 possible alternative mechanism is that FBXO38 inhibits the interaction between KIF20B and one of its negative regulators, such as an E3 ubiquitin ligase. To test this hypothesis, one would first need to perform proteomics experiments, such as BioID, to identify the KIF20B specific E3 ligase in question. Any E3 ligases detected in KIF20B BioID would then be assessed for their ability to negatively regulate KIF20B. In the event that a KIF20B specific E3 ligase is identified, the hypothesis that FBXO38 can disrupt the interaction will be tested by determining the ability of KIF20B and the E3 ligase to co-IP in the presence or absence of FBXO38. The hypothesis would be supported if the interaction between the KIF20B and the E3 ligase in question is abrogated in the presence of FBXO38. Furthermore, the KIF20B BioID experiment might lead to the identification of potential cytokinetic proteins that function with KIF20B, which could provide fundamental mechanistic insights into how KIF20B is regulating cytokinesis.

4.4 CONCLUSION The focus of this thesis was to gain a more complete picture of USP7 interactions in cancer cells and to ultimately enhance our understanding of USP7 cellular functions and its roles in cancer biology. Here, I show how I contributed to the work involved in the discovery of a second USP7 binding pocket located in the Ubl2 of the USP7 C-terminal domain. The generation of the USP7 Ubl2 mutant (D762R/D764R) and the identification of the KxxxK binding motif will be instrumental in the discovery of additional USP7 interactors that bind through the Ubl2 pocket. Furthermore, I provided a profile of USP7 binding partners in human gastric carcinoma cells and identified several uncharacterized and previously unidentified USP7 interactors. Upon examining the significance of interactions, I identified FBXO38, DDX24 and DHX40 as novel USP7 targets and confirmed the interaction of USP7 with USP11 and PPM1G in multiple cell lines. Furthermore, I identified specific motifs used by DDX24 and USP11 in binding to USP7, which may prove to be useful tools for further understanding the functional significance of these interactions. Although I did not identify the functional consequences of many of these USP7 interactions, I believe the data presented in this thesis has opened opportunities for future studies that can lead to the discovery of new roles for USP7 in cellular processes such as RNA metabolism, DNA damage responses, tumor suppression and oncogenesis. In studying the significance of the interaction between USP7 and FBXO38, I provide the first evidence of a role for USP7 and FBXO38 in cytokinesis, which is through their stabilization of KIF20B. Overexpression of KIF20B has been found to positively correlate with tumorigenesis

104 and cell proliferation (Kanehira et al., 2007, Liu et al., 2014). Accordingly, the findings in my study suggest that aberrant USP7 expression seen in cancer cells may contribute to tumorigensis by promoting cytokinesis through the upregulation of KIF20B. Finally, future studies on the interactions identified in FBXO38 BioID experiment may lead to the discovery of additional cellular functions of FBXO38 and the identification of protein targets of a FBXO38 SCF complex.

105 REFERENCES

Abaza, A., Soleilhac, J. M., Westendorf, J., Piel, M., Crevel, I., Roux, A.,Pirollet, F. (2003). M phase phosphoprotein 1 is a human plus-end-directed kinesin-related protein required for cytokinesis. The Journal of biological chemistry, 278, 27844-52.

Akutsu, M., Dikic, I.,Bremm, A. (2016). Ubiquitin chain diversity at a glance. Journal of cell science, 129, 875-80.

Alcivar, A., Hu, S., Tang, J.,Yang, X. (2003). DEDD and DEDD2 associate with caspase-8/10 and signal cell death. Oncogene, 22, 291-7.

Ali, A., Raja, R., Farooqui, S. R., Ahmad, S.,Banerjea, A. C. (2017). USP7 deubiquitinase controls HIV-1 production by stabilizing Tat protein. The Biochemical journal, 474, 1653-1668.

Alonso-De Vega, I., Martin, Y.,Smits, V. A. (2014). USP7 controls Chk1 protein stability by direct deubiquitination. Cell cycle, 13, 3921-6.

Altun, M., Kramer, H. B., Willems, L. I., Mcdermott, J. L., Leach, C. A., Goldenberg, S. J., Kumar, K. G., Konietzny, R., Fischer, R., Kogan, E., Mackeen, M. M., Mcgouran, J., Khoronenkova, S. V., Parsons, J. L., Dianov, G. L., Nicholson, B.,Kessler, B. M. (2011). Activity-based chemical proteomics accelerates inhibitor development for deubiquitylating enzymes. Chemistry & biology, 18, 1401-12.

Amerik, A. Y.,Hochstrasser, M. (2004). Mechanism and function of deubiquitinating enzymes. Biochimica et biophysica acta, 1695, 189-207.

An, L., Jiang, Y., Ng, H. H., Man, E. P., Chen, J., Khoo, U. S., Gong, Q.,Huen, M. S. (2017). Dual-utility NLS drives RNF169-dependent DNA damage responses. Proceedings of the National Academy of Sciences of the United States of America, 114, E2872-E2881.

Arai, S., Miyake, K., Voit, R., Nemoto, S., Wakeland, E. K., Grummt, I.,Miyazaki, T. (2007). Death-effector domain-containing protein DEDD is an inhibitor of mitotic Cdk1/cyclin B1. Proceedings of the National Academy of Sciences of the United States of America, 104, 2289-94.

Ballabeni, A., Melixetian, M., Zamponi, R., Masiero, L., Marinoni, F.,Helin, K. (2004). Human geminin promotes pre-RC formation and DNA replication by stabilizing CDT1 in mitosis. The EMBO journal, 23, 3122-32.

Bargonetti, J.,Manfredi, J. J. (2002). Multiple roles of the tumor suppressor p53. Current opinion in oncology, 14, 86-91.

Basant, A.,Glotzer, M. (2018). Spatiotemporal Regulation of RhoA during Cytokinesis. Current biology : CB, 28, R570-R580.

Beausoleil, S. A., Jedrychowski, M., Schwartz, D., Elias, J. E., Villen, J., Li, J., Cohn, M. A., Cantley, L. C.,Gygi, S. P. (2004). Large-scale characterization of HeLa cell nuclear

106 phosphoproteins. Proceedings of the National Academy of Sciences of the United States of America, 101, 12130-5.

Bella, J., Hindle, K. L., Mcewan, P. A.,Lovell, S. C. (2008). The leucine-rich repeat structure. Cellular and molecular life sciences : CMLS, 65, 2307-33.

Bhattacharya, S., Chakraborty, D., Basu, M.,Ghosh, M. K. (2018). Emerging insights into HAUSP (USP7) in physiology, cancer and other diseases. Signal transduction and targeted therapy, 3, 17.

Bhattacharya, S.,Ghosh, M. K. (2014). HAUSP, a novel deubiquitinase for Rb - MDM2 the critical regulator. The FEBS journal, 281, 3061-78.

Bhattacharya, S.,Ghosh, M. K. (2015). HAUSP regulates c-MYC expression via deubiquitination of TRRAP. Cellular oncology, 38, 265-77.

Boname, J. M., Thomas, M., Stagg, H. R., Xu, P., Peng, J.,Lehner, P. J. (2010). Efficient internalization of MHC I requires lysine-11 and lysine-63 mixed linkage polyubiquitin chains. Traffic, 11, 210-20.

Borodovsky, A., Kessler, B. M., Casagrande, R., Overkleeft, H. S., Wilkinson, K. D.,Ploegh, H. L. (2001). A novel active site-directed probe specific for deubiquitylating enzymes reveals proteasome association of USP14. The EMBO journal, 20, 5187-96.

Boutell, C., Canning, M., Orr, A.,Everett, R. D. (2005). Reciprocal activities between herpes simplex virus type 1 regulatory protein ICP0, a ubiquitin E3 ligase, and ubiquitin-specific protease USP7. Journal of virology, 79, 12342-54.

Boutell, C.,Everett, R. D. (2013). Regulation of alphaherpesvirus infections by the ICP0 family of proteins. The Journal of general virology, 94, 465-81.

Braten, O., Livneh, I., Ziv, T., Admon, A., Kehat, I., Caspi, L. H., Gonen, H., Bercovich, B., Godzik, A., Jahandideh, S., Jaroszewski, L., Sommer, T., Kwon, Y. T., Guharoy, M., Tompa, P.,Ciechanover, A. (2016). Numerous proteins with unique characteristics are degraded by the 26S proteasome following monoubiquitination. Proceedings of the National Academy of Sciences of the United States of America, 113, E4639-47.

Bravo, M., Nicolini, F., Starowicz, K., Barroso, S., Cales, C., Aguilera, A.,Vidal, M. (2015). Polycomb RING1A- and RING1B-dependent histone H2A monoubiquitylation at pericentromeric regions promotes S-phase progression. Journal of cell science, 128, 3660-71.

Brenkman, A. B., De Keizer, P. L., Van Den Broek, N. J., Van Der Groep, P., Van Diest, P. J., Van Der Horst, A., Smits, A. M.,Burgering, B. M. (2008). The peptidyl-isomerase Pin1 regulates p27kip1 expression through inhibition of Forkhead box O tumor suppressors. Cancer research, 68, 7597-605.

Brinkmann, K., Schell, M., Hoppe, T.,Kashkar, H. (2015). Regulation of the DNA damage response by ubiquitin conjugation. Frontiers in genetics, 6, 98.

107

Brooks, C. L., Li, M., Hu, M., Shi, Y.,Gu, W. (2007). The p53--Mdm2--HAUSP complex is involved in p53 stabilization by HAUSP. Oncogene, 26, 7262-6.

Budde, A.,Grummt, I. (1999). p53 represses ribosomal gene transcription. Oncogene, 18, 1119- 24.

Buetow, L.,Huang, D. T. (2016). Structural insights into the catalysis and regulation of E3 ubiquitin ligases. Nature reviews. Molecular cell biology, 17, 626-42.

Cai, J. B., Shi, G. M., Dong, Z. R., Ke, A. W., Ma, H. H., Gao, Q., Shen, Z. Z., Huang, X. Y., Chen, H., Yu, D. D., Liu, L. X., Zhang, P. F., Zhang, C., Hu, M. Y., Yang, L. X., Shi, Y. H., Wang, X. Y., Ding, Z. B., Qiu, S. J., Sun, H. C., Zhou, J., Shi, Y. G.,Fan, J. (2015). Ubiquitin- specific protease 7 accelerates p14(ARF) degradation by deubiquitinating thyroid hormone receptor-interacting protein 12 and promotes hepatocellular carcinoma progression. Hepatology, 61, 1603-14.

Caiazzo, M., Colucci-D'amato, L., Esposito, M. T., Parisi, S., Stifani, S., Ramirez, F.,Di Porzio, U. (2010). Transcription factor KLF7 regulates differentiation of neuroectodermal and mesodermal cell lineages. Experimental cell research, 316, 2365-76.

Canning, M., Boutell, C., Parkinson, J.,Everett, R. D. (2004). A RING finger ubiquitin ligase is protected from autocatalyzed ubiquitination and degradation by binding to ubiquitin-specific protease USP7. The Journal of biological chemistry, 279, 38160-8.

Cao, J. Y., Shire, K., Landry, C., Gish, G. D., Pawson, T.,Frappier, L. (2014). Identification of a novel protein interaction motif in the regulatory subunit of casein kinase 2. Molecular and cellular biology, 34, 246-58.

Chauhan, D., Tian, Z., Nicholson, B., Kumar, K. G., Zhou, B., Carrasco, R., Mcdermott, J. L., Leach, C. A., Fulcinniti, M., Kodrasov, M. P., Weinstock, J., Kingsbury, W. D., Hideshima, T., Shah, P. K., Minvielle, S., Altun, M., Kessler, B. M., Orlowski, R., Richardson, P., Munshi, N.,Anderson, K. C. (2012). A small molecule inhibitor of ubiquitin-specific protease-7 induces apoptosis in multiple myeloma cells and overcomes bortezomib resistance. Cancer cell, 22, 345- 58.

Chavoshi, S., Egorova, O., Lacdao, I. K., Farhadi, S., Sheng, Y.,Saridakis, V. (2016). Identification of Kaposi Sarcoma Herpesvirus (KSHV) vIRF1 Protein as a Novel Interaction Partner of Human Deubiquitinase USP7. The Journal of biological chemistry, 291, 6281-91.

Chen, C., Song, J., Wang, J., Xu, C., Gu, W., Sun, H.,Wen, X. (2017). Synthesis and biological evaluation of thiazole derivatives as novel USP7 inhibitors. Bioorganic & medicinal chemistry letters, 27, 845-849.

Cheng, J., Yang, H., Fang, J., Ma, L., Gong, R., Wang, P., Li, Z.,Xu, Y. (2015). Molecular mechanism for USP7-mediated DNMT1 stabilization by acetylation. Nature communications, 6, 7023.

108 Cheon, K. W.,Baek, K. H. (2006). HAUSP as a therapeutic target for hematopoietic tumors (review). International journal of oncology, 28, 1209-15.

