Urinary Calcium to Creatinine Ratio: a Potential Marker of Secondary Hyperparathyroidism in Patients with Vitamin D-Dependent Rickets Type 1A

Endocrine Journal 2015, 62 (1), 61-68

Original Urinary calcium to creatinine ratio: a potential marker of secondary hyperparathyroidism in patients with vitamin D-dependent rickets type 1A

Kentaro Miyai1), 2), Toshikazu Onishi2), 3), Kenichi Kashimada2), 4) and Yukihiro Hasegawa1)

1) Division of Endocrinology and Metabolism, Tokyo Metropolitan Children’s Medical Center, Tokyo 183-8561, Japan 2) Department of Pediatrics and Developmental Biology, Tokyo Medical and Dental University, Tokyo 113-8510, Japan 3) Department of Pediatrics, Kinki Central Hospital, Hyogo 664-8533, Japan 4) Department of Pediatrics, Tsuchiura General Hospital, Ibaraki 300-0053, Japan

Abstract. Patients with vitamin D-dependent rickets type 1A (VDDR1A) are usually treated with alfacalcidol, an analog of vitamin D. Around puberty, an increased dose of alfacalcidol is recommended for these patients to avoid hypocalcemia and secondary hyperparathyroidism. However, no indicators of secondary hyperparathyroidism except for PTH are presently known. The aim of this study is to evaluate whether urinary calcium to creatinine ratio (U-Ca/Cr) is useful as a biomarker of secondary hyperparathyroidism in VDDR1A patients in order to determine the proper dose of alfacalcidol. Two brothers with VDDR1A were recruited who had null mutations of CYP27B1 which encodes 1-alpha-hydroxylase of vitamin D. We investigated the relationship between U-Ca/Cr and intact-PTH around puberty when the brothers showed hypocalcemia with secondary hyperparathyroidism. The results were compared to those of five patients with vitamin D deficiency (VDD). As a result, high intact-PTH levels were observed when U-Ca/Cr decreased to less than 0.1 (mg/mg) in both VDDR1A brothers. This relationship was also observed in the VDD patients. However, it is necessary to take into account body calcium status, either in depletion or in excess, to accurately evaluate the relationship between U-Ca/Cr and secondary hyperparathyroidism. First, low U-Ca/Cr was detected in situations with calcium depletion without hyperparathyroidism in the VDDR1A patients. Second, high U-Ca/Cr with hyperparathyroidism could be detected theoretically in a condition of excess calcium supply. In conclusion, a U-Ca/Cr ratio of less than 0.1 (mg/mg) in VDDR1A patients is useful to accurately evaluate calcium depletion and secondary hyperparathyroidism.

Keywords: Urinary calcium to creatinine ratio, Secondary hyperparathyroidism, Vitamin D-dependent rickets type 1A, Vitamin D deficiency, Growth spurt

VITAMIN D plays an important role not only in the converts 25-OHD and 1,25(OH)2D into 24,25(OH)2D maintenance of mineral homeostasis but also in the and 1,24,25(OH)3D, respectively, in order to avoid modulation of osteoblast differentiation [1]. Native vitamin D toxicity and to maintain the concentration of vitamin D is produced from food intake or synthesized active vitamin D within the physiological range. These in the skin in response to ultraviolet light. Vitamin types of hydroxylation occur under hormonal control D is then sequentially activated by two hydroxy- in relation to mineral metabolism, especially calcium lases: 25-hydroxylase converts native vitamin D into (Ca) metabolism [2]. 25-hydroxyvitamin D (25-OHD) in the liver and Serum Ca level is maintained by PTH and 1-alpha-hydroxylase (1α-OHase) converts 25-OHD 1,25(OH)2D primarily to avoid hypocalcemia. PTH into 1,25(OH)2D in the kidney. Inactivation of vita- secretion is under the control of Ca-sensing receptors min D also occurs in the liver by 24-hydroxylase which on the surface of the parathyroid gland. The dose-response curve of serum PTH level to serum Ca has Submitted Feb. 24, 2014; Accepted Sep. 16, 2014 as EJ14-0085 Released online in J-STAGE as advance publication Oct. 4, 2014 an inverted sigmoid shape, which allows an imme- Correspondence to: Kentaro Miyai, Tokyo Metropolitan Children’s diate response to hypocalcemia [3]. When serum Ca Medical Center, 2-8-29 Musashidai, Fuchu, Tokyo 183-8561, Japan. decreases below the lower limit, parathyroid hormone E-mail: [email protected] secretion is up-regulated through the inactivation of ©The Japan Endocrine Society 62 Miyai et al.

