Rattus Fuscipes) Into Sydney Harbour National Park: Restoring Ecosystem Function

Translocation and Reintroduction of Native Bush Rats (Rattus fuscipes) into Sydney Harbour National Park: Restoring Ecosystem Function

Megan Callander

Thesis submitted in fulfilment of the requirements for the degree of

Doctor of Philosophy Science

In the School of Science and Health, Western Sydney University

2018

Acknowledgements

I would firstly like to thank my supervisors Ricky Spencer and Peter Banks for their assistance, input and feedback in helping this project come to completion. Extra thanks to Peter for the opportunity to be part of the Bush Rat Project, without which I would not have a thesis.

Thanks to all organisations that were part of the Bush Rat Project: Australian Research Council, Department of Environment and Climate Change, National Parks and Wildlife Service, Landcare Research New Zealand, Rentokil, Australian Wildlife Conservancy, Taronga Conservation Society Australia and Mosman Council.

Acknowledgements to the Banks lab in Sydney University and Australian Wildlife Conservancy for the enormous fieldwork effort and the collection and collation of data. Additional thanks to all the volunteers that assisted in the field throughout the research, none of this would be possible without you.

Special thanks to Mark Emanuel for his assistance in the laboratory and always providing me with all the resources I needed. I would also like to thank Julie Old who provided me with invaluable information and feedback on genetic analysis and Fiona McDougall for her help in the lab and the field. Further thanks to Oselyne Ong for her amazing knowledge in genetic analysis and helping me through a sometimes very frustrating process.

Thank you to the Lab Group, especially Jessica Dormer, Fiona Loudon and Jessica McGlashan, for their support throughout the research process and for understanding the ups and downs of research.

To my amazing family and friends for their understanding, interest and support throughout this very long process. Last, but certainly not least, my partner Alan, who was always there for me in this roller-coaster of a project. I could not have done it without you.

Statement of Authentication

The work presented in this thesis is, to the best of my knowledge and belief, original except as acknowledged in the text. I hereby declare that I have not submitted this material, either in full or in part for a degree at this or any other institution.

Megan Callander

Table of Contents

Acknowledgements ...... i Statement of Authentication ...... ii List of Figures ...... vi List of Tables ...... xii Abstract ...... xiv

CHAPTER 1: General Introduction and the Sydney Bush Rat Project ...... 1 1.1 ECOSYSTEM RESTORATION AND TRANSLOCATION ...... 2 1.1.1 Factors Driving Translocation Success ...... 3 1.2 INVASIVE SPECIES ...... 5 1.3 BIOLOGICAL CONTROL ...... 6 1.3.1 Competitive Biocontrol ...... 7 1.4 SYDNEY BUSH RAT PROJECT ...... 7 1.4.1 Overview of Study Design ...... 8 1.5 BUSH RATS IN SYDNEY HARBOUR NATIONAL PARK ...... 12 1.6 SCOPE OF THESIS ...... 13

CHAPTER 2: General Methods...... 16 2.1 STUDY SPECIES ...... 17 2.2 SOURCE POPULATION ...... 18 2.3 REINTRODUCTION SITES ...... 22 2.4 RELEASE TECHNIQUE ...... 23 2.5 TRAPPING AND DATA COLLECTION ...... 24 2.6 SITE DESCRIPTION ...... 26 2.6.1 Source Sites...... 26 2.6.2 Reintroduction Sites ...... 27 2.7 HABITAT CHARACTERISTICS ...... 28

CHAPTER 3: Selective Traits Influencing Bush Rat Survival ...... 31 3.1 INTRODUCTION ...... 32 3.1.1 Aims ...... 33 3.2 METHODS ...... 34 3.2.1 Study Species ...... 34 3.2.2 Translocation and Monitoring ...... 34 3.2.3 Habitat Characteristics ...... 35

iii

3.2.4 Statistical Analysis ...... 35 3.2.4.1 Body Condition ...... 38 3.2.4.2 Virus Status ...... 38 3.3 RESULTS ...... 38 3.3.1 Survival of Bush Rats over Time ...... 38 3.3.2 Influence of Site on Adult Bush Rat Survival and Recapture ...... 42 3.3.3 Influence of Sex on Bush Rat Survival and Recapture ...... 43 3.3.4 Influence of Sex on Bush Rat Offspring Survival and Recapture ...... 46 3.3.5 Influence of Weight and Body Condition...... 47 3.3.6 Influence of Virus Status ...... 50 3.3.7 Habitat Characteristics ...... 51 3.4 DISCUSSION ...... 53 APPENDIX ...... 60

CHAPTER 4: Movement Behaviour of Bush Rats: Exploration and Establishment . 67 4.1 INTRODUCTION ...... 68 4.1.1 Aims ...... 70 4.2 METHODS ...... 71 4.2.1 Radio Tracking ...... 71 4.2.2 Statistical Analysis ...... 73 4.3 RESULTS ...... 75 4.3.1 Bush Rat Exploration, Establishment and Survival ...... 75 4.3.2 Movement of Female and Male Bush Rats ...... 76 4.3.3 Overlap of Establishment Area: Home Range Sharing or Separation ...... 80 4.4 DISCUSSION ...... 85 APPENDIX ...... 90

CHAPTER 5: Genetic Relatedness of Bush Rats: Social Dynamics and Population Structures ...... 98 5.1 INTRODUCTION ...... 99 5.1.1 Aims ...... 101 5.2 METHODS ...... 102 5.2.1 Study Species ...... 102 5.2.2 Microsatellites ...... 103 5.2.3 DNA Extraction and Laboratory Procedures ...... 104 5.2.4 Statistical Analysis ...... 104 5.3 RESULTS ...... 106

5.3.1 Genetic Diversity and Properties of Microsatellite Markers ...... 106 5.3.2 Sibship Assignment ...... 106 5.3.3 Parentage Assignment ...... 112 5.4 DISCUSSION ...... 116 APPENDIX ...... 121

CHAPTER 6: Coexistence or Competition: Avoidance Patterns of Bush Rats and Black Rats ...... 126 6.1 INTRODUCTION ...... 127 6.1.1 Aims ...... 129 6.2 METHODS ...... 129 6.2.1 Statistical Analysis ...... 131 6.2.1.1 Occupancy Modelling ...... 131 6.2.1.2 Trapping Pattern and Overlap ...... 133 6.3 RESULTS ...... 134 6.3.1 Interspecific Competition ...... 134 6.3.2 Occupancy Models ...... 136 6.3.3 Trapping Pattern and Overlap ...... 137 6.4 DISCUSSION ...... 140 APPENDIX ...... 145

CHAPTER 7: Translocation and Wildlife Restoration: Returning Ecosystem Function ...... 152 7.1 TRANSLOCATION CRITERIA AND SUCCESS ...... 153 7.1.1 Key Findings ...... 154 7.2 CONSERVATION OF COMMON SPECIES ...... 160

REFERENCES ...... 163

List of Figures

Figure 1.1. Map of study area. Bush Rat Project conducted in Sydney, Australia. Experimental sites throughout headlands in Sydney Harbour National Park bush reserves ...... 10

Figure 1.2. Sydney Bush Rat Project treatment grids. The 16 sites were divided into four treatments, each treatment replicated four times. Sites were 1ha grids and were separated by at least 500m for spatial independence. This study focuses only on the four reintroduction sites...... 11

Figure 1.3. Map of bush rat distribution around the Australian coast. Closer view of the distribution of bush rats in the Sydney region, New South Wales. No sightings have been recorded within the bush rat reintroduction sites in Mosman or Manly...... 13

Figure 2.1. Map of sites bush rats were sourced - Ku-ring-gai Chase National Park and Muogamarra Nature Reserve. Bush rats were transported to Cowan Field Station for processing and holding. They were then released into Sydney Harbour National Parks reintroduction sites...... 19