Ching, W., Koyuncu, E., Singh, S., Arbelo-Roman, C., Hartl, B., Kremmer, E., Speiseder, T., Meier, C.,Dobner, T. (2013a). A ubiquitin-specific protease possesses a decisive role for adenovirus replication and oncogene-mediated transformation. PLoS Pathog, 9, e1003273.

Ching, W., Koyuncu, E., Singh, S., Arbelo-Roman, C., Hartl, B., Kremmer, E., Speiseder, T., Meier, C.,Dobner, T. (2013b). A ubiquitin-specific protease possesses a decisive role for adenovirus replication and oncogene-mediated transformation. PLoS pathogens, 9, e1003273.

Chiu, Y. H., Zhao, M.,Chen, Z. J. (2009). Ubiquitin in NF-kappaB signaling. Chemical reviews, 109, 1549-60.

Choudhary, C., Kumar, C., Gnad, F., Nielsen, M. L., Rehman, M., Walther, T. C., Olsen, J. V.,Mann, M. (2009). Lysine acetylation targets protein complexes and co-regulates major cellular functions. Science, 325, 834-40.

Christ, L., Wenzel, E. M., Liestol, K., Raiborg, C., Campsteijn, C.,Stenmark, H. (2016). ALIX and ESCRT-I/II function as parallel ESCRT-III recruiters in cytokinetic abscission. The Journal of cell biology, 212, 499-513.

Colland, F., Formstecher, E., Jacq, X., Reverdy, C., Planquette, C., Conrath, S., Trouplin, V., Bianchi, J., Aushev, V. N., Camonis, J., Calabrese, A., Borg-Capra, C., Sippl, W., Collura, V., Boissy, G., Rain, J. C., Guedat, P., Delansorne, R.,Daviet, L. (2009). Small-molecule inhibitor of USP7/HAUSP ubiquitin protease stabilizes and activates p53 in cells. Molecular cancer therapeutics, 8, 2286-95.

Comartin, D., Gupta, G. D., Fussner, E., Coyaud, E., Hasegan, M., Archinti, M., Cheung, S. W., Pinchev, D., Lawo, S., Raught, B., Bazett-Jones, D. P., Luders, J.,Pelletier, L. (2013). CEP120 and SPICE1 cooperate with CPAP in centriole elongation. Current biology : CB, 23, 1360-6.

Craig, R.,Beavis, R. C. (2004). TANDEM: matching proteins with tandem mass spectra. Bioinformatics, 20, 1466-7.

Cui, C., Ye, L., Huang, Z., Huang, S., Liu, H.,Yu, J. (2016). FAM172A is a tumor suppressor in colorectal carcinoma. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37, 6501-10.

Cui, C. H., Chen, R. H., Zhai, D. Y., Xie, L., Qi, J.,Yu, J. L. (2017). Detection of FAM172A expressed in circulating tumor cells is a feasible method to predict high-risk subgroups of colorectal cancer. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 39, 1010428317699126.

Cui, H., Guo, M., Xu, D., Ding, Z. C., Zhou, G., Ding, H. F., Zhang, J., Tang, Y.,Yan, C. (2015). The stress-responsive gene ATF3 regulates the histone acetyltransferase Tip60. Nature communications, 6, 6752.

109 Cummins, J. M., Rago, C., Kohli, M., Kinzler, K. W., Lengauer, C.,Vogelstein, B. (2004). Tumour suppression: disruption of HAUSP gene stabilizes p53. Nature, 428, 1 p following 486.

Cummins, J. M.,Vogelstein, B. (2004). HAUSP is required for p53 destabilization. Cell cycle, 3, 689-92.

Cunningham, C. N., Baughman, J. M., Phu, L., Tea, J. S., Yu, C., Coons, M., Kirkpatrick, D. S., Bingol, B.,Corn, J. E. (2015). USP30 and parkin homeostatically regulate atypical ubiquitin chains on mitochondria. Nature cell biology, 17, 160-9.

D'avino, P. P., Giansanti, M. G.,Petronczki, M. (2015). Cytokinesis in animal cells. Cold Spring Harbor perspectives in biology, 7, a015834.

Danovi, D., Meulmeester, E., Pasini, D., Migliorini, D., Capra, M., Frenk, R., De Graaf, P., Francoz, S., Gasparini, P., Gobbi, A., Helin, K., Pelicci, P. G., Jochemsen, A. G.,Marine, J. C. (2004). Amplification of Mdmx (or Mdm4) directly contributes to tumor formation by inhibiting p53 tumor suppressor activity. Molecular and cellular biology, 24, 5835-43.

Dar, A., Shibata, E.,Dutta, A. (2013). Deubiquitination of Tip60 by USP7 determines the activity of the p53-dependent apoptotic pathway. Molecular and cellular biology, 33, 3309-20.

De Bie, P., Zaaroor-Regev, D.,Ciechanover, A. (2010). Regulation of the Polycomb protein RING1B ubiquitination by USP7. Biochemical and biophysical research communications, 400, 389-95.

Deng, T., Yan, G., Song, X., Xie, L., Zhou, Y., Li, J., Hu, X., Li, Z., Hu, J., Zhang, Y., Zhang, H., Sun, Y., Feng, P., Wei, D., Hu, B., Liu, J., Tan, W.,Ye, M. (2018). Deubiquitylation and stabilization of p21 by USP11 is critical for cell-cycle progression and DNA damage responses. Proceedings of the National Academy of Sciences of the United States of America, 115, 4678- 4683.

Di Fiore, B.,Pines, J. (2008). Defining the role of Emi1 in the DNA replication-segregation cycle. Chromosoma, 117, 333-8.

Di Lello, P., Pastor, R., Murray, J. M., Blake, R. A., Cohen, F., Crawford, T. D., Drobnick, J., Drummond, J., Kategaya, L., Kleinheinz, T., Maurer, T., Rouge, L., Zhao, X., Wertz, I., Ndubaku, C.,Tsui, V. (2017). Discovery of Small-Molecule Inhibitors of Ubiquitin Specific Protease 7 (USP7) Using Integrated NMR and in Silico Techniques. Journal of medicinal chemistry, 60, 10056-10070.

Dou, H., Buetow, L., Sibbet, G. J., Cameron, K.,Huang, D. T. (2012). BIRC7-E2 ubiquitin conjugate structure reveals the mechanism of ubiquitin transfer by a RING dimer. Nature structural & molecular biology, 19, 876-83.

Du, Z., Song, J., Wang, Y., Zhao, Y., Guda, K., Yang, S., Kao, H. Y., Xu, Y., Willis, J., Markowitz, S. D., Sedwick, D., Ewing, R. M.,Wang, Z. (2010). DNMT1 stability is regulated by proteins coordinating deubiquitination and acetylation-driven ubiquitination. Science signaling, 3, ra80.

110

Duffy, M. J., Synnott, N. C., Mcgowan, P. M., Crown, J., O'connor, D.,Gallagher, W. M. (2014). p53 as a target for the treatment of cancer. Cancer treatment reviews, 40, 1153-60.

Durcan, T. M., Tang, M. Y., Perusse, J. R., Dashti, E. A., Aguileta, M. A., Mclelland, G. L., Gros, P., Shaler, T. A., Faubert, D., Coulombe, B.,Fon, E. A. (2014). USP8 regulates mitophagy by removing K6-linked ubiquitin conjugates from parkin. The EMBO journal, 33, 2473-91.

Eggert, U. S., Mitchison, T. J.,Field, C. M. (2006). Animal cytokinesis: from parts list to mechanisms. Annual review of biochemistry, 75, 543-66.

Eletr, Z. M.,Wilkinson, K. D. (2014). Regulation of proteolysis by human deubiquitinating enzymes. Biochimica et biophysica acta, 1843, 114-28.

Endoh, M., Endo, T. A., Endoh, T., Isono, K., Sharif, J., Ohara, O., Toyoda, T., Ito, T., Eskeland, R., Bickmore, W. A., Vidal, M., Bernstein, B. E.,Koseki, H. (2012). Histone H2A monoubiquitination is a crucial step to mediate PRC1-dependent repression of developmental genes to maintain ES cell identity. PLoS genetics, 8, e1002774.

Eng, J. K., Jahan, T. A.,Hoopmann, M. R. (2013). Comet: an open-source MS/MS sequence database search tool. Proteomics, 13, 22-4.

Epping, M. T., Meijer, L. A., Krijgsman, O., Bos, J. L., Pandolfi, P. P.,Bernards, R. (2011). TSPYL5 suppresses p53 levels and function by physical interaction with USP7. Nature cell biology, 13, 102-8.

Everett, R. D., Boutell, C.,Orr, A. (2004). Phenotype of a herpes simplex virus type 1 mutant that fails to express immediate-early regulatory protein ICP0. Journal of virology, 78, 1763-74.

Everett, R. D., Freemont, P., Saitoh, H., Dasso, M., Orr, A., Kathoria, M.,Parkinson, J. (1998). The disruption of ND10 during herpes simplex virus infection correlates with the Vmw110- and proteasome-dependent loss of several PML isoforms. Journal of virology, 72, 6581-91.

Everett, R. D., Meredith, M.,Orr, A. (1999). The ability of herpes simplex virus type 1 immediate-early protein Vmw110 to bind to a ubiquitin-specific protease contributes to its roles in the activation of gene expression and stimulation of virus replication. Journal of virology, 73, 417-26.

Everett, R. D., Meredith, M., Orr, A., Cross, A., Kathoria, M.,Parkinson, J. (1997). A novel ubiquitin-specific protease is dynamically associated with the PML nuclear domain and binds to a herpesvirus regulatory protein. The EMBO journal, 16, 1519-30.

Faesen, A. C., Dirac, A. M., Shanmugham, A., Ovaa, H., Perrakis, A.,Sixma, T. K. (2011). Mechanism of USP7/HAUSP activation by its C-terminal ubiquitin-like domain and allosteric regulation by GMP-synthetase. Molecular cell, 44, 147-59.

111 Faustrup, H., Bekker-Jensen, S., Bartek, J., Lukas, J.,Mailand, N. (2009). USP7 counteracts SCFbetaTrCP- but not APCCdh1-mediated proteolysis of Claspin. The Journal of cell biology, 184, 13-9.

Felle, M., Joppien, S., Nemeth, A., Diermeier, S., Thalhammer, V., Dobner, T., Kremmer, E., Kappler, R.,Langst, G. (2011). The USP7/Dnmt1 complex stimulates the DNA methylation activity of Dnmt1 and regulates the stability of UHRF1. Nucleic acids research, 39, 8355-65.

Feng, Z., Li, H., Liu, S., Cheng, J., Xiang, G.,Zhang, J. (2013). FAM172A induces S phase arrest of HepG2 cells via Notch 3. Oncology reports, 29, 1154-60.

Fernandez-Montalvan, A., Bouwmeester, T., Joberty, G., Mader, R., Mahnke, M., Pierrat, B., Schlaeppi, J. M., Worpenberg, S.,Gerhartz, B. (2007). Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization. The FEBS journal, 274, 4256-70.

Fleming, A. B., Kao, C. F., Hillyer, C., Pikaart, M.,Osley, M. A. (2008). H2B ubiquitylation plays a role in nucleosome dynamics during transcription elongation. Molecular cell, 31, 57-66.

Fradet-Turcotte, A., Canny, M. D., Escribano-Diaz, C., Orthwein, A., Leung, C. C., Huang, H., Landry, M. C., Kitevski-Leblanc, J., Noordermeer, S. M., Sicheri, F.,Durocher, D. (2013). 53BP1 is a reader of the DNA-damage-induced H2A Lys 15 ubiquitin mark. Nature, 499, 50-4.

Frappier, L.,Verrijzer, C. P. (2011). Gene expression control by protein deubiquitinases. Current opinion in genetics & development, 21, 207-13.

Frum, R. A., Singh, S., Vaughan, C., Mukhopadhyay, N. D., Grossman, S. R., Windle, B., Deb, S.,Deb, S. P. (2014). The human oncoprotein MDM2 induces replication stress eliciting early intra-S-phase checkpoint response and inhibition of DNA replication origin firing. Nucleic acids research, 42, 926-40.

Galisson, F., Mahrouche, L., Courcelles, M., Bonneil, E., Meloche, S., Chelbi-Alix, M. K.,Thibault, P. (2011). A novel proteomics approach to identify SUMOylated proteins and their modification sites in human cells. Molecular & cellular proteomics : MCP, 10, M110 004796.

Gatti, M., Pinato, S., Maiolica, A., Rocchio, F., Prato, M. G., Aebersold, R.,Penengo, L. (2015). RNF168 promotes noncanonical K27 ubiquitination to signal DNA damage. Cell reports, 10, 226-38.