Ca-sensing receptors. Secreted PTH increases serum their informed consent, and the study was approved by Ca levels via enhancement of reabsorption in the prox- our local review board. imal tubule of kidneys, bone resorption, and absorption in the intestines through activation of 1α-OHase Blood and urinary samples and biochemical mea- of vitamin D. surements Vitamin D-dependent rickets type 1A (VDDR1A) Blood and urinary samples of the VDDR1A brothers (OMIM #264700) is a rare autosomal recessive dis- were obtained every two months as occasional speci- ease. The gene responsible for VDDR1A has been iden- mens more than two hours after meal. Laboratory data tified as CYP27B1, located on chromosome 12q13.1- of the VDDR1A brothers were collected from prepu- 13.3 [4], which encodes 1α-OHase of 25-OHD. Patients bertal period to pubertal period (from age 9 to 15 years with VDDR1A are recognized by symptoms related of the elder brother and from age 7 to 13 years of the to hypocalcemia such as hypotonia, rickets, and sei- younger brother), and those of the VDD patients were zures. To prevent such hypocalcemic events, patients collected during two to four years after diagnosis. with VDDR1A are usually treated with alfacalcidol Serum intact-PTH was measured by ECLIA (SRL, (1-hydroxycholecalciferol), a vitamin D analog, which Inc., Japan), and serum Ca, phosphate (P), alkaline is converted to 1,25(OH)2D by 25-hydroxylase in the phosphatase (ALP), urinary calcium and urinary cre- liver. To achieve normocalcemia and to avoid hypercal- atinine were measured by standard colorimetric meth- ciuria, the dose of alfacalcidol should be adjusted based ods. U-Ca/Cr was calculated as urinary calcium (mg/ on serum Ca, intact-PTH, and urinary calcium to cre- dL)/urinary creatinine (mg/dL). atinine ratio (U-Ca/Cr) levels. But, to date, there has been only one report on the dose of calcitriol (1,25-dihy- Sequence analyses of the CYP27B1 gene droxycholecalciferol), another analog of vitamin D, in Total genomic DNA was isolated from periph- VDDR1A patients during adolescence [5]. eral blood using the QIAamp DNA blood midi kit Here we report two brothers with VDDR1A who have (QIAGEN Inc., Tokyo, Japan). Coding regions includ- compound heterozygous mutations of the CYP27B1 ing the exon-intron boundaries of the CYP27B1 gene gene. The two mutations, previously reported [4, 6], were amplified by PCR using primers listed in Table 1. are a missense mutation and a frameshift mutation, PCR products were directly sequenced by Operon both of which are regarded as null function mutations. Biotechnologies, Inc., Japan. Mutational nucleotide Around puberty, the brothers were treated with three sequences were compared to the human gene mutation to four times the dose of alfacalcidol (0.06-0.1µg/kg/ database website (http://www.biobase-international. day) compared to the dose used in childhood (0.02- com/product/hgmd). 0.03µg/kg/day) to avoid hypocalcemia and secondary hyperparathyroidism. We examined the relation- Statistical Analyses ship between U-Ca/Cr and intact-PTH in the brothers. Statistical analyses were performed using SPSS ver- Furthermore, we examined whether a similar relation- sion 20 software. Pearson’s correlation coefficient ship is observed in patients with vitamin D deficiency between intact-PTH and U-Ca/Cr was calculated, and (VDD) diagnosed after the age of two years. p values less than 0.05 were considered significant.