Figure 2.2. Bush rats being processed in Cowan Field Station. Males and females were separated and kept with individuals that were caught closest to them (maximum of 3 females and 2 males in each cage)...... 21

Figure 2.3. Release points. Five release points per site with 3 females and 2 males being released together (25 animals per site). Pink dots represent 36 trap stations on a 1ha grid; each trap approximately 20m apart, with each grid line approximately 20m apart...... 21

Figure 2.4. Bush rats were released on August 11, 2011 into four sites across Sydney Harbour National Parks: Athol Hall (Site 1), Middle Head (Site 2), North Head 3 (Site 3), and North Head 6 (Site 4). Sites were drawn from a subset of sites established as part of the Sydney Bush Rat Project...... 23

Figure 2.5. Soft-release at dusk. Bush rats were given a conditioning period to the new environment in their breeder cages, where supplementary food was available for one week...... 24

Figure 3.1. Total number of bush rat individuals captured at least once over the trapping period from September 2011 to May 2014 (9 sessions), in four reintroduction sites. Dark grey (original) represents the number of adults recaptured out of the original 100 that were released. Light grey (offspring) represents the total number of new individuals captured (i.e. not from original 100)...... 39

Figure 3.2. Number of individual bush rat recaptures of adults (original 100 released, dark grey) and juveniles (offspring of the 100 released, light grey) over the entire trapping period (9 sessions, September 2011 to May 2014) in the four reintroduction sites. Bush rats were reintroduced in August 2011 (n = 864 per session)...... 40

Figure 3.3. Number of adult bush rats (original 100 released) not captured (0) or recaptured once (1 = dispersers) or up to five times (2, 3, 4, 5 = residents) over eight sessions of trapping (September 2011 to October 2012) in the four reintroduction sites (n = 864 per session). Numbers include all animals captured per site – including any animals that originated and dispersed from another site...... 41

Figure 3.4. Number of adult bush rats (original 100 released) not recaptured or recaptured only once (0-1 = dispersers), and bush rats recaptured more than once (>1 = residents) over eight sessions of trapping (September 2011 to October 2012) in the four reintroduction sites (n = 864 per session)...... 42

Figure 3.6. Number of bush rats from the original 100 that were recaptured over the entire trapping period (9 sessions, September 2011 to May 2014) in the four reintroduction sites. Male (dark grey) and female (light grey). Bush rats were reintroduced in August 2011 (n = 864 per session)...... 44

Figure 3.7. Number of male (dark grey), female (light grey) and unknown sex (stripes) offspring captured over the entire trapping period in the four reintroduction sites (9 sessions, September 2011 to May 2014) and a control site Bradley’s Head (BH – site 500m from Site 1)...... 45

Figure 3.9. (A) Model averaged estimates of survival probability for male and female bush rat offspring over time (from October 2011, seven* trapping sessions over one year) and (B) estimates of recapture probability for male and female bush rat offspring over time (from December 2011, six trapping sessions over one year) (±SE)...... 47

Figure 3.10. Average initial weight (g) of 60 female and 40 male bush rats released into the four reintroduction sites in August 2011 (±SE)...... 47

Figure 3.11. Average weight (g) of the original 100 bush rats released into the four reintroduction sites. Including average release weight for each site and the average weight for each site for the first 12 months after release (±SE)...... 48

Figure 3.12. Difference in Body Condition Index (BCI) of bush rats upon release into the four reintroduction sites. Dark grey indicates a BCI of greater than 1 (good body condition) and light grey indicates a BCI of less than 1 (poor body condition). Demonstrating the difference in BCI within and between the four reintroduction sites...... 49

Figure 3.13. Difference in Body Condition Index (BCI) of male bush rats upon release into the four reintroduction sites. Dark grey indicates a BCI of greater than 1 (good body condition) and light grey indicates a BCI of less than 1 (poor body condition)...... 50

vii

Figure 3.14. Difference in Body Condition Index (BCI) of female bush rats upon release into the four reintroduction sites. Dark grey indicates a BCI of greater than 1 (good body condition) and light grey indicates a BCI of less than 1 (poor body condition)...... 50

Figure 3.15. Survival curve comparing the probability of bush rats surviving after release for six months with Encephalomyocarditis virus (light grey) and without the virus (dark grey)...... 51

Figure 3.16. Relationship between habitat characteristics and the number of bush rats on each site after one year of release in October 2012, fitted with linear regression. Habitat characteristics include (A) quadrant cover, (B) average canopy height, (C) average soil moisture, (D) average leaf litter depth, (E) average plant ground cover, and (F) average bare ground. See Table 2.2 for description of characteristics and Table 2.3 for categories and scales used to classify characteristics of vegetation structure...... 52

Figure 3.17. Mean quadrant cover percentage (column) and total number of bush rat captures (line) on the four reintroduction sites after one year (October 2012). Quadrant cover measured in a 1m radius around 36 trap stations on each site and averaged...... 53

Figure 4.1. Radio transmitter collar (single stage VHF collars Sirtrack®) weighing 3.0g and radio transmitter attached to bush rat. Collar less than 5% of the bush rats’ body weight so as not to impede the bush rats comfort or movement...... 71

Figure 4.2. An example of how triangulation of three directional bearings are taken to locate a radio collared bush rat, with an angle of no less than 30° between each bearing...... 73

Figure 4.3. Mean area (ha ± SE) 50% KUD exploratory phase (dark grey) compared to 50% KUD establishment phase (light grey) across four reintroduction sites...... 76

Figure 4.4. Mean area (ha ± SE) comparison of male and female 50% KUD exploratory phase (dark grey) compared to 50% KUD establishment phase (light grey) across four reintroduction sites...... 77

Figure 4.5. Mean area (ha ± SE) for female bush rats (n = 11). 50% KUD exploratory phase core area (dark grey) compared to 50% KUD establishment phase core area (light grey) across four reintroduction sites...... 78

Figure 4.6. Mean area (ha ± SE) for male bush rats (n = 10). 50% KUD exploratory phase core area (dark grey) compared to 50% KUD establishment phase core area (light grey) across four reintroduction sites...... 78

Figure 4.7. Linear distance travelled (m) by individual male (dark grey) and female (light grey) bush rats from their release points in the four reintroduction sites. Distance measured in a straight line from release point to final trap position if recaptured. 79

viii

Figure 4.8. Mean dispersal distance (m ± SE) from release points for male (dark grey) and female (light grey) bush rats across four reintroduction sites. Distance measured in a straight line from release point to final trap position if recaptured...... 79

Figure 4.9. Mean dispersal distance (m ± SE) from release points for male (dark grey) and female (light grey) bush rats in the four reintroduction sites. Distance measured in a straight line from release point to final trap position if recaptured...... 80

Figure 4.10. Mean percentage (± SE) of female bush rats overlapping establishment areas (home range) with other females. Compared to male bush rats overlapping establishment areas (home range) with other males at the four reintroduction sites. 50% KUD (dark grey) and 95% KUD (light grey)...... 81

Figure 4.11. Female bush rat kernel utilisation distribution (KUD) establishment phase overlap (50% and 95% KUD). A. Site 1 (n = 3), B. Site 2 (n = 3), C. Site 3 (n = 3) and D. Site 4 (n = 2). Each bush rat is represented by a different colour...... 82

Figure 4.12. Male bush rat kernel utilisation distribution (KUD) establishment phase overlap (50% and 95% KUD). A. Site 1 (n = 3), B. Site 2 (n = 2), C. Site 3 (n = 2) and D. Site 4 (n = 3). Each bush rat is represented by a different colour...... 83

Figure 4.13. Mean percentage (± SE) of male bush rats overlapping establishment areas (home range) of female bush rats. Compared to female bush rats overlapping establishment areas (home range) of male bush rats at the four reintroduction sites. 50% KUD (dark grey) and 95% KUD (light grey)...... 85

Figure A4.1. Mean area (ha ± SE) 95% KUD exploratory phase (dark grey) compared to 95% KUD establishment phase (light grey) across four reintroduction sites...... 92