Gavory, G., O'dowd, C. R., Helm, M. D., Flasz, J., Arkoudis, E., Dossang, A., Hughes, C., Cassidy, E., Mcclelland, K., Odrzywol, E., Page, N., Barker, O., Miel, H.,Harrison, T. (2018). Discovery and characterization of highly potent and selective allosteric USP7 inhibitors. Nature chemical biology, 14, 118-125.

Georges, A. A., Coyaud, E., Marcon, E., Greenblatt, J., Raught, B., and Frappier, L. (2018). USP7 Regulates Cytokinesis through FBXO38 and KIF20B. J Cell Sci (submitted).

112 Georges, A. A.,Frappier, L. (2015a). Proteomics methods for discovering viral-host interactions. Methods, 90, 21-7.

Georges, A. A.,Frappier, L. (2015b). Proteomics methods for discovering viral-host interactions. Methods, 90, 21-27.

Gillen, J., Li, W., Liang, Q., Avey, D., Wu, J., Wu, F., Myoung, J.,Zhu, F. (2015). A survey of the interactome of Kaposi's sarcoma-associated herpesvirus ORF45 revealed its binding to viral ORF33 and cellular USP7, resulting in stabilization of ORF33 that is required for production of progeny viruses. Journal of virology, 89, 4918-31.

Giovinazzi, S., Morozov, V. M., Summers, M. K., Reinhold, W. C.,Ishov, A. M. (2013). USP7 and Daxx regulate mitosis progression and taxane sensitivity by affecting stability of Aurora-A kinase. Cell death and differentiation, 20, 721-31.

Giovinazzi, S., Sirleto, P., Aksenova, V., Morozov, V. M., Zori, R., Reinhold, W. C.,Ishov, A. M. (2014). Usp7 protects genomic stability by regulating Bub3. Oncotarget, 5, 3728-42.

Glickman, M. H.,Ciechanover, A. (2002). The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiological reviews, 82, 373-428.

Glotzer, M. (2009). The 3Ms of central spindle assembly: microtubules, motors and MAPs. Nature reviews. Molecular cell biology, 10, 9-20.

Green, R. A., Paluch, E.,Oegema, K. (2012). Cytokinesis in animal cells. Annual review of cell and developmental biology, 28, 29-58.

Grummt, I. (2003). Life on a planet of its own: regulation of RNA polymerase I transcription in the nucleolus. Genes & development, 17, 1691-702.

Gudipaty, S. A.,D'orso, I. (2016). Functional interplay between PPM1G and the transcription elongation machinery. RNA & disease, 3.

Gudipaty, S. A., Mcnamara, R. P., Morton, E. L.,D'orso, I. (2015). PPM1G Binds 7SK RNA and Hexim1 To Block P-TEFb Assembly into the 7SK snRNP and Sustain Transcription Elongation. Molecular and cellular biology, 35, 3810-28.

Haglund, K., Di Fiore, P. P.,Dikic, I. (2003). Distinct monoubiquitin signals in receptor endocytosis. Trends in biochemical sciences, 28, 598-603.

Hall, J. A., Tabata, M., Rodgers, J. T.,Puigserver, P. (2014). USP7 attenuates hepatic gluconeogenesis through modulation of FoxO1 gene promoter occupancy. Molecular endocrinology, 28, 912-24.

Hanpude, P., Bhattacharya, S., Dey, A. K.,Maiti, T. K. (2015). Deubiquitinating enzymes in cellular signaling and disease regulation. IUBMB life, 67, 544-55.

113 Hao, Y. H., Fountain, M. D., Jr., Fon Tacer, K., Xia, F., Bi, W., Kang, S. H., Patel, A., Rosenfeld, J. A., Le Caignec, C., Isidor, B., Krantz, I. D., Noon, S. E., Pfotenhauer, J. P., Morgan, T. M., Moran, R., Pedersen, R. C., Saenz, M. S., Schaaf, C. P.,Potts, P. R. (2015). USP7 Acts as a Molecular Rheostat to Promote WASH-Dependent Endosomal Protein Recycling and Is Mutated in a Human Neurodevelopmental Disorder. Molecular cell, 59, 956-69.

Harper, S., Gratton, H. E., Cornaciu, I., Oberer, M., Scott, D. J., Emsley, J.,Dreveny, I. (2014). Structure and catalytic regulatory function of ubiquitin specific protease 11 N-terminal and ubiquitin-like domains. Biochemistry, 53, 2966-78.

He, J., Zhu, Q., Wani, G., Sharma, N., Han, C., Qian, J., Pentz, K., Wang, Q. E.,Wani, A. A. (2014). Ubiquitin-specific protease 7 regulates nucleotide excision repair through deubiquitinating XPC protein and preventing XPC protein from undergoing ultraviolet light- induced and VCP/p97 protein-regulated proteolysis. The Journal of biological chemistry, 289, 27278-89.

Hendriks, I. A., D'souza, R. C., Yang, B., Verlaan-De Vries, M., Mann, M.,Vertegaal, A. C. (2014). Uncovering global SUMOylation signaling networks in a site-specific manner. Nature structural & molecular biology, 21, 927-36.

Henras, A. K., Plisson-Chastang, C., O'donohue, M. F., Chakraborty, A.,Gleizes, P. E. (2015). An overview of pre-ribosomal RNA processing in eukaryotes. Wiley interdisciplinary reviews. RNA, 6, 225-42.

Herceg, Z., Hulla, W., Gell, D., Cuenin, C., Lleonart, M., Jackson, S.,Wang, Z. Q. (2001). Disruption of Trrap causes early embryonic lethality and defects in cell cycle progression. Nature genetics, 29, 206-11.

Hernandez-Perez, S., Cabrera, E., Salido, E., Lim, M., Reid, L., Lakhani, S. R., Khanna, K. K., Saunus, J. M.,Freire, R. (2017). DUB3 and USP7 de-ubiquitinating enzymes control replication inhibitor Geminin: molecular characterization and associations with breast cancer. Oncogene, 36, 4817.

Hershko, A.,Ciechanover, A. (1998). The ubiquitin system. Annual review of biochemistry, 67, 425-79.

Hershko, A., Heller, H., Elias, S.,Ciechanover, A. (1983). Components of ubiquitin-protein ligase system. Resolution, affinity purification, and role in protein breakdown. The Journal of biological chemistry, 258, 8206-14.

Hicke, L. (2001). Protein regulation by monoubiquitin. Nature reviews. Molecular cell biology, 2, 195-201.

Hicke, L.,Dunn, R. (2003). Regulation of membrane protein transport by ubiquitin and ubiquitin- binding proteins. Annual review of cell and developmental biology, 19, 141-72.

Higa, M., Zhang, X., Tanaka, K.,Saijo, M. (2016). Stabilization of Ultraviolet (UV)-stimulated Scaffold Protein A by Interaction with Ubiquitin-specific Peptidase 7 Is Essential for

114 Transcription-coupled Nucleotide Excision Repair. The Journal of biological chemistry, 291, 13771-9.

Hoar, K., Chakravarty, A., Rabino, C., Wysong, D., Bowman, D., Roy, N.,Ecsedy, J. A. (2007). MLN8054, a small-molecule inhibitor of Aurora A, causes spindle pole and chromosome congression defects leading to aneuploidy. Molecular and cellular biology, 27, 4513-25.

Holowaty, M. N., Sheng, Y., Nguyen, T., Arrowsmith, C.,Frappier, L. (2003a). Protein interaction domains of the ubiquitin-specific protease, USP7/HAUSP. The Journal of biological chemistry, 278, 47753-61.

Holowaty, M. N., Zeghouf, M., Wu, H., Tellam, J., Athanasopoulos, V., Greenblatt, J.,Frappier, L. (2003b). Protein profiling with Epstein-Barr nuclear antigen-1 reveals an interaction with the herpesvirus-associated ubiquitin-specific protease HAUSP/USP7. The Journal of biological chemistry, 278, 29987-94.

Holowaty, M. N., Zeghouf, M., Wu, H., Tellam, J., Athanasopoulos, V., Greenblatt, J.,Frappier, L. (2003c). Protein profiling with Epstein-Barr nuclear antigen-1 reveals an interaction with the herpesvirus-associated ubiquitin-specific protease HAUSP/USP7. J Biol Chem, 278, 29987-94.

Hu, M., Gu, L., Li, M., Jeffrey, P. D., Gu, W.,Shi, Y. (2006). Structural basis of competitive recognition of p53 and MDM2 by HAUSP/USP7: implications for the regulation of the p53- MDM2 pathway. PLoS biology, 4, e27.

Hu, M., Li, P., Li, M., Li, W., Yao, T., Wu, J. W., Gu, W., Cohen, R. E.,Shi, Y. (2002). Crystal structure of a UBP-family deubiquitinating enzyme in isolation and in complex with ubiquitin aldehyde. Cell, 111, 1041-54.

Huang, L., Kinnucan, E., Wang, G., Beaudenon, S., Howley, P. M., Huibregtse, J. M.,Pavletich, N. P. (1999). Structure of an E6AP-UbcH7 complex: insights into ubiquitination by the E2-E3 enzyme cascade. Science, 286, 1321-6.

Huang, Z., Wu, Q., Guryanova, O. A., Cheng, L., Shou, W., Rich, J. N.,Bao, S. (2011). Deubiquitylase HAUSP stabilizes REST and promotes maintenance of neural progenitor cells. Nature cell biology, 13, 142-52.

Hussain, S., Zhang, Y.,Galardy, P. J. (2009). DUBs and cancer: the role of deubiquitinating enzymes as oncogenes, non-oncogenes and tumor suppressors. Cell cycle, 8, 1688-97.

Ichim, G., Mola, M., Finkbeiner, M. G., Cros, M. P., Herceg, Z.,Hernandez-Vargas, H. (2014). The histone acetyltransferase component TRRAP is targeted for destruction during the cell cycle. Oncogene, 33, 181-92.

Ilves, I., Petojevic, T., Pesavento, J. J.,Botchan, M. R. (2010). Activation of the MCM2-7 helicase by association with Cdc45 and GINS proteins. Molecular cell, 37, 247-58.

Ishimi, Y. (1997). A DNA helicase activity is associated with an MCM4, -6, and -7 protein complex. The Journal of biological chemistry, 272, 24508-13.

115

Jagannathan, M., Nguyen, T., Gallo, D., Luthra, N., Brown, G. W., Saridakis, V.,Frappier, L. (2014). A role for USP7 in DNA replication. Molecular and cellular biology, 34, 132-45.

Jager, W., Santag, S., Weidner-Glunde, M., Gellermann, E., Kati, S., Pietrek, M., Viejo- Borbolla, A.,Schulz, T. F. (2012a). The ubiquitin-specific protease USP7 modulates the replication of Kaposi's sarcoma-associated herpesvirus latent episomal DNA. J Virol, 86, 6745- 57.

Jager, W., Santag, S., Weidner-Glunde, M., Gellermann, E., Kati, S., Pietrek, M., Viejo- Borbolla, A.,Schulz, T. F. (2012b). The ubiquitin-specific protease USP7 modulates the replication of Kaposi's sarcoma-associated herpesvirus latent episomal DNA. Journal of virology, 86, 6745-57.

Janisch, K. M., Mcneely, K. C., Dardick, J. M., Lim, S. H.,Dwyer, N. D. (2018). Kinesin-6 KIF20B is required for efficient cytokinetic furrowing and timely abscission in human cells. Molecular biology of the cell, 29, 166-179.

Janisch, K. M., Vock, V. M., Fleming, M. S., Shrestha, A., Grimsley-Myers, C. M., Rasoul, B. A., Neale, S. A., Cupp, T. D., Kinchen, J. M., Liem, K. F., Jr.,Dwyer, N. D. (2013). The vertebrate-specific Kinesin-6, Kif20b, is required for normal cytokinesis of polarized cortical stem cells and cerebral cortex size. Development, 140, 4672-82.

Jenkins, Y., Markovtsov, V., Lang, W., Sharma, P., Pearsall, D., Warner, J., Franci, C., Huang, B., Huang, J., Yam, G. C., Vistan, J. P., Pali, E., Vialard, J., Janicot, M., Lorens, J. B., Payan, D. G.,Hitoshi, Y. (2005). Critical role of the ubiquitin ligase activity of UHRF1, a nuclear RING finger protein, in tumor cell growth. Molecular biology of the cell, 16, 5621-9.

Jensen, V. L., Li, C., Bowie, R. V., Clarke, L., Mohan, S., Blacque, O. E.,Leroux, M. R. (2015). Formation of the transition zone by Mks5/Rpgrip1L establishes a ciliary zone of exclusion (CIZE) that compartmentalises ciliary signalling proteins and controls PIP2 ciliary abundance. The EMBO journal, 34, 2537-56.

Jin, J., Cardozo, T., Lovering, R. C., Elledge, S. J., Pagano, M.,Harper, J. W. (2004). Systematic analysis and nomenclature of mammalian F-box proteins. Genes & development, 18, 2573-80.

