Page 1of49 between this versionandtheVersionofrecord. Pleasecitethis articleasdoi:10.1002/biof.1415. through thecopyediting, typesetting, paginationandproofreadingprocess, whichmayleadtodifferences This istheauthormanuscript acceptedforpublicationandhasundergone full peerreviewbuthasnotbeen

# * * mail: mail: E +97248520076. Fax: +97248295278, Tel: Israel. Haifa, 31096, Galim Bat 1, Efron Technology, of Institute Israel – Technion Medicine, of Faculty Rappaport Laboratory,

formation: studies in humans,formation: in studies mice, andcultured macrophages These authorsThese contributed equally thiswork. to Address for correspondence: Claudia GrajedaIglesias, PhD, The Lipid Research Research Lipid The PhD, GrajedaIglesias, Claudia correspondence: for Address Claudia Claudia GrajedaIglesias 3 1 Leucine supplementationLeucine attenuates macrophage foamcell Department of Department Internal MedicineRambamHealth E, Care CampusRappaport and 2 Cardiovascular Center, DepartmentMedicine,ofInternal University Michigan of Lipid Research Laboratory,The RappaportFaculty Medicine, of Technion–Israel [email protected] Faculty of Medicine,Faculty of Technion–Israel Instituteof Haifa,Technology, Israel Author Manuscripttitle:RunningLeucine attenuates macrophagefoamcell formation

Hayek This article isprotected by copyright. All rights reserved. MedicalArbor,AnnCenter, Michigan, USA 1,3 Institute Institute of Technology, Haifa, Israel , Niroz AbuSaleh Niroz , 1 * # , Oren RomOren , .

BioFactors 2

,Shadi Hamoud 1 and Michael Aviram Michael and 3# , Nina Volkova Nina , 1

1 , Tony ,

ABSTRACT arpae iohnra rsiain n AP rdcin Te bv studies, for role protective above a highlight macrophages, The cultured and mice, production. human, in conducted ATP and respiration mitochondrial macrophage depth investigation of the role of leucine in macrophage lipid metabolism was conducted conducted was metabolism lipid macrophage in leucine of role the of investigation depth in an study, current the In system. model macrophage the in properties atherogenic anti has leucine that showed weRecently, atherogenesis. early of hallmark a formation, foamcell macrophage to acids is amino dietary of little contribution possible relatively the about known studied, largely been has lipids dietary of atherogenicity Whereas arpae wr tetd ih eoscpot (I) a e luie metabolite. both when leucine Finally, key observed a (KIC), were αketoisocaproate with effects treated were Similar macrophages macrophages. catalyzing in enzyme biosynthesis key a triglyceride (DGAT1), acyltransferase1 diacylglycerol of regulation down concurrent a with rate, biosynthesis triglyceride and low (VLDL) lipoproteins very density of mass. uptake attenuated triglyceride showed mM) (0.2 and leucine with treated cholesterol Macrophages cellular decreased dosedependently leucine that revealed macrophages murine J774A.1 in reduced Studies with rate. biosynthesis relation cholesterol in (MPM) macrophages peritoneal harvested their in content cholesterol decreased in resulted weeks) (8 mice C57BL/6 to supplementation leucine of rate the Similarly, macrophages. from inhibiting efflux cholesterol increasing and by biosynthesis cholesterol mass cholesterol cellular decreased significantly weeks) 3 g/d, (5 leucine with supplemented adults healthy from obtained serum with incubation Macrophage leucine. with macrophages cultured or mice, humans, supplementing by

Luie αktioarae mcohgs lpd eaoim foamcell metabolism, formation lipid macrophages, αketoisocaproate, Leucine, Author:Keywords the to ofmetabolismcholesterol, triglycerides, energyand production. related mechanisms by formation foamcell macrophage attenuating leucine Manuscript

n vivo in This article isprotected by copyright. All rights reserved. and n vitro in John Wiley&Sons ecn splmnain infcnl improved significantly supplementation leucine BioFactors 2 Page 2of49

Page 3of49

Abbreviations: Abbreviations:

aie DFA 2,′dclrfursiictt; IC fluoresceinisothiocyanate; FITC, 2′,7′dichlorofluorescindiacetate; DCFHDA, saline; buffered phosphate PBS, medium; Eagle’s modified Dulbecco's DMEM, acid; isovaleric IVA, βhydroxyβmethylbutyrate; HMB, ischemia/reperfusion; I/R, deficient; receptor myocardial infarction; apoE infarction; myocardial MI, diet; highfat HFD, acids; amino branchedchain BCAA, diseases; cardiovascular CVD, αketoisocaproate; KIC, acyltransferase1; diacylglycerol DGAT1, lipoproteins; Author Manuscript BCKDH, aminotransferase; branchedchainαketoacid dehydrogenase. branchedchain BCAT, lipoproteins; highdensity HDL, rate; consumption oxygen OCR, chromatography; thinlayer TLC, counting; scintillation liquidLSC, aggregatedLDL; AggLDL, species; oxygen ROS,reactive Collection; Culture Type American cyanide4 ATCC, ratio; carbonyl waisttohip FCCP, WHR, phenylhydrazone; dehydrogenase; (trifluoromethoxy) lactate LDH, albumin; serum bovine BSA, serum; bovine fetal FBS, dimethylformamide; DMF, sulfoxide; dimethyl DMSO,

P, os prtna mcohgs VD, ey lowdensity very VLDL, macrophages; peritoneal mouse MPM, This article isprotected by copyright. All rights reserved. / , apolipoprotein E deficient; LDLR deficient; E apolipoprotein ,

John Wiley&Sons BioFactors / , lowdensity lipoprotein lowdensity , 3

A crucial early step in atherosclerosis development is the infiltration of monocytes from monocytes of infiltration the is development atherosclerosis in step early crucial A Atherosclerosis, a progressive disease characterized by the accumulation of lipids and and lipids of accumulation the by characterized disease progressive a Atherosclerosis, arpae tk u ntv ad oiid iortis acmlt lpd, n are and lipids, accumulate lipoproteins, modified and native up take macrophages intocirculation the arterialwherewallthe differentiate theyinto macrophages. (3), Intimal iru eeet i te ag atre () i te ahgnc eitr f most of mediator pathogenic the is (1), arteries cardiovascularleadingadiseases cause morbidity(CVD), mortality andof worldwide (2). large the in elements fibrous 1. INTRODUCTION transformed into foamcells, a hallmark feature of early atherogenesis (1, 4). Although a Although 4). (1, atherogenesis early of feature hallmark a foamcells, into transformed mrvn prmtr o ifamto, lo pesr, n isln resistance, insulin and pressure, blood inflammation, of parameters improving by cardioprotective be associations, BCAAwere to shown these intakes Despite 1317). (10, diseases cardiometabolic and obesity, dyslipidemia, with subjects in found were BCAAcirculating High distinct catabolic a pathwayshare (12). thatacids aminoessential relatedcardiometabolicand disorders. CVD atherosclerosis, of risk increased with associated been have 11), (10, glutamine and excess glutamate as well as (79), homocysteine metabolite, instance, its and (6), methionine dietary For risk. CVD and atherosclerosis, acids, amino specific between of onset the and relationship the formation regarding reported been have findings Controversial (5). atherosclerosis foamcell macrophage of process the to acids, amino as such components, dietary key other of contribution the about known is little relatively atherogenesis, and fat dietary between link the supports evidence of body considerable alr rt oe (2, n t ipoe eai setss y ouaig ii synthetic lipid modulating by steatosis hepatic improve to and (22), model rat failure heart a in effects (1921). cardioprotective possess women to shown and were BCAA men dietary in Moreover, development diabetes of risk decreased and obesity of prevalence lower with associated were and (18), conditions metabolic of independent

Author are valine, and isoleucine, leucine, (BCAA), acids amino Branchedchain Manuscript This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors 4 Page 4of49

Page 5of49

apoE in profile lipid plasma leucine Moreover, improved (30). supplementation survival postMI and function, structure, cardiac improved and apoptosis, and fibrosis attenuated diet highleucine a (MI), infarction myocardial experimental to subjected mice C57BL/6 In (29). women in atherosclerosis and stiffness arterial of measures improved with associated was intake leucine Recently, (28). mice tissue fed adipose (HFD) diet highfat in ameliorated resistance insulin and deposition, lipid and hepatic inflammation, (27), obesity, attenuated hypercholesterolemia leucine and Dietary (26). hyperglycemia, humans in and animals in studied been protein novo havemetabolism glucose andlipid in leucine of beneficialeffects The 25). (24, synthesis de in role known its beyond regulation, metabolic in properties unique has leucine that indicate evidence increasing Particularly, (23). mice obese in pathways effects of nicotinic acid administration in lowdensity lipoprotein receptor deficient (LDLR deficient receptor lipoproteinlowdensity administrationin acid nicotinic of effects atheroprotective and hypolipidemic the enhanced and (31), progression atherosclerotic 3) Hwvr ltl i kon bu te fet o luie n is eaoie in metabolites its and leucine of anti for screened have we Recently, effects atherogenesis. or formation cell macrophagefoam the about known is little However, (33). hearts mouse isolated in injury (I/R) ischemiareperfusion attenuated by demonstrated recently was catabolism, leucine from metabolite first the KIC, of role cardioprotective / metabolic effects of leucine catabolismderived metabolites ( metabolites catabolismderivedleucine of effects metabolic arpae ii mtbls ad h cnoiat omcl frain rcs by process formation foamcell in concomitant leucine the of and role metabolism the lipid elucidate macrophage to aims investigation current The unclear. remain inhibit macrophage foamcell formation formation foamcell macrophage inhibit ecn a a oet mn ai wih oedpnety erae macrophage decreased dosedependently which content triglyceride and cholesterol acid amino potent identified a and as system, leucine model macrophage a using acids amino proatherogenic or ) mice mice (32). )

Author the study to interest growing a is there metabolism, in role Manuscript unique its to Due This article isprotected by copyright. All rights reserved. (34). Nevertheless, whether leucine is able to able is leucine whether Nevertheless, (34). vitro in John Wiley&Sons BioFactors ad t lpdlwrn mechanisms, lipidlowering its and vivo, in Figure 1 Figure / ie rtcig from protecting mice ). For instance, the instance, For ). 5

Aldrich (St. Louis, MO, USA). KIC (Alfa Aesar H60076) and HMB (Alfa Aesar 42722) 42722) Aesar (Alfa HMB and H60076) Aesar (Alfa KIC USA). MO, Louis, (St. Aldrich . m) ad hshts ihbtr okal P76, ee ucae fo Sigma from purchased were (P5726), cocktail inhibitor phosphatase and mM), 2.5 sulfoxide (DMSO, D8418), dimethylformamide (DMF, 227056), glucose solution (G8769, solution glucose 227056), (DMF,dimethylformamide D8418), (DMSO, sulfoxide from Roche Diagnostics (Mannheim, Germany). Leucinedeficient DMEM, heat heat DMEM, Leucinedeficient Germany). (Mannheim, Diagnostics Roche from streptomycinnystatin solution, were purchased from Biological Industries (Beit Haemek, (Beit Industries Biological from purchased were solution, streptomycinnystatin ictt (CHD, 68) furseniohoynt (IC F20, dimethyl F7250), (FITC, fluoresceinisothiocyanate D6883), (DCFHDA, diacetate (11491458) and protease inhibitor cocktail tablets (cOmplete 11231400) were obtained obtained were 11231400) (cOmplete tablets cocktail inhibitor protease and (11491458) oim yuae ouin 10M, ltmn slto (0 m) ad penicillin and mM), (200 solution Lglutamine (100mM), solution pyruvate sodium T2449 triglyceride reagent and the F6428 free glycerol reagent), 2′,7′dichlorofluorescin reagent), glycerol free F6428 the and reagent triglyceride T2449 were purchased from Tzamal DChem Laboratories Ltd. Cholesterol measurement kit kit measurement Cholesterol Ltd. Laboratories DChem Tzamal from purchased were nciae ftl oie eu (B) bvn srm lui slto (S, 10%), (BSA, solution albumin serum bovine (FBS), serum bovine fetal inactivated sal. [9,10 Israel). hsht bfee sln (B, 83) tilcrd dtriain i (otiig the (containing kit determination triglyceride D8537), (PBS, saline buffered phosphate NT005C, n [1,2 and (NET003005MC), Materials 2.1. EXPERIMENTAL 2. PROCEDURES IVA)on acid, lipid weremetabolism assessedmacrophagethein system.model isovaleric or HMB, βhydroxyβmethylbutyrate, (KIC, catabolites leucine key of effects the Moreover, leucine. with macrophages cultured and mice, humans, supplementing hoaorpy D1 clms 1810) ee band rm E healthcare GE from obtained were (17085101) columns PD10 chromatography Lleucine (L8912), IVA (129542), Dulbecco's modified Eagle’s medium (DMEM, D5796), (DMEM, medium Eagle’s modified Dulbecco's (129542), IVA (L8912), Lleucine silica gel plates (60F254) were purchased from Merck (Darmstadt, Germany). Exclusion Exclusion Germany). (Darmstadt, Merck from purchased were (60F254) plates gel silica Perkin Elmer (Waltham, MA, USA). Lactate dehydrogenase (LDH) determination kit and kit determination (LDH) dehydrogenase Lactate USA). MA, (Waltham, Elmer Perkin (Buckinghamshire, UK). Bradford reagent was purchased from BioRad (Hercules, CA, (Hercules, BioRad from purchased was reagent Bradford UK). (Buckinghamshire, Author Manuscript

3 ()li ai (E290M) [ (NET289001MC), acid H(N)]oleic This article isprotected by copyright. All rights reserved. 3 ()hlseo (E190M) wr prhsd from purchased were (NET139001MC), H(N)]cholesterol John Wiley&Sons BioFactors 3 H]acetic acid sodium salt salt sodium acid H]acetic 6 Page 6of49

Page 7of49

A randomized interventional study was conducted in accordance with the principles of of principles the with accordance in conducted was study interventional randomized A Library of Medicine Libraryof ( the Declaration of Helsinki (ID: 056616RMB CTIL), and registered in the US National US the in registered and CTIL), 056616RMB (ID: Helsinki of Declaration the kind ofamino acidkind supplementswere excludedalso thestudy. from endocrinal condition, diabetes, cancer, or morbid obesity (BMI >40 kg/m >40 (BMI obesity morbid or cancer, diabetes, condition, endocrinal itcnlge (aio, I UA. DA rprto kt n Aslt Bu qPCR Blue Absolute and kit preparation cDNA USA). WI, (Madison, Biotechnologies consumption of more than two alcoholic drinks per day. Subjects who were using any using were who Subjects day. per drinks alcoholic two than more of consumption ewe 10 er od Te xlso ciei wr ay ea, umnr, or pulmonary, renal, any were criteria exclusion The old. years 1850 between 2.2. Clinical2.2. trial Fagronobtained from Inc(St.MN,Paul, USA). the first visit (baseline, 0 h), subjects were provided with a solution of leucine (5 g g (5 leucine of solution a with provided were subjects h), 0 (baseline, visit first the Epicentre from obtained was TM) (MasterPure kit purification RNA USA). 1250) ad ehre F el io tes et i (00510 including (103015100) Kit Test Stress Mito Cell XF Seahorse and (102353100), related procedures. The inclusion criteria were healthy male subjects, in the age range age the in subjects, male healthy were criteria inclusion The procedures. related itiuo, eah iv, sal. ecn apoe fr ua cnupin was consumption human for approved Lleucine Israel). Tikva, Petach distributor, Each volunteer was asked to fast overnight before the beginning of the study.day ofovernightofthe beginningbefore The the to fast volunteer Eachwas asked Leucine administration2.2.2. al amnsrto o luie a crid u fr wes Luie a poie in provided was Leucine weeks. 3 for out carried was leucine of administration daily ROX mix were purchased from Thermo Scientific (Epsom, UK). Seahorse XF medium XF Seahorse UK). (Epsom, Scientific Thermo from purchased were mix ROX were screened for eligibility after signing an informed consent document for all the studyinformedall anthe consent document signing eligibility for wereafter screened for f oeoeatmcn , ee rm ehre isine Aiet Technologies (Agilent Bioscience Seahorse from were A, rotenone/antimycin of dissolved in 250 mL of fresh water) which was consumed in a single dose. Afterwards, dose. single a in consumed was which water) fresh of mL 250 in dissolved Subjects were recruited at the Rambam Health Care Campus, Haifa, Israel. Volunteers Israel. Haifa, Campus, Care Health Rambam the at recruited were Subjects Study 2.2.1. population