Figure A4.2. Bush rat kernel utilisation distribution (KUD) for Site 1. (A) Exploratory phase core area 50% KUD and (B) 95% KUD, (C) establishment phase core area 50% KUD and (D) 95% KUD for all bush rats radio tracked (n = 3 females and 3 males). Each bush rat is represented by a different colour...... 93

Figure A4.3. Bush rat kernel utilisation distribution (KUD) for Site 2. (A) Exploratory phase core area 50% KUD and (B) 95% KUD, (C) establishment phase core area 50% KUD and (D) 95% KUD for all bush rats radio tracked (n = 3 females and 2 males). Each bush rat is represented by a different colour...... 94

Figure A4.4. Bush rat kernel utilisation distribution (KUD) for Site 3. (A) Exploratory phase core area 50% KUD and (B) 95% KUD, (C) establishment phase core area 50% KUD and (D) 95% KUD for all bush rats radio tracked (n = 3 females and 2 males). Each bush rat is represented by a different colour...... 95

Figure A4.5. Bush rat kernel utilisation distribution (KUD) for Site 4. (A) Exploratory phase core area 50% KUD and (B) 95% KUD, (C) establishment phase core area 50% KUD and (D) 95% KUD for all bush rats radio tracked (n = 2 females and 3 males). Each bush rat is represented by a different colour...... 96

Figure A4.6. Mean area (ha ± SE) comparison of male and female 95% KUD exploratory phase (dark grey) compared to 95% KUD establishment phase (light grey) across four reintroduction sites...... 97

Figure A4.7. Mean area (ha ± SE) for female bush rats (n = 11). 95% KUD exploratory phase (dark grey) compared to 95% KUD establishment phase (light grey) across four reintroduction sites...... 97

Figure A4.8. Mean area (ha ± SE) for male bush rats (n = 10). 95% KUD exploratory phase (dark grey) compared to 95% KUD establishment phase (light grey) across four reintroduction sites...... 97

Figure 5.1. The number of siblings that were captured at the source sites (Muogamarra Nature Reserve and Ku-ring-gai Chase National Park, August 2011) and the distance (m) between their captures...... 107

Figure 5.2. Probability of survival from time released (months) for related (light grey) and unrelated (dark grey) bush rats across all four reintroduction sites...... 108

Figure 5.3. Probability of survival from time released (months) for related (light grey) and unrelated (dark grey) male bush rats across all four reintroduction sites...... 108

Figure 5.4. Probability of survival from time released (months) for related (light grey) and unrelated (dark grey) female bush rats across all four reintroduction sites. .. 108

Figure 5.5. Percentage of related (light grey) bush rats remaining on each of the four reintroduction sites compared to unrelated (dark grey) bush rats over a ten month period after release in August 2011...... 109

Figure 5.7. The percentage of bush rats recaptured (dark grey) over the trapping period (September 2011 to May 2014) in the four reintroduction sites compared to the percentage of bush rats that were not recaptured but produced offspring (light grey) determined with genetic analysis...... 112

Figure 5.9. The number of parents and the corresponding number of offspring produced at S1+S2. Three out of 8 mothers (dark grey) produced one offspring each and one

mother produced five offspring. Two out of five fathers (light grey) produced one offspring each and one father produced five offspring...... 115

Figure 5.10. The total number of parents and the corresponding number of offspring produced at S3+S4. Nine of 15 mothers (dark grey) produced one offspring each. Two out of nine fathers (light grey) produced one offspring each and one father produced five offspring...... 115

Figure 5.11. Relationship between the number of offspring produced and the initial weight of the mother (A) and father (B)...... 116

Figure 6.1. Number of black rats (light grey) removed from the four reintroduction sites and bush rats (dark grey) released into the four reintroduction sites compared to total number of black rats and bush rats captured over the entire trapping period (9 sessions, September 2011 to May 2014, n = 864 per session). Black rats were removed in August 2011 and bush rats were reintroduced one week after removal...... 135

Figure 6.2. Number of bush rats (dark grey) and black rats (light grey) not recaptured or recaptured only once (A. Dispersers 0-1), and bush rats and black rats recaptured more than once (B. Residents > 1) over eight sessions of trapping (September 2011 to October 2012) in the four reintroduction sites (n = 864 per session)...... 136

Figure 6.3. Site 1 trapping grid with 20% (A) and 50% (B) fixed kernel utilisation distribution (KUD) of trapping pattern and overlap for bush rat (blue) and black rats (red). Bush rat area is 0.12ha and 0.41ha for KUD A and B respectively. Black rat area is 0.27ha and 0.79ha. Trapping grid (1ha, 36 trap stations) represented by red and blue dots...... 138

Figure 6.4. Site 2 trapping grid with 20% (A) and 50% (B) fixed kernel utilisation distribution (KUD) of trapping pattern and overlap for bush rat (blue) and black rats (red). Bush rat area is 0.15ha and 0.51ha for KUD A and B respectively. Black rat area is 0.26ha and 0.73ha. Trapping grid (1ha, 36 trap stations) represented by red and blue dots...... 139

Figure 6.5. Site 3 trapping grid with 20% (A) and 50% (B) fixed kernel utilisation distribution (KUD) of trapping pattern and overlap for bush rat (blue) and black rats (red). Bush rat area is 0.21ha and 0.59ha for KUD A and B respectively. Black rat area is 0.24ha and 0.70ha. Trapping grid (1ha, 36 trap stations) represented by red and blue dots...... 139

Figure 6.6. Site 4 trapping grid with 20% (A) and 50% (B) fixed kernel utilisation distribution (KUD) of trapping pattern and overlap for bush rat (blue) and black rats (red). Bush rat area is 0.26ha and 0.76ha for KUD A and B respectively. Black rat area is 0.24ha and 0.07ha. Trapping grid (1ha, 36 trap stations) represented by red and blue dots...... 140

List of Tables

Table 2.1. Different characteristics of Rattus fuscipes and Rattus rattus used to identify each species while trapping and collecting data in Sydney Harbour National Park reintroduction sites...... 26

Table 2.2. Characteristics and description of the vegetation structure measured around each trap station in a 1m radius. Measurements used for the two source sites (Muogamarra Nature Reserve and Ku-ring-gai Chase National Park) and the four reintroduction sites in Sydney Harbour National Park...... 29

Table 2.3. Categories used to classify characteristics of vegetation structure measured around each trap station in a 1m radius...... 30

Table A3.1. RELEASE Goodness of Fit results. Summary of Test 2 and Test 3: Comparison of group survival rate estimation with capture-recapture data of bush rats. Group represented by four different reintroduction sites...... 60

Table A3.2. Top four models describing survival (φ) and recapture (p) probabilities of bush rats over four reintroduction sites...... 61

Table A3.3. RELEASE Goodness of Fit results. Summary of Test 2 and Test 3: Comparison of group survival rate estimation with capture-recapture data of bush rats. Groups represented by male and female...... 62

Table A3.4. Top seven models describing survival (φ) and recapture (p) probabilities of bush rats over four reintroduction sites between sexes...... 63

Table A3.5. RELEASE Goodness of Fit results. Summary of Test 2 and Test 3: Comparison of group survival rate estimation with capture-recapture data of bush rats. Groups represented by male and female...... 64

Table A3.6. Top eleven models describing survival (φ) and recapture (p) probabilities of juvenile bush rats (recruits) over four reintroduction sites between sexes...... 65

Table A3.7. Measurements of habitat characteristics around each trap station in a 1m radius averaged across each source site (Muogamarra Nature Reserve and Ku-ring- gai Chase National Park) and reintroduction site (Sydney Harbour National Park)...... 66

Table A4.1. Bush rat individuals attached with radio transmitters for radio tracking across the four reintroduction sites in Sydney Harbour National Park...... 90