Jin, J., Xie, X., Xiao, Y., Hu, H., Zou, Q., Cheng, X.,Sun, S. C. (2016). Epigenetic regulation of the expression of Il12 and Il23 and autoimmune inflammation by the deubiquitinase Trabid. Nature immunology, 17, 259-68.

Jin, L., Williamson, A., Banerjee, S., Philipp, I.,Rape, M. (2008). Mechanism of ubiquitin-chain formation by the human anaphase-promoting complex. Cell, 133, 653-65.

Jing, B., Liu, M., Yang, L., Cai, H. Y., Chen, J. B., Li, Z. X., Kou, X., Wu, Y. Z., Qin, D. J., Zhou, L., Jin, J., Lei, H., Xu, H. Z., Wang, W. W.,Wu, Y. L. (2017). Characterization of naturally occurring pentacyclic triterpenes as novel inhibitors of deubiquitinating protease USP7 with anticancer activity in vitro. Acta pharmacologica Sinica.

116 Johnston, S. C., Larsen, C. N., Cook, W. J., Wilkinson, K. D.,Hill, C. P. (1997). Crystal structure of a deubiquitinating enzyme (human UCH-L3) at 1.8 A resolution. The EMBO journal, 16, 3787-96.

Jung, Y. S., Qian, Y.,Chen, X. (2010). Examination of the expanding pathways for the regulation of p21 expression and activity. Cellular signalling, 22, 1003-12.

Kaiser, P.,Huang, L. (2005). Global approaches to understanding ubiquitination. Genome biology, 6, 233.

Kajimura, D., Dragomir, C., Ramirez, F.,Laub, F. (2007). Identification of genes regulated by transcription factor KLF7 in differentiating olfactory sensory neurons. Gene, 388, 34-42.

Kalamvoki, M., Gu, H.,Roizman, B. (2012). Overexpression of the ubiquitin-specific protease 7 resulting from transfection or mutations in the ICP0 binding site accelerates rather than depresses herpes simplex virus 1 gene expression. Journal of virology, 86, 12871-8.

Kamimoto, T., Zama, T., Aoki, R., Muro, Y.,Hagiwara, M. (2001). Identification of a novel kinesin-related protein, KRMP1, as a target for mitotic peptidyl-prolyl isomerase Pin1. The Journal of biological chemistry, 276, 37520-8.

Kamura, T., Koepp, D. M., Conrad, M. N., Skowyra, D., Moreland, R. J., Iliopoulos, O., Lane, W. S., Kaelin, W. G., Jr., Elledge, S. J., Conaway, R. C., Harper, J. W.,Conaway, J. W. (1999). Rbx1, a component of the VHL tumor suppressor complex and SCF ubiquitin ligase. Science, 284, 657-61.

Kane, L. A., Lazarou, M., Fogel, A. I., Li, Y., Yamano, K., Sarraf, S. A., Banerjee, S.,Youle, R. J. (2014). PINK1 phosphorylates ubiquitin to activate Parkin E3 ubiquitin ligase activity. The Journal of cell biology, 205, 143-53.

Kanehira, M., Katagiri, T., Shimo, A., Takata, R., Shuin, T., Miki, T., Fujioka, T.,Nakamura, Y. (2007). Oncogenic role of MPHOSPH1, a cancer-testis antigen specific to human bladder cancer. Cancer research, 67, 3276-85.

Karimian, A., Ahmadi, Y.,Yousefi, B. (2016). Multiple functions of p21 in cell cycle, apoptosis and transcriptional regulation after DNA damage. DNA repair, 42, 63-71.

Kategaya, L., Di Lello, P., Rouge, L., Pastor, R., Clark, K. R., Drummond, J., Kleinheinz, T., Lin, E., Upton, J. P., Prakash, S., Heideker, J., Mccleland, M., Ritorto, M. S., Alessi, D. R., Trost, M., Bainbridge, T. W., Kwok, M. C. M., Ma, T. P., Stiffler, Z., Brasher, B., Tang, Y., Jaishankar, P., Hearn, B. R., Renslo, A. R., Arkin, M. R., Cohen, F., Yu, K., Peale, F., Gnad, F., Chang, M. T., Klijn, C., Blackwood, E., Martin, S. E., Forrest, W. F., Ernst, J. A., Ndubaku, C., Wang, X., Beresini, M. H., Tsui, V., Schwerdtfeger, C., Blake, R. A., Murray, J., Maurer, T.,Wertz, I. E. (2017). USP7 small-molecule inhibitors interfere with ubiquitin binding. Nature, 550, 534-538.

117 Kazlauskaite, A., Kondapalli, C., Gourlay, R., Campbell, D. G., Ritorto, M. S., Hofmann, K., Alessi, D. R., Knebel, A., Trost, M.,Muqit, M. M. (2014). Parkin is activated by PINK1- dependent phosphorylation of ubiquitin at Ser65. The Biochemical journal, 460, 127-39.

Kessner, D., Chambers, M., Burke, R., Agus, D.,Mallick, P. (2008). ProteoWizard: open source software for rapid proteomics tools development. Bioinformatics, 24, 2534-6.

Khoronenkova, S. V., Dianova, Ii, Parsons, J. L.,Dianov, G. L. (2011). USP7/HAUSP stimulates repair of oxidative DNA lesions. Nucleic acids research, 39, 2604-9.

Khoronenkova, S. V., Dianova, Ii, Ternette, N., Kessler, B. M., Parsons, J. L.,Dianov, G. L. (2012). ATM-dependent downregulation of USP7/HAUSP by PPM1G activates p53 response to DNA damage. Molecular cell, 45, 801-13.

Kim, P. K., Hailey, D. W., Mullen, R. T.,Lippincott-Schwartz, J. (2008). Ubiquitin signals autophagic degradation of cytosolic proteins and peroxisomes. Proceedings of the National Academy of Sciences of the United States of America, 105, 20567-74.

Kim, R. Q.,Sixma, T. K. (2017). Regulation of USP7: A High Incidence of E3 Complexes. Journal of molecular biology, 429, 3395-3408.

Kim, R. Q., Van Dijk, W. J.,Sixma, T. K. (2016). Structure of USP7 catalytic domain and three Ubl-domains reveals a connector alpha-helix with regulatory role. Journal of structural biology, 195, 11-8.

Klein, C.,Vassilev, L. T. (2004). Targeting the p53-MDM2 interaction to treat cancer. British journal of cancer, 91, 1415-9.

Ko, L. J.,Prives, C. (1996). p53: puzzle and paradigm. Genes & development, 10, 1054-72.

Kobe, B.,Kajava, A. V. (2001). The leucine-rich repeat as a protein recognition motif. Current opinion in structural biology, 11, 725-32.

Komander, D., Clague, M. J.,Urbe, S. (2009a). Breaking the chains: structure and function of the deubiquitinases. Nature reviews. Molecular cell biology, 10, 550-63.

Komander, D., Reyes-Turcu, F., Licchesi, J. D., Odenwaelder, P., Wilkinson, K. D.,Barford, D. (2009b). Molecular discrimination of structurally equivalent Lys 63-linked and linear polyubiquitin chains. EMBO reports, 10, 466-73.

Koyano, F., Okatsu, K., Kosako, H., Tamura, Y., Go, E., Kimura, M., Kimura, Y., Tsuchiya, H., Yoshihara, H., Hirokawa, T., Endo, T., Fon, E. A., Trempe, J. F., Saeki, Y., Tanaka, K.,Matsuda, N. (2014). Ubiquitin is phosphorylated by PINK1 to activate parkin. Nature, 510, 162-6.

Laman, H., Funes, J. M., Ye, H., Henderson, S., Galinanes-Garcia, L., Hara, E., Knowles, P., Mcdonald, N.,Boshoff, C. (2005). Transforming activity of Fbxo7 is mediated specifically through regulation of cyclin D/cdk6. The EMBO journal, 24, 3104-16.

118 Lamberto, I., Liu, X., Seo, H. S., Schauer, N. J., Iacob, R. E., Hu, W., Das, D., Mikhailova, T., Weisberg, E. L., Engen, J. R., Anderson, K. C., Chauhan, D., Dhe-Paganon, S.,Buhrlage, S. J. (2017). Structure-Guided Development of a Potent and Selective Non-covalent Active-Site Inhibitor of USP7. Cell chemical biology, 24, 1490-1500 e11.

Lamoliatte, F., Bonneil, E., Durette, C., Caron-Lizotte, O., Wildemann, D., Zerweck, J., Wenshuk, H.,Thibault, P. (2013). Targeted identification of SUMOylation sites in human proteins using affinity enrichment and paralog-specific reporter ions. Molecular & cellular proteomics : MCP, 12, 2536-50.

Lanfranca, M. P., Mostafa, H. H.,Davido, D. J. (2014). HSV-1 ICP0: An E3 Ubiquitin Ligase That Counteracts Host Intrinsic and Innate Immunity. Cells, 3, 438-54.

Laub, F., Lei, L., Sumiyoshi, H., Kajimura, D., Dragomir, C., Smaldone, S., Puche, A. C., Petros, T. J., Mason, C., Parada, L. F.,Ramirez, F. (2005). Transcription factor KLF7 is important for neuronal morphogenesis in selected regions of the nervous system. Molecular and cellular biology, 25, 5699-711.

Lecona, E., Narendra, V.,Reinberg, D. (2015). USP7 cooperates with SCML2 to regulate the activity of PRC1. Molecular and cellular biology, 35, 1157-68.

Lecona, E., Rodriguez-Acebes, S., Specks, J., Lopez-Contreras, A. J., Ruppen, I., Murga, M., Munoz, J., Mendez, J.,Fernandez-Capetillo, O. (2016). USP7 is a SUMO deubiquitinase essential for DNA replication. Nature structural & molecular biology, 23, 270-7.

Lee, H. J., Kim, M. S., Kim, Y. K., Oh, Y. K.,Baek, K. H. (2005). HAUSP, a deubiquitinating enzyme for p53, is polyubiquitinated, polyneddylated, and dimerized. FEBS letters, 579, 4867- 72.

Lee, H. R., Choi, W. C., Lee, S., Hwang, J., Hwang, E., Guchhait, K., Haas, J., Toth, Z., Jeon, Y. H., Oh, T. K., Kim, M. H.,Jung, J. U. (2011a). Bilateral inhibition of HAUSP deubiquitinase by a viral interferon regulatory factor protein. Nature structural & molecular biology, 18, 1336-44.

Lee, H. R., Choi, W. C., Lee, S., Hwang, J., Hwang, E., Guchhait, K., Haas, J., Toth, Z., Jeon, Y. H., Oh, T. K., Kim, M. H.,Jung, J. U. (2011b). Bilateral inhibition of HAUSP deubiquitinase by a viral interferon regulatory factor protein. Nat Struct Mol Biol, 18, 1336-44.

Lee, J. C., Schickling, O., Stegh, A. H., Oshima, R. G., Dinsdale, D., Cohen, G. M.,Peter, M. E. (2002). DEDD regulates degradation of intermediate filaments during apoptosis. The Journal of cell biology, 158, 1051-66.

Levine, A. J. (1997). p53, the cellular gatekeeper for growth and division. Cell, 88, 323-31.

Li, C., Jensen, V. L., Park, K., Kennedy, J., Garcia-Gonzalo, F. R., Romani, M., De Mori, R., Bruel, A. L., Gaillard, D., Doray, B., Lopez, E., Riviere, J. B., Faivre, L., Thauvin-Robinet, C., Reiter, J. F., Blacque, O. E., Valente, E. M.,Leroux, M. R. (2016a). MKS5 and CEP290 Dependent Assembly Pathway of the Ciliary Transition Zone. PLoS biology, 14, e1002416.

119 Li, H., Cuenin, C., Murr, R., Wang, Z. Q.,Herceg, Z. (2004a). HAT cofactor Trrap regulates the mitotic checkpoint by modulation of Mad1 and Mad2 expression. The EMBO journal, 23, 4824- 34.

Li, M., Brooks, C. L., Kon, N.,Gu, W. (2004b). A dynamic role of HAUSP in the p53-Mdm2 pathway. Molecular cell, 13, 879-86.

Li, M., Brooks, C. L., Wu-Baer, F., Chen, D., Baer, R.,Gu, W. (2003). Mono- versus polyubiquitination: differential control of p53 fate by Mdm2. Science, 302, 1972-5.

Li, M., Chen, D., Shiloh, A., Luo, J., Nikolaev, A. Y., Qin, J.,Gu, W. (2002). Deubiquitination of p53 by HAUSP is an important pathway for p53 stabilization. Nature, 416, 648-53.

Li, M. F., Zhang, R., Guo, M. G., Li, L. X., Lu, H. K., Lu, J. X.,Jia, W. P. (2016b). FAM172A protein promotes the proliferation of human papillary thyroid carcinoma cells via the p38 mitogen-activated protein kinase pathway. Molecular medicine reports, 13, 353-8.