Author Manuscript mix a and (FCCP), phenylhydrazone (trifluoromethoxy) cyanide4 carbonyl oligomycin, http://www.clinicaltrials.gov This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors ID: NCT03180775).ID: 2 ), smokers, or smokers, ), 7

% CO 5% Collection (ATCC, Rockville, MD, USA) and maintained in a humidified incubator (37 °C, (37 incubator humidified a in maintained and USA) MD,Rockville, (ATCC, Collection 2.2.4. 2.2.4. J774A.1 murine macrophagelike cell line was obtained from the American Type Culture Type American the from obtained was line cell macrophagelike murine J774A.1 calculated bycalculated dividing circumferencewaist by hip measures.circumference t aeie n a te n o te itr itreto (1 ) Ec priiat was participant Each d). (21 intervention dietary the of end the at and baseline at composition monitor (Tanita®, Tokyo, Japan) (36), and the waisttohip ratio (WHR) was (WHR) ratio waisttohip the and (36), Japan) Tokyo, (Tanita®, monitor composition Laboratory of Clinical Biochemistry of the Rambam Health Care Campus, Haifa, Israel, Haifa, Campus, Care Health Rambam the of Biochemistry Clinical of Laboratory i crufrne. et bd cmoiin a asse uig sgetl body segmental a using assessed was composition body Next, circumferences. hip ecn, lcs, ii poie lvr nye ad ea fnto, ee sesd t the at assessed were function, renal and enzyme, liver profile, lipid glucose, leucine, subjected to the following anthropometric measurements: body weight, height, waist and waist height, weight, body measurements:anthropometric following the to subjected supplements. Fasting blood samples were drawn from the patients on the first visit at at visit first the on patients the from drawn were samples blood Fasting supplements. 20 °C for further analyses. Biochemical parameters of the serum including the levels of of levels the including serum the of parameters Biochemical analyses. further for °C 20 water and consumed each morning throughout the study. Leucine dose (5 g/d) was set was g/d) (5 dose Leucine study. the throughout morning each consumed and water with their usual activities and dietary habits, and were advised to avoid any other dietary other any avoid to advised were and habits, dietary and activities usual their with each participant, serum was obtained by centrifugation (1000 g, 10 min) and stocked at at stocked and min) 10 g, (1000 centrifugation serum by was participant, obtained each yuae, upeetd ih .% S ad .% eu otie fo te leucine the from obtained serum 2.5% and BSA 0.2% with supplemented pyruvate), fresh in dissolved participants the which powder, soluble the of g 5 containing packages sodium pyruvate) supplemented with 5% heatinactivated FBS. For the the For FBS. heatinactivated 5% with supplemented pyruvate) sodium During the period between blood collections, the participants were allowed to continue to allowed were participants the collections, blood between period the During Anthropometric 2.2.3. and laboratory measures baseline, after 1 h of the first leucine dose (1 h), and at end of the study (21 d). From d). (21 study the of end at and h), (1 dose leucine first the of h 1 after baseline, MM 1 pncli/tetmcnnsai slto, % ltmn, % sodium 1% Lglutamine, 1% solution, penicillin/streptomycin/nystatin (1% DMEM up based onbased theup average leucine daily reportedadultsinintake (5.3±0.1 (35).g/d) xeiet, utrd 74. mcohgs ee nuae oengt n serumfree in overnight incubated were macrophages J774A.1 cultured experiments, supplemented participants at baseline, 1 h, or at 21 d. Serum concentration was chosen was concentration Serum d. 21 at or h, 1 baseline, at participants supplemented Exvivo 2

Author 1% Lglutamine, 1% solution, penicillinstreptomycinnystatin (1% DMEM in ) Manuscript

studies inhuman serumsupplemented J774A.1 macrophages This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors x vivo ex 8

Page 8of49

Page 9of49

Animal experiments were carried out in accordance with the Guide for the Care and Use Use and Care the for Guide the with accordance in out carried were experiments Animal conditions atconditionstheAnimal FacilityRappaportCare of the Faculty of Medicine, Technion. the benefitsofthe metabolic affectingleucineweight without intake or mice infood (30). gain od nae n bd wih o te ie ee oioe eey w ad ee days, seven and two every monitored were mice the of weight body and intake food poie b Evg, euae, sal wr be ad osd n pathogenfree in housed and bred were Israel) Jerusalem, Envigo, by (provided eevd tnad hw n wtr ih o upeetto, n 2 Leucine 2) and supplementation, no with water and chow standard received chow (average consumption). This dose was based on previous reports demonstrating reports previous on based was dose This consumption). (average chow provided by the manufacturer are detailed in the supporting information (Table S1). The S1). (Table information supporting the in detailed are manufacturer the by provided ehooy Apoa nme: L441) Ml C7L6 8wes l mice old 8weeks C57BL/6, Male IL0450416). number: (Approval Technology 2.3.2. Serumanalyses 2.3.2. ie ee admy iie i 2 xeietl rus n8: ) oto gop which group, Control 1) (n=8): groups experimental 2 in divided randomly were Mice Leucine administration2.3.1. tomice drinking water for 8 weeks. Leucine dose was set to double its amount provided by daily daily provided by amount its double to set was dose Leucine weeks. 8 for water drinking Data on the macronutrient and the amino acid composition of the standard chow as as chow standard the of composition acid amino the and macronutrient the on Data 2.3. Mice studyMice 2.3. metabolism).and Committee for Supervision of Animal Experiments of the Technion – Israel Institute of Institute Israel – Technion the of Experiments Animal of Supervision for Committee respectively,thecourseduringof 8week the study. supplemented group, which received standard chow and leucine (1%, w/v) via their their via w/v) (1%, leucine and chow standard received which group, supplemented eaoim n ifrn el ye, uh s P ad uA hptm cls 3, 38). (37, cells hepatoma Fu5AH and MPM as such types, cell different in metabolism of Laboratory Animals of the NIH, USA. The protocol for the study was approved by the the by approved was study the for protocol The USA. NIH, the of Animals Laboratory of lipid on addition serum human of effects the evaluating studies previous on based ee sesd s ecie i te olwn scin ( sections following the in described as assessed were

Author Manuscriptmetabolismlipids and content lipids macrophage on effects serummediated human The This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors 2.5. arpae ii contents lipid Macrophage 9

ots n lvr wr rpdy eoe fo te uhnzd ie n kp a 80°C. at kept and mice euthanized the from removed rapidly were livers and Aortas Materials section. DataMaterials section. were proteinnormalized to levels. os, P wr hretd rm h prtna fud o te uhnzd ie MPM mice. euthanized the of fluids peritoneal the from harvested were MPM mouse, determined spectrophotometrically using the commercially available kits described in the the in described kits availablecommercially the spectrophotometricallyusing determined he dy atr nrprtna ijcin f m o tigyolt (0 /) no each into g/L) (40 thioglycollate of mL 3 of injection intraperitoneal after days Three isofluraneanesthesia under mice the of plexusretroorbital the from collectedwas Blood ne ntoe. h aons f otc r ie coetrl r rgyeie were triglycerides or cholesterol liver or aortic of amounts The nitrogen. under 2.3.4. Mouse peritoneal 2.3.4. Mouse macrophages (MPM) isolationand culture aorta) were cleared of adhering fat and connective tissue before further analyses. Aorta analyses. further before tissue connective and fat adhering of cleared were aorta) were then plated and incubated in a humidified incubator (37°C, 5% CO 5% (37°C, incubator humidified a in incubated and plated then were upeetd ih % etiatvtd B, o frhr ii cnet n metabolism and content lipid further for FBS, heatinactivated 5% with supplemented homogenates with hexane:isopropanol (3:2, v:v), and the hexane phase was evaporatedwas phase hexane the and v:v), (3:2, hexane:isopropanolwith homogenates by centrifugation (1000 g, 10 min). Serum cholesterol and triglycerides were measured were triglycerides and cholesterol Serum min). 10 g, (1000 centrifugation by ots icuig h acnig ot, h ari ac, n te ecnig thoracic descending the and arch, aortic the aorta, ascending the (including Aortas phosphatase inhibitor cocktails) using a Polytron Homogenizer (Kinematica AG, Littau, AG, (Kinematica Homogenizer Polytron a using cocktails) inhibitor phosphatase eiilnsrpoyiyttn ouin 1 Lguaie 1 sdu pyruvate) sodium 1% Lglutamine, 1% solution, penicillinstreptomycinnystatin 3) T ass te otc r ie lpd opsto, iis ee xrce fo the from extracted were lipids composition, lipid liver or aortic the assess To (39). (via inhalation) after overnight fasting. The serum was separated from the clotted blood clotted the from separated was serum The fasting. overnight after inhalation) (via r ie smls ee ooeie i PS cnann poes ihbtr and inhibitor protease (containing PBS in homogenized were samples liver or g, 20 min) and the supernatants were analyzed for protein levels by the Lowry assay assay Lowry the by levels protein for analyzed were supernatants the and min) 20 g, sn te omrily vial kt dtie i te aeil scin Srm leucine Serum section. Materials the in detailed kits available commercially the using 2.3.3. Aortic 2.3.3. and analyses liver lipid Switzerland) at 60W for 1 min. Aorta or liver homogenates were then centrifuged (5000 centrifuged then were homogenates liver or Aorta min. 1 for 60W at Switzerland) BiochemistryoftheRambamHealth CareHaifa, Campus, Israel.

Author Manuscript Clinical of Laboratory the at assessed were (34), HPLC by determined levels, This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors 2 ) in DMEM (1% (1% DMEM in ) 10 Page 10of49

Page 11of49

37°C. Next, the cells were washed with PBS (2x), and the adherent cells were detached were cells adherent the and (2x), PBS with washed were cells the Next, 37°C. 4) Cls ee nuae wt DFA 1 , n B) n h dr fr 0 i at min 40 for dark the in PBS) in M, (10 DCFHDA with incubated were Cells (45). evaluated in J774A.1 macrophages by the DCFHDA probe as previously described described previously as probe DCFHDA the by macrophages J774A.1 in evaluated by gentle scraping, resuspended in PBS, and transferred to special tubes. Measurementtubes. special to transferred and PBS, in resuspendedscraping, gentle by nrclua gnrto o ratv oye seis RS i mcohgs was macrophages in (ROS) species oxygen reactive of generation Intracellular 2.4.2. J774A.1 2.4.2. macrophage oxidative stress– DCFHDA assay Fisher,Thermo Israel). 0.1, 0.2, 1 and 2 mM) of leucine, KIC, HMB, or IVA. The range of concentrations was concentrations of range The IVA. or HMB, KIC, leucine, of mM) 2 and 1 0.2, 0.1, 2.4.1. J774A.1 2.4.1. macrophage toxicity proliferationand previous reports 34,(14, 4043). fe cl tetet ih ecn (. m) i a atmtd el one (ones II, (Countess counter cell automated an in mM), (0.2 leucine with treatment cell after supplemented with 5% heatinactivated FBS and increasing concentrations (0.02, 0.05, (0.02, concentrations increasing and FBS heatinactivated 5% with supplemented t mtblts KC r M (V pam lvl i aut ae o dsrbd, n on and described), not are adults in levels plasma (IVA HMB or KIC metabolites, its macrophages were assessed by measuring the release of LDH from the cells into the into cells the from LDH of release the measuring by assessed were macrophages expressed as LDH units/mg cell protein. J774A.1 macrophages counting was performed was counting macrophages J774A.1 protein. cell units/mg LDH as expressed eiilnsrpoyiyttn ouin 1 Lguaie 1 sdu pyruvate) sodium 1% Lglutamine, 1% solution, penicillinstreptomycinnystatin determined based on the physiological or supraphysiological plasma levels of leucine orleucine of levelssupraphysiological plasma physiologicalor the on based determined h efc o icesn lvl o luie r t mtblts n h txct o J774A.1 of toxicity the on metabolites its or leucine of levels increasing of effect The ( sections following the in described as studies, aH fr ellr rti qatfcto b te or asy 3) Rsls were Results (39). assay Lowry the by quantification protein cellular for NaOH, Rockville, MD, USA) were incubated overnight (20 h) in leucinedeficient DMEM (1% (1% DMEM leucinedeficient in h) (20 overnight incubated were USA) MD, Rockville, utr mdu (4 4) Te eann cls n h pae wr dsovd n . M 0.1 in dissolved were plates the in cells remaining The 44). (34, medium culture

Author Manuscript(ATCC, macrophages J774A.1 cultured metabolites, its or leucine with experiments For J774A.12.4. studymacrophage metabolism). This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors 2.5. 2.5. arpae ii cnet and contents lipid Macrophage 11

0.1 M NaOH for cellular protein determination by the Lowry assay (39). Cholesterol or or Cholesterol (39). assay Lowry the by determination protein cellular for NaOH M 0.1 described in the Materials section. The remaining cells in the plates were dissolved in dissolved were plates the in cells remaining The section. Materials the in described 2.5.1. Cellularcholesterol 2.5.1. or triglyceridequantification Macrophage2.5. contents lipid and metabolism Biosciences,LSRFortessa(BD San CA,Jose, USA). contents were determined spectrophotometrically using the commercially available kits kits available commercially the using spectrophotometrically determined were contents rgyeie ms vle wr nraie t clua poen ees I some In levels. protein cellular to normalized were values mass triglycerides BD a using performed and cytometry flow by made was fluorescence cellular of h hxn pae a eaoae udr irgn Clua coetrl r triglyceride or cholesterol Cellular nitrogen. under evaporated was phase hexane the ata, A UA. h rmiig el i ec wl wr wse wt PS (x2), PBS with washed were well each in cells remaining The USA). MA, Waltham, were collected and the [ the and collected were (triglyceridesrich lipoprotein, 50 g/mL) or with aggregated LDL (AggLDL, cholesterol (AggLDL, LDL aggregated with or g/mL) 50 lipoprotein, (triglyceridesrich Cellular lipids were extracted twice with a mixture of hexane:isopropanol (3:2, v:v), and v:v), (3:2, hexane:isopropanol of mixture a with twice extracted were lipids Cellular cnilto cutn (S) βcutr Pcad r Cr 20T, PerkinElmer, 2100TR, Carb Tri Packard (βcounter, (LSC) counting scintillation trial, at baseline, 1 h, or at 21 d. At the end of the incubation period, the efflux media efflux the period, incubation the of end the At d. 21 at or h, 1 baseline, at trial, xeiet, 74. mcohgs ee odd vrih (0 ) ih sltd VLDL isolated with h) (20 overnight loaded were macrophages J774A.1 experiments, 90 s, resulting in a turbid solution. Then, cells were washed with PBS (1x) and incubatedand (1x) PBSwith washed werecells Then, solution. turbida in resulting s, 90 h asne r rsne f .% eu otie fo te atcpns f h clinical the of participants the from obtained serum 2.5% of presence or absence the rich lipoproteins, 50 g/mL).duringisolatedLDLby50 AggLDLlipoproteins,vortexing the were rich prepared h at 37°C, followed by cell wash with PBS (x2) and further incubation for 3 h at 37°C, in in 37°C, at h 3 for incubation further and (x2) PBS with wash cell by followed 37°C, at h for 20 h with leucine (0.2 mM) in leucinedeficient DMEM. Next, macrophage lipids were lipids macrophage Next, DMEM. leucinedeficient in mM) (0.2 leucine with h 20 for J774A.1 macrophages weremacrophages preincubatedwith J774A.1 [ Human serummediated2.5.2. cholesterolefflux above.described

Author as determined were contents triglycerides or cholesterol cellular and extracted, Manuscript This article isprotected by copyright. All rights reserved. 3 H]labels in 500 L of each sample were determined by liquid by determined were sample each of L 500 in H]labels John Wiley&Sons BioFactors 3 H]labeled cholesterol (2.5 H]labeledcholesterol 1Ci/ml) for 12 Page 12of49