Table A4.2. Radio tracked bush rats and the size of their exploratory area (ha) and establishment area (ha) with 50% (core area) and 95% Kernel Utilisation Distribution (KUD). Over the four reintroduction sites...... 91

Table A5.1. Eleven microsatellite loci and primer sequences (5’ – 3’) used for relatedness analysis of bush rats reintroduced into Sydney Harbour National Park...... 121

xii

Table A5.2. Genetic diversity estimates of 11 microsatellite loci used for parentage and sibship assignment of bush rats. Including the number of alleles (NA), observed heterozygosity (Ho), expected heterozygosity (He) polymorphism information content (PIC), the frequency of null alleles (F (Null)), and average non-exclusion probabilities (NE-1P, NE-2P, NE-PP) as estimated by CERVUS...... 122

Table A5.3. Parentage assignment of 25 offspring from S1+S2 population and 42 offspring from S3+S4. Candidate mother or father is assigned with pair LOD score (LOD), pair delta (Δ), pair loci mismatching (MM), and pair confidence (C) as estimated by CERVUS...... 123

Table 6.1. Number of black rats removed each day from the reintroduction sites over ten days, including total number removed. Bush rats were released onto each of these sites one week after day ten (August 2011)...... 130

Table 6.2. Proportion (percentage) of bush rats and black rats captured in Elliott traps versus cage traps and the number of times a bush rat and a black rat was caught at the same trap position at the same time (i.e. 1 animal in each trap at one trap station – Both Species Detected). Data collected over nine sessions of trapping (September 2011 to May 2014) in the four reintroduction sites (n = 864 per session)...... 131

Table 6.3. Percentage of overlap for black rats and bush rats in the four reintroduction sites within 20% KUD and 50% KUD...... 140

Table A6.1. Parameters for multi-season, two-species occupancy model in PRESENCE 10.0...... 145

Table A6.2. Multi-season, two-species model fit and selection statistics for bush rats and black rats. Top six models for each of the four reintroduction sites. Describing probability of occupancy (ѱ), detection (p), colonisation (γ) and extinction (ε). ... 147

Table A6.3. Model outputs from multi-season, two-species occupancy models for bush rats and black rats in four reintroduction sites. Output describing occupancy (ѱ), co- occurrence (ϕ), colonisation (γ) and extinction (ε) probabilities with standard errors (SE). ‘A’ represents black rat, ‘B’ represents bush rat. Outputs are shown for models that were within two ΔAIC of the most supported model...... 148

Table A6.4. Model outputs from multi-season, two-species occupancy models for bush rats and black rats in four reintroduction sites. Output describing season (s), detection (p), detection with both species present (r) and co-detection (δ) probabilities with standard error (SE). ‘A’ represents black rat, ‘B’ represents bush rat. Outputs are shown for models that were within two ΔAIC of the most supported model...... 150

xiii

Abstract

With habitat destruction and invasive species comes the loss of biodiversity and ecosystem function. Animal translocations and reintroductions are one of the key options available to conserve and restore wildlife populations and ecosystems. Translocation is relatively new within the broader context of conservation and has only become a commonly used scientific tool within the past 40 years, as such, there are no definitive guidelines for best practice. Wildlife translocations and reintroductions are complex, expensive, and time-consuming, often meaning that many of them fail to establish viable populations. The low success rate has been attributed to inadequate knowledge of species-specific behaviour, poor release site selection, environmental pressures, predation, competition and stress. Monitoring populations after reintroduction is important to identify the success or potential causes for failure, to adapt and improve management strategies. Ideally, successful translocation is indicated by the ability of the translocated, or augmented population, to become self-sustaining, free-ranging and viable in the long term.

The Bush Rat Project was the first study to translocate and reintroduce the native bush rat (Rattus fuscipes) into Sydney Harbour National Parks (SHNP) in an attempt to restore the ecosystem and reduce invasive species (black rat, Rattus rattus) populations. 100 bush rats (60 females and 40 males) were released in August 2011 into four sites in SHNP. Bush rats were released in familiar groups and 20 animals were radio tracked for two months. Nine trapping sessions were conducted, the last in May 2014. Ear tissue was taken from all bush rats for use in microsatellite genetic analysis. Sibships and parent-offspring relatedness were determined through this process. Prior to bush rat release each of the four sites were intensively trapped for ten nights to remove black rats. Using these methods, factors that influenced bush rat translocation success were examined, including sex, body condition, weight, virus status, dispersal and establishment of home range, genetic relatedness and structure. These factors were assessed in relation to population dynamics and survival rates, breeding success and habitat. Possible biological control of an invasive species via competition was also examined by

xiv

comparing persistence of bush rats to number of black rats, avoidance patterns and spatial segregation.

Success of translocation in this study can be shown through sex, reproduction, body condition, habitat suitability, site fidelity, relatedness and competition. In the initial stages (within the first year), populations of bush rats had established on all sites and juvenile recruitment occurred, indicating survival, growth and evidence of reproduction. Over the entire study period bush rats persisted in three of the four sites but the remaining numbers were low (less than the numbers released), thus maintaining a viable, self-sustaining population would be difficult. Although animals remained after three or four generations, long-term persistence could be affected by major environmental change or demographic stochasticity if populations remain small.

The most successful site that persisted the longest had the highest recapture rate, juvenile recruitment, resident individuals and it retained and recruited the most females. It was also the site with significantly lower body condition and weight (BCI < 1) and significantly higher habitat complexity (Quadrant Cover). These two qualities could be considered as important for a successful translocation. Good BCI indicates older and possibly more dominant individuals, thus, translocation fitness could be negatively correlated with previous social ranking and age. Age and the stress resulting from handling and translocation could have caused premature death. Combined with the bush rat’s short life cycle, it could be beneficial to choose younger individuals for the translocation process. Quadrant Cover would increase chances of survival for bush rats unfamiliar with the area, as it is the degree of concealment microhabitats provide from visual predators or competition. There were positive correlations between habitat complexity and bush rat numbers, which confirms the need for suitable dense habitat once the bush rat has established in an area and juvenile recruitment is occurring. Quadrant Cover, canopy height, soil moisture, leaf litter depth and plant ground cover were all important to bush rat survival. Bare ground cover had a negative relationship with bush rat occupancy. It is essential for successful reintroductions to find suitable environments that can meet a species’ habitat requirements. Species considered for reintroduction may lack their original habitat types or lack

unaltered habitat (e.g. due to human land use). Therefore translocating to areas with suitable habitat could increase the chances of a sustainable population.

Translocation disrupted typical movement behaviour of bush rats reintroduced into SHNP. Bush rat movement was greater when compared to earlier research, indicating site fidelity was affected by translocation. Animals were dispersing extensive distances, resulting in poor juvenile recruitment and population growth on release sites. It was most likely a flight response due to the stress of being released into an unfamiliar environment. Further, low densities of conspecifics will lead to larger ranges because of difficulty in ﬁnding suitable mates in low density populations. Larger studies with continued monitoring need to be implemented to help in evaluating future success of the populations. Trapping in larger areas (outside of trapping grids) and extending the radio tracking period may have shown bush rat persistence and whether the effect of the translocation is limited to a certain time period after release.

Proximate bush rats were more genetically alike than more distant animals, with a high degree of relatedness amongst animals captured close together. That is, the closer the bush rats were caught at the source sites, the more likely it was that they would be related. Genetic analysis was complimentary to trapping, adding data that would have otherwise been missed. Trapping alone underestimated the number of bush rats remaining by approximately 25%. Genetic analysis helped detect bush rats that were not trapped and had dispersed after translocation, as they had produced offspring in other locations. The bush rats released in SHNP were polygamous with both sexes sharing offspring with multiple partners. But there was no clear indication of a structured female or male breeding hierarchy in the populations; where a small number of animals produce the majority of offspring. This is unusual for bush rats, however, translocation and dispersal could have influenced the structured hierarchy. The establishment of a new hierarchy after translocation may have allowed more females to breed in a closer proximity to each other. Females were tolerating each other and allowing home range/breeding overlap. Perhaps leading to re-establishment of a hierarchy with multiple females breeding at once, as the first female to breed is usually the dominant in the area. Continued monitoring may have indicated whether bush

xvi

rats are able to adapt to a changing environment and be flexible with social structure to regain population density. Further genetic testing could also lead to a better understanding of social structures and mating systems.