Li, W., Bengtson, M. H., Ulbrich, A., Matsuda, A., Reddy, V. A., Orth, A., Chanda, S. K., Batalov, S.,Joazeiro, C. A. (2008). Genome-wide and functional annotation of human E3 ubiquitin ligases identifies MULAN, a mitochondrial E3 that regulates the organelle's dynamics and signaling. PloS one, 3, e1487.

Lim, K. H., Suresh, B., Park, J. H., Kim, Y. S., Ramakrishna, S.,Baek, K. H. (2016). Ubiquitin- specific protease 11 functions as a tumor suppressor by modulating Mgl-1 protein to regulate cancer cell growth. Oncotarget, 7, 14441-57.

Liu, J., Chung, H. J., Vogt, M., Jin, Y., Malide, D., He, L., Dundr, M.,Levens, D. (2011). JTV1 co-activates FBP to induce USP29 transcription and stabilize p53 in response to oxidative stress. The EMBO journal, 30, 846-58.

Liu, J., Stevens, P. D., Eshleman, N. E.,Gao, T. (2013). Protein phosphatase PPM1G regulates protein translation and cell growth by dephosphorylating 4E binding protein 1 (4E-BP1). The Journal of biological chemistry, 288, 23225-33.

Liu, S. T.,Zhang, H. (2016). The mitotic checkpoint complex (MCC): looking back and forth after 15 years. AIMS molecular science, 3, 597-634.

Liu, W., Wang, S., Qian, K., Zhang, J., Zhang, Z.,Liu, H. (2017). Expression of family with sequence similarity 172 member A and nucleotide-binding protein 1 is associated with the poor prognosis of colorectal carcinoma. Oncology letters, 14, 3587-3593.

Liu, X., Yang, X., Li, Y., Zhao, S., Li, C., Ma, P.,Mao, B. (2016). Trip12 is an E3 ubiquitin ligase for USP7/HAUSP involved in the DNA damage response. FEBS letters, 590, 4213-4222.

Liu, X., Zhou, Y., Peng, A., Gong, H., Huang, L., Ji, K., Petersen, R. B., Zheng, L.,Huang, K. (2014). MPHOSPH1: a potential therapeutic target for hepatocellular carcinoma. Cancer research, 74, 6623-34.

120 Livneh, I., Kravtsova-Ivantsiv, Y., Braten, O., Kwon, Y. T.,Ciechanover, A. (2017). Monoubiquitination joins polyubiquitination as an esteemed proteasomal targeting signal. BioEssays : news and reviews in molecular, cellular and developmental biology, 39.

Lopez-Contreras, A. J., Ruppen, I., Nieto-Soler, M., Murga, M., Rodriguez-Acebes, S., Remeseiro, S., Rodrigo-Perez, S., Rojas, A. M., Mendez, J., Munoz, J.,Fernandez-Capetillo, O. (2013). A proteomic characterization of factors enriched at nascent DNA molecules. Cell reports, 3, 1105-16.

Luo, J., Lu, Z., Lu, X., Chen, L., Cao, J., Zhang, S., Ling, Y.,Zhou, X. (2013). OTUD5 regulates p53 stability by deubiquitinating p53. PloS one, 8, e77682.

Luo, M., Zhou, J., Leu, N. A., Abreu, C. M., Wang, J., Anguera, M. C., De Rooij, D. G., Jasin, M.,Wang, P. J. (2015). Polycomb protein SCML2 associates with USP7 and counteracts histone H2A ubiquitination in the XY chromatin during male meiosis. PLoS genetics, 11, e1004954.

Ma, H., Chen, H., Guo, X., Wang, Z., Sowa, M. E., Zheng, L., Hu, S., Zeng, P., Guo, R., Diao, J., Lan, F., Harper, J. W., Shi, Y. G., Xu, Y.,Shi, Y. (2012). M phase phosphorylation of the epigenetic regulator UHRF1 regulates its physical association with the deubiquitylase USP7 and stability. Proceedings of the National Academy of Sciences of the United States of America, 109, 4828-33.

Ma, J., Martin, J. D., Xue, Y., Lor, L. A., Kennedy-Wilson, K. M., Sinnamon, R. H., Ho, T. F., Zhang, G., Schwartz, B., Tummino, P. J.,Lai, Z. (2010). C-terminal region of USP7/HAUSP is critical for deubiquitination activity and contains a second mdm2/p53 binding site. Archives of biochemistry and biophysics, 503, 207-12.

Ma, J., Rong, L., Zhou, Y., Roy, B. B., Lu, J., Abrahamyan, L., Mouland, A. J., Pan, Q.,Liang, C. (2008). The requirement of the DEAD-box protein DDX24 for the packaging of human immunodeficiency virus type 1 RNA. Virology, 375, 253-64.

Ma, Q., Chen, Z., Jia, G., Lu, X., Xie, X.,Jin, W. (2015). The histone demethylase PHF8 promotes prostate cancer cell growth by activating the oncomiR miR-125b. OncoTargets and therapy, 8, 1979-88.

Ma, Z., Moore, R., Xu, X.,Barber, G. N. (2013). DDX24 negatively regulates cytosolic RNA- mediated innate immune signaling. PLoS pathogens, 9, e1003721.

Maertens, G. N., El Messaoudi-Aubert, S., Elderkin, S., Hiom, K.,Peters, G. (2010). Ubiquitin- specific proteases 7 and 11 modulate Polycomb regulation of the INK4a tumour suppressor. The EMBO journal, 29, 2553-65.

Mailand, N., Falck, J., Lukas, C., Syljuasen, R. G., Welcker, M., Bartek, J.,Lukas, J. (2000). Rapid destruction of human Cdc25A in response to DNA damage. Science, 288, 1425-9.

Marchenko, N. D., Wolff, S., Erster, S., Becker, K.,Moll, U. M. (2007). Monoubiquitylation promotes mitochondrial p53 translocation. The EMBO journal, 26, 923-34.

121 Martin, Y., Cabrera, E., Amoedo, H., Hernandez-Perez, S., Dominguez-Kelly, R.,Freire, R. (2015). USP29 controls the stability of checkpoint adaptor Claspin by deubiquitination. Oncogene, 34, 1058-63.

Marumoto, T., Honda, S., Hara, T., Nitta, M., Hirota, T., Kohmura, E.,Saya, H. (2003). Aurora-A kinase maintains the fidelity of early and late mitotic events in HeLa cells. The Journal of biological chemistry, 278, 51786-95.

Masuya, D., Huang, C., Liu, D., Nakashima, T., Yokomise, H., Ueno, M., Nakashima, N.,Sumitomo, S. (2006). The HAUSP gene plays an important role in non-small cell lung carcinogenesis through p53-dependent pathways. The Journal of pathology, 208, 724-32.

Mccullough, J., Colf, L. A.,Sundquist, W. I. (2013). Membrane fission reactions of the mammalian ESCRT pathway. Annual review of biochemistry, 82, 663-92.

Mcmahon, S. B., Van Buskirk, H. A., Dugan, K. A., Copeland, T. D.,Cole, M. D. (1998). The novel ATM-related protein TRRAP is an essential cofactor for the c-Myc and E2F oncoproteins. Cell, 94, 363-74.

Mcmahon, S. B., Wood, M. A.,Cole, M. D. (2000). The essential cofactor TRRAP recruits the histone acetyltransferase hGCN5 to c-Myc. Molecular and cellular biology, 20, 556-62.

Mellacheruvu, D., Wright, Z., Couzens, A. L., Lambert, J. P., St-Denis, N. A., Li, T., Miteva, Y. V., Hauri, S., Sardiu, M. E., Low, T. Y., Halim, V. A., Bagshaw, R. D., Hubner, N. C., Al- Hakim, A., Bouchard, A., Faubert, D., Fermin, D., Dunham, W. H., Goudreault, M., Lin, Z. Y., Badillo, B. G., Pawson, T., Durocher, D., Coulombe, B., Aebersold, R., Superti-Furga, G., Colinge, J., Heck, A. J., Choi, H., Gstaiger, M., Mohammed, S., Cristea, I. M., Bennett, K. L., Washburn, M. P., Raught, B., Ewing, R. M., Gingras, A. C.,Nesvizhskii, A. I. (2013). The CRAPome: a contaminant repository for affinity purification-mass spectrometry data. Nature methods, 10, 730-6.

Meredith, M., Orr, A., Elliott, M.,Everett, R. (1995). Separation of sequence requirements for HSV-1 Vmw110 multimerisation and interaction with a 135-kDa cellular protein. Virology, 209, 174-87.

Meredith, M., Orr, A.,Everett, R. (1994). Herpes simplex virus type 1 immediate-early protein Vmw110 binds strongly and specifically to a 135-kDa cellular protein. Virology, 200, 457-69.

Merolla, F., Luise, C., Muller, M. T., Pacelli, R., Fusco, A.,Celetti, A. (2012). Loss of CCDC6, the first identified RET partner gene, affects pH2AX S139 levels and accelerates mitotic entry upon DNA damage. PloS one, 7, e36177.

Meulmeester, E., Maurice, M. M., Boutell, C., Teunisse, A. F., Ovaa, H., Abraham, T. E., Dirks, R. W.,Jochemsen, A. G. (2005a). Loss of HAUSP-mediated deubiquitination contributes to DNA damage-induced destabilization of Hdmx and Hdm2. Molecular cell, 18, 565-76.

122 Meulmeester, E., Pereg, Y., Shiloh, Y.,Jochemsen, A. G. (2005b). ATM-mediated phosphorylations inhibit Mdmx/Mdm2 stabilization by HAUSP in favor of p53 activation. Cell cycle, 4, 1166-70.

Meyer, H. J.,Rape, M. (2014). Enhanced protein degradation by branched ubiquitin chains. Cell, 157, 910-21.

Meziane El, K., Randle, S. J., Nelson, D. E., Lomonosov, M.,Laman, H. (2011). Knockdown of Fbxo7 reveals its regulatory role in proliferation and differentiation of haematopoietic precursor cells. Journal of cell science, 124, 2175-86.

Miller, A. L. (2011). The contractile ring. Current biology : CB, 21, R976-8.

Minsky, N., Shema, E., Field, Y., Schuster, M., Segal, E.,Oren, M. (2008). Monoubiquitinated H2B is associated with the transcribed region of highly expressed genes in human cells. Nature cell biology, 10, 483-8.

Morra, F., Luise, C., Merolla, F., Poser, I., Visconti, R., Ilardi, G., Paladino, S., Inuzuka, H., Guggino, G., Monaco, R., Colecchia, D., Monaco, G., Cerrato, A., Chiariello, M., Denning, K., Claudio, P. P., Staibano, S.,Celetti, A. (2015). FBXW7 and USP7 regulate CCDC6 turnover during the cell cycle and affect cancer drugs susceptibility in NSCLC. Oncotarget, 6, 12697-709.

Mousli, M., Hopfner, R., Abbady, A. Q., Monte, D., Jeanblanc, M., Oudet, P., Louis, B.,Bronner, C. (2003). ICBP90 belongs to a new family of proteins with an expression that is deregulated in cancer cells. British journal of cancer, 89, 120-7.

Moyal, L., Lerenthal, Y., Gana-Weisz, M., Mass, G., So, S., Wang, S. Y., Eppink, B., Chung, Y. M., Shalev, G., Shema, E., Shkedy, D., Smorodinsky, N. I., Van Vliet, N., Kuster, B., Mann, M., Ciechanover, A., Dahm-Daphi, J., Kanaar, R., Hu, M. C., Chen, D. J., Oren, M.,Shiloh, Y. (2011). Requirement of ATM-dependent monoubiquitylation of histone H2B for timely repair of DNA double-strand breaks. Molecular cell, 41, 529-42.

Murr, R., Loizou, J. I., Yang, Y. G., Cuenin, C., Li, H., Wang, Z. Q.,Herceg, Z. (2006). Histone acetylation by Trrap-Tip60 modulates loading of repair proteins and repair of DNA double- strand breaks. Nature cell biology, 8, 91-9.

Musacchio, A. (2015). The Molecular Biology of Spindle Assembly Checkpoint Signaling Dynamics. Current biology : CB, 25, R1002-18.

Nahse, V., Christ, L., Stenmark, H.,Campsteijn, C. (2017). The Abscission Checkpoint: Making It to the Final Cut. Trends in cell biology, 27, 1-11.

Nakada, S., Chen, G. I., Gingras, A. C.,Durocher, D. (2008). PP4 is a gamma H2AX phosphatase required for recovery from the DNA damage checkpoint. EMBO reports, 9, 1019-26.

Nakasone, M. A., Livnat-Levanon, N., Glickman, M. H., Cohen, R. E.,Fushman, D. (2013). Mixed-linkage ubiquitin chains send mixed messages. Structure, 21, 727-40.

123 Nakayama, K. I.,Nakayama, K. (2005). Regulation of the cell cycle by SCF-type ubiquitin ligases. Seminars in cell & developmental biology, 16, 323-33.