Materials and Methods Patients and Results

Patients Case presentations The patients included two brothers diagnosed as The elder brother was brought to the hospital because having VDDR1A, and five VDD patients whose ages of fever at the age of five months. Blood examination at diagnosis were between 2.4 and 15.1 years. All showed hypocalcemia (5.3 mg/dL), hypophosphatemia patients were from our hospital. Because most children (4.8 mg/dL), high ALP (1418 U/L), and high intact-PTH with VDD are diagnosed and treated before age two, (220 pg/mL). At that time, he was diagnosed as hav- when urinary creatinine secretion is low and U-Ca/Cr ing pseudohypoparathyroidism (PHP) and was treated is highly variable, we excluded VDD patients below with alfacalcidol. To maintain normocalcemia, treat- the age of two years. All study participants provided ment with alfacalcidol was continued at a dose of 0.02 U-Ca/Cr in detecting secondary HPT 63

Table 1 Oligonucleotide primers used for PCR amplification and sequencing of the CYP27B1 gene Exon Sense primer Antisense primer Size (bp) 1 gagatatgatgctcaggagaag ggcatccgttctctctggct 360 2 gtatcaaaggcatacactagttg agatgcccaatggtagagtgg 462 3-4 aggttctgtgactcaagttacc ttccacctcgacctgtgcct 739 4-5 tcggactggaaggtgagtcc ctacgtggccataatggatcc 655 6-7 gaccagcttggcttagcacc cactgttccattacatcctagaa 706 8 ttgtccctgtctgaatatcctc ttcagaagattcattctaccagg 402 9 ccaatcattgaccattctaacac ttctatccagtttggtcagatag 349 The sense primer for amplifying exons 4-5 is partially located at the end of exon 3 of CYP27B1 DNA. The other primers are in the flanking or intronic regions.

Fig. 1 Growth charts around puberty of the brothers with VDDR1A The five lines indicate the range of heights (in standard deviations) for Japanese boys from the Japanese Ministry of Health, Labour and Welfare. (A) Elder brother. Arrow indicates first hypocalcemic episode (Ca 6.7 mg/dL, P 6.7 mg/dL and ALP 1923 IU/L). Arrowhead indicates second episode (Ca 7.3 mg/dL, P 7.2 mg/dL and ALP 1626 IU/L). (B) Younger brother. Arrow indicates hypocalcemic episode (Ca 4.8 mg/dL, P 7.3 mg/dL, ALP 2939 IU/L). Lower panels show the dose of alfacalcidol per body weight. Dose of alfacalcidol was increased after the episodes of hypocalcemia.

µg/kg/day until adolescence (Fig. 1A). When he was dose of alfacalcidol was maintained at 0.02 µg/kg/day. 11 years old (subsequent records showed that this was The younger brother was brought to the hospital the beginning of a growth spurt), routine blood exam- because of retardation of motor development at the ination showed hypocalcemia (6.7 mg/dL) with hyper- age of 15 months. He showed hypotonia, and blood phosphatemia (6.7 mg/dL) with low U-Ca/Cr (0.00 examination showed hypocalcemia (6.2 mg/dL), hypo- mg/mg) and high tubular reabsorption of phosphorus phosphatemia (3.1 mg/dL), and increased high-sensi- (%TRP) (95%). The dose of alfacalcidol was then tive PTH level (2000 pg/mL, normal range: 160-520 increased to 0.04 µg/kg/day. Hypocalcemia improved pg/mL). Because his elder brother was diagnosed as soon after the dose was increased, but 6 months later, having PHP at that time, he was also diagnosed as hav- blood examination showed hypocalcemia (7.3 mg/dL) ing PHP and was treated with alfacalcidol. When he with hyperphosphatemia (7.2 mg/dL) with low U-Ca/ was 10 years old (subsequent records showed that this Cr (0.01 mg/mg) and high %TRP (96%) again. The was one and a half year before the start of a growth dose of alfacalcidol was then increased to 0.09 µg/kg/ spurt), blood examination showed hypocalcemia (4.8 day and was maintained at that level for about one and mg/dL), hyperphosphatemia (7.3 mg/dL) and high a half years. When he was 13 years old, the dose of ALP (2939 U/L) with low U-Ca/Cr (0.03 mg/mg) and alfacalcidol was gradually decreased because U-Ca/Cr high %TRP (98%) (Fig. 1B). The dose of alfacalci- was high (0.44 mg/mg). After the age of 15 years the dol was increased from 0.02 µg/kg/day to 0.03 µg/kg/ 64 Miyai et al.