There was no significant relationship between the persistence of bush rats and the number of black rats. Neither species regained their initial numbers from spring 2011 (number of black rats removed or number of bush rats released), but after one year, with the combined numbers of both species, two of the sites had numbers close to the total number of black rats removed. Overall, bush rat numbers remained low so they did not gain residency advantage in the sites and control black rat populations. There was some indication of interspecific avoidance, meaning both species were temporally segregated; occupying the same area but avoiding spaces where the other was previously detected. It appears that the two species were coexisting and partitioning microhabitat. Bush rats were more likely to occupy traps than black rats, and the detection of one species was affected by the other. Habitat and resource partitioning are complementary mechanisms for interspecific coexistence; but only if the site has adequate resources to support both species. Continued removal of black rats from the system may allow bush rats to establish territories, increasing population densities and possibly indicating whether interspecific competition is a viable option for the control of invasive species in SHNP.

Common species are important in ecosystem structure and function. Declines in their abundance and distribution can lead to loss of less common species and ecosystem function. Wildlife restoration and thus ecosystem function can be restored to ecosystems that are biodiversity poor or have a high element of invasive species. Wildlife restoration increases the functional diversity of remnant habitats, making them more resistant to invasion. As well as being far more cost- effective than reactive management in reversing declines, this proactive approach also helps to determine underlying mechanisms that are required for successful translocation, thus, producing best practice for the reintroduction of rarer species.

Bush rat reintroduction into SHNP uses the wildlife restoration concept to reintroduce a common species to restore ecosystem function, increase biodiversity and control invasive species. Bush rats are good candidates for

xvii

translocation and reintroduction, because they are adaptable and not endangered, therefore can be safely used for multiple reintroductions. Bush rats existed in SNHP as recently as 100 years ago and have conspecifics close by in comparable habitats. They can be sourced from original sites and usually display a rapid population recovery. Therefore bush rat characteristics make them ideal for investigating translocation, colonisation, recovery and competition, within a fragmented habitat. The sites in this study are too new, therefore more introductions to stabilise population would assist bush rat persistence if changes in the environment occur. This is supported by other studies that have shown that repeated releases of large numbers of individuals were generally required to successfully establish a translocated population and create a self-sustaining ecosystem where minimal intervention is required.

Wildlife restoration via bush rats creates a situation in which less resources need to be invested in ecological management, as the environment will eventually be capable of self-maintenance. Thus, creating a self-sustaining ecology that does not require further interventions. By reintroducing locally-extirpated animals into modified landscapes, wildlife restoration is a proactive approach that will maintain biodiversity, ecosystem function and avoid future species decline.

xviii

CHAPTER 1: General Introduction and the Sydney Bush Rat Project

Megan Callander – Translocation and Reintroduction of Native Bush Rats

1.1 ECOSYSTEM RESTORATION AND TRANSLOCATION Degradation of habitats and fragmenting landscapes are causing the decline of species and biological diversity worldwide (Griffith et al. 1989). Due to this, and with the introduction of predators such as the red fox (Vulpes vulpes) and feral cat (Felis catus), many Australian native species have experienced a high rate of decline or even extinction (Kingsford et al. 2009; Ford et al. 2001; Bennett et al. 2012). This decline has been seen across mammal, bird and amphibian taxa (Short and Smith 1994; Ford et al. 2001; Murray and Hose 2005; Bennett et al. 2012). With these pressures and other anthropogenic impacts (including climate change) an increasing number of species require direct human assistance to maintain demographically and genetically viable populations, persist in areas where conditions are suitable, and extend past their natural range (Carter et al. 2017; Griffith et al. 1989; Batson et al. 2015).

Habitat restoration is fundamental to recovering both species and ecological processes in Australia. Restoration ecology has traditionally focused on restoring vegetation, assuming that native fauna will then return with ecosystem function. However, if the habitat is fragmented then translocation of wildlife may be required, especially for species with limited dispersal abilities (Griffith et al. 1989; Carter et al. 2017; Bennett et al. 2012). Increased rates of species extinction have required management to conserve biological diversity and translocation has become an increasingly important conservation technique in the management of wild populations (Griffith et al. 1989; Letty et al. 2000; Seddon et al. 2007; Bajomi et al. 2010; Bennett et al. 2012).

Translocation involves the deliberate movement of wild individuals or populations from one part of their range to another, in an attempt to establish, re- establish, or augment a population (IUCN 1998; Griffith et al. 1989) and may involve wild-caught or captive-bred animals and consist of more than one release. Translocation can recover declining populations, restore locally extinct species or allow the creation of new wild populations (Griffith et al. 1989; Bakker 2006; Dickens et al. 2010; Short 2009). Also, it may be used to move sensitive species from habitats that are degraded due to human development (Field et al. 2007), and can reduce human-wildlife interactions and conflicts (Fritts et al. 1984;

Chapter 1: General Introduction and the Sydney Bush Rat Project

Sullivan et al. 2004; Fischer and Lindenmayer 2000; Seddon et al. 2007). Translocation can be divided into three categories, introduction, reintroduction, and restocking (IUCN 1998; Short 2009).

Introduction is the intentional (or accidental) dispersal of a species outside their native range (IUCN 1998; Short 2009; Seddon et al. 2007). Historically, this type of translocation has been used for aesthetic reasons, biological pest control, to establish new food resources and to create satellite populations to reduce the risk of species loss (Griffith et al. 1989; Green 1997; Seddon et al. 2007). The IUCN guidelines have recently been updated to include ‘assisted colonisation’, as species may need to be moved to new locations for their long-term survival (IUCN 2013; Carter et al. 2017). Also, the potential for ‘ecological replacements’ in situations where key species are lost from an area and cannot realistically be restored (IUCN 2013; Carter et al. 2017). Reintroduction is the intentional movement of a species back into its former native range from which it has been extirpated or become extinct (IUCN 1998; Bennett et al. 2012; Short 2009). Restocking is the movement of a species with the intention of increasing numbers of populations already occupying the original habitat (IUCN 1998; Short 2009). This is often used to augment depleted populations and strengthen genetic heterogeneity of small populations (Nussear et al. 2012; Seddon et al. 2007; Bajomi et al. 2010; Sheean et al. 2012).

1.1.1 Factors Driving Translocation Success Translocations can be complex, time consuming and expensive to complete at a high standard (IUCN 2013; Batson et al. 2015). Because of this, translocation of a number of species has had varying (often low) levels of success; success being the creation of a self-sustaining population (Griffith et al. 1989; Dickens et al. 2010; Letty et al. 2000; Field et al. 2007). Out of nearly 500 translocations, which included invertebrates, fish, reptiles, amphibians and mammals, fewer than half of the translocation efforts were successful (Griffith et al. 1989; Wolf et al. 1996; Seddon et al. 2007; Sheller et al. 2006).

The period directly after release is usually the most crucial for the animal’s survival and thus successful population establishment (Armstrong and Seddon 2008; Dickens et al. 2010). A variety of factors can contribute to translocation

Megan Callander – Translocation and Reintroduction of Native Bush Rats failure including decrease in reproductive capacity (Wolf et al. 1998; Dickens et al. 2009), dispersal from the reintroduction site (Griffith et al. 1989; Miller et al. 1999; Coates et al. 2006), stress (Letty et al. 2000; Teixeira et al. 2007; Chipman et al. 2008), increase in disease (Hartup et al. 1999), predation (Banks et al. 2002; Van Zant and Wooten 2003) and competition by pest species (Richards and Short 2003; Short et al. 1992; Gibson et al. 1994; Southgate and Possingham 1995). Other factors include overgrazing by livestock and introduced herbivores, and poor fire management (Martin and McDonald-Madden 2011; Short 2009; Richards and Short 2003). In some instances translocation can be very successful, with the translocated population increasing to high densities and having major impacts on the surrounding species and ecosystem (Mueller and Hellmann 2008; Ricciardi and Simberloff 2009; Sandler 2010). Thus, valid concerns, both biological and political, are associated with the translocation of wildlife (Berry 1986; Dodd and Seigel 1991; Tuberville et al. 2005).