Page 13of49

[ of amount the and NaOH, M 0.1 in overnight solubilized n iia e pae, n dvlpd n eaeehraei ai (3:015 v:v:v). (130:30:1.5, acid hexane:ether:acetic in developed and plates, gel silica on sesd fe a hicbto pro a 3° wt [ with 37°C at period hincubation 4 a after assessed evaporation of the hexane phase, lipids were dissolved in CHCl in dissolved were lipids phase, hexane the of evaporation h mdu (6. eut wr epesd s srmmdae coetrl flx vs efflux cholesterol serummediated % as expressed were Results (46). medium the dniiain ad [ and identification, Macrophages were washed with PBS (1x) and the rate of triglycerides biosynthesis was biosynthesis triglycerides of rate the and (1x) PBS with washed were Macrophages Triglycerides 2.5.4. biosynthesis rate cpm/mgcellprotein. as nuain ie cls ee ahd ih B (2, n lpd wr etatd After extracted. were lipids and (x2), PBS with washed were cells time, incubation mediated cholesterol efflux corresponded to the % of total [ total of % the to corresponded efflux cholesterol mediated hlseo sos ee iulzd y oie ao uig n prpit sadr for standard appropriate an using vapor iodine by visualized were spots cholesterol 7C ih [ with 37°C rgyeie sos ee iulzd y oie ao uig n prpit sadr for standard appropriate an using vapor iodine by visualized were spots Triglycerides eure MM upeetd ih .% S (4 4, 8. t h ed f the of end the At 48). 47, (34, BSA 0.2% with supplemented DMEM serumfree the radioactivity in the efflux medium plus the radioactivity in the lysates. Human serum Human lysates. the in radioactivity the plus medium efflux the in radioactivity the plates, and developed in hexane:ether:acetic acid (130:30:1.5, v:v:v). Unesterified Unesterified v:v:v). (130:30:1.5, acid hexane:ether:acetic in developed and plates, Macrophage cholesterol biosynthesis rate was assessed after a 4 hincubation period at period hincubation 4 a after assessed was rate biosynthesis cholesterol Macrophage Cholesterol biosynthesis2.5.3. rate baseline. lysate was determined LSC. Total cellular [ cellular Total LSC. determined was lysate BSA (47). At the end of the incubation time, cells were washed with PBS (x2), and lipids and (x2), PBS with washed were cells time, incubation the of end the At (47). BSA were dissolved overnight in 0.1 M NaOH for cellular protein determination by the Lowry the by determination protein cellular for NaOH M 0.1 in overnight dissolved were isle i CHCl in dissolved were extracted with hexane:isopropanol (3:2, v:v). After hexane evaporation, lipids were lipids evaporation, hexane After v:v). (3:2, hexane:isopropanol with extracted were Author[ (39). assay Manuscript 3 ]aei ai (. im) n eure MM upeetd ih 0.2% with supplemented DMEM serumfree in Ci/mL) (3.3 acid H]acetic 3 H]labels counts were normalized to cellular protein levels, and expressed and levels, protein cellular to normalized were counts H]labels

3 and separated by thinlayer chromatography (TLC) on silica gel gel silica on (TLC) chromatography thinlayer by separated and 3 ]lbl wr cutd y S. h rmiig el i te plate the in cells remaining The LSC. by counted were H]labels This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors 3 H]cholesterol was calculated as the sum of sum the as calculated was H]cholesterol 3 ]oec cd 33 C/L in Ci/mL) (3.3 acid H]oleic 3 3 H]labels in 500 L of each of L 500 in H]labels H]cholesterol released into released H]cholesterol 3 and separated by TLC by separated and 13

[ and identification, VLDL and LDL were isolated from plasma of healthy humans by discontinuous density density discontinuous by humans healthy of plasma from isolated were LDL and VLDL 2.5.6. Isolationoflipoproteins cpm/mgcellprotein. as (x2) PBS with washed were cells procedure, rate biosynthesis triglyceride the Following Triglyceride 2.5.5. ratedegradation cpm/mgcellprotein. as assay (39). [ (39). assay rdet lrcnrfgto a peiul dsrbd 4, 9. LL rcin was fraction VLDL 49). (47, described previously as ultracentrifugation gradient At BSA. 0.2% with supplemented DMEM serumfree in h 4 additional for incubated and the plate were dissolved in 0.1 M NaOH for cellular protein determination by the Lowry the by determination protein cellular for NaOH M 0.1 in dissolved were plate the were dissolved overnight in 0.1 M NaOH for cellular protein quantification by the Lowry the by quantification protein cellular for NaOH M 0.1 in overnight dissolved were ee xrce. [ extracted. were eaae a d 106gm, n LLfato a d 103 Poen ocnrto was concentration Protein 1.063. d= at fraction LDL and g/mL, 1.006 d= at separated lipids and (x2) PBS with washed were cells period, incubation second the of end the assay (39). [ (39). assay sltd LL 08 gm) ee aeld ih IC 02 gm DF a previously as DMF) mg/mL (0.2 FITC with labelled were mg/mL) (0.8 VLDL Isolated washed (x2) and resuspended in PBS to be transferred to special tubes. The uptake of uptake The tubes. special to transferred be to PBS in resuspended and (x2) washed 2.6. Assessment2.6. ofmitochondrial function in macrophages 2.5.7. Lipoprotein 2.5.7. labelingVLDLanduptake analysis bydetermined theBradford proteinassay. VLDL (24 g/mL) in serumfree DMEM supplemented with 0.2% BSA. Next, cells were cells Next, BSA. 0.2% with supplemented DMEM serumfree in g/mL) (24 VLDL LSRFortessa, BDBiosciences,LSRFortessa, San CA,Jose, USA) 51).(34, described (34, 50). Macrophages were incubated for 4 h at 37°C with FITCconjugated with 37°C at h 4 for incubated were Macrophages 50). (34, described Author (BD cytometry flow by determined was macrophages the by VLDL FITCconjugated Manuscript 3 3

H]labels counts were normalized to cellular protein levels, and expressed and levels, protein cellular to normalized were counts H]labels expressed and levels, protein cellular to normalized were counts H]labels

3 ]lbl wr aaye a dsrbd bv. h rmiig el in cells remaining The above. described as analyzed were H]labels 3 ]lbl wr cutd y S. h rmiig el i te plate the in cells remaining The LSC. by counted were H]labels This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors 14 Page 14of49

Page 15of49

T pouto, n mxml iohnra rsiain wr etmtd fe oxygen after estimated were respiration, mitochondrial maximal and production, ATP seeded in XF96 cell culture microplates (V3PS Seahorse Bioscience) and incubated at incubated and Bioscience) Seahorse (V3PS microplates culture cell XF96 in seeded iohnra ihbtr: lgmcn bok AP ytae, CP uculn agent, (uncoupling FCCP synthase), ATP (blocks oligomycin inhibitors: mitochondrial epciey t su dw mtcodil eprto) 5, 3. arpae were Macrophages 53). (52, respiration) mitochondrial down shut to respectively, inand J774A.1macrophages in measured was(OCR) rate consumption oxygen Cellular osmto rt (C) esrmns Ti apoc rqie te s of use the requires approach This measurements. (OCR) rate consumption iohnra ptnil, n rtnn ad niyi A ihbt opee I n III, and I complexes (inhibit A antimycin and rotenone and potential), mitochondrial For OCR measurement, stock solutions of oligomycin, FCCP, and a mix of rotenone and rotenone of mix a and oligomycin,FCCP, of solutions stock measurement, OCR For 7C 5 CO 5% 37°C, overnight with Seahorse XF Calibrant (200 L/well)nonCO a in (200 Calibrant withXF overnight Seahorse ae te ne mtcodil ebae emal fr rtn ad disrupts and protons for permeable membrane mitochondrial inner the makes incubation with 180 L of the same assay medium at 37°C in a CO a in 37°C at medium assay same the of L 180 with incubation allow media temperature and pH to reach equilibrium before the firstrate measurement. firstrate the before equilibrium reach to pH and temperature media allow MPM using a Seahorse Bioscience XF96 analyzer (Seahorse Bioscience, Billerica, MA) Billerica, Bioscience, (Seahorse analyzer XF96 Bioscience Seahorse a using MPM h asy eim wtot itrig h cl mnlyr rm ah el ad h 1 and well, each from monolayer cell the disturbing without medium, assay the antimycin A were prepared in assay medium and loaded into the appropriate ports ofthe ports appropriate the into loadedand medium assay in preparedwere A antimycin day of the experiment, the assay medium was prepared by supplementing Seahorse XF Seahorse supplementing by prepared was medium assay the experiment, the of day aaees f iohnra fnto, aeie arpae eprto, mitochondrial respiration, macrophage baseline function, mitochondrial of parameters kept at 37°C until use. The assay was initiated by carefully washing the cells (3x) with (3x) cells the washing carefully by initiated was assay The use. until 37°C at kept following the recommended procedure and conditions of the manufacturer. The key key The manufacturer. the of conditions and procedure recommended the following was adjusted to 7.4with was to Madjusted 0.1 NaOH, followed sterilization by andm),(0.22 by filtration previously hydrated sensor cartridge as follows: Port A: Oligomycin 1 M, 20 L; Port B: Port L; 20 M, 1 Oligomycin A: Port follows: as cartridge sensor hydrated previously Base Medium with 1 mM pyruvate, 2 mM glutamine, and 10 mM glucose, and the pH the and glucose, mM 10 and glutamine, mM 2 pyruvate, mM 1 with Medium Base FCCP 0.5 M, 22 L; Port C: Rotenone/antimycin A 100 M, 25 L. The corresponding The L. 25 M, 100 A Rotenone/antimycin C: Port L; 22 M, 0.5 FCCP measurement (4, 0, and 3 min, respectively) after each injection. Once the program program the Once injection. each after respectively) min, 3 and 0, (4, measurement

airto ad qiirto tms ee olwd y cce o mxn, atn, and waiting, mixing, of cycles 34 by followed were times equilibration Author and calibration Manuscript

2 for 20 h. The day prior to the assay, a sensor cartridge was hydrated hydrated was cartridge sensor a assay, the to prior day The h. 20 for This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors 2 incubator, at 37°C.The at incubator, 2 free incubator, to to incubator, free 15

compounds concentrations vs. control). The IndependentSamples T test was used to to used was test T IndependentSamples The control). vs. concentrations compounds ACGAATAGTAA C3 atsne primer, observations. primer, independent three least at of mean±SEM as presented are primer, Results antisense sense Statisticalanalysis2.8. antisense CD36 CD36 TCGGGGTCCTGAGTTATATTT. DGAT1 CAGCAGCAAAATCAAGGTTAAA; GGTCAAAAATACTCCTGTCCTG; TGGTGGAATGCTGAGTCTG; opr te en bten oe hn w eprmna gop (.. different (i.e. groups experimental two than more between means the compare control). p<0.05 control). was considered statistically significant. ujce t qC uig aMn ee xrsin sas ih RtrGn 6000 RotorGene a with assays expression gene TaqMan using qPCR to subjected eind y rmr ein Suh apo, K: GT sne primer, sense DGAT1 UK): Hampton, (South Design Primer by designed Chicago, IL, USA). Oneway ANOVA followed by Bonferroni posthoc tests were used to to used were tests posthoc Bonferroni by followed ANOVAOneway USA). IL, Chicago, opr te en bten w eprmna gop (.. pcfc opud vs. compound specific (i.e. groups experimental two between means the compare i. sn Aslt Bu qC RX i, rdcs f h rvre rncito were transcription reverse the of products mix, ROX qPCR Blue Absolute Using kit. oskeig ee Te rmr ue fr os DA1 C3, n GPH were GAPDH and CD36, DGAT1, mouse for used primers The gene. housekeeping ttsia aaye wr promd sn SS 1. sfwr (PS n. IBM, Inc. (SPSS software 17.0 SPSS using performed were analyses Statistical purification kit. cDNA was generated from 1 g of total RNA with ThermoScientific cDNAThermoScientific with RNA total of g 1 from generated was cDNA kit. purification mlfcto dtcin ytm mN dt wr nraie t GPH sd s the as used GAPDH to normalized were data mRNA system. detection amplification the by determined were well each in samples the of concentrations protein finished, Total RNA was extracted from J774A.1 macrophages with MasterPureTM RNA RNA MasterPureTM with macrophages J774A.1 from extracted was RNA Total Quantitative2.7. chainpolymerasereaction (qPCR) pmol/min/mgcellprotein. respiration, ATPproduction,respiration, and maximalweremitochondrialand reportedrespiration, in

Author Manuscriptbasal mitochondrialcalculate to used were results OCR Mitochondrial (39). assay Lowry This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors 16 Page 16of49

Page 17of49

h efcs f ecn o srm teoeiiy ee tde i haty ae adults male healthy in studied were atherogenicity serum on leucine of effects The supplementationhealthy to volunteers leucine following harvested serum human of properties Antiatherogenic 3.1. RESULTS 3. h rt o coetrl isnhss n coetrl flx Acrigy J774A.1 Accordingly, efflux. cholesterol and biosynthesis cholesterol of rate the supplemented with leucine (5 g/d). Seven of the eight participants recruited completed recruited participants eight the of Seven g/d). (5 leucine with supplemented n hlseo mtbls i J7A1mcohgs ee tde nx b determining by next studied were macrophages J774A.1 in metabolism cholesterol on eu cmae t bsln srm b 1% p<0.05, 15%, (by serum baseline to compared serum observed decrease in macrophage cholesterol content, the effects of the human serum human the of effects the content, cholesterol macrophage in decrease observed the instructions on leucine supplementation throughout the whole period (3 weeks), and weeks), (3 period whole the throughout supplementation leucine on instructions the ape. hlseo cnet a sgiiaty eue i cls nuae wt 2 d 21 with incubated cells in reduced significantly was content Cholesterol samples. increased byincreased 36%, from 159.4±10.3 baseline,Mup to 217.3±23.6at at 21 d (p<0.05). upeetto o mcohg atherogenicity macrophage on supplementation nuae fr 0 i srmfe DE splmne wt 25 hmn serum human 2.5% with supplemented DMEM serumfree in h 20 for incubated ecn srm ees ee infcnl hge a te n o te nevnin and intervention the of end the at higher significantly were levels serum leucine n 2 d n7 e ec tm pit wr ue t suy h efcs f leucine of effects the study to used were point) time each per (n=7 d 21 and were included in the study. None of the participants reported any adverse effects related effects adverse any reported participants the of None study. the in included were in the age range of 2138 years, nonsmokers. All participants were nonobese adults, adults, nonobese were participants All nonsmokers. years, 2138 of range age the in glucose, lipid profile, and other biochemical parameters did not significantly change, change, significantly not did parameters biochemical other and profile, lipid glucose, subjects at baseline and at 21 d are shown in Table 1. The enrolled subjects were men were subjects enrolled The 1. Table in shown are d 21 at and baseline at subjects observed in body weight, body fat (%) or WHR, throughout the study. Whereas serum Whereas study. the throughout WHR, or (%) fat body weight, body in observed o h deay nevnin Atrpmti ad iceia caatrsis f the of characteristics biochemical and Anthropometric intervention. dietary the to ih ma BI f 4508 rne 2.83, n n sgiiat ifrne were differences significant no and 21.628.3), (range: 24.5±0.8 of BMI mean a with

Author h 1 baseline, at participants the from obtained were that samples serum Next, Manuscript This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors J7A1 arpae were macrophages J774A.1 vivo. ex iue 2A Figure ). To explain the the explain To ). 17

biosynthesis rate (by 11%, p<0.05, 11%, (by rate biosynthesis aeiesrm Mroe, ecn splmnain o 2 d eutd n significant a in resulted d 21 for supplementation leucine Moreover, baselineserum. cholesterol in reduction significant a showed dserum 21 with incubated macrophages 3.2. Lipidlowering3.2. effects andin MPM liver from leucinesupplemented mice p<0.01, p<0.01, ie oy egt o srm ii poie Tbe ) Hwvr luie significantly leucine However, 2). (Table profile lipid serum or weight, body mice nrae f h srm blt t idc coetrl flx rm arpae (10%, macrophages from efflux cholesterol induce to ability serum the of increase iia t te ua suy luie upeetto hd o infcn efcs n the on effects significant no had supplementation leucine study, human the to Similar decreased the cholesterol content in MPM by 30% (p<0.05, (p<0.05, 30% by MPM in cholesterolcontent the decreased ecnupeetd ie sgiiat erae n oh hlseo ad triglyceride and cholesterol both in decrease significant a mice leucinesupplemented trend toward decreased triglyceride content was found in aortas isolated from leucine from isolated aortas in found was content triglyceride decreased toward trend rgyeie otn bten oh rus ( groups both between content triglyceride leucine supplementation were observed in other tissues as well. In livers isolated from from isolated livers In well. as tissues other in observed were supplementation leucine ial, hl n sgiiat fet wr osre i te otc hlseo cnet a content, cholesterol aortic the in observed were effects significant no while Finally, 9, p<0.05, 59%, otn ws on (3, <.5 ad 5, <.1 respectively, p<0.01, 45%, and p<0.05, (13%, found was content significant decrease in cholesterol biosynthesis rate compared to the control group (by group control the to compared rate biosynthesis cholesterol in decrease significant upeetd ie i cmaio wt te oto gop b 5% p=0.052, 51%, (by group control the with comparison in mice, supplemented ogi mr isgt no h eaoi mcaim b wih ecn atnae lipid attenuates leucine which by mechanisms metabolic the into insight more gain To 3.3. Lipidlowering3.3. effects of inleucineJ774A.1 macrophages S1B cuuain n arpae, 74. mrn mcohgs ee nuae with incubated were macrophages murine J774A.1 macrophages, in accumulation odn, n AgD fr hlseo laig. n codne ih the with accordance In loading). cholesterol for AggLDL and loading, nraigcnetain o luie ih r ihu lpd odn (LLfr triglyceride for (VLDL loading lipid without or with leucine of concentrations increasing ). ).