Nelson, D. E., Randle, S. J.,Laman, H. (2013). Beyond ubiquitination: the atypical functions of Fbxo7 and other F-box proteins. Open biology, 3, 130131.

Nicholson, B.,Suresh Kumar, K. G. (2011). The multifaceted roles of USP7: new therapeutic opportunities. Cell biochemistry and biophysics, 60, 61-8.

Nijman, S. M., Luna-Vargas, M. P., Velds, A., Brummelkamp, T. R., Dirac, A. M., Sixma, T. K.,Bernards, R. (2005). A genomic and functional inventory of deubiquitinating enzymes. Cell, 123, 773-86.

Oh, Y. M., Kwon, Y. E., Kim, J. M., Bae, S. J., Lee, B. K., Yoo, S. J., Chung, C. H., Deshaies, R. J.,Seol, J. H. (2009). Chfr is linked to tumour metastasis through the downregulation of HDAC1. Nature cell biology, 11, 295-302.

Oh, Y. M., Yoo, S. J.,Seol, J. H. (2007). Deubiquitination of Chfr, a checkpoint protein, by USP7/HAUSP regulates its stability and activity. Biochemical and biophysical research communications, 357, 615-9.

Ohtake, F., Saeki, Y., Ishido, S., Kanno, J.,Tanaka, K. (2016). The K48-K63 Branched Ubiquitin Chain Regulates NF-kappaB Signaling. Molecular cell, 64, 251-266.

Ohtake, F., Saeki, Y., Sakamoto, K., Ohtake, K., Nishikawa, H., Tsuchiya, H., Ohta, T., Tanaka, K.,Kanno, J. (2015). Ubiquitin acetylation inhibits polyubiquitin chain elongation. EMBO reports, 16, 192-201.

Oliver, D., Ji, H., Liu, P., Gasparian, A., Gardiner, E., Lee, S., Zenteno, A., Perinskaya, L. O., Chen, M., Buckhaults, P., Broude, E., Wyatt, M. D., Valafar, H., Pena, E.,Shtutman, M. (2017). Identification of novel cancer therapeutic targets using a designed and pooled shRNA library screen. Scientific reports, 7, 43023.

Ordureau, A., Sarraf, S. A., Duda, D. M., Heo, J. M., Jedrychowski, M. P., Sviderskiy, V. O., Olszewski, J. L., Koerber, J. T., Xie, T., Beausoleil, S. A., Wells, J. A., Gygi, S. P., Schulman, B. A.,Harper, J. W. (2014). Quantitative proteomics reveal a feedforward mechanism for mitochondrial PARKIN translocation and ubiquitin chain synthesis. Molecular cell, 56, 360-75.

Passmore, L. A.,Barford, D. (2004). Getting into position: the catalytic mechanisms of protein ubiquitylation. The Biochemical journal, 379, 513-25.

Patil, M., Pabla, N.,Dong, Z. (2013). Checkpoint kinase 1 in DNA damage response and cell cycle regulation. Cellular and molecular life sciences : CMLS, 70, 4009-21.

Pelzer, C., Kassner, I., Matentzoglu, K., Singh, R. K., Wollscheid, H. P., Scheffner, M., Schmidtke, G.,Groettrup, M. (2007). UBE1L2, a novel E1 enzyme specific for ubiquitin. The Journal of biological chemistry, 282, 23010-4.

124 Petroski, M. D.,Deshaies, R. J. (2005). Function and regulation of cullin-RING ubiquitin ligases. Nature reviews. Molecular cell biology, 6, 9-20.

Pfoh, R., Lacdao, I. K., Georges, A. A., Capar, A., Zheng, H., Frappier, L.,Saridakis, V. (2015a). Crystal Structure of USP7 Ubiquitin-like Domains with an ICP0 Peptide Reveals a Novel Mechanism Used by Viral and Cellular Proteins to Target USP7. PLoS pathogens, 11, e1004950.

Pfoh, R., Lacdao, I. K.,Saridakis, V. (2015b). Deubiquitinases and the new therapeutic opportunities offered to cancer. Endocrine-related cancer, 22, T35-54.

Pickart, C. M.,Eddins, M. J. (2004). Ubiquitin: structures, functions, mechanisms. Biochimica et biophysica acta, 1695, 55-72.

Plechanovova, A., Jaffray, E. G., Tatham, M. H., Naismith, J. H.,Hay, R. T. (2012). Structure of a RING E3 ligase and ubiquitin-loaded E2 primed for catalysis. Nature, 489, 115-20.

Popov, A., Smirnov, E., Kovacik, L., Raska, O., Hagen, G., Stixova, L.,Raska, I. (2013). Duration of the first steps of the human rRNA processing. Nucleus, 4, 134-41.

Pozhidaeva, A. K., Mohni, K. N., Dhe-Paganon, S., Arrowsmith, C. H., Weller, S. K., Korzhnev, D. M.,Bezsonova, I. (2015). Structural Characterization of Interaction between Human Ubiquitin-specific Protease 7 and Immediate-Early Protein ICP0 of Herpes Simplex Virus-1. The Journal of biological chemistry, 290, 22907-18.

Pruneda, J. N., Littlefield, P. J., Soss, S. E., Nordquist, K. A., Chazin, W. J., Brzovic, P. S.,Klevit, R. E. (2012). Structure of an E3:E2~Ub complex reveals an allosteric mechanism shared among RING/U-box ligases. Molecular cell, 47, 933-42.

Qian, J., Pentz, K., Zhu, Q., Wang, Q., He, J., Srivastava, A. K.,Wani, A. A. (2015). USP7 modulates UV-induced PCNA monoubiquitination by regulating DNA polymerase eta stability. Oncogene, 34, 4791-6.

Qin, D., Wang, W., Lei, H., Luo, H., Cai, H., Tang, C., Wu, Y., Wang, Y., Jin, J., Xiao, W., Wang, T., Ma, C., Xu, H., Zhang, J., Gao, F.,Wu, Y. L. (2016). CDDO-Me reveals USP7 as a novel target in ovarian cancer cells. Oncotarget, 7, 77096-77109.

Qin, W., Leonhardt, H.,Spada, F. (2011). Usp7 and Uhrf1 control ubiquitination and stability of the maintenance DNA methyltransferase Dnmt1. Journal of cellular biochemistry, 112, 439-44.

Rahighi, S., Ikeda, F., Kawasaki, M., Akutsu, M., Suzuki, N., Kato, R., Kensche, T., Uejima, T., Bloor, S., Komander, D., Randow, F., Wakatsuki, S.,Dikic, I. (2009). Specific recognition of linear ubiquitin chains by NEMO is important for NF-kappaB activation. Cell, 136, 1098-109.

Randle, S. J.,Laman, H. (2016). F-box protein interactions with the hallmark pathways in cancer. Seminars in cancer biology, 36, 3-17.

125 Reimann, J. D., Freed, E., Hsu, J. Y., Kramer, E. R., Peters, J. M.,Jackson, P. K. (2001). Emi1 is a mitotic regulator that interacts with Cdc20 and inhibits the anaphase promoting complex. Cell, 105, 645-55.

Reverdy, C., Conrath, S., Lopez, R., Planquette, C., Atmanene, C., Collura, V., Harpon, J., Battaglia, V., Vivat, V., Sippl, W.,Colland, F. (2012). Discovery of specific inhibitors of human USP7/HAUSP deubiquitinating enzyme. Chemistry & biology, 19, 467-77.

Reyes-Turcu, F. E., Ventii, K. H.,Wilkinson, K. D. (2009). Regulation and cellular roles of ubiquitin-specific deubiquitinating enzymes. Annual review of biochemistry, 78, 363-97.

Ritorto, M. S., Ewan, R., Perez-Oliva, A. B., Knebel, A., Buhrlage, S. J., Wightman, M., Kelly, S. M., Wood, N. T., Virdee, S., Gray, N. S., Morrice, N. A., Alessi, D. R.,Trost, M. (2014). Screening of DUB activity and specificity by MALDI-TOF mass spectrometry. Nature communications, 5, 4763.

Robert, F., Hardy, S., Nagy, Z., Baldeyron, C., Murr, R., Dery, U., Masson, J. Y., Papadopoulo, D., Herceg, Z.,Tora, L. (2006). The transcriptional histone acetyltransferase cofactor TRRAP associates with the MRN repair complex and plays a role in DNA double-strand break repair. Molecular and cellular biology, 26, 402-12.

Rocak, S.,Linder, P. (2004). DEAD-box proteins: the driving forces behind RNA metabolism. Nature reviews. Molecular cell biology, 5, 232-41.

Ronai, Z. A. (2016). Monoubiquitination in proteasomal degradation. Proceedings of the National Academy of Sciences of the United States of America, 113, 8894-6.

Rotin, D.,Kumar, S. (2009). Physiological functions of the HECT family of ubiquitin ligases. Nature reviews. Molecular cell biology, 10, 398-409.

Roux, K. J., Kim, D. I., Raida, M.,Burke, B. (2012). A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells. The Journal of cell biology, 196, 801-10.

Ruchaud, S., Carmena, M.,Earnshaw, W. C. (2007). Chromosomal passengers: conducting cell division. Nature reviews. Molecular cell biology, 8, 798-812.

Sadowski, M., Suryadinata, R., Tan, A. R., Roesley, S. N.,Sarcevic, B. (2012). Protein monoubiquitination and polyubiquitination generate structural diversity to control distinct biological processes. IUBMB life, 64, 136-42.

Salsman, J., Jagannathan, M., Paladino, P., Chan, P. K., Dellaire, G., Raught, B.,Frappier, L. (2012a). Proteomic profiling of the human cytomegalovirus UL35 gene products reveals a role for UL35 in the DNA repair response. J Virol, 86, 806-20.

Salsman, J., Jagannathan, M., Paladino, P., Chan, P. K., Dellaire, G., Raught, B.,Frappier, L. (2012b). Proteomic profiling of the human cytomegalovirus UL35 gene products reveals a role for UL35 in the DNA repair response. Journal of virology, 86, 806-20.

126

Salsman, J., Wang, X.,Frappier, L. (2011). Nuclear body formation and PML body remodeling by the human cytomegalovirus protein UL35. Virology, 414, 119-29.

Sanchez, Y., Wong, C., Thoma, R. S., Richman, R., Wu, Z., Piwnica-Worms, H.,Elledge, S. J. (1997). Conservation of the Chk1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25. Science, 277, 1497-501.

Saridakis, V., Sheng, Y., Sarkari, F., Holowaty, M. N., Shire, K., Nguyen, T., Zhang, R. G., Liao, J., Lee, W., Edwards, A. M., Arrowsmith, C. H.,Frappier, L. (2005a). Structure of the p53 binding domain of HAUSP/USP7 bound to Epstein-Barr nuclear antigen 1 implications for EBV- mediated immortalization. Mol Cell, 18, 25-36.

Saridakis, V., Sheng, Y., Sarkari, F., Holowaty, M. N., Shire, K., Nguyen, T., Zhang, R. G., Liao, J., Lee, W., Edwards, A. M., Arrowsmith, C. H.,Frappier, L. (2005b). Structure of the p53 binding domain of HAUSP/USP7 bound to Epstein-Barr nuclear antigen 1 implications for EBV- mediated immortalization. Molecular cell, 18, 25-36.

Sarkari, F., La Delfa, A., Arrowsmith, C. H., Frappier, L., Sheng, Y.,Saridakis, V. (2010a). Further insight into substrate recognition by USP7: structural and biochemical analysis of the HdmX and Hdm2 interactions with USP7. Journal of molecular biology, 402, 825-37.

Sarkari, F., Sanchez-Alcaraz, T., Wang, S., Holowaty, M. N., Sheng, Y.,Frappier, L. (2009a). EBNA1-mediated recruitment of a histone H2B deubiquitylating complex to the Epstein-Barr virus latent origin of DNA replication. PLoS Pathog, 5, e1000624.

Sarkari, F., Sanchez-Alcaraz, T., Wang, S., Holowaty, M. N., Sheng, Y.,Frappier, L. (2009b). EBNA1-mediated recruitment of a histone H2B deubiquitylating complex to the Epstein-Barr virus latent origin of DNA replication. PLoS pathogens, 5, e1000624.

Sarkari, F., Sheng, Y.,Frappier, L. (2010b). USP7/HAUSP promotes the sequence-specific DNA binding activity of p53. PloS one, 5, e13040.

Sarkari, F., Wang, X., Nguyen, T.,Frappier, L. (2011). The herpesvirus associated ubiquitin specific protease, USP7, is a negative regulator of PML proteins and PML nuclear bodies. PLoS ONE, 6, e16598.

Sarkari, F., Wheaton, K., La Delfa, A., Mohamed, M., Shaikh, F., Khatun, R., Arrowsmith, C. H., Frappier, L., Saridakis, V.,Sheng, Y. (2013). Ubiquitin-specific protease 7 is a regulator of ubiquitin-conjugating enzyme UbE2E1. The Journal of biological chemistry, 288, 16975-85.