Fig. 2 DNA analyses of the CYP27B1 gene of the VDDR1A brothers and their father (A) The brothers were compound heterozygotes of a 7-bp duplication in exon 8 and c.320G>A in exon 2. Their father was heterozygous for the 7-bp duplication. Their mother could not be investigated because we were unable to contact her. (B) Mutational sequences of CYP27B1 DNA; (left) 7-bp duplication in exon8, (right) c.320G>A (p.R107H) in exon 2.

day, which raised his blood Ca levels to within normal mutations [4, 6], and the brothers were diagnosed as hav- range. When he was 11 years old (subsequent records ing vitamin D-dependent rickets type 1A (VDDR1A). showed that this was the beginning of a growth spurt), serum Ca levels were within normal range. However, Relationship between intact-PTH and U-Ca/Cr the dose of alfacalcidol was increased and maintained To find a predictor of secondary hyperparathyroid- up to 0.06-0.10 µg/kg/day to avoid hypocalcemia. ism, we investigated the relationships between intact- PTH and U-Ca/Cr. When U-Ca/Cr decreased to less Genomic analyses of CYP27B1 gene than 0.1 (mg/mg), intact-PTH tended to increase above We examined the brothers and their father for the upper limit in both brothers (Fig. 3A, B). We CYP27B1 gene mutations after obtaining written were unable to compare the data with other VDDR1A informed consent. Though the brothers were diag- patients because VDDR1A is rare. Instead, to test nosed as having PHP and their serum P levels were whether a similar relation was present in other patients high in spite of low serum calcium levels around the related to vitamin D metabolism, we also investigated age of puberty, several observations (that is, their age five patients who were diagnosed as having VDD after of first appearance with hypocalcemia and hypophos- the age of two years old. Their clinical data at diagno- phatemia, the demand of alfacalcidol at puberty, the sis are shown in Table 2. Each of the five patients had high PTH levels with normal to low 1,25(OH)2D lev- an unbalanced diet at diagnosis. Intact-PTH and U-Ca/ els (14.7-31.3 pg/mL; reference range 20-70 pg/mL), Cr had a reverse sigmoid relationship (Fig. 4A) that and the normalized PTH levels by alfacalcidol), led could be made more linear in a log-log plot (Fig. 4B). us to conclude that their condition was consistent with When the scatter diagrams of the VDDR1A brothers 1α-OHase deficiency and not with PHP. were displayed together with those of the VDD patients Genomic analyses revealed that the brothers had the in a log-log plot, the two sets of data overlapped (Fig. same compound heterozygote of missense mutation of 4C). It should be noted that U-Ca/Cr less than 0.1 (mg/ c.320G>A (p.R107H) in exon 2, and frameshift mutation mg) with normal intact-PTH levels, and U-Ca/Cr more of c.1319_1325dupCCCACCC in exon 8, and that their than 0.1 (mg/mg) with high intact-PTH levels were father was heterozygous for the latter (Fig. 2). These also observed (Fig. 4C). mutations were previously reported as null function U-Ca/Cr in detecting secondary HPT 65

Fig. 3 Relationships between intact-PTH and U-Ca/Cr in two VDDR1A brothers (A) Elder brother (from 9 to 15 years old) and (B) younger brother (from 7 to 13 years old). Black lines show the regression lines. Vertical dashed lines show U-Ca/Cr=0.1 (mg/mg) and transverse dashed lines show the upper limit of the normal range of intact-PTH (70 pg/mL).