Author ManuscriptFigure2C iue S1A Figure

). This article isprotected by copyright. All rights reserved. . oee, o infcn dfeec ws on i te MPM the in found was difference significant no However, ). Figure 2B Figure John Wiley&Sons BioFactors iue 3B Figure ) when compared with cells incubated withincubated cells with compared when ) . h lpdlwrn efcs of effects lipidlowering The ). Figure 3A Figure iue C n D and 3C Figure ) in relation with a with relation in ) data, data, vivo in Figure 18 ). ). Page 18of49

Page 19of49

s hw in shown As As leucine supplementation to J774A.1 macrophages was found to have a marked effect havemarked a to was J774A.1 leucine Asmacrophages supplementationfound to n arpae rgyeie isnhss ae a dtrie b mauig the measuring by determined was rate biosynthesis triglyceride macrophage on triglyceriderich lipoproteins by macrophages (e.g. VLDL) (54, 55). The effect of leucine of effect The 55). (54, VLDL) (e.g. macrophages by lipoproteins triglyceriderich iue S2 Figure rate of cellular triglyceride biosynthesis, the rate of their hydrolysis, and the uptake of uptake the and hydrolysis, their of rate the biosynthesis, triglyceride cellular of rate (0.2 mM) inhibited the accumulation of cholesterol in macrophages loaded with AggLDL. with loaded macrophages in cholesterol of accumulation the inhibited mM) (0.2 cholesterol bymassto30% upat0.21.0 mM (p<0.001, assessed next in J774A.1 macrophages treated with nontoxic levels of leucine (0.2 mM,leucine(0.2 levelsof nontoxic with treated macrophages J774A.1in next assessed whichwasin leucinetreatedsignificantly attenuated the cells(by34%, p<0.001). macrophage in decrease dosedependent a induced supplementation leucine f eraig arpae rgyeie cuuain mtbls o tilcrds was triglycerides of metabolism accumulation, triglyceride macrophage decreasing of infcn ices i coetrl as n oto mcohgs 22fl, p<0.001), (2.2fold, macrophages control in mass cholesterol in increase significant macrophage triglyceride content, from 23% already at 0.02 mM (p<0.05), up to 56% at 56% to up (p<0.05), mM 0.02 at already 23% from content, triglyceride macrophage macrophages, macrophages significant increase in cellular triglyceride mass (66%, p<0.001), the triglyceride content triglyceride the p<0.001), (66%, mass triglyceride cellular in increase significant <.0, s LLlae mcohgs ad y 7, <.5 v nonloaded vs p<0.05, 37%, by and macrophages; VLDLloaded vs p<0.001, .. h efcs f ecn o tilcrd mtbls i clue J774A.1 cultured in metabolism triglyceride on leucine of effects The 3.4. h hge cnetain etd 2 M p<0.001, mM, (2 tested concentration higher the loaded macrophages. Whereas an overnight incubation with VLDL (50 g/mL) caused a caused g/mL) (50 VLDL with incubation overnight an Whereas macrophages. loaded 02 M t vle ee lwr hn hs osre i nnlae cls b 62%, (by cells nonloaded in observed those than lower even values to mM) (0.2 upeetto sgiiaty teutd h acmlto o tilcrds n VLDL in triglycerides of accumulation the attenuated significantly supplementation in VLDLloaded macrophages was significantly decreased after leucine supplementationleucine after decreased significantly was macrophages VLDLloaded in ecn tetet eutd n sgiiat n dseedn dces in decrease dosedependent and significant a in resulted treatment Leucine

Author the between balance a by determined is content triglyceride Macrophage ). Manuscript

iue 4B Figure Figure4D This article isprotected by copyright. All rights reserved. a oengt nuain ih 0 gm o AgD cue a caused AggLDL of g/mL 50 with incubation overnight an , ). ). John Wiley&Sons BioFactors iue 4C Figure Figure4A . n codne leucine accordance, In ). ). Accordingly, leucine ). 19

According to the catabolic pathway that characterizes BCAA, leucine is first converted toconverted first is leucine BCAA, characterizes that pathway catabolic the to According [ of incorporation oto cls 4% s 8, >.5 rsetvl) Uig IClbld LL leucine VLDL, FITClabeled Using respectively). p>0.05, 38%, vs (43% cells control nraig ocnrtos f I, M, r V ( m) ad hi efcs n lipid on effects their and mM), (02 IVA or HMB, KIC, of concentrations increasing eutd n nnsgiiat nrae f h tilcrd dgaain ae oprd to compared rate degradation triglyceride the of increase nonsignificant a in resulted 6A lo e xre b is eaoie, 74. mcohgs ee upeetd with supplemented were macrophages J774A.1 metabolites, its by exerted be also J774A.1 macrophages treated with leucine showed a marked decrement in triglyceride in decrement marked a showed leucine with treated macrophages J774A.1 ramn ws on t dces te arpae pae f LL y 0 (p<0.01, 20% by VLDL of uptake macrophage the decrease to found was treatment 3.5. KIC,the3.5.first metabolite,leucinedecreases macrophage lipidcontent I ( KIC caused a significant reduction in macrophage cholesterol mass (26%, p<0.01, p<0.01, (26%, mass cholesterol macrophage in reduction significant a caused eemn i te bevd rtcie fet o luie gis lpd cuuain can accumulation lipid against leucine of effects protective observed the if determine ih [ with contents were assessed. At the examined concentrations, these compounds showed no no showed compounds these concentrations, examined the At assessed. were contents transporter,CD36( treating the cells with KIC. Similar to leucine supplementation, KIC treatment (0.2 mM) (0.2 treatment KIC supplementation, leucine to Similar KIC. with cells the treating orsodn ayo drvtv (2, r lentvl, xdzd o M (7. To (57). HMB to oxidized alternatively, or (12), derivative acylCoA corresponding rgyeie i luietetd arpae ws tde atr nuaig el loaded cells incubating after studied was macrophages leucinetreated in triglycerides biosynthesis rate by 77% (p<0.001), compared to control cells. Accordingly, DGAT1, a DGAT1, Accordingly, cells. control to compared (p<0.001), 77% by rate biosynthesis iue 5C Figure eedn dces i clua tilcrd ad hlseo ms wr osre after observed were mass cholesterol and triglyceride cellular in decrease dependent yooi efcs n 74. mcohgs ( macrophages J774A.1 on effects cytotoxic infcnl dweuae (y 0, p<0.05, 30%, (by downregulated significantly e ezm i te rgyeie isnhtc aha i mcohgs 5) was (56), macrophages in pathway biosynthetic triglyceride the in enzyme key ) and triglyceride mass (50%, p<0.001, (50%, mass triglyceride and ) 3 ]oec cd n resrm eim Luie diin o utrd macrophages cultured to addition Leucine medium. freeserum in acid H]oleic Author 1 Figure Manuscript wt a oinfcn ted oad dcesd RA ees f its of levels mRNA decreased towards trend nonsignificant a with )

, hc i sbeunl dcroyae ad ovre t the to converted and decarboxylated subsequently is which ),

3 ]oec cd no ellr rgyeie. s hw in shown As triglycerides. cellular into acid H]oleic Figure5D This article isprotected by copyright. All rights reserved. ). John Wiley&Sons BioFactors Figure 6B Figure iue 5B Figure iue S3 Figure ), related to a marked inhibition of of inhibition marked a to related ), . diinly dgaain of degradation Additionally, ). . sgiiat n dose and significant A ). iue 5A Figure Figure 20 , , Page 20of49

Page 21of49

arpae oe sse, n ietfe luie s ptn aio cd be to able acid amino potent a as leucine identified and system, model macrophage s rwn eiec soig ht iohnra dsucin a b creae with correlated be may dysfunction mitochondrial that showing evidence growing is 3.6. 3.6. 6CF Recently, we have studied the anti or proatherogenic effects of all amino acids using a using acids amino all of effects proatherogenic or anti the studied have we Recently, (by 28, 31,and (by28, 36%, p<0.05, Given the importance of mitochondria in maintaining normal vascular cell function, there function, cell vascular normal maintaining in mitochondria of importance the Given mitochondrial function 4. DISCUSSION 4. status is affected by affected is status measured with an extracellular flux analyzer (Seahorse Bioscience XF96, Bioscience (Seahorse analyzer flux extracellular an with measured significant effects on macrophage cholesterol or triglyceride content were noted ( noted were content triglyceride or cholesterol macrophage on effects significant arpae omcl frain s hlmr faue f al ahrgnss 1 4). (1, atherogenesis early of feature hallmark a is formation foamcell Macrophage supplemented mice, a significant increase in the above three parameters was observed was parameters three above the in increase significant a mice, supplemented decrease macrophage lipid content lipid macrophage decrease teoeei ad V rs (8. o vlae o mcohg mtcodil energy mitochondrial macrophage how evaluate To (58). risk CVD and atherogenesis n otat uo adn icesn cnetain o HB r V ( m) no mM), (02 IVA or HMB of concentrations increasing adding upon contrast, In M, n i MM avse fo te ecnupeetd ie I J774A.1 In mice. leucinesupplemented the from harvested MPM in and mM), p<0.001, (73%, cells control the to compared rate biosynthesis triglyceride oprd o h cnrl el ( cells control the to compared C maueet wr md i J7A1 arpae nuae wt luie (0.2 leucine with incubated macrophage J774A.1 in made were measurements OCR p<0.001), ATP production (by 39%, p<0.001), and maximal respiration (by 25%, p<0.01) 25%, (by respiration maximal andp<0.001), 39%, (by production ATP p<0.001), arpae, ecn sgiiaty nrae mtcodil aa rsiain b 54%, (by respiration basal mitochondrial increased significantly leucine macrophages, ). Author Manuscript vitro In

and

and vitro in This article isprotected by copyright. All rights reserved. n vivo in Figure7EG ecn splmnain mrvs macrophage improves supplementation leucine iue 7BD Figure leucine supplementation, macrophage OCR was OCR macrophage supplementation, leucine vivo in (34). In the current investigation we studied, we investigation current the In (34). vitro in John Wiley&Sons BioFactors ). . codnl, n P fo te leucine the from MPM in Accordingly, ). Figure 7A Figure Figure S4 Figure Figure 21 ). ). ).

ii cnet nld ihbto o clua coetrl r rgyeie isnhss rate, biosynthesis triglyceride or cholesterol cellular of inhibition include content lipid cuuain s determined as accumulation the both time, first the for macrophages); 2) the metabolic mechanisms by which leucine decreases macrophage decreases leucine which by mechanisms metabolic the 2) macrophages); e fnig o te rsn suy r: ) ecn dcess arpae lipid macrophage decreases Leucine 1) are: study present the of findings key 1, 6 2, 0 3) Hg deay ecn itk hs en soitd ih lower with associated been has intake leucine dietary High 31). 30, 22, 16, (10, enhancement of cholesterol efflux from macrophages, and attenuation of VLDL uptake; VLDL of attenuation and macrophages, from efflux cholesterol of enhancement formation by supplementing humans, mice and cultured macrophages with leucine. The leucine. with macrophages cultured and mice humans, supplementing by formation Leucine has been shown to play an important cardiometabolic role and to affect CVD affect to and role cardiometabolic important an play to shown been has Leucine vitro metabolic regulation, beyond its fundamental role as substrate for protein synthesis (59). synthesis(59). protein for substrate as role beyondfundamental its regulation, metabolic prevalence of overweight status, obesity, and regulation of glucose homeostasis in mice in homeostasis glucose of regulation and obesity, status, overweight of prevalence our human clinical trial, a leucine dose of 5 g/d was set up based on the average leucineaverage the on based up set was g/d 5 of dose leucinea clinicaltrial, human our KIC, the first leucine metabolite, is able to mimic the lipidlowering effects of leucine of effects lipidlowering the mimic to able is metabolite, leucine first the KIC, itr poen, hc hs eevd ra atnin u t is nqe ucin in function unique its to due attention great received has which protein), dietary 3) leucine improves macrophage mitochondrial respiration mitochondrial macrophage improves leucine 3) identified, to date, no upper limit or safe intake for this BCAA have been established. In established. been have BCAA this for intake safe or limit upper no date, to identified, by OCR measurements; 4) unlike other examined leucine metabolites (HMB and IVA), IVA), and (HMB metabolites leucine examined other unlike 4) measurements; OCR by and humans (26). Since adverse effects of high intakes of leucine have not been clearly been not have leucine of intakes high of effects adverse Since (26). humans and daily intake reported in adults (5.3±0.1 g/d) (35). As a result, this daily dose allowed a a allowed dose daily this result, a As (35). g/d) (5.3±0.1 adults in reported intake daily infcn ices i luie eu vle a te n o te nevnin 2 d), (21 intervention the of end the at values serum leucine in increase significant quantified. Further studies involving longer dietary leucine interventions would be useful be would interventions leucine dietary longer involving studies Further quantified. eu lpd rfl, lcs cnetain r te bohmcl aaees ht were that parameters biochemical other or concentration glucose profile, lipid serum oprd o aeie aus I cnrs, ecnupeetto dd o afc the affect not did leucinesupplementation contrast, In values. baseline to compared by decreasing cholesterolmacrophage and triglyceridecontents.