Scheffner, M., Nuber, U.,Huibregtse, J. M. (1995). Protein ubiquitination involving an E1-E2-E3 enzyme ubiquitin thioester cascade. Nature, 373, 81-3.

Schiel, J. A., Park, K., Morphew, M. K., Reid, E., Hoenger, A.,Prekeris, R. (2011). Endocytic membrane fusion and buckling-induced microtubule severing mediate cell abscission. Journal of cell science, 124, 1411-24.

127 Schoenfeld, A. R., Apgar, S., Dolios, G., Wang, R.,Aaronson, S. A. (2004). BRCA2 is ubiquitinated in vivo and interacts with USP11, a deubiquitinating enzyme that exhibits prosurvival function in the cellular response to DNA damage. Molecular and cellular biology, 24, 7444-55.

Schwertman, P., Lagarou, A., Dekkers, D. H., Raams, A., Van Der Hoek, A. C., Laffeber, C., Hoeijmakers, J. H., Demmers, J. A., Fousteri, M., Vermeulen, W.,Marteijn, J. A. (2012). UV- sensitive syndrome protein UVSSA recruits USP7 to regulate transcription-coupled repair. Nature genetics, 44, 598-602.

Scolnick, D. M.,Halazonetis, T. D. (2000). Chfr defines a mitotic stress checkpoint that delays entry into metaphase. Nature, 406, 430-5.

Seol, J. H., Feldman, R. M., Zachariae, W., Shevchenko, A., Correll, C. C., Lyapina, S., Chi, Y., Galova, M., Claypool, J., Sandmeyer, S., Nasmyth, K.,Deshaies, R. J. (1999). Cdc53/cullin and the essential Hrt1 RING-H2 subunit of SCF define a ubiquitin ligase module that activates the E2 enzyme Cdc34. Genes & development, 13, 1614-26.

Shah, P., Qiang, L., Yang, S., Soltani, K.,He, Y. Y. (2017). Regulation of XPC deubiquitination by USP11 in repair of UV-induced DNA damage. Oncotarget, 8, 96522-96535.

Shen, Y., Pan, X.,Zhao, H. (2014). The histone demethylase PHF8 is an oncogenic protein in human non-small cell lung cancer. Biochemical and biophysical research communications, 451, 119-25.

Sheng, Y., Saridakis, V., Sarkari, F., Duan, S., Wu, T., Arrowsmith, C. H.,Frappier, L. (2006). Molecular recognition of p53 and MDM2 by USP7/HAUSP. Nature structural & molecular biology, 13, 285-91.

Shi, D., Dai, C., Qin, J.,Gu, W. (2016). Negative regulation of the p300-p53 interplay by DDX24. Oncogene, 35, 528-36.

Singh, R. K., Zerath, S., Kleifeld, O., Scheffner, M., Glickman, M. H.,Fushman, D. (2012). Recognition and cleavage of related to ubiquitin 1 (Rub1) and Rub1-ubiquitin chains by components of the ubiquitin-proteasome system. Molecular & cellular proteomics : MCP, 11, 1595-611.

Skowyra, D., Craig, K. L., Tyers, M., Elledge, S. J.,Harper, J. W. (1997). F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex. Cell, 91, 209-19.

Skowyra, D., Koepp, D. M., Kamura, T., Conrad, M. N., Conaway, R. C., Conaway, J. W., Elledge, S. J.,Harper, J. W. (1999). Reconstitution of G1 cyclin ubiquitination with complexes containing SCFGrr1 and Rbx1. Science, 284, 662-5.

Smaldone, S., Laub, F., Else, C., Dragomir, C.,Ramirez, F. (2004). Identification of MoKA, a novel F-box protein that modulates Kruppel-like transcription factor 7 activity. Molecular and cellular biology, 24, 1058-69.

128

Smaldone, S.,Ramirez, F. (2006). Multiple pathways regulate intracellular shuttling of MoKA, a co-activator of transcription factor KLF7. Nucleic acids research, 34, 5060-8.

Song, L.,Rape, M. (2008). Reverse the curse--the role of deubiquitination in cell cycle control. Current opinion in cell biology, 20, 156-63.

Song, M. S., Salmena, L., Carracedo, A., Egia, A., Lo-Coco, F., Teruya-Feldstein, J.,Pandolfi, P. P. (2008). The deubiquitinylation and localization of PTEN are regulated by a HAUSP-PML network. Nature, 455, 813-7.

Soss, S. E., Klevit, R. E.,Chazin, W. J. (2013). Activation of UbcH5c~Ub is the result of a shift in interdomain motions of the conjugate bound to U-box E3 ligase E4B. Biochemistry, 52, 2991- 9.

Soucy, T. A., Smith, P. G., Milhollen, M. A., Berger, A. J., Gavin, J. M., Adhikari, S., Brownell, J. E., Burke, K. E., Cardin, D. P., Critchley, S., Cullis, C. A., Doucette, A., Garnsey, J. J., Gaulin, J. L., Gershman, R. E., Lublinsky, A. R., Mcdonald, A., Mizutani, H., Narayanan, U., Olhava, E. J., Peluso, S., Rezaei, M., Sintchak, M. D., Talreja, T., Thomas, M. P., Traore, T., Vyskocil, S., Weatherhead, G. S., Yu, J., Zhang, J., Dick, L. R., Claiborne, C. F., Rolfe, M., Bolen, J. B.,Langston, S. P. (2009). An inhibitor of NEDD8-activating enzyme as a new approach to treat cancer. Nature, 458, 732-6.

Sowa, M. E., Bennett, E. J., Gygi, S. P.,Harper, J. W. (2009). Defining the human deubiquitinating enzyme interaction landscape. Cell, 138, 389-403.

Stewart, M. D., Ritterhoff, T., Klevit, R. E.,Brzovic, P. S. (2016). E2 enzymes: more than just middle men. Cell research, 26, 423-40.

Stockum, A., Snijders, A. P.,Maertens, G. N. (2018). USP11 deubiquitinates RAE1 and plays a key role in bipolar spindle formation. PloS one, 13, e0190513.

Storer, A. C.,Menard, R. (1994). Catalytic mechanism in papain family of cysteine peptidases. Methods in enzymology, 244, 486-500.

Sumner, C. J., D'ydewalle, C., Wooley, J., Fawcett, K. A., Hernandez, D., Gardiner, A. R., Kalmar, B., Baloh, R. H., Gonzalez, M., Zuchner, S., Stanescu, H. C., Kleta, R., Mankodi, A., Cornblath, D. R., Boylan, K. B., Reilly, M. M., Greensmith, L., Singleton, A. B., Harms, M. B., Rossor, A. M.,Houlden, H. (2013). A dominant mutation in FBXO38 causes distal spinal muscular atrophy with calf predominance. American journal of human genetics, 93, 976-83.

Sun, C., Wang, G., Wrighton, K. H., Lin, H., Songyang, Z., Feng, X. H.,Lin, X. (2016). Regulation of p27(Kip1) phosphorylation and G1 cell cycle progression by protein phosphatase PPM1G. American journal of cancer research, 6, 2207-2220.

Sun, W., Tan, X., Shi, Y., Xu, G., Mao, R., Gu, X., Fan, Y., Yu, Y., Burlingame, S., Zhang, H., Rednam, S. P., Lu, X., Zhang, T., Fu, S., Cao, G., Qin, J.,Yang, J. (2010). USP11 negatively

129 regulates TNFalpha-induced NF-kappaB activation by targeting on IkappaBalpha. Cellular signalling, 22, 386-94.

Sun, X., Qiu, J. J., Zhu, S., Cao, B., Sun, L., Li, S., Li, P., Zhang, S.,Dong, S. (2013). Oncogenic features of PHF8 histone demethylase in esophageal squamous cell carcinoma. PloS one, 8, e77353.

Sun, X. X., Challagundla, K. B.,Dai, M. S. (2012). Positive regulation of p53 stability and activity by the deubiquitinating enzyme Otubain 1. The EMBO journal, 31, 576-92.

Sun, Y., Cao, L., Sheng, X., Chen, J., Zhou, Y., Yang, C., Deng, T., Ma, H., Feng, P., Liu, J., Tan, W.,Ye, M. (2017). WDR79 promotes the proliferation of non-small cell lung cancer cells via USP7-mediated regulation of the Mdm2-p53 pathway. Cell death & disease, 8, e2743.

Sun, Y., Hegamyer, G., Cheng, Y. J., Hildesheim, A., Chen, J. Y., Chen, I. H., Cao, Y., Yao, K. T.,Colburn, N. H. (1992). An infrequent point mutation of the p53 gene in human nasopharyngeal carcinoma. Proceedings of the National Academy of Sciences of the United States of America, 89, 6516-20.

Sun, Y., Jiang, X., Chen, S., Fernandes, N.,Price, B. D. (2005). A role for the Tip60 histone acetyltransferase in the acetylation and activation of ATM. Proceedings of the National Academy of Sciences of the United States of America, 102, 13182-7.

Sun, Y., Xu, Y., Roy, K.,Price, B. D. (2007). DNA damage-induced acetylation of lysine 3016 of ATM activates ATM kinase activity. Molecular and cellular biology, 27, 8502-9.

Tanner, N. K.,Linder, P. (2001). DExD/H box RNA helicases: from generic motors to specific dissociation functions. Molecular cell, 8, 251-62.

Tanny, J. C., Erdjument-Bromage, H., Tempst, P.,Allis, C. D. (2007). Ubiquitylation of histone H2B controls RNA polymerase II transcription elongation independently of histone H3 methylation. Genes & development, 21, 835-47.

Tapias, A., Zhou, Z. W., Shi, Y., Chong, Z., Wang, P., Groth, M., Platzer, M., Huttner, W., Herceg, Z., Yang, Y. G.,Wang, Z. Q. (2014). Trrap-dependent histone acetylation specifically regulates cell-cycle gene transcription to control neural progenitor fate decisions. Cell stem cell, 14, 632-43.

Thrower, J. S., Hoffman, L., Rechsteiner, M.,Pickart, C. M. (2000). Recognition of the polyubiquitin proteolytic signal. The EMBO journal, 19, 94-102.

Turnbull, A. P., Ioannidis, S., Krajewski, W. W., Pinto-Fernandez, A., Heride, C., Martin, A. C. L., Tonkin, L. M., Townsend, E. C., Buker, S. M., Lancia, D. R., Caravella, J. A., Toms, A. V., Charlton, T. M., Lahdenranta, J., Wilker, E., Follows, B. C., Evans, N. J., Stead, L., Alli, C., Zarayskiy, V. V., Talbot, A. C., Buckmelter, A. J., Wang, M., Mckinnon, C. L., Saab, F., Mcgouran, J. F., Century, H., Gersch, M., Pittman, M. S., Marshall, C. G., Raynham, T. M., Simcox, M., Stewart, L. M. D., Mcloughlin, S. B., Escobedo, J. A., Bair, K. W., Dinsmore, C. J.,

130 Hammonds, T. R., Kim, S., Urbe, S., Clague, M. J., Kessler, B. M.,Komander, D. (2017). Molecular basis of USP7 inhibition by selective small-molecule inhibitors. Nature, 550, 481-486.

Van Der Horst, A., De Vries-Smits, A. M., Brenkman, A. B., Van Triest, M. H., Van Den Broek, N., Colland, F., Maurice, M. M.,Burgering, B. M. (2006). FOXO4 transcriptional activity is regulated by monoubiquitination and USP7/HAUSP. Nature cell biology, 8, 1064-73.

Van Der Knaap, J. A., Kozhevnikova, E., Langenberg, K., Moshkin, Y. M.,Verrijzer, C. P. (2010). Biosynthetic enzyme GMP synthetase cooperates with ubiquitin-specific protease 7 in transcriptional regulation of ecdysteroid target genes. Molecular and cellular biology, 30, 736- 44.

Van Der Knaap, J. A., Kumar, B. R., Moshkin, Y. M., Langenberg, K., Krijgsveld, J., Heck, A. J., Karch, F.,Verrijzer, C. P. (2005). GMP synthetase stimulates histone H2B deubiquitylation by the epigenetic silencer USP7. Molecular cell, 17, 695-707.

Van Loosdregt, J., Fleskens, V., Fu, J., Brenkman, A. B., Bekker, C. P., Pals, C. E., Meerding, J., Berkers, C. R., Barbi, J., Grone, A., Sijts, A. J., Maurice, M. M., Kalkhoven, E., Prakken, B. J., Ovaa, H., Pan, F., Zaiss, D. M.,Coffer, P. J. (2013). Stabilization of the transcription factor Foxp3 by the deubiquitinase USP7 increases Treg-cell-suppressive capacity. Immunity, 39, 259- 71.