Table 2 Clinical data of five patients with vitamin D deficiency No. 1 2 3 4 5 Age at Dx 2.4y 3y 10y 10.5y 15.1y Sex F F F M M Factor vegetarian unbalanced diet unbalanced diet unbalanced diet unbalanced diet Serum Ca (mg/dL) 7.8 7.2 9.6 8.8 9.3 Serum P (mg/dL) 3.6 3.6 4.8 5.0 5.1 ALP (U/L) 2812 5064 1177 1130 750 Intact-PTH (ng/mL) 742.6 906 96.4 149.4 119.9 U-Ca/Cr (mg/mg) 0.006 0.012 0.046 0.029 0.031 The age of diagnosis (Dx) for all patients was more than two years old.

Fig. 4 Relationships between intact-PTH and U-Ca/Cr in VDD patients and VDDR1A brothers (A, B) VDD patients data shown on linear (A) and log-log (B) scales. (C) Superposition of VDD patients data (gray symbols) and VDDR1A brothers data (black symbols). Vertical dashed lines show U-Ca/Cr=0.1 (mg/mg), and transverse lines show an upper limit level of the normal range of intact-PTH (70 pg/mL). 66 Miyai et al.

Discussion erly secrete PTH in response to hypocalcemia, and in patients with PHP who do not properly respond to PTH. We found that a U-Ca/Cr ratio less than 0.1 (mg/ The relationship between U-Ca/Cr and PTH might mg) was useful for detecting secondary hyperparathy- not be identical in VDDR1A and VDD. On one hand, roidism in VDDR1A and VDD patients. It is difficult because the lack of alfacalcidol could be directly linked to predict an increase of PTH secretion from the levels to decreased active vitamin D in VDDR1A patients, of serum Ca because dynamic changes in PTH secre- serum Ca level could be maintained mainly by reab- tion occur as a result of minute changes in serum Ca sorption in the kidneys, which depends mostly on PTH. [7], and because normocalcemic secondary hyperpara- Thus, U-Ca/Cr would be low in situations with slightly thyroidism can occur as a result of compensation by short active vitamin D. On the other hand, although PTH. Theoretically, a decrease in U-Ca/Cr precedes we could not detect such situations in our VDD patients, a decrease in serum Ca levels as a result of Ca reab- in the initial stage of VDD it is theoretically possible sorption in the kidneys. Therefore, U-Ca/Cr could be a that serum Ca level could be maintained by increased sensitive indicator of secondary hyperparathyroidism. absorption of calcium in the intestines and bone resorp- While a high U-Ca/Cr ratio is often used as an indica- tion through increased active vitamin D, leading to rel- tor of hypercalciuria leading to nephrocalcinosis and atively high urinary calcium excretion. Therefore, it nephrolithiasis [8-10], the present study is the first to might be difficult to detect the initial stage of secondary establish a lower limit for this ratio. hyperparathyroidism in VDD patients only by U-Ca/Cr. A low U-Ca/Cr was found to be related to second- U-Ca/Cr levels could also be influenced by the sup- ary hyperparathyroidism in both the VDDR1A broth- ply of calcium. When a calcium supply is not sufficient, ers and the VDD patients. In the five VDD patients, U-Ca/Cr could be low with or without hyperparathy- intact-PTH rose sharply at U-Ca/Cr ratios below 0.1 roidism in both VDDR1A patients and VDD patients. (mg/mg) (Fig. 4A), in agreement with a previous report Conversely, when a calcium supply by oral intake or by on the relationship between intact-PTH and serum ion- excess active vitamin D transiently exceeds the storage ized calcium [11]. On the other hand, the relationships capacity in the bone, U-Ca/Cr could be more than 0.1 between intact-PTH and U-Ca/Cr in the two broth- (mg/mg) even when intact-PTH levels are high in both ers were more linear (Fig. 3A, B). This is because the VDDR1A patients and VDD patients. Therefore, it is range of intact-PTH was kept much lower in the two necessary to assess U-Ca/Cr and other parameters such brothers than in the VDD patients as a result of thera- as serum Ca and intact-PTH, in light of the supply of peutic intervention. calcium, in order to accurately evaluate calcium deple- U-Ca/Cr might be more sensitive than PTH for tion and secondary