Definitions of successful translocations are variable and determining definitive success can involve lengthy studies (Fischer and Lindenmayer 2000; Seigel and Dodd 2002). Different species vary significantly in their suitability for translocation due to behavioural and ecological characteristics, such as mobility within the landscape, genetic issues, susceptibility to disease, and conservation status (Griffith et al. 1989; Wolf et al. 1996; Carter et al. 2017). Many birds have the ability to move across habitats despite fragmentation and reach areas naturally if conditions are suitable. Translocations may be required for reintroduction of locally extinct species or birds with poor ability to recolonise independently (Carter et al. 2008). In contrast, most amphibians and reptiles, and many mammals are not highly mobile, and for some species dispersal is exceedingly problematic (Bright 1993; Cushman 2006; Carter et al. 2017).

The primary factors associated with translocation successes are 1. Good quality and suitable habitat, with the presence of refugia, 2. Location of release area (e.g. inside the core native range), 3. Large number of animals released, 4. Duration of translocation program, and 5. Reproductive traits (Griffith et al. 1989; Wolf et al. 1996; Sheller et al. 2006; Tuberville et al. 2005). Other important factors to take into consideration are the identification and control of the original causes for the

Chapter 1: General Introduction and the Sydney Bush Rat Project decline of the study species (Bennett et al. 2012; Griffith et al. 1989). Additionally, high genetic diversity, low competition, herbivorous or omnivorous diet (Griffith et al. 1989), behavioral traits and species-specific attributes (Armstrong and Craig 1995; Clarke and Schedvin 1997; Van Zant and Wooten 2003). Translocation of intact social groups has also been shown to increase success rates of reintroductions in some instances (Shier and Owings 2006; Bennett et al. 2012).

Comprehensive planning prior to translocation is critical for successful conservation goals and reducing the risk of unintended consequences (IUCN 1998; Tuberville et al. 2005). The science of reintroduction biology is rapidly developing, with conservation managers beginning to view translocations more creatively than simply restoring populations (Seddon et al. 2014). As knowledge increases, researchers can work with more challenging species and help to ensure risks inherent in species translocations are minimised (Seddon et al. 2007). To increase the success of translocation it is important to understand species-specific behaviour, traits, movement patterns and structure, both social and genetic (Dickens et al. 2010; Bakker 2006; Tarszisz et al 2014). Habitat type and condition, competition, predation and invasive species within the new environment also needs to be taken into consideration.

1.2 INVASIVE SPECIES After habitat destruction, the second biggest threat to ecosystem restoration and biodiversity is invasive species (Macdonald and Thom 2001; Fasola et al. 2009). Introduced species can cause extinctions and displacement of native fauna through competition, predation, herbivory and disease (Stokes et al. 2009a; Banks and Smith 2015; Henderson et al. 2011; Vitousek et al. 1996; Karesh et al. 2007). Successful invasive species usually exhibit life history traits such as short generation times, opportunistic breeding, high fecundity and an opportunistic diet (McKinney and Lockwood 1999). They normally have a climate match between their original geographic range and the new one; a history of establishing invasive populations; and are able to live in modified landscapes (McKinney and Lockwood 1999; Hart and Bomford 2006; Forsyth et al. 2004). Invasive species typically have few natural predators or fatal diseases, and as a result, their populations do not naturally decline and can reproduce quickly when conditions are favourable

Megan Callander – Translocation and Reintroduction of Native Bush Rats

(DSEWPC 2011; Bomford 2008), giving them a competitive advantage over native species (Stokes et al. 2009a).

Pest species represent one of Australia’s greatest environmental problems. The cost of introduced pest species has been estimated at more than AU$743 million per year, excluding social, environmental, and long-term costs such as general ecosystem degradation (Gong et al. 2009; Hart and Bomford 2006; McLeod 2004; Invasive Animals CRC 2013). The control of vertebrate pests often involves conventional methods such as trapping, baiting, fencing and shooting, although these methods are often high energy and high cost (DSEWPC 2011). Due to their life history traits, reinvasion following pest control is the most common cause of failure in invasive species management (McLeod 2004; Invasive Animals CRC 2013). A majority of the effort and money goes into preventing reinvasion (DSEWPC 2011). Despite attempts, no invasive pest species on mainland Australia has been successfully eradicated. It is imperative to find ways of controlling these species, therefore, mitigating their impacts through biological control may be an effective option to combine with traditional methods (Hart and Bomford 2006; Keller et al. 2007).

1.3 BIOLOGICAL CONTROL Biological control typically involves active human management of a pest with the use of a natural enemy or biological control agent (Vincent et al. 2007). A biological control agent can be a natural predator, competitor, parasite, or disease-inducing bacteria or virus (DSEWPC 2011). There are three basic types of biological pest control strategies:

1. Classical biocontrol is the introduction of a control agent into an area where it has not previously existed to provide long-term control of a pest. 2. Inundative (or Augmentative) biocontrol involves the supplemental release of locally-occurring, natural control agents. This method increases the control agent’s population but usually needs to be repeated. 3. Conservation biocontrol conserves or enriches a control agent already present in the environment. This is achieved through the manipulation of

Chapter 1: General Introduction and the Sydney Bush Rat Project

the environment or through crop and pest management practices (Vincent et al. 2007).

1.3.1 Competitive Biocontrol Another method to reduce reinvasion is competitive biocontrol. Competition may occur within or between species where individuals deprive others of resources, resulting in the reduction in growth, fecundity and survival (Begon et al. 1986; Glen and Dickman 2005). There are two broad categories of competition: exploitation or interference (Schoener 1983). Exploitation competition is when individuals use resources and deprive others of those resources (Schoener 1983; Glen and Dickman 2005). Whereas, interference competition is when individuals are directly antagonistic and thus exclude others from resources, for example, producing chemical deterrents or fighting (Schoener 1983; Glen and Dickman 2005; Sih et al. 1985). If resources are separated, competition theory predicts two competing species can coexist, if there is no separation and the two species are within the same ecological niche, competitive exclusion predicts one species will exclude or eliminate the other (Gause 1934; Hardin 1960). The Sydney Bush Rat Project has investigated this form of competitive biological control, which uses a native mammal species to combat an invasive species.

1.4 SYDNEY BUSH RAT PROJECT The Sydney Bush Rat Project was developed by combining ecosystem restoration via translocation of a native species and pest control via competitive biocontrol. The Sydney Bush Rat Project was a collaborative project which began in 2010, with the goal to bring native species back into Sydney Harbour National Parks (SHNP), reduce invasive species and recover the ecosystem. It involved partnered organisations Australian Research Council (ARC), Department of Environment and Climate Change (DECC), National Parks and Wildlife Service (NPWS), Landcare Research New Zealand, Rentokil, Australian Wildlife Conservancy (AWC), Taronga Conservation Society Australia (TCSA) and Mosman Council.

The project was implemented to improve management of rodents by developing a new pest control method; using the reintroduction of a common native species (bush rat, Rattus fuscipes) to block the reinvasion of an invasive species (black rat,

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Rattus rattus). This competitive biocontrol is a humane and ecological solution to control black rats without the prolonged use of poisons. Studies conducted previously have shown that densities of black rats are low in the presence of native rats and dominance depends upon a residency advantage (Stokes et al. 2009a, 2009b). Thus, reducing black rat numbers and reintroducing bush rats may limit the reinvasion of black rats and restore the native ecosystem of SHNP.