Author Manuscript total of >20% for (accounting group BCAA the of acid amino key a is Leucine This article isprotected by copyright. All rights reserved. and vivo in (humans), vivo ex John Wiley&Sons roles of leucine in macrophage foamcell macrophage in leucine of roles vitro in BioFactors mc) and (mice), vivo in and vitro in (J774A.1 vitro in as shown as vivo in 22 in Page 22of49

Page 23of49

and subjects healthy in observed be can profile lipid serum in changes if determine to also in individualsinalso CVDincreased with risk. arpae omcl frain n hglgt h ne t suy h antiatherogenic the study to need the highlight and formation foamcell macrophage teut o idc lpd cuuain n utrd arpae (0. n h current the In (60). macrophages cultured in accumulation lipid induce or attenuate cholesterol efflux from the macrophages to HDL. The findings of the current clinical current the of findings The HDL. to macrophages the from efflux cholesterol hlseo boytei rt. utemr, h efc o luie upeetto on supplementation leucine of effect the Furthermore, rate. biosynthesis cholesterol time. Although leucine supplementation to healthy adults did not alter their serum lipid serum their alter not did adults healthy to supplementation leucine Although time. n h cpct o te Tidn cset tasotr AC1AC1 o facilitate to ABCA1/ABCG1 transporters cassette ATPbinding the of capacity the on decreased macrophage cholesterol content, paralleled with a decrease in macrophage in decrease a with paralleled content, cholesterol macrophage decreased s rtcl o mitiig ii hmotss n arpae, hs t measurement its thus macrophages, in homeostasis lipid maintaining for critical is role ofleucinerole larger incohorts,including CVDpatients. study, the effects of leucine on human serum atherogenicity were studied for the first first the for studied were atherogenicity serum human on leucine of effects the study, tde dmntae oe mtblc ehnss y hc luie inhibits leucine which by mechanisms metabolic novel demonstrate studies vivo eu otie fo priiat 2 d fe luie upeetto, significantly supplementation, leucine after d 21 participants from obtained serum serummediated cholesterol efflux from macrophages was evaluated. Cholesterol efflux efflux Cholesterol evaluated. was macrophages from efflux cholesterol serummediated rfl ad ny nrae luie ees icbto o J7A1 arpae with macrophages J774A.1 of incubation levels, leucine increased only and profile constitutes a predictor of atherosclerotic burden (61). By incubating the cells with human with cells the incubating By (61). burden atherosclerotic of predictor a constitutes cholesterol from macrophages (cholesterol efflux), as well as a possible effect of leucine of effect possible a as well as efflux), (cholesterol macrophages from cholesterol serum obtained at 21 d of leucine supplementation, a significant increase in the serum the in increase significant a supplementation, leucine of d 21 at obtained serum ucinl hne i te D prils wih ol ipoe hi aiiy o remove to ability their improve could which particles, HDL the in changes functional key mediator of cholesterol efflux from macrophages (61), was not changed by leucine by changed not was (61), macrophages from efflux cholesterol of mediator key oee, e ant icr a osbe aaiy f ecn t pooe tutrl and structural promote to leucine of capacity possible a discard cannot we However, mediated cholesterol efflux from macrophages was observed. Considering that HDL, the HDL, that Considering observed. was macrophages from effluxcholesterol mediated cholesterol homeostasis,cholesterol whichantiatherogenic ofHDL.independentof propertiesthe is upeetto, hs fnig hglgt n motn rl fr ecn i macrophage in leucine for role important an highlight findings these supplementation,

Author Manuscript to ability its by determined is serum human of proatherogenicity or Anti This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors 23 ex ex

arpae ioae rmte ecnupeetdmc, nrlto ih decreased with relation in mice, leucinesupplemented the from isolated macrophages macrophages (34), the (34),macrophagesthe current investigation J774A.1revealedtreatingmacrophages that hne hi pam lpd rfl, u sgiiaty eue coetrl otn in content cholesterol reduced significantly but profile, lipid plasma their change (31). Overall, findings from the current investigation, and from the above mentioned mentioned above the from and investigation, current the from findings Overall, (31). for the onset and progression of metabolic syndrome and atherosclerosis (63), the lipid the (63), atherosclerosis and syndrome metabolic of progression and onset the for atherosclerosis. hlseo isnhss ae oevr iia opeiu tde weeluie was leucine where studies previous to similar Moreover, rate. biosynthesis cholesterol cholesterol content in those in content cholesterol mice. Since accumulation of lipids in the liver (hepatic steatosis) represents a risk factor risk a represents steatosis) (hepatic liver the in lipids of accumulation Since mice. ise ii acmlto, hc i a e faue f oh at lvr ies and disease liver fatty both of feature key a is which accumulation, lipid tissue wellcardiometabolicofMPMinacid.benefits amino as indicatethe this are Our findings sgiiat erae n eai coetrl n tilcrds n leucinesupplemented in triglycerides and cholesterol hepatic in decrease significant a reports, support a beneficial role of leucine in lipid metabolism and its ability to inhibit inhibit to ability its and metabolism lipid in leucine of role beneficial a support reports, lowering effects currently observed in livers isolated from leucinesupplemented mice as mice leucinesupplemented from isolated livers in observed currently effects lowering found todecreasehepatic found triglyceridewithweaccumulation mice in(62), liver fatty found osset ih rvos tde ta dmntae te adomtblc rtcin by protection cardiometabolic the demonstrated that studies previous with consistent ecnupeetd ie hwd ted oad erae tilcrd content triglyceride decreased toward trend a showed mice leucinesupplemented h porsin f teoceoi paus n apoE in plaques atherosclerotic of progression the dietary leucine supplementation. For instance, doubling leucine intake in mice fed HFD, fed mice in intake leucine doubling instance, For supplementation. leucine dietary eraig LL n LL ad nraig D lvl, hc cnrbtd o attenuate to contributed which levels, HDL increasing and LDL, and VLDL decreasing resistance, glucoseand cholesterol metabolism,attenuated weightand gain(27). p002. eety luie a rpre t ipoe h srm ii poie by profile lipid serum the improve to reported was leucine Recently, (p=0.052). infcnl dcesd lsa oa coetrl n LL ees ipoe insulin improved levels, LDL and cholesterol total plasma decreased significantly

In accordance with the human study, leucine supplementation to mice did not not did mice to supplementation leucine study, human the with accordance In In accordance with our previous reports on the lipidlowering effects of leucine in leucine of effects lipidlowering the on reports previous our with accordance In

Author from isolated aortas that found we significance, statistical Manuscript without Although This article isprotected by copyright. All rights reserved.

mice was significantly reduced by leucine supplementation supplementation leucine by reduced significantly was mice John Wiley&Sons BioFactors / ie Mroe, h hepatic the Moreover, mice. 24 Page 24of49

Page 25of49

oevr bt AgDnue coetrl cuuain n VLDLinduced and accumulation cholesterol AggLDLinduced both Moreover, administration. concentrations of leucine resulted in a dosedependent reduction of cellular lipid content.lipid cellular of reductiondosedependent a inleucine resultedof concentrations mM) 2 and (1 supraphysiological and (43)) mM, 0.2 to (up physiological with concomitant foamcell formation (65, 66). In addition to attenuating macrophage VLDL macrophage attenuating to addition In 66). (65, formation foamcell concomitant triglyceride accumulation were significantly abolished by treating J774A.1 macrophages J774A.1 treating by abolished significantly were accumulation triglyceride aha i mcohgs 5) Hwvr ulk te rmnn ihbto o triglyceride of inhibition prominent the unlike However, (56). macrophages in pathway xlsv t te CA aaoi ptwy ctlzd y branchedchain by catalyzed pathway, catabolic BCAA the to exclusive eeomn (4. pae f LL otiue t tilcrd acmlto ad the and accumulation triglyceride to contributes VLDL of Uptake (64). development soitd ih onrglto o DA1 a e ezm i tilcrd biosynthetic triglyceride in enzyme key a DGAT1, of downregulation with associated arpae atr direct after macrophages ares f rgyeie n h bod iclto, n ae mlctd n atherosclerosis in implicated are and circulation, blood the in triglyceride of carriers pae luie asd mre dces i te ae f rgyeie biosynthesis triglyceride of rate the in decrease marked a caused leucine uptake, ecn b te el, ihihig h dfeet ucms eadn lpd eaoim in metabolism lipid regarding outcomes different the highlighting cells, the by leucine with physiological leucine levels. Interestingly, the the Interestingly, levels. leucine physiological with next decarboxylated and converted to its corresponding acylCoA derivative (isovaleryl derivative acylCoA corresponding its to converted and decarboxylated next cuuain bevd n ecnrae J7A1 arpae, ellr triglyceride cellular macrophages, J774A.1 leucinetreated in observed accumulation aminotransferase (BCAT) to generate KIC, a key leucine metabolite ( metabolite leucine key a KIC, generate to (BCAT) aminotransferase is directly added to the culture medium culture the to added directly is significantly attenuated the macrophage uptake of VLDL, which are major endogenous major are which VLDL, of uptake macrophage the attenuated significantly complex matrix of serum components, which are very likely to influence the utilization of utilization the influence to likely very are which components, serum of matrix complex could be explained by a different effect exerted on triglyceride metabolism when leucine when metabolism triglyceride on exerted effect different a by explained be could akd fet f ecn o mcohg tilcrd mtbls. is, leucine First, metabolism. triglyceride macrophage on leucine of effect marked o) i bacehi αkt ai dhdoeae BKH, o ial generate finally to (BCKDH), dehydrogenase acid αketo branchedchain via CoA) otn rmie uafce atr ecn supplementation leucine after unaffected remained content

Author reaction, transamination reversible first a comprises catabolism Leucine Manuscript This article isprotected by copyright. All rights reserved. ecn epsr vru oral versus exposure leucine vitro in John Wiley&Sons BioFactors in vitro in , while , , leucine is found in a more a in found is leucine vivo, in tde dmntae a demonstrated studies vitro in n vivo in Ti discrepancy This . Figure 1 Figure leucine vivo in ). KIC is KIC ). 25

According to previous studies, the effects observed after KIC cellsupplementation are cellsupplementation KIC after observed effects the studies, previous to According inhibition of mitochondrial ATP production and function by pharmacologic (oligomycin) or(oligomycin) pharmacologic by functionand production ATP mitochondrial of inhibition seta fr eaoi poess icuig ii hmotss I mcohgs the macrophages, In homeostasis. lipid including processes, metabolic for essential Leucine improved mitochondrial energetic status, represented by a significant increase significant a by represented status, energetic mitochondrial improved Leucine mice. Mitochondria are critical for cellular function and ATP generation, which is is which generation, ATP and function cellular for critical are Mitochondria mice. genetic (Pgc1α deletion) means, resulted in a significant reduction in cholesterol efflux cholesterol in reduction significant a in resulted means, deletion) (Pgc1α genetic in both leucinetreated J774A.1 macrophages and in MPM from leucinesupplemented from MPM in and macrophages J774A.1 leucinetreated both in h porsin f teoceoi i te apoE the in atherosclerosis of progression the in mitochondrial basal and maximal respiration, as well as mitochondrial ATP production, asATP wellmitochondrial as maximal basalandrespiration, mitochondrialin vitro capacity of the cells (68). Mitochondrial dysfunction has been mechanistically linked to linked mechanistically been has dysfunction Mitochondrial (68). cells the of capacity mitochondrial dysfunction in atherosclerosis (2). Therefore, we assessed the effects of effects assessed wethe Therefore, atherosclerosis(2). in dysfunctionmitochondrial models (40,models 67). n KC a b itrovre, eedn o te eaoi nes f h cl (12). cell the of needs metabolic the on depending interconverted, be can KIC and iey rsl o is rnaiain ak o ecn, s t a fud n ifrn cell different in found was it as leucine, to back transamination its of result a likely similar manner. Given the reversibility of the BCAT transamination reaction, both leucineboth reaction, transaminationBCAT the of reversibilitythe Given manner. similar involved in the pathway of cholesterol biosynthesis (57). Similar to leucine and unlike the unlike and leucine Similarto biosynthesischolesterol (57). of pathway the involvedin Moreover, KIC and leucine markedly inhibited the rate of triglyceride biosynthesis in a a in biosynthesis triglyceride of rate the inhibited markedly leucine and KIC Moreover, follow an alternative pathway via cytosolic oxidation to generate HMB, which might be might which HMB, generate to oxidation cytosolic via pathway alternative an follow eednl dcesd oh hlseo ad rgyeie otns n macrophages. in contents triglyceride and cholesterol both decreased dependently can KIC (12). acetoacetate) or (acetylCoA cycle acids tricarboxylic the for substrates other examined leucine metabolites, we found that treating macrophages with KIC dose KIC withmacrophages treating that found we metabolites, leucine examined other significantly increased cell proliferation and decreased the number of cells undergoing undergoing cells of number the decreased and proliferation cell increased significantly eutd n euto o ncoi cr aes n teoceoi paus n apoE in plaques atherosclerotic in areas core necrotic of reduction in resulted oxidative phosphorylation (69). On the other hand, augmented mitochondrial respiration mitochondrial augmented hand, other the On (69). phosphorylation oxidative and

arpae ii acmlto as rpeet oe f h mcaim for mechanisms the of one represents also accumulation lipid Macrophage

Author Manuscriptstatus. energetic mitochondrial macrophage on supplementation leucine vivo in This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors / ie oe, u i pr t dfcs in defects to part in due model, mice / mice, mice, 26 in Page 26of49

Page 27of49

augmented mitochondrial respiration, showed higher OCR after uncoupling with FCCP with uncoupling after OCR higher showed respiration, mitochondrial augmented and Fellowships on Food and Nutrition with Implications on Public Health of the Israeli the of Health Public on Implications with Nutrition and Food on Fellowships and genetically with mice atherosclerotic these from macrophages Also, apoptosis. Research, Prevention and Treatment of Atherosclerosis, the Fund for Research ProjectsResearch for Fund the Atherosclerosis, of Treatment and Prevention Research, rsiaoy eev cpct) ad nrae audne f oh mitochondrial both of abundance increased and capacity), reserve (respiratory The current work was supported by the Israel Medical Association and the Society for for Society the and Association Medical Israel the by supported was work current The Acknowledgements Ministry of Health (30000012135),Ministry Universityof and Michigan–Israel the of Partnership for overall favorable effects exerted by this unique amino acid involve multiple mechanisms, involvemultiple acid amino unique this by exerted effects favorable overall hs rcn fnig, h cpct o luie o nrae iohnra rsiain in respiration mitochondrial increase to leucine of capacity the findings, recent these the approachthe therapeutic ofleucine supplementation. osiue ptnil taey o teut ahrslrss eeomn. lal, the Clearly, development. atherosclerosis attenuate to strategy potential a constitute respiratory complexes I and III, compared with atherosclerotic controls (70). Based on Based (70). controls atherosclerotic with compared III, and I complexes respiratory periods of time, and the use of atherosclerotic models, are warranted to fully establish establish fully to warranted are models, atherosclerotic of use the and time, of periods eerh n Euain W tak r Mhod ajr D. ii ir ad r Dalit Dr. and Nimri Lili Dr. Najjar, Mahmoud Dr. thank We Education. and Research eaoim ih smlaeu ehneet f iohnra rsiain may respiration, mitochondrial of enhancement simultaneous a with metabolism n frhr netgto, nldn luie upeetto t hmn fr extended for humans to supplementation leucine including investigation, further and macrophages alak f al ahrgnss Tu, ecn aiiy o oiy arpae lipid macrophage modify to ability leucine Thus, atherogenesis. early of hallmark

eeld nvl niioy fet f ecn i mcohg fael omto, the formation, foamcell macrophage in leucine of effect inhibitory novel a revealed Esther Dar Dar Esthertheirfor valuable most advicescientific and assistance.technical amino acid,aminoalthough theunderlying molecular/biochemicalmechanisms remainunclear. metabolism and its mitochondrial energetic status energetic mitochondrial its and metabolism

Author Manuscript lipid macrophage in leucine of role the studying by then, conclusion In

and vitro in This article isprotected by copyright. All rights reserved. reveals a new potential atheroprotective feature of this of atheroprotectivefeature potential new a reveals vivo in John Wiley&Sons BioFactors and vivo in , the current study current the , vitro in 27

8 Eeteidu I, rgrpuo, . Mysks I, okns A, era D, t al. et D., Perrea, A., Kokkinos, I., Moyssakis, P., Grigoropoulou, I., Eleftheriadou, [8] 7 Blay M F, coel I F, asy M W, rwle M, oe, . e al. et C., Bones, M., Brownlee, W., M. Ramsey, F., I. McDowell, F., M. Bellamy, [7] 9 Yn, . . Zag H P, u, . Yn, . . Wn, . e a. 21) High (2015) al. et N., Wang, L., X. Yang, Y., Sun, P., H. Zhang, N., A. Yang, [9] 6 Slu, . Ton A M (06 Slu aio cd ad teoceoi: rl for role a atherosclerosis: and acids amino Sulfur (2016) M. A. Troen, J., Selhub, [6] 5 Rm O, vrm M (07 I i nt ut iis poteoei v. antiatherogenic vs. proatherogenic lipids: just not is It (2017) M. Aviram, O., Rom, [5] Libby, [1] P. Inflammation(2002) atherosclerosis.in REFERENCES 5. 2 Mdmnh, . . Rne M S (07 Mtcodil yfnto in Dysfunction Mitochondrial (2007) S. M. Runge, R., N. Madamanchi, [2] 4 Aia, . Rsnlt M (04 Prooae 1 2 ad , xdtv srs, and stress, oxidative 3, and 2, 1, Paraoxonases (2004) M. Rosenblat, M., Aviram, [4] 3 X, . Di err, . Prad J L, ag D, io X, t l (05 Foamy (2015) al. et X., Xiao, D., Yang, L., J. Perrard, X., Perrard, Dai L., Xu, [3] Atherosclerosis. endothelialhealthyin function adults. 4009. (1998) Hyperhomocysteinemia after an oral methionine load acutely impairs impairs acutely load methionine oral an after Hyperhomocysteinemia (1998) demethylation pathway via DNMT1 in ApoE(/) mice. mice. ApoE(/) in DNMT1 via pathway demethylation 21) h efc o hprooytiei o ari dsesblt i healthy in distensibility aortic on hyperhomocysteinemia of effect The (2013) ehoie it aclrt ahrslrss y Hymdae FB4 gene FABP4 HHcymediated by atherosclerosis accelerate diets methionine excessdietarymethionine. 8587. individuals. roles for amino acids in macrophage foam cell formation. formation. cell foam macrophage in acids amino for roles Radic. Biol.Med.Radic. arpae om el omto drn ahrslrss development. atherosclerosis during formation cell foam macrophage hypercholesterolemia. Author Manuscript with mice in atherosclerosis nascent to contribute and early form monocytes

Nutrition This article isprotected by copyright. All rights reserved. Circ.Res.