Vijay-Kumar, S., Bugg, C. E.,Cook, W. J. (1987). Structure of ubiquitin refined at 1.8 A resolution. Journal of molecular biology, 194, 531-44.

Vittal, V., Stewart, M. D., Brzovic, P. S.,Klevit, R. E. (2015). Regulating the Regulators: Recent Revelations in the Control of E3 Ubiquitin Ligases. The Journal of biological chemistry, 290, 21244-51.

Wang, J., Shan, M., Liu, T., Shi, Q., Zhong, Z., Wei, W.,Pang, D. (2016a). Analysis of TRRAP as a Potential Molecular Marker and Therapeutic Target for Breast Cancer. Journal of breast cancer, 19, 61-7.

Wang, Q., Ma, S., Song, N., Li, X., Liu, L., Yang, S., Ding, X., Shan, L., Zhou, X., Su, D., Wang, Y., Zhang, Q., Liu, X., Yu, N., Zhang, K., Shang, Y., Yao, Z.,Shi, L. (2016b). Stabilization of histone demethylase PHF8 by USP7 promotes breast carcinogenesis. The Journal of clinical investigation, 126, 2205-20.

Wertz, I. E., O'rourke, K. M., Zhou, H., Eby, M., Aravind, L., Seshagiri, S., Wu, P., Wiesmann, C., Baker, R., Boone, D. L., Ma, A., Koonin, E. V.,Dixit, V. M. (2004). De-ubiquitination and ubiquitin ligase domains of A20 downregulate NF-kappaB signalling. Nature, 430, 694-9.

Wiegering, A., Dildrop, R., Kalfhues, L., Spychala, A., Kuschel, S., Lier, J. M., Zobel, T., Dahmen, S., Leu, T., Struchtrup, A., Legendre, F., Vesque, C., Schneider-Maunoury, S., Saunier, S., Ruther, U.,Gerhardt, C. (2018a). Cell type-specific regulation of ciliary transition zone assembly in vertebrates. The EMBO journal, 37.

131 Wiegering, A., Ruther, U.,Gerhardt, C. (2018b). The ciliary protein Rpgrip1l in development and disease. Developmental biology.

Wilkinson, K. D.,Audhya, T. K. (1981). Stimulation of ATP-dependent proteolysis requires ubiquitin with the COOH-terminal sequence Arg-Gly-Gly. The Journal of biological chemistry, 256, 9235-41.

Wilkinson, K. D., Tashayev, V. L., O'connor, L. B., Larsen, C. N., Kasperek, E.,Pickart, C. M. (1995). Metabolism of the polyubiquitin degradation signal: structure, mechanism, and role of isopeptidase T. Biochemistry, 34, 14535-46.

Wohlschlegel, J. A., Dwyer, B. T., Dhar, S. K., Cvetic, C., Walter, J. C.,Dutta, A. (2000). Inhibition of eukaryotic DNA replication by geminin binding to Cdt1. Science, 290, 2309-12.

Wright, M. H., Berlin, I.,Nash, P. D. (2011). Regulation of endocytic sorting by ESCRT-DUB- mediated deubiquitination. Cell biochemistry and biophysics, 60, 39-46.

Wu, H. C., Lin, Y. C., Liu, C. H., Chung, H. C., Wang, Y. T., Lin, Y. W., Ma, H. I., Tu, P. H., Lawler, S. E.,Chen, R. H. (2014). USP11 regulates PML stability to control Notch-induced malignancy in brain tumours. Nature communications, 5, 3214.

Wu, H. C., Lin, Y. C., Liu, C. H., Chung, H. C., Wang, Y. T., Lin, Y. W., Ma, H. I., Tu, P. H., Lawler, S. E.,Chen, R. H. (2017). Erratum: USP11 regulates PML stability to control Notch- induced malignancy in brain tumours. Nature communications, 8, 16167.

Wu, H. T., Kuo, Y. C., Hung, J. J., Huang, C. H., Chen, W. Y., Chou, T. Y., Chen, Y., Chen, Y. J., Cheng, W. C., Teng, S. C.,Wu, K. J. (2016). K63-polyubiquitinated HAUSP deubiquitinates HIF-1alpha and dictates H3K56 acetylation promoting hypoxia-induced tumour progression. Nature communications, 7, 13644.

Wurdak, H., Zhu, S., Romero, A., Lorger, M., Watson, J., Chiang, C. Y., Zhang, J., Natu, V. S., Lairson, L. L., Walker, J. R., Trussell, C. M., Harsh, G. R., Vogel, H., Felding-Habermann, B., Orth, A. P., Miraglia, L. J., Rines, D. R., Skirboll, S. L.,Schultz, P. G. (2010). An RNAi screen identifies TRRAP as a regulator of brain tumor-initiating cell differentiation. Cell stem cell, 6, 37-47.

Xiang, Q., Ju, H., Li, Q., Mei, S. C., Chen, D., Choi, Y. B.,Nicholas, J. (2018). Human Herpesvirus 8 Interferon Regulatory Factors 1 and 3 Mediate Replication and Latency Activities via Interactions with USP7 Deubiquitinase. Journal of virology.

Xu, J., Wu, H., Zhang, C., Cao, Y., Wang, L., Zeng, L., Ye, X., Wu, Q., Dai, J., Xie, Y.,Mao, Y. (2002). Identification of a novel human DDX40gene, a new member of the DEAH-box protein family. Journal of human genetics, 47, 681-3.

Xu, K., Wang, L., Feng, W., Feng, Y.,Shu, H. K. (2016). Phosphatidylinositol-3 kinase- dependent translational regulation of Id1 involves the PPM1G phosphatase. Oncogene, 35, 5807- 5816.

132 Yamaguchi, T., Kimura, J., Miki, Y.,Yoshida, K. (2007). The deubiquitinating enzyme USP11 controls an IkappaB kinase alpha (IKKalpha)-p53 signaling pathway in response to tumor necrosis factor alpha (TNFalpha). The Journal of biological chemistry, 282, 33943-8.

Yamauchi, T., Nishiyama, M., Moroishi, T., Yumimoto, K.,Nakayama, K. I. (2014). MDM2 mediates nonproteolytic polyubiquitylation of the DEAD-Box RNA helicase DDX24. Molecular and cellular biology, 34, 3321-40.

Yang, Z., Huo, S., Shan, Y., Liu, H., Xu, Y., Yao, K., Li, X.,Zhang, X. (2012). STAT3 repressed USP7 expression is crucial for colon cancer development. FEBS letters, 586, 3013-7.

Yao, T.,Cohen, R. E. (2002). A cryptic protease couples deubiquitination and degradation by the proteasome. Nature, 419, 403-7.

Yau, R.,Rape, M. (2016). The increasing complexity of the ubiquitin code. Nature cell biology, 18, 579-86.

Yau, R. G., Doerner, K., Castellanos, E. R., Haakonsen, D. L., Werner, A., Wang, N., Yang, X. W., Martinez-Martin, N., Matsumoto, M. L., Dixit, V. M.,Rape, M. (2017). Assembly and Function of Heterotypic Ubiquitin Chains in Cell-Cycle and Protein Quality Control. Cell, 171, 918-933 e20.

Yi, L., Cui, Y., Xu, Q.,Jiang, Y. (2016). Stabilization of LSD1 by deubiquitinating enzyme USP7 promotes glioblastoma cell tumorigenesis and metastasis through suppression of the p53 signaling pathway. Oncology reports, 36, 2935-2945.

Yu, M., Liu, K., Mao, Z., Luo, J., Gu, W.,Zhao, W. (2016). USP11 Is a Negative Regulator to gammaH2AX Ubiquitylation by RNF8/RNF168. The Journal of biological chemistry, 291, 959- 67.

Yuan, J., Luo, K., Deng, M., Li, Y., Yin, P., Gao, B., Fang, Y., Wu, P., Liu, T.,Lou, Z. (2014a). HERC2-USP20 axis regulates DNA damage checkpoint through Claspin. Nucleic acids research, 42, 13110-21.

Yuan, W. C., Lee, Y. R., Lin, S. Y., Chang, L. Y., Tan, Y. P., Hung, C. C., Kuo, J. C., Liu, C. H., Lin, M. Y., Xu, M., Chen, Z. J.,Chen, R. H. (2014b). K33-Linked Polyubiquitination of Coronin 7 by Cul3-KLHL20 Ubiquitin E3 Ligase Regulates Protein Trafficking. Molecular cell, 54, 586- 600.

Zagulski, M., Kressler, D., Becam, A. M., Rytka, J.,Herbert, C. J. (2003). Mak5p, which is required for the maintenance of the M1 dsRNA virus, is encoded by the yeast ORF YBR142w and is involved in the biogenesis of the 60S subunit of the ribosome. Molecular genetics and genomics : MGG, 270, 216-24.

Zeghouf, M., Li, J., Butland, G., Borkowska, A., Canadien, V., Richards, D., Beattie, B., Emili, A.,Greenblatt, J. F. (2004). Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes. Journal of proteome research, 3, 463-8.

133 Zemp, I.,Lingner, J. (2014). The shelterin component TPP1 is a binding partner and substrate for the deubiquitinating enzyme USP7. The Journal of biological chemistry, 289, 28595-606.

Zhai, W.,Comai, L. (2000). Repression of RNA polymerase I transcription by the tumor suppressor p53. Molecular and cellular biology, 20, 5930-8.

Zhang, E., Shen, B., Mu, X., Qin, Y., Zhang, F., Liu, Y., Xiao, J., Zhang, P., Wang, C., Tan, M.,Fan, Y. (2016a). Ubiquitin-specific protease 11 (USP11) functions as a tumor suppressor through deubiquitinating and stabilizing VGLL4 protein. American journal of cancer research, 6, 2901-2909.

Zhang, J., Tripathi, D. N., Jing, J., Alexander, A., Kim, J., Powell, R. T., Dere, R., Tait-Mulder, J., Lee, J. H., Paull, T. T., Pandita, R. K., Charaka, V. K., Pandita, T. K., Kastan, M. B.,Walker, C. L. (2015). ATM functions at the peroxisome to induce pexophagy in response to ROS. Nature cell biology, 17, 1259-1269.

Zhang, L.,Gong, F. (2016). Involvement of USP24 in the DNA damage response. Molecular & cellular oncology, 3, e1011888.

Zhang, L., Wang, H., Tian, L.,Li, H. (2016b). Expression of USP7 and MARCH7 Is Correlated with Poor Prognosis in Epithelial Ovarian Cancer. The Tohoku journal of experimental medicine, 239, 165-75.

Zhang, S., Xie, C., Li, H., Zhang, K., Li, J., Wang, X.,Yin, Z. (2018). Ubiquitin-specific protease 11 serves as a marker of poor prognosis and promotes metastasis in hepatocellular carcinoma. Laboratory investigation; a journal of technical methods and pathology.

Zhang, W., Sartori, M. A., Makhnevych, T., Federowicz, K. E., Dong, X., Liu, L., Nim, S., Dong, A., Yang, J., Li, Y., Haddad, D., Ernst, A., Heerding, D., Tong, Y., Moffat, J.,Sidhu, S. S. (2017). Generation and Validation of Intracellular Ubiquitin Variant Inhibitors for USP7 and USP10. Journal of molecular biology, 429, 3546-3560.

Zhao, G. Y., Lin, Z. W., Lu, C. L., Gu, J., Yuan, Y. F., Xu, F. K., Liu, R. H., Ge, D.,Ding, J. Y. (2015). USP7 overexpression predicts a poor prognosis in lung squamous cell carcinoma and large cell carcinoma. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36, 1721-9.

Zheng, N.,Shabek, N. (2017). Ubiquitin Ligases: Structure, Function, and Regulation. Annual review of biochemistry, 86, 129-157.

Zhou, Z., Luo, A., Shrivastava, I., He, M., Huang, Y., Bahar, I., Liu, Z.,Wan, Y. (2017). Regulation of XIAP Turnover Reveals a Role for USP11 in Promotion of Tumorigenesis. EBioMedicine, 15, 48-61.

Zhu, B., Zheng, Y., Pham, A. D., Mandal, S. S., Erdjument-Bromage, H., Tempst, P.,Reinberg, D. (2005). Monoubiquitination of human histone H2B: the factors involved and their roles in HOX gene regulation. Molecular cell, 20, 601-11.

134 Zhu, Q., Sharma, N., He, J., Wani, G.,Wani, A. A. (2015). USP7 deubiquitinase promotes ubiquitin-dependent DNA damage signaling by stabilizing RNF168. Cell cycle, 14, 1413-25.

Zlatanou, A., Sabbioneda, S., Miller, E. S., Greenwalt, A., Aggathanggelou, A., Maurice, M. M., Lehmann, A. R., Stankovic, T., Reverdy, C., Colland, F., Vaziri, C.,Stewart, G. S. (2016). USP7 is essential for maintaining Rad18 stability and DNA damage tolerance. Oncogene, 35, 965-76.