To understand competition processes Stokes and colleagues (2009b) experimentally reduced black rat numbers in littoral rainforest sites of Jervis Bay, Australia. Removal of black rats resulted in significant and sustained increases in populations of bush rats from immigration, juvenile recruitment and increased residency of females. Where the black rats were not removed juvenile bush rats were largely absent despite breeding in females. Body condition and reproduction of adult bush rats did not change with the removal of black rats, suggesting that direct competition was occurring through interference by black rats (Stokes et al. 2009b). Relative abundance and distribution of the two species indicated competition but without one species being dominant. Therefore dominance is not asymmetrically species-specific as in other rodent communities, but site-specific and dependent upon residency (Stokes et al. 2009b; Stokes et al. 2012). Direct behavioural interaction between these two species has also shown that resident individuals (in small experimental enclosures) were dominant in their behaviour towards intruders, regardless of which species was resident (Stokes et al. 2012). Interactions between conspecifics was neutral or amicable and neither species reacted to the other’s odour in field experiments (Stokes et al. 2012). Therefore, direct aggressive interactions between bush rats and black rats in the wild may facilitate spatial segregation. Residency effects represent a novel mechanism by which the bush rat has the potential to limit the invasion success of black rats into native forests.

1.4.1 Overview of Study Design The Sydney Bush Rats Project ran between 2010 and 2013 within 16 experimental sites located throughout headlands in SHNP bush reserves; including North Head, Dobroyd Head, Middle Head and Bradley’s Head (Figure 1.1). Sites were chosen because they were comparable in vegetation structure and fire regimes, with all

Chapter 1: General Introduction and the Sydney Bush Rat Project being adjacent to urban areas (Romero 2012; Benson and Howell 1990; Benson 2011). The 16 sites were divided into four treatments, each treatment replicated four times: Pulse: once only removal of black rats; Press: continual removal of black rats; Reintroduction: once only removal of black rats and reintroduction of native bush rats; Control: no treatment. Treatments were allocated randomly within the 16 sites to avoid bias. Sites were 1ha grids and were separated by at least 500m for spatial independence (Figure 1.2). 500m is a suitable distance because bush rat movement is usually over short distances (Wood 1971); mean distance movement has been found to be as little as 35m to a maximum of 365m (Peakall et al. 2006; Wood 1971; Peakall et al. 2003).

On all SHNP headlands, formerly common native small mammals, such as bush rats, are now absent (Banks et al. 2011a), whereas the black rat is abundant (Banks et al. 2011a; OEH 2015). Black rats were caught by live trapping with 36 traps per site. Pulse removal sites were trapped for ten consecutive nights, and all black rat individuals removed from the site. Press removal sites were trapped initially for ten consecutive nights, and then for three nights each trap session to prevent black rat reinvasion. Control sites were trapped, but no rats were removed. Reintroduction sites were intensively trapped for ten consecutive nights, and bush rats were introduced one week later. In August 2011, 100 native bush rats were reintroduced into the four reintroduction sites in SHNP: Athol Hall (AH – Site 1), Middle Head (MH – Site 2), North Head 3 (NH3 – Site 3), and North Head 6 (NH6 – Site 4) (Figure 1.2).

Bush rats were sourced from two populations approximately 35km North of Sydney: Muogamarra Nature Reserve and Ku-ring-gai Chase National Park (approximately 6km between the two sites). The source sites were chosen after detailed meetings and recommendations from the National Parks and Wildlife Services (NPWS) area managers and teams. NPWS have a working knowledge of the area, thus the sites were chosen because they had comparable habitat to the reintroduction sites and high densities of bush rats. To ensure bush rat numbers were not depleted, removal occurred for a maximum of five consecutive nights in any one area.

Megan Callander – Translocation and Reintroduction of Native Bush Rats

CONTROL No treatment.

PULSE Once only removal of black rats.

PRESS Continual removal of black rats. REINTRODUCTION Once only removal of black rats and reintroduction of native bush rats.

Figure 1.1. Map of study area. Bush Rat Project conducted in Sydney, Australia. Experimental sites throughout headlands in Sydney Harbour National Park bush reserves; including North Head, Dobroyd Head, Middle Head and Bradley’s Head.

Chapter 1: General Introduction and the Sydney Bush Rat Project

DH NH4 TP NH6 (Site 4) GP NH5 NH3 (Site 3) NH2

MH (Site 2)

HMS

BI CH AH (Site 1)

BH 1 KILOMETRE

No treatment. BH (Bradley’s Head), CH (Chowder Head), GP (Grotto Point), CONTROL NH5 (North Head 5).

Once only removal of black rats. CG (Clifton Gardens), TP (Tania Park), NH2 PULSE (North Head 2), NH4 (North Head 4).

Continual removal of black rats. BI (Berry Island), HMS (HMAS Penguin), DH PRESS (Dobroyd Head), WR (Wellings Reserve). Once only removal of black rats and reintroduction of native bush rats. AH REINTRODUCTION (Athol Hall - Site 1), MH (Middle Head - Site 2), NH3 (North Head 3 - Site 3), NH6 (North Head 6 - Site 4).

Monitoring of the populations was conducted by trapping both the bush and the black rats on the four reintroduction sites. Nine trapping sessions were conducted in total. The first, one month after release in September 2011 and every two months thereafter, the eighth trap session in October 2012. The ninth and final trapping session was performed 18 months after the eighth in May 2014. Each of the captured rats were micro-chipped and ear notched for identification. They

Megan Callander – Translocation and Reintroduction of Native Bush Rats were also weighed, sexed, had their head length measured, reproductive status assessed and the condition of the animal was noted.

1.5 BUSH RATS IN SYDNEY HARBOUR NATIONAL PARK The bush rat (Rattus fuscipes) is a native Australian rodent, found along the east coast of Australia. In the surrounding areas of Sydney (Royal, Ku-ring-gai Chase, Garigal and Lane Cove National Parks) the bush rat is abundant, unlike SHNP where they are absent (Cox et al. 2000; Heavener et al. 2014; Banks et al. 2011a) (Figure 1.3). Before reintroducing an animal into a previous range, the cause for their original demise should be determined. One theory as to why bush rats are locally extinct in SHNP is because of the plague, brought to Sydney by the black rat (Banks et al. 2011a). Bush rats that were not killed by the plague were killed by humans to rid Sydney of rats. Bush rats lost their residency in the isolated remnants of bushland and could not disperse due to urbanisation (Banks et al. 2011b; Seebeck and Menkhorst 2000). The areas vacated by bush rats have been rapidly invaded by black rats dispersing from adjacent suburban populations. With the invasive black rats’ ability to thrive with humans, large populations have replaced native Australian species in SHNP. To assist bush rat success in SHNP, black rat numbers were reduced, foxes (a potential predator) were controlled by NPWS, and community awareness programs were initiated. Therefore, bush rat populations released into SHNP would not be constrained by pressures that may have caused previous local extinction.

Chapter 1: General Introduction and the Sydney Bush Rat Project

Figure 1.3. Map of bush rat distribution around the Australian coast. Closer view of the distribution of bush rats in the Sydney region, New South Wales (NCRIS 2011). No sightings have been recorded within the bush rat reintroduction sites in Mosman or Manly.

1.6 SCOPE OF THESIS The Sydney Bush Rat Project’s overall aim is to restore the mammal fauna of SHNP and in doing so, reduce vertebrate pest invasion. This study was the first translocation of a native species into SHNP. My contribution to the greater project focused on evaluating the bush rat translocation by looking at three elements that may influence the reintroduction success:

1. Properties of the individuals 2. Behaviour and social structure 3. Competition

This was achieved by monitoring the establishment process of bush rats, their social structure, interactions, reproduction and survival. For this reason, the four reintroduction sites (Athol Hall – AH, Site 1; Middle Head – MH, Site 2; North Head 3 – NH3, Site 3; and North Head 6 – NH6, Site 4) were the only sites analysed for this thesis. The objectives of the reintroduction were to understand the factors involved that influenced the successful translocation of bush rats and to determine

Megan Callander – Translocation and Reintroduction of Native Bush Rats the short and long term success of the reintroduction of native species. The study evaluates the importance of behaviour and ecology in the design of translocations. It could also assist in the future success of translocation projects by providing an insight into the selection of appropriate sites, animals and the reintroduction process itself.