37,13041316. 29 Arterioscler.Thromb.Vasc. Biol. , , 876880.

100 Ann.NYAcad.Sci. John Wiley&Sons , 460473. , BioFactors Circulation Nature

13631825. , , 18481852. 98, 420

35,17871797. , , 868874. ES Lett. FEBS Curr. Opin. Lipidol. Opin. Curr.

3998 589, Free

28, 28 Page 28of49

Page 29of49

[11] Wurtz, P., Raiko, J. R., Magnussen, C. G., Soininen, P., Kangas, A. J., et al. (2012) al. et J., A. Kangas, P., Soininen, G., C. Magnussen, R., J. Raiko, P., Wurtz, [11] 1] apr A E, ilr R H, lc, . . 18) rnhdcan mn acid amino Branchedchain (1984) P. K. Block, H., R. Miller, E., A. Harper, [12] al. et R., D. Crosslin, D., R. Stevens, J., M. Muehlbauer, R., J. Bain, H., S. Shah, [10] [15] Newgard, C. B., An, J., Bain, J. R., Muehlbauer, M. J., Stevens, R. D., et al. (2009) al. et D., R. Stevens, J., M. Muehlbauer, R., J. Bain, J., An, B., C. Newgard, [15] 1] aaao M, aaa T, aa, . Ihzk, . Mtsia T, t l (2012) al. et T., Mitushima, Y., Ishizaka, K., Nagao, T., Tanaka, M., Yamakado, [13] [16] Yang, R., Dong, J., Zhao, H., Li, H., Guo, H., et al. (2014) Association of branched of Association (2014) al. et H., Guo, H., Li, H., Zhao, J., Dong, R., Yang, [16] [14] Yamakado, M., Nagao, K., Imaizumi, A., Tani, M., Toda, A., et al. (2015) Plasma (2015) al. et A., Toda, M., Tani, A., Imaizumi, K., Nagao, M., Yamakado, [14] [17] RuizCanela, M., Toledo, E., Clish, C. B., Hruby, A., Liang, L., et al. (2016) Plasma (2016) al. et L., Liang, A., Hruby, B., C. Clish, E., Toledo, M., RuizCanela, [17] bacehi aio cdrltd eaoi sgaue ht differentiates that signature metabolic acidrelated amino branchedchain A Disease and Risk of Subsequent Cardiovascular Events. Events. Cardiovascular Subsequent of Risk and Disease Genet. (2010) Association of a Peripheral Blood Metabolic Profile With Coronary Artery Artery Coronary With Profile Metabolic Blood Peripheral a of Association (2010) subclinicalatherosclerosis. Sci. Rep.Sci. ihtruhu qatfcto o cruaig eaoie ipoe peito of prediction improves metabolites circulating of quantification Highthroughput eaoi Snrm, ylpdma ad yetnin n aaee Population. Japanese in Hypertension and Dyslipidemia, Syndrome, Metabolic hi aio cd wt crtd niamda hcns ad ooay artery coronary and thickness intimamedia carotid with acids amino chain metabolism. metabolism. re mn Ai Poie Peit orYa Rs o Dvlpn Diabetes, Developing of Risk FourYear Predict Profiles Acid Amino Free 326. Japanese subjects.Japanese obese and lean humans and contributes to insulinresistance. to contributes humansand lean and obese PREDIMED Trial. Plasma amino acid profile is associated with visceral fat accumulation in obese in accumulation fat visceral with associated is profile acid amino Plasma diseaserisk factors. BranchedChain Amino Acids and Incident Cardiovascular Disease in the the in Disease Cardiovascular Incident and Acids Amino AuthorBranchedChain Manuscript

3 , 207214. ,

5 ,11918. Annu.Rev. Nutr. This article isprotected by copyright. All rights reserved. Clin.Chem. Clin. Obes. PLoSOne Eur.HeartJ. John Wiley&Sons

4 62,582592.

,409454. 9 2 BioFactors ,e99598. ,2940.

33 , 23072316. , Cell Metab. Cell Circ.Cardiovasc.

9 , 311 , 29

2] a, . Da, . L, . Tn B, o, . e a. 21) ecn i Obesity: in Leucine (2016) al. et Y., Hou, B., Tan, F., Li, Y., Duan, K., Yao, [26] 2] ann N P, aga, . . 21) ecn idcd nblc aaoim two catabolism: anabolic induced Leucine (2016) A. R. Vaughan, P., N. Gannon, [25] 2] amn D K (03 Te oe f ecn i wih ls des n glucose and diets loss weight in leucine of role The (2003) K. D. Layman, [24] 2] ouh, . Nsiaa N, hkt, . Kmr, . Aea, . . e a. (2010) al. et O., J. Aleman, Y., Kimura, N., Shikata, N., Nishikata, Y., Noguchi, [23] [22] Tanada, Y., Shioi, T., Kato, T., Kawamoto, A., Okuda, J., et al. (2015) Branched (2015) al. et J., Okuda, A., Kawamoto, T., Kato, T., Shioi, Y., Tanada, [22] [21] Theytaz, F., Noguchi, Y., Egli, L., Campos, V., Buehler, T., et al. (2012) Effects of Effects (2012) al. et T., Buehler, V., Campos, L., Egli, Y., Noguchi, F., Theytaz, [21] [20] Nagata, C., Nakamura, K., Wada, K., Tsuji, M., Tamai, Y., et al. (2013) Branched (2013) al. et Y., Tamai, M., Tsuji, K., Wada, K., Nakamura, C., Nagata, [20] [19] Qin, L. Q., Xun, P., Bujnowski, D., Daviglus, M. L., Van Horn, L., et al. (2011) Higher al. (2011) et L., Daviglus,Horn, Van D., M. Bujnowski, L., P., Xun, Q., L. Qin, [19] (2016) A. Cassidy, T., Spector, T., Pallister, A., MacGregor, A., Jennings, [18] soitos ewe bace can mn ai itk ad imres of biomarkers and intake acid amino chain branched between Associations Therapeutic Prospects. Therapeutic sides ofthesidessamecoin. homeostasis. homeostasis. Prevent Hepatic SteatosisHepaticPrevent Mice.in Ketogenic Essential Amino Acids Modulate Lipid Synthetic Pathways and and Pathways Synthetic Lipid Modulate Acids Amino Essential Ketogenic , 2027. 137, chain amino acids ameliorate heart failure with cardiac cachexia in rats. rats. in cachexia cardiac with failure heart ameliorate acids amino chain during fructose overfeedingduring fructose humans.in Takayamastudy. upeetto wt esnil mn ais n nrhptc ii concentrations lipid intrahepatic on acids amino essential with supplementation overweight or obese in middleaged East Asian and Western adults. Asianand EastWestern middleaged in obese or overweight chain amino acid intake and the risk of diabetes in a Japanese community: the community: Japanese a in diabetes of risk the and intake acid amino chain branchedchain amino acid intake is associated with a lower prevalence of being of prevalence lower a with associated is intake acid amino branchedchain 249254. study. study.

Author Manuscript twin A factors: genetic of independent health cardiometabolic and adiposity

Int.Cardiol.J. J. Nutr.J. This article isprotected by copyright. All rights reserved. Am. J.Am. Epidemiol.

223 133261S267S. , Amino AcidsAmino Trends Pharmacol. Trends Sci. , 992998. , John Wiley&Sons BioFactors PLoSOne

178,12261232.

48 , 321336. , Am. J. Clin.J.Nutr.Am.

5

,e12057. , 714727. 37,

96 , 10081016. , J. Nutr. J. Life Sci. Life

141, 30

Page 30of49

Page 31of49

[30] Witham, W. G., Yester, K. A., McGaffin, K. R. (2013) A high leucine diet mitigates diet leucine high A (2013) R. K. McGaffin, A., K. Yester, G., W. Witham, [30] 3] rcbur A, aeje J, a, . Ci X, ig J, t l (07 Leucine (2017) al. et J., Jing, X., Cui, Q., Cao, J., Banerjee, A., Bruckbauer, [32] [29] Jennings, A., MacGregor, A., Welch, A., Chowienczyk, P., Spector, T., et al. (2015) al. et T., Spector, P., Chowienczyk, A., Welch, A., MacGregor, A., Jennings, [29] [33] Dong, W., Zhou, M., Dong, M., Pan, B., Liu, Y., et al. (2016) Keto acid metabolites acid Keto (2016) al. et Y., Liu, B., Pan, M., Dong, M., Zhou, W., Dong, [33] [28] Macotela, Y., Emanuelli, B., Bang, A. M., Espinoza, D. O., Boucher, J., et al. (2011) al. et J., Boucher, O., D. Espinoza, M., A. Bang, B., Emanuelli, Y., Macotela, [28] 3] ho Y, a, .y, hu Z, ho G. Wn, . e a. 21) Leucine (2016) al. et X., Wang, G.x., Zhao, Z., Zhou, X.y., Dai, Y., Zhao, [31] Increasing(2007) al. et J., G. Schwartz,D., Loh,E., R. K.,LeBlanc, Guo, Y.,Zhang, [27] [34] Rom, O., GrajedaIglesias, C., Najjar, M., AbuSaleh, N., Volkova, N., et al. (2017) al. et N., Volkova, N., AbuSaleh, M., Najjar, C., GrajedaIglesias, O., Rom, [34] Amino Acid Intakes Are Inversely Associated with Arterial Stiffness and Central and Stiffness Arterial with Associated Inversely Are Intakes Acid Amino Atherogenicity of amino acids in the lipidladen macrophage model system system model macrophage lipidladen the in acids amino of Atherogenicity atherosclerosisin mice. BloodinPressure Women. eaoim n lfsa i Ceohbii eeas ad yelpdma and hyperlipidemia and elegans, Caenorhabditis in lifespan and metabolism Multiple Levels of Metabolism.Multiple of Levels ioii ai snry tmlts MKSr1 inln ad euae lipid regulates and signaling AMPK/Sirt1 stimulates synergy acid nicotinic mice. f rnhdcan mn ais nii oiaie tesidcd erss and necrosis stressinduced oxidative inhibit acids amino branchedchain of itr Luie A Evrnetl oiir f nui Rssac Atn on Acting Resistance Insulin of Modifier Environmental An Leucine Dietary supplementation via drinking water reduces atherosclerotic lesions in apoE null apoE in lesions atherosclerotic reduces water drinking via supplementation n Coetrl eaoim n ie i Multimechanisms. via Mice in Metabolism Cholesterol and 1654. , 290302. 62, itr Luie nae eue Denue Oeiy n Ipoe Glucose Improves and Obesity DietInduced Reduces Intake Leucine Dietary cardiac injury and improvesacuteandinjury cardiac survivalmyocardial infarction. after attenuate myocardial ischemiareperfusion injury. ischemiareperfusion myocardial attenuate

Author98. Manuscript

ActaSin.Pharmacol. This article isprotected by copyright. All rights reserved. Am. J. Cardiovasc.J.Dis.Am.

J. Nutr.J. 37,196203. John Wiley&Sons PLoS One BioFactors

145 , 21302138. ,

6 ,e21187.

7 , 3347. , J. Mol. Cell. Cardiol. Cell. Mol. J. Diabetes Metabolism

56

, 90 101, 1647 , 31 in

[41] Kitsy, A., Carney, S., Vivar, J. C., Knight, M. S., Pointer, M. A., et al. (2014) Effects (2014) al. et A., M. Pointer, S., M. Knight, C., J. Vivar, S., Carney, A., Kitsy, [41] [40] Moghei, M., TavajohiFini, P., Beatty, B., Adegoke, O. A. J. (2016) Ketoisocaproic (2016) J. A. O. Adegoke, B., Beatty, P., TavajohiFini, M., Moghei, [40] 3] aod S, ae, . Vloa N, tis J, ocvz D, t l (2014) al. et D., Moscoviz, J., Attias, N., Volkova, T., Hayek, S., Hamoud, [37] 3] or, . . Rsbog, . . Fr, . . Rnal R J (91 Protein (1951) J. R. Randall, L., A. Farr, J., N. Rosebrough, H., O. Lowry, [39] 3] o, . Rzik A Z, edr Z, akb, . Aznu, . 21) Body (2015) D. Aizenbud, K., Karkabi, Z., Keidar, Z., A. Reznick, O., Rom, [36] [38] Adorni, M. P., Zimetti, F., Billheimer, J. T., Wang, N., Rader, D. J., et al. (2007) The (2007) al. et J., D. Rader, N., Wang, T., J. Billheimer, F., Zimetti, P., M. Adorni, [38] [35] Medicine, I. (2005) Dietary Reference Intakes for Energy, Carbohydrate, Fiber, Fat, Fiber, Carbohydrate, Energy, for Intakes Reference Dietary (2005) I. Medicine, [35]

e102615. aha gn ad rti epeso i mue adipocytes. mouse in expression protein and gene pathway of leucine supplementation and serum withdrawal on branchedchain amino acid amino branchedchain on withdrawal serum and supplementation leucine of Physiol. kltl uce el i a CTeedn manner. BCAT2dependent a in cells muscle skeletal acid, a metabolite of leucine, suppresses insulinstimulated glucose transport in transport glucose insulinstimulated suppresses leucine, of metabolite a acid, oernt etat PM) erae te teoeiiy f eu ad of and serum of atherogenicity the decreases (POMx) extract Pomegranate analysisdualenergyandabsorptiometry.Xray measurement withmeasurement theFolin phenol reagent. ua mncteie mcohgs HD) n simvastatintreated in (HMDM) macrophages monocytederived human composition in heavy smokers: comparison of segmental bioelectrical impedancebioelectrical segmental of comparison smokers: heavyin composition LipidRes. Press, DC. Washington, roles of different pathways in the release of cholesterol from macrophages. macrophages. from cholesterol of release the in pathways different of roles randomized, prospectiverandomized, study.pilot at Ais Coetrl Poen ad mn Ais Te ainl Academies National The Acids. Amino and Protein, Cholesterol, Acids, Fatty yecoetrlmc ains A obebidd placebocontrolled, doubleblinded, A patients: hypercholesterolemic Biochem. Author Manuscriptvitro and in atherosclerotic mice: A key role for triglyceride metabolism. triglyceride for role key A mice: atherosclerotic in and

311,C518C527.

45 48,24532462. , 2438. , This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors Atherosclerosis J. Biol.J. Chem. Adv.Exp.Med. Biol.