hyperparathyroidism. calcium depletion in the body in VDDR1A patients. The dose of alfacalcidol (µg/kg) that the VDDR1A Indeed, U-Ca/Cr ratios less than 0.1 (mg/mg) were not brothers were administered around puberty might always related with high serum intact-PTH levels in the reflect the physiological levels of active vitamin D VDDR1A brothers (Fig. 3A, B and 4C). Such data were in normal adolescents, because the mutations that the often obtained just before and after secondary hyper- brothers have are considered as null function mutations parathyroidism became overt. Therefore, it would be and because the growth rate of the brothers appeared suggested that when calcium depletion begins to occur, to be normal. Indeed, in normal subjects the level of the reabsorption of calcium in the kidneys, which is 1,25(OH)2D showed a sharp increase in early pubertal independent of PTH signaling [12], precedes the mobi- stage followed by subsequent decrease in late puber- lization of calcium from the bone to maintain serum Ca tal stage [13]. A previous report showed that the dose levels within normal range. It would be also suggested of calcitriol (µg/day) given to VDDR1A patients was that the reabsorption lasts until net calcium in the body, increased in pubertal period [5], though it is unclear especially in the bone, is satisfied. From these view- whether the dose per body weight was also increased. points, U-Ca/Cr would not always reflect secondary We found that the amount of active vitamin D (i.e., hyperparathyroidism but could serve as an indicator alfacalcidol (µg/kg)) required during puberty is more of calcium depletion in the body. Furthermore, U-Ca/ than the amounts required in the periods before and Cr may be beneficial in detecting calcium depletion in after puberty. patients with hypoparathyroidism who do not prop- It is possible that the episodes of hypocalcemia of U-Ca/Cr in detecting secondary HPT 67 the brothers around puberty were caused by depletion to maintain serum calcium, because the brothers’ %TRP of oral calcium intake, and could have been corrected was high when they were hyperphosphatemic and hypo- with calcium supplementation. Indeed, the demands calcemic simultaneously. It is well known that when for calcium intake and bone mineral content per height patients with vitamin D deficiency who show hypocal- increase starting from 9 years of age and peak at 13-14 cemia concomitant with hyperphosphatemia were often years of age [14]. During this period calcium require- misdiagnosed as pseudohypoparathyroidism type 2 [17, ments would be more than 1000 mg/day [14]. As the 18], which is defined by normal cyclic AMP production brothers exhibited hypocalcemia around puberty, we without phosphaturia by PTH. When the deficiency of cannot exclude the possibility that they had a defi- vitamin D is not severe, the effect of vitamin D action on ciency of calcium intake. increasing serum phosphate might be stronger than the It is unclear why blood examinations showed hyper- phosphaturic effect of PTH. phosphatemia together with hypocalcemia and high In conclusion, measuring U-Ca/Cr is a simple and intact-PTH levels (104-141 pg/ml) around puberty in the useful method of detecting body calcium depletion in VDDR1A brothers. One possibility is that the dose of VDDR1A patients. U-Ca/Cr should be evaluated with alfacalcidol that they were given was not enough, result- intact-PTH and serum Ca as well as calcium supply to ing in a condition resembling the early phase of vita- diagnose calcium depletion and secondary hyperpara- min D deficiency. Previous reports showed that vitamin thyroidism precisely. D deficient rickets patients exhibit hypocalcemia with normal to elevated phosphate levels in the early phase Disclosure [15, 16]. Another possibility is that the dose of active vitamin D that was needed to maintain serum phosphate None of the authors have any potential conflicts of within the normal range was less than the dose needed interest associated with this research.