Chapter 2 will discuss the general methods used for this research with the overview of study species, where the population was sourced and released, habitat characteristics and general study design (release technique, monitoring and data collection).

Chapter 3 will focus on factors influencing bush rat survival using occupancy and detection models, and survival over time. The aim is to assess the importance of species-specific traits and how they may influence translocation success. Changes of demography were determined, i.e. sex, body condition, weight and virus status, and were assessed in relation to survival rates, breeding success and habitat.

Chapter 4 demonstrates how translocation often disrupts behavioural responses of animals. Using radio tracking and trapping data this chapter will describe patterns in the movement behaviour of translocated bush rats. It will determine whether survival is dependent on bush rats dispersal and establishment of home ranges. It also assesses whether dispersal is influenced by other factors like sex and weight.

Chapter 5 determines the bush rats’ social response to translocation, understanding whether genetic relatedness and structure influences spatial structure, breeding and survival. Sibships and parent-offspring relatedness will be determined using genetic analysis of microsatellites and compared with survival, dispersal and virus status. It also discusses whether weight influences fecundity and social structure.

Chapter 6 will discuss influences of competition on potential translocation success using presence modeling and trap association space use. Competition, avoidance patterns and spatial segregation will be examined by comparing persistence of bush rats to number of black rats. Spatial and temporal occupancy and detection of both species will also be examined.

Chapter 1: General Introduction and the Sydney Bush Rat Project

Chapter 7 will be the final discussion and will bring together the findings of all chapters to look at the importance of species-specific traits, behaviour and external factors in the design of translocation research. It will then discuss the implications for reintroduction projects and the potential of translocation as a wildlife restoration and conservation tool.

CHAPTER 2: General Methods

Megan Callander – Translocation and Reintroduction of Native Bush Rats

2.1 STUDY SPECIES A native Australian rodent, the bush rat (Rattus fuscipes) is a new endemic rodent that is widely distributed species, found in a variety of habitats on the east coast of Australia (Watts and Aslin 1981; Peakall and Lindenmayer 2006). Their habitats include rainforest, wet and dry sclerophyll forest, woodlands, scrub or heath, and sedge (Watts and Aslin 1981; Holland and Bennett 2010; Kraaijeveld- Smit et al. 2007; Moro 1991). They favour areas with dense, structurally diverse vegetation and high litter cover, regardless of composition (Bennett 1993; Holland and Bennett 2007; Holland and Bennett 2011). Vegetation complexity provides a wide variety of dietary resources and the dense cover provides protection from predators (Bennett 1993; Holland and Bennett 2007). The bush rat is terrestrial, nocturnal and inconspicuous, nesting in burrows during the day (Watts and Aslin 1981; Peakall and Lindenmayer 2006; Wood 1971). They are omnivorous, and will eat a range of seeds, fruit, fungi, plants and insects (Lindenmayer and Lacy 2002). Bush rats weigh approximately 80-200g, the males generally the heavier of the sexes (Wood 1971; Holland and Bennett 2010).

Bush rats can have more than one litter per year if conditions are favourable, and produce an average of four young per litter (Heinsohn and Heinsohn 1999; Lindenmayer et al. 2005). Bush rat breeding is usually from November to January (Kraaijeveld-Smit et al. 2007). Population densities can exceed ten animals per hectare, increasing in summer due to juvenile recruitment and decreasing over winter, when juveniles mature into sub-adults, and the number of adults decline. In spring, sub-adults reach maturity and come into breeding condition (Lindenmayer et al. 2005; Peakall et al. 2003). This creates an annual turnover of the population as longevity is normally 12 to 15 months (Holland and Bennett 2010; Macqueen et al. 2008). Young are independent at 1-2 months, but most do not breed until the following spring (Lindenmayer and Lacy 2002). At 2-3 months male juveniles usually disperse and females stay in the natal areas, later occupying exclusive breeding territories (Holland and Bennett 2010; Kraaijeveld-Smit et al. 2007; Wood 1971). Bush rats are usually socially tolerant of conspecifics, however breeding season may cause females to be territorial (Robinson 1987).

Chapter 2: General Methods

2.2 SOURCE POPULATION Bush rats were sourced at the beginning of August 2011 from two sites approximately 35km North of Sydney: Muogamarra Nature Reserve (33°33’S 151°11’E) and Ku-ring-gai Chase National Park (33°33’S 151°13’E). They were then housed at Cowan Field Station before being translocated to Sydney Harbour National Park (SHNP) (Figure 2.1). Sites were chosen because of the abundance of bush rats, and comparable climate and habitat to SHNP. Transects were used along each sites fire trail; 200 Elliot traps were set at approximately ten metre intervals along both sides of the trail. They were baited with peanut butter, honey and oats, along with coconut fibre for bedding and a plastic bag for the trap covering. Traps were checked early each morning and trapping occurred until 100 individuals were caught - 60 females and 40 males. Females are dominant and create territories to breed and establish the new population, while the males will usually disperse (Woodside 1983). Translocation may increase the possibility of mortality rate due to predation, difficulty finding food and establishing territory (Gouirand and Matuszewich 2005; Pérez-Tris et al. 2004; Sundell et al. 2004; Teixeira et al. 2007; Yoder et al. 2004). Thus the extra females were required to increase the likelihood of population establishment. The selection criteria for keeping a bush rat for translocation was that the animal had to be an adult (over 90g), in good condition and females were not lactating or obviously pregnant.

Megan Callander – Translocation and Reintroduction of Native Bush Rats

5 KILOMETRES

At Cowan Field Station males and females were separated and housed in large rodent breeder cages (outside 45.7 x 31.8 x 21.2cm; inside 41.9 x 27.9 x 21.0cm; polypropylene base and stainless steel high top). Cages had deep sawdust and shredded paper for bedding and enrichment, and each rat had access to a nesting/shelter area (PVC tubing). Captive animals have reduced stress levels when there is adequate stimulation and refuge areas (Morgan and Tromborg 2007; Teixeira et al. 2007). They were fed a mixture of rat pellets, fruit and nut mix, fresh fruit and mealworms.

Criteria for housing individuals together was based on where they were captured. If the animal met the size, sexual reproduction stage and condition criteria they were placed with another animal trapped closest to them. Individuals that were caught close together (within 200m) were placed in the same breeder cage

Chapter 2: General Methods

(maximum of three females or two males in each cage). For animals that were going to be released together, breeder cages were placed next to each other (one breeder cage with three females next to one breeder cage with two males) (Figure 2.2). If the animals closest to them had enough individuals in the release group already (three females and two males), the individual was either put into the next closest group or released if a suitable group was not available. The distance between individuals that were designated to a group was 20 traps (200m) or closer. In some cases, this was not possible (i.e. no animal that was close by met the criteria), this happened in four cases (in four groups) where an individual was taken from a further distance (270m, 420m, 460m, 480m). To ensure familiarity, bush rats that were captured and housed together were then released into the reintroduction sites together. There were five release points per reintroduction site with three females and two males being released together at each of these release points (25 animals per site – 15 females and 10 males) (Figure 2.3). This was done with the intention of keeping familiar groups close together, reducing stress (Shier 2006; Pinter-Wollman et al. 2009; Dickens et al. 2010; Morgan and Tromborg 2007; Teixeira et al. 2007). Species-specific traits are the key features for reducing stress when holding animals in captivity (Teixeira et al. 2007; Morgan and Tromborg 2007; Dickens et al. 2010). Social housing is critical for some species, with laboratory rodents