232,204210.

193 m J Physiol.Cell J. Am. , 265275. , One PLoS

840 , , 111. J. Nutr. J. 32 9 J. , Page 32of49

Page 33of49

(2016) al. et G., M. Philip, J., Jayakumar, S., Selvam, P., D. Lokesh, R., Kuriyan, [42] 4] bae, . Aia, . Hyk T (06 Auos r ii cmoet of components lipid or Aqueous (2016) T. Hayek, M., Aviram, N., AbuSaleh, [48] 4] ao lnc Aio cd, uniaie Plasma: Quantitative, Acids, Amino Clinic. Mayo [43] 4] u X, oasy K, ree, . 20) cvne Rcpo Cas , ye I Type B, Class Receptor Scavenger (2000) M. Krieger, K., Kozarsky, X., Gu, [46] [47] Rosenblat, M., Rom, O., Volkova, N., Aviram, M. (2016) NitroOleic Acid Reduces Acid NitroOleic (2016) M. Aviram, N., Volkova, O., Rom, M., Rosenblat, [47] [44] Rom, O., Volkova, N., Nandi, S., Jelinek, R., Aviram, M. (2016) Pomegranate Juice Pomegranate (2016) M. Aviram, R., Jelinek, S., Nandi, N., Volkova, O., Rom, [44] 4] o, . Jre, . Hyk T, vrm M (07 Splmnain ih linoleic with Supplementation (2017) M. Aviram, T., Hayek, H., Jeries, O., Rom, [45] Sci. atherosclerotic lesion increase macrophage oxidation and lipid accumulation.lipid and oxidationincreaselesionmacrophage atherosclerotic http://www.mayomedicallaboratories.com/test biosynthesis. h rltosi o edgnu pam cnetain o btyrx beta betaHydroxy of concentrations plasma endogenous of relationship The 74. Mcohg Oiaie tts n Tilcrd Ms: novmn of Involvement Mass: Triglyceride and Status Oxidative Macrophage J774A.1 xdtv srs ad icllcrl clrnfrs1mdae triglyceride acyltransferase1mediated diacylglycerol and stress oxidative Gerontol. 30001. cdrc syen i siuae mcohg fa cl frain i increased via formation cell foam macrophage stimulates oil soybean acidrich Methyl Butyrate (HMB) to age and total appendicular lean mass in humans. in mass lean appendicular total and age to (HMB) Butyrate Methyl catalog/Clinical+and+Interpretive/9265 Dependent on Lipoprotein Binding to the Receptor. the to Binding Lipoprotein on Dependent Paraoxonase2and TriglycerideMetabolizing Enzymes. Cardiovasc.Pharmacol. eitd 3]hlseo Efu t Hg ad o Dniy iortis Is Lipoproteins Density Low and High to Efflux [3H]Cholesterol mediated oyhnl Idc Mcohg Dah i Aotss s poe t Necrosis to Opposed as Apoptosis via Death Macrophage Induce Polyphenols Induced by Free Radical Generation: A Central Role for Oxidative Stress. Stress. Oxidative for Role Central A Generation: Radical Free by Induced

Author Manuscript 154,114.

81 ,1318. Biofactors This article isprotected by copyright. All rights reserved.

, 100116. 43, , 106114. 68, John Wiley&Sons BioFactors (revised2017). J. Biol. Chem. Biol. J. Lipids

51,941953.

275 , 29993 , Exp. Life 33 J.

[50] Rosenblat, M., Volkova, N., Coleman, R., Aviram, M. (2007) Antioxidant and anti and Antioxidant (2007) M. Aviram, R., Coleman, N., Volkova, M., Rosenblat, [50] [52] Smolina, N., Bruton, J., Kostareva, A., Sejersen, T., in (D. F. Gilbert, O. Friedrich, O. Gilbert, F. (D. in T., Sejersen, A., Kostareva, J., Bruton, N., Smolina, [52] gradient density discontinuous by separation lipoprotein Plasma (1983) M. Aviram, [49] [51] Rom, O., KorachRechtman, H., Hayek, T., DaninPoleg, Y., Bar, H., et al. (2017) al. et H., Bar, Y., DaninPoleg, T., Hayek, H., KorachRechtman, O., Rom, [51] 5] a Keeig M, isn S (92 Oiain f ecn ad alpha and leucine of Oxidation (1992) S. Nissen, M., Koevering, Van [57] [55] Meilin, E., Aviram, M., Hayek, T. (2011) Insulin increases macrophage triglyceride macrophage increases Insulin (2011) T. Hayek, M., Aviram, E., Meilin, [55] [56] Yen, C. L. E., Stone, S. J., Koliwad, S., Harris, C., Farese, R. V. (2008) Thematic (2008) V. R. Farese, C., Harris, S., Koliwad, J., S. Stone, E., L. C. Yen, [56] [53] Mito Stress Test Kit User Guide: Guide: User Kit Test Stress Mito [53] [54] Feingold, K. R., Shigenaga, J. K., Kazemi, M. R., McDonald, C. M., Patzek, S.M.,etMcDonald, Kazemi, Shigenaga,M.K.,R.,M.,Patzek, R., Feingold, C. K. J. [54] Acrolein increases macrophage atherogenicity in association with gut microbiota gut with association in atherogenicity macrophage increases Acrolein teoei poete o lpsml lttin: Studies glutathione: liposomal of properties atherogenic ultracentrifugationhyperlipoproteinemicin patients. pomegranate juice. atherosclerotic apolipoproteinatherosclerotic Edeficient mice. eoeig n teoceoi mc: rtcie oe o te polyphenolrich the for role protective mice: atherosclerotic in remodeling LipidRes. Eds). (2017) Cell Viability Assays: Methods and Protocols, Springer New York, New Springer Protocols, and Methods Assays: Viability Cell (2017) Eds). Review Series: Glycerolipids. DGAT enzymes and triacylglycerol biosynthesis. biosynthesis. triacylglycerol and enzymes DGAT Glycerolipids. Series: Review E2731. Leukoc. Biol. Leukoc. ketoisocaproate to betahydroxybetamethylbutyrate to ketoisocaproate al. (2012) Mechanisms of triglyceride accumulation in activated macrophages. macrophages. activated in accumulation triglyceride of Mechanisms (2012) al. New York, NY, ppNewNY, 7987. York, sensitivelipaseadiposetriglycerideand lipase. analysis(seahorse)/seahorsexfconsumables#1 Authorhormone of regulation down the through conditions diabetic under accumulation Manuscript

49,22832301.

92,829839. This article isprotected by copyright. All rights reserved. Arch.Toxicol. John Wiley&Sons BioFactors

91 , 17091725. , http://www.agilent.com/enus/products/cell Atherosclerosis Biofactors (revised2017). Biochem.Med. in vivoin.

37 ad n the in and vitro , in ,95103. Am. J. Physiol.J. Am.

195,e61e68.

30 , 111118. ,

262 34 J. J. , Page 34of49

Page 35of49

Disease, Cardiovascular in Role Their and Mitochondria (2013) in. J., MarínGarcía, [58] [66] Calvo, D., GómezCoronado, D., Suárez, Y., Lasunción, M. A., Vega, M. A. (1998) (1998) A. M. Vega, A., M. Lasunción, Y., Suárez, D., GómezCoronado, D., Calvo, [66] [59] Layman, D.D.A. K.,Potential(2006) [59] ofLeucineImportancein Walker, Treatment of [63] Carallo, C., Mancuso, G., Mauro, G., Laghi, F., Madafferi, B., et al. (2009) Hepatic (2009) al. et B., Madafferi, F., Laghi, G., Mauro, G., Mancuso, C., Carallo, [63] 6] ebr, . Ial L A (98 Apaktioarae s o a re usrt for substrate true a not is Alphaketoisocaproate (1998) A. L. Idahl, N., Lembert, [67] 6] or, . . Femn M W (06 Saegr eetr i atherosclerosis: in receptors Scavenger (2006) W. M. Freeman, J., K. Moore, [65] [64] Goldberg, I. J., Eckel, R. H., McPherson, R. (2011) Triglycerides and Heart Disease,(2011)TriglyceridesMcPherson, Eckel, R. Heart and J., H., R. I. Goldberg, [64] 6] gr A S, eoia A M, ln, . . Xna N P, tfn M, t l (2014) al. et M., Stefan, P., N. Xenia, A., V. Elena, M., A. Veronica, S., A. Igor, [60] 6] ooa S. Ad, . Aym, . Nkmr, . Siaa S (06 Leucine (2016) S. Shibata, K., Nakamura, S., Aoyama, M., Ando, S.I., Yokota, [62] [61] Phillips, M. C. (2014) Molecular mechanisms of cellular cholesterol efflux. efflux. cholesterol cellular of mechanisms Molecular (2014) C. M. Phillips, [61] ATP production ATP by pancreaticbetacell mitochondria. Acids Springer US,SpringerMA, Boston,295303. pp steatosis, carotid atherosclerosis and metabolic syndrome: the STEATO Study. STEATO the syndrome: metabolic and atherosclerosis carotid steatosis, Human CD36 is a high affinity receptor for the native lipoproteins HDL, LDL, and LDL, HDL, lipoproteins native the for receptor affinity high a is CD36 Human beyondlipid uptake. Obesity and the MetabolicandObesity the Syndrome. StillHypothesis?a J. Gastroenterol.J. y upesn atpay n ecsie nolsi rtclm stress. reticulum endoplasmic excessive and autophagy suppressing by VLDL. etrs uie eai tilcrd acmlto idcd y lwpoen diet lowprotein a by induced accumulation triglyceride hepatic murine restores Chem. lo Srm teoeiiy n Crnr Atr Calcification. Artery Coronary and Atherogenicity Serum Blood

Author ManuscriptDesign

, 10131021. 48,

J. LipidJ. Res. 289,2402024029. , 58845888. 20, This article isprotected by copyright. All rights reserved.

44,11561161. Arterioscler.Thromb.Vasc. Biol.

39,777788. Arterioscler.Thromb.Vasc. Biol. John Wiley&Sons BioFactors J. Nutr.J.

136 , 319S–323S. ,

31,17161725.

Diabetes , 17021711. 26,

47,339344. ur Pharm. Curr. . Biol. J. Amino 35

[70] Yu, E. P. K., Reinhold, J., Yu, H., Starks, L., Uryga, A. K., et al. (2017) Mitochondrial(2017) al. et K., A. Starks,Uryga, L., H., Yu, Reinhold, J., P. K., E. Yu, [70]

al. et M., Geoffrion, L., Richards, A., M. Nguyen, B., A. Thrush, D., Karunakaran, [68] 6] u E, avr, . . Mre, . . Hrio, . Bkr L, t l (2013) al. et L., Baker, J., Harrison, R., J. Mercer, A., P. Calvert, E., Yu, [69]

eprto I Rdcd n teoceoi, rmtn Ncoi Cr Formation Core Necrotic Promoting Atherosclerosis, in Reduced Is Respiration 702712. 10.1161/atvbaha.117.310042. Monocytes and Correlates With HigherRisk Plaques in Humans. HigherRiskPlaquesHumans. in MonocytesCorrelates and With and Reducing Relative Fibrous Cap Thickness. Thickness. Cap Fibrous Relative Reducing and ecie xgn pce Truh fet o Sot Msl Cls and Cells Muscle Smooth on Effects Through Species Oxygen Reactive and Is EnhancedIsbyand AntimiR33 inAtherosclerosis. Mitochondrial DNA Damage Can Promote Atherosclerosis Independently of of Independently Atherosclerosis Promote Can Damage DNA Mitochondrial

Author Manuscript Efflux Cholesterol Regulates Status Energy Mitochondrial Macrophage (2015) This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors Arterioscler. Thromb. Vasc. Biol. Vasc. Thromb. Arterioscler. Circ.Res.

117,266278. Circulation , 128, 36

Page 36of49

Page 37of49

1. Table leucine supplementationafter 21 days. for Serum Biochemical data Biochemical Serum data Anthropometric Creatinine (mg/dl) BUN(mg/dl) (g/dl)Albumin Total HDL LDL C T (mg/dl)Glucose Leucine WHR (%)Body fat (height/weightBMI Body(kilograms) weight Height (meters) Age(years) Uric acid Uric (mg/dl) riglycerides ua atrpmti ad iceia caatrsis t aeie ii and visit baseline at characteristics biochemical and anthropometric Human Author holesterol Manuscript C C

P

(mg/dl) rotein (g/dl) (mg/dl)

( mol/L

(mg/dl)

This article isprotected by copyright. All rights reserved.

(mg/dl)

)

2

)

John Wiley&Sons BioFactors 159.4 0.±. 11577 0.812 111.5±7.7 109.0±6.9 411. 8.±. 0.791 88.5±9.7 94.1±17.3 7.±. 17288 0.748 177.2±8.8 173.3±7.8 Baseline .700 .700 0.874 0.87±0.02 0.87±0.0 6231 6330 0.979 76.3±3.06 76.2±3.1 4508 4507 0.977 24.5±0.78 24.5±0.8 5139 9629 0.382 89.6±2.9 85.1±3.9 5531 8042 0.636 48.0±4.2 45.5±3.1 27.6±2.0 3308 4418 0.563 14.4±1.8 13.3±0.8 7313 7913 0.767 17.9±1.34 17.3±1.3 .±. 5303 0.714 5.3±0.3 5.5±0.3 .±. 0800 0.817 0.8±0.0 0.8±0.0 1.8±0.0 .±. 7301 0.603 7.3±0.1 7.2±0.1 .±. 4701 0.740 4.7±0.1 4.6±0.1 ±10.33

Supplementation 217.3 (21 d) (21 After ±23.62

p 0.044* value

37

L, lnn aiornfrs; G, ltml rnppiae AP alkaline ALP, transpeptidase; γglutamyl GGT, aminotransferase; alanine ALT,

ie a ma±E. neednape T et a ue t cmae h means the compare to used was test T IndependentSamples mean±SEM. as given and supplementation outcomes. n= 7 healthy subjects. healthy 7 n= outcomes. supplementation and between baseline and after supplementation values. p<0.05 was considered statistically considered was p<0.05 values. supplementation after and baseline between ihdniy iortis BN bod ra irgn AT aprae aminotransferase; aspartate AST, nitrogen; urea blood BUN, lipoproteins; highdensity hshts; D, att dehydrogenase. lactate LDH, phosphatase;

BMI, Body mass index; WHR, waisttohips ratio; LDLC, lowdensity lipoprotein; HDLC, lipoprotein; lowdensity LDLC, ratio;waisttohips WHR, index; mass Body BMI, significant.

Author ManuscriptLDH(U/L) ALP(U/L) (U/L) GGT ALT(U/L) AST(U/L)

This article isprotected by copyright. All rights reserved.

John Wiley&Sons BioFactors 6.±. 10096 0.966 160.0±9.6 160.6±9.1 2025 9416 0.410 19.4±1.6 22.0±2.5 9343 3339 0.508 63.3±3.9 59.3±4.3 9631 3244 0.508 23.2±4.4 19.6±3.1 0128 8125 0.605 18.1±2.5 20.1±2.8

p ausfr oprsn ewe baseline between comparison for values *p<0.05 vs baselinevs *p<0.05 . Values are are Values . 38 Page 38of49

Page 39of49

Leucine Serum Biochemical data Biochemical Serum (mg/BW/d) consumptionFood (mg/BW/d) gain(g) BW w/v), weeks.(1%, 8 for 5B/ ml mc tetd ih ae (oto) o wt luiesplmne water leucinesupplemented with or (control), water with treated mice male C57BL/6 2 Table chowtheplusleucinediet consumed quantityof in thedrinkingwater bythemice. BW, body weight. n= 8 mice per group. bodyn=per 8* group. weight. mice BW,

b a ie a ma±E. neednape T et a ue t cmae h means the compare to used was test T IndependentSamples mean±SEM. as given ewe vle fo cnrl n luie rus p00 ws osdrd statistically considered was p<0.05 groups. leucine and control from values between significant. significant. Calculated from thedifferenceCalculated from bodyin weight atstartand atthe end ofthe study. the Total leucine consumption was calculated from the amount of leucine reported in the in reported leucine of amount the from calculated was consumption leucine Total Leucine (mol/L) . Body weight gain, consumption patterns, and serum biochemical parameters in parameters biochemical serum and patterns, consumption gain, weight Body .