References 1. Liu P, Oyajobi BO, Russell RG, Scutt A (1999) thesis, secretion, action, and metabolism. Physiol Rev Regulation of osteogenic differentiation of human bone 64: 985–1053. marrow stromal cells: interaction between transforming 8. De Santo NG, Di Iorio B, Capasso G, Paduano C, growth factor-β and 1, 25 (OH) 2 vitamin D3 in vitro. Stamler R, et al. (1992) Population based data on uri- Calcif Tissue Int 65: 173–180. nary excretion of calcium, magnesium, oxatate, phos- 2. Christakos S, Ajibade DV, Dhawan P, Fechner AJ, phate and uric acid in children from Cimitile (southern Mady LJ (2010) Vitamin D: Metabolism. Endocrinol Italy). Pediatr Nephrol 6: 149–157. Metab Clin North Am 39: 243–253. 9. Kruse K, Kracht U, Kruse U (1984) Reference values 3. Chen RA, Goodman WG (2004) Role of the calcium- for urinary calcium excretion and screening for hyper- sensing receptor in parathyroid gland physiology. Am J calciuria in children and adolescents. Eur J Pediatr 143: Physiol Renal Physiol 286: F1005–1011. 25–31. 4. Kitanaka S, Takeyama K, Murayama A, Sato T, 10. Sargent JD, Stukel TA, Kresel J, Klein RZ (1993) Okumura K, et al. (1998) Inactivating mutations in Normal values for random urinary calcium to creatinine the 25-hydroxyvitamin D3 1alpha-hydroxylase gene ratios in infancy. J Pediatr 123: 393–397. in patients with pseudovitamin D-deficiency rickets. N 11. Brown EM (1983) Four-parameter model of the sigmoi- Engl JMed 338: 653–661. dal relationship between parathyroid hormone release 5. Edouard T, Alos N, Chabot G, Roughley P, Glorieux FH, and extracellular calcium concentration in normal and et al. (2011) Short- and long-term outcome of patients abnormal parathyroid tissue. J Clin Endocrinol Metab with pseudo-vitamin D deficiency rickets treated with 56: 572–581. calcitriol. J Clin Endocrinol Metab 96: 82–89. 12. Toka HR, Al-Romaih K, Koshy JM, DiBartolo S 3rd, 6. Wang JT, Lin CJ, Burridge SM, Fu GK, Labuda M, et Kos CH, et al. (2012) Deficiency of the calcium-sens- al. (1998) Genetics of vitamin D 1alpha-hydroxylase ing receptor in the kidney causes parathyroid hormone- deficiency in 17 families. Am J Hum Genet 63: 1694– independent hypocalciuria. J Am Soc Nephrol 23: 1879- 1702. 1890. 7. Habener JF, Rosenblatt M, Potts JT Jr (1984) 13. Aksnes L, Aarskog D (1982) Plasma concentrations of Parathyroid hormone: biochemical aspects of biosyn- vitamin D metabolites in puberty: effect of sexual mat- 68 Miyai et al.

uration and implications for growth. J Clin Endocrinol 16. Kruse K (1995) Pathophysiology of calcium metabo- Metab 55: 94-101. lism in children with vitamin D-deficiency rickets. J 14. Vatanparast H, Bailey DA, Baxter-Jones AD, Whiting Pediatr 126: 736–741. SJ (2010) Calcium requirements for bone growth in 17. Srivastava T, Alon US (2002) Stage I vitamin Canadian boys and girls during adolescence. Br J Nutr D-deficiency rickets mimicking pseudohypoparathy- 103: 575–580. roidism type II. Clin Pediatr (Phila) 41: 263-268. 15. Fraser D, Kooh SW, Scriver CR (1967) 18. Shriraam M, Bhansali A, Velayutham P (2003) Vitamin Hyperparathyroidism as the cause of hyperaminoacid- D deficiency masquerading as pseudohypoparathyroid- uria and phosphaturia in human vitamin D deficiency. ism type 2. J Assoc Physicians India 51: 619-620. Pediatr Res 1: 425–435.