Cholesterol (mol/L) Triglycerides(mol/L)

Author Manuscriptconsumption

b a

This article isprotected by copyright. All rights reserved.

John Wiley&Sons ± 270.3 ± 198.1 114.4 ± 100.6 Control 5.6 1.4 BioFactors p<0.05, ***p<0.001 vsp<0.05, Control***p<0.001 group

±±± ± ±

±±± . 5.9 0.4 0.0 ± ± 255.8 6.5 ± 187.6 4.7 6.3 ± 106.0 1.8

139.2 (1%, (1%, w/v) Leucine Leucine 3.3 ±±± ± ± ±±± 0.6 0.1 ± 6.2 4.5 4.5 2.6

valuep 0.000*** 0.046* 0.110 0.110 0.706 0.100 . Data are Data .

39

for 8 weeks as described under the Experimental Procedures section. Lipid content in content Lipid section. Procedures Experimental the under described as weeks 8 for male mice treated with water (Control), or with leucinesupplemented water (1%, w/v), (1%, water leucinesupplemented with or (Control), water with treated mice male are Data given as mean±SEM. peritoneal macrophages (MPM) were harvested and livers were excised from C57BL/6 from excised were livers and harvested were (MPM) macrophages peritoneal (B, D) (B, MPM and in livers after lipid extraction and determination of: determination and extraction lipid after livers in and MPM Figure 3. Lipid content in MPM and liver from leucinesupplemented mice. mice. leucinesupplemented from liver and MPM in content Lipid 3. Figure (mean±SEM).healthyn=7 subjects. nuain ih .% ua srm Dt ae hw a % oprd o baseline to compared % as shown are Data serum. human 2.5% with incubation 74. macrophages. J774A.1 iue . teoeiiy f ua srm olwn luie upeetto in supplementation leucine following serum human of Atherogenicity 2. Figure (21 d). J774A.1 macrophages were incubated for 20 h with 2.5% human serum, serum, followed human with 2.5% h 20 weremacrophagesfor incubated J774A.1 d). (21 eueitd hlseo efu fo macrophages from efflux cholesterol Serummediated Hydroxymethylglutaryl–Coenzyme A; A; Hydroxymethylglutaryl–Coenzyme participant at baseline (0 h), after 1 h of leucine consumption, and at the end of the the studyend of at the ofleucineand hconsumption, after1 atbaseline (0h), participant Branchedchain aminotransferase;Branchedchain methylbutyrate; methylbutyrate; compounds and their chemical structure. structure. chemical their and compounds by analyses of: analyses by 1. Figure LEGENDS FIGURE enzymes of the pathway. Names in bold letters in the figure correspond to the studied the to correspond figure the in letters bold in Names pathway. the of enzymes Triglyceride mass. n= 8 mice per group. per mice 8 n= mass. Triglyceride

Author Manuscript

ecn ctblc pathway. catabolic Leucine

(A) αKG Cellular cholesterol mass; cholesterol Cellular This article isprotected by copyright. All rights reserved. αketoglutarate; = eu ws avse fo bod olce fo each from collected blood from harvested was Serum BCKDH John Wiley&Sons *p<0.05,**p<0.01 vs.baseline TCA BioFactors IVCoA αKIC = Branchedchain = dehydrogenase.ketoacid rydse surs niae h main the indicate squares Graydashed yl= rcroyi ais cycle. acids Tricarboxylic cycle= (B) = αketoisocaproate; = = Isovaleryl–Coenzyme A; A; Isovaleryl–Coenzyme = *p<0.05, **p<0.01 vs. Control group Control vs. **p<0.01 *p<0.05, Cholesterol biosynthesis rate; and rate; biosynthesis Cholesterol , , vlae atr h f cell of h 3 after evaluated (A, C) (A, . HMB Cholesterol mass; Cholesterol = βhydroxyβ = HMGCoA BCAT Mouse (C) 40 = = = = .

Page 40of49

Page 41of49

g/mL); vrih cl laig ih grgtd D (gLL coetrlrc lppoen, 50 lipoproteins, cholesterolrich (AggLDL, LDL aggregated with loading cell overnight odn wt VD (rgyeieih iorti, 0 gm) n 6. n= g/mL). 50 lipoprotein, (triglyceridesrich VLDL with loading *p001 s Control vs ***p<0.001 extraction and determination of: of: determination and extraction lipids. macrophage J774A.1 on leucine of Effects 4. Figure performed after 20 h of cell incubation with leucine (0.2 mM), followed by cellular lipid cellular by followed mM), (0.2 leucine with incubation cell of h 20 after performed 6. are given as mean±SEM. iue . fet o luie n rgyeie eaoim n utrd J774A.1 cultured in metabolism triglyceride on leucine of Effects 5. Figure macrophage lipid content. lipid macrophage using FITCVLDL (24 g/mL); and, g/mL); (24 FITCVLDL using triglyceriderichControl iue . fet o luie eaoie (I, M, n IA i J774A.1 in IVA) and HMB, (KIC, metabolites leucine of Effects 6. Figure mean±SEM. xrcin n determination: and extraction (0.2 mM) followed by by followed mM) (0.2 leucine with incubation cell of h 20 after performed were Quantifications macrophages. with increasing concentrations of leucine metabolites (02 mM), followed by cellular lipid cellular by followed mM), (02 metabolites leucine of concentrations increasing with mass. [ Isovaleric acid. n= 6. n= acid. Isovaleric 3 H]oleic acid; acid; H]oleic *p<0.05 KIC= KIC= (C)

Author Manuscript ,

rgyeie ms; and, mass; Triglycerides **p<0.01, ***p<0.001 vs Control Control vs ***p<0.001 **p<0.01,

αketoisocaproate, (B) (B) RC aayi o DA1 ee expression; gene DGAT1 of analysis qRTPCR *p<0.05 This article isprotected by copyright. All rights reserved. (A) (A) ,respectively. are Data given as mean±SEM. 0 wt n addition) no with (0, Triglyceride biosynthesis rate after 4 h of cell incubation with incubation cell of h 4 after rate biosynthesis Triglyceride Quantifications were performed after 20 h of cell incubation cell of h 20 after performed were Quantifications , , **p<0.01, ***p<0.001 vs Control Control vs ***p<0.001 **p<0.01, (A, C, E) E) C, (A, HMB (A) (D) (D) John Wiley&Sons Cholesterol mass; mass; Cholesterol qRTPCR analysis of CD36 gene expression. n= expression. gene CD36 of analysis qRTPCR BioFactors βhdoyβmtyuyi ai, and acid, βhydroxyβmethylbutyric = (D) (D) hlseo ms; and mass; Cholesterol rgyeie ms atr n vrih cell overnight an after mass Triglycerides . (with no addition). Data are given as as given are Data addition). no (with

### <.0 v coetrlrc or cholesterolrich vs p<0.001 (B) (B) hlseo ms atr an after mass Cholesterol (with no addition). Data addition). no (with B D F) D, (B, uniiain were Quantifications (C) (C) , *p<0.05, LL uptake, VLDL Triglyceride **p<0.01, IVA 41 = =

mitochondrial energetic status determined by:determined status energetic mitochondrial basal respiration; respiration; basal mitochondrial respiration. n= 8 mice per group. per group. mice 8 mitochondrial n= respiration. tilooehx) hnlyrzn (CP, r oeoe atmcn . Macrophage A. antimycin + rotenone or (FCCP), phenylhydrazone (trifluoromethoxy) aaees ee acltd fe te neto o oioyi, abnl cyanide4 carbonyl oligomycin, of injection the after calculated were parameters group ne te xeietl rcdrs eto. l oye cnupin ae (OCR) rate consumption oxygen All section. Procedures Experimental the under (Control), or with leucinesupplemented water (1%, w/v), for up to 8 weeks as described as weeks 8 to up for w/v), (1%, water leucinesupplemented with or (Control), mouse and macrophages J774A.1 of status energetic Mitochondrial 7. Figure arpae (P) ee avse fo C7L6 ae ie rae wt water with treated mice male C57BL/6 from harvested were (MPM) macrophages ee efre atr 0 o cl icbto wt luie 02 M. os peritoneal Mouse mM). (0.2 leucine with incubation cell of h 20 after performed were peritoneal macrophages (MPM). (MPM). macrophages peritoneal

Author ManuscriptDataare . givenas mean±SEM. (C, F) F) (C, This article isprotected by copyright. All rights reserved. iohnra AP rdcin and production; ATP Mitochondrial John Wiley&Sons uniiain i clue J7.1 macrophages J774.A1 cultured in Quantifications BioFactors (A) *p<0.05,**p<0.001**p<0.01,Controlvs OCR parameters; parameters; OCR (B, E) E) (B, (D, G) G) (D, Mitochondrial Maximal 42 Page 42of49

Page 43of49

Coenzyme A; HMGCoA= Hydroxymethylglutaryl–HMGCoA= A; Coenzyme KIC= αketoisocaproate; HMB= KIC= βhydroxyβmethylbutyrate; αKG= αketoglutarate; IVCoA= Isovaleryl– Names in bold Names figureletters correspond in the thetheir to studied and chemical structure. compounds α Figure 1. Leucine catabolic pathway. Graydashed squares Graydashed pathway. Figure catabolic Leucine 1. pathway. enzymesindicatethe of main the

Author Branchedchain Branchedchain aminotransferase;BCKDH= ketoaciddehydrogenase. Manuscript This article isprotected by copyright. All rights reserved. 30x40mm (600 x 600 DPI) (600 60030x40mm DPI) x John Wiley&Sons BioFactors Coenzyme A; TCA cycle= Tricarboxylic TCA A; cycle. acids BCAT= Coenzyme

bloodfrom harvested baseline 1 collectedwas after at (0 h), leucine participant of h each from co Figure 2. Atherogenicity of human serumfollowing FigureAtherogenicity 2. human leucineof supplementationmacrophages. Serumin J774A.1 and at the end the of at study the and macrophages (21d).J774A.1 serum, were with 2.5%forhuman incubated 20h followed by analyses of: (A) Cellular cholesterol mass; (B) Cholesterol biosynthesis rate; and (C) (C) followed Cellular Cholesterolof:(A) and cholesterolSerum- biosynthesisanalyses by rate; (B) mass; mediated cholesterol efflux from macrophages, evaluated mediatedcholesterolcellefflux macrophages, of from h 3 after with incubation 2.5%human

Author shown are as Data serum. healthy 7 %n= baseline comparedto subjects.(mean±SEM). *p<0.05, Manuscript This article isprotected by copyright. All rights reserved. 19x27mm (600 x 600 DPI) (600 60019x27mm DPI) x **p<0.01 vs. baseline. **p<0.01vs. John Wiley&Sons BioFactors

nsumption, nsumption, Page 44of49

Page 45of49 liverswere and (MPM) harvested male mice weretreated or(Control),with water excised C57BL/6 from mass; (B, mice8 (B, n= Triglyceride per D) mass; mass. Figure 3. Lipid content in MPM and liver and Figure Lipidleucine-supplementedfrom in 3. macrophages MPM content peritoneal mice. Mouse section. Lipid content in MPM and in Lipidsection.livers in MPM and content lipid after C) determination Cholesteroland extraction of:(A,

Author(1%, forleucine-supplementedweeksw/v),8 as water describedProcedures under Experimental the Manuscript This article isprotected by copyright. All rights reserved. 16x19mm (600 x 600 DPI) (600 60016x19mm DPI) x John Wiley&Sons as mean±SEM. as group. *p<0.05, **p<0.01 vs. Control group. Data Control **p<0.01 vs. group.are*p<0.05, group.Data given BioFactors

with

with no addition). cholesterolrichwith no ###p<0.001 vs ortriglyceride with VLDL (triglyceridesrich n= lipoprotein,with***p<0.001 VLDL **p<0.01, *p<0.05, 50µg/mL). 6. (0, Control vs lipoproteins, 50 µg/mL); (C)lipoproteins, 50µg/mL); (D) Triglycerides and, an Triglycerides after mass; overnight loadingcell mass Figure 4. Effects of leucine macrophageof FigureJ774A.1 Effects on 4. lipids.Quantifications wereof 20h cell after performed incubation with incubation leucine followed mM), (0.2 cellularby determinationlipid Cholesterol and extraction of:(A)

AuthorovernightCholesterol (B) cell an mass; after (AggLDL, cholesterolrich with aggregatedmass LDL loading Manuscript This article isprotected by copyright. All rights reserved. 16x19mm (600 x 600 DPI) (600 60016x19mm DPI) x John Wiley&Sons as mean±SEM. as BioFactors

rich Control, respectively. Data are givenare respectively. Data Control, rich

Page 46of49

Page 47of49

were performed after 20 h of cell wereperformed with incubation leucinefollowed of mM) (0.2 20h after Triglyceride (A) by bi rate after 4 h of cell of h 4 after withrate incubation [3H]oleic acid;analysis qRTPCR DGAT1 (B) of geneexpression; (C) Figure 5. Effects of leucine of FiguretriglycerideEffects on 5. inmetabolism cultured macrophages. Quantifications J774A.1 VLDL uptake,(D) (24 usingµg/mL); FITCVLDL and, qRTPCR VLDL analysis CD36 geneof expression. 6. n=

Author(withaddition). Control ***p<0.001 no **p<0.01, vs given *p<0.05, are as mean±SEM. Data Manuscript This article isprotected by copyright. All rights reserved. 15x16mm (600 x 600 DPI) (600 60015x16mm DPI) x John Wiley&Sons BioFactors

osynthesis osynthesis

and (B, KIC=Triglyceride F) αketoisocaproate, (B, D, and βhydroxyβmethyl HMB= mass. metabolites (02 mM), followed by cellular lipid extraction and determination: C,metabolitesCholesterol E) and followed cellularby(02lipid(A, mass; mM), extraction Isovaleric acid. n= 6. *p<0.05, 6. Isovaleric n= ***p<0.001acid. **p<0.01, given(withare addition). Control no vs as Data Quantifications were performed Quantifications cell of 20h after incubation leucinewith increasingof concentrations

AuthorHMB, leucine of Figure Effects in metabolites6. J774A.1 and (KIC, macrophage IVA) lipid content. Manuscript This article isprotected by copyright. All rights reserved. 17x21mm (600 x 600 DPI) (600 60017x21mm DPI) x John Wiley&Sons mean±SEM. mean±SEM. BioFactors

butyric acid, and IVA= butyricand acid, IVA=

Page 48of49

Page 49of Figure 7. Mitochondrial energetic status of J774A.1 macrophagesof FigureMitochondrial peritoneal 7. mouse energetic(MPM).status and macrophages Experimental Procedures section. All oxygen consumption rate (OCR) parameters were Allparameters Experimental (OCR) consumptionoxygen rate Procedures section. the after calculated Quantifications in culturedmacrophages wereJ774.A1 Quantifications performed with leucinecell of 20h after incubation water (Control), or(Control), withwater leucine-supplemented described weeks8 as to forw/v), up underwater (1%, the (0.2 mM). Mouse peritoneal macrophages (MPM) were peritoneal (MPM) harvestedMouse mM). (0.2macrophages male C57BL/6 from mice treated with Mitochondrial basal respiration; (C, F) Mitochondrial F) ATPrespiration;Mitochondrial (C, G)Maximal basal production;(D, and mitochondrial respiration.**p<0.01, mice*p<0.05, 8 **p<0.001n= per group. group. Control vs givenare as Data injectioncarbonylcyanide-4 oligomycin, (trifluoromethoxy) of or rotenonephenylhydrazone + (FCCP),

Author mitochondrial A. Macrophage antimycin energetic determined E) status parameters;(B, OCR by: (A) Manuscript This article isprotected by copyright. All rights reserved. 19x28mm (600 x 600 DPI) (600 60019x28mm DPI) x John Wiley&Sons mean±SEM. mean±SEM. BioFactors

Author Manuscript This article isprotected by copyright. All rights reserved. John Wiley&Sons BioFactors Page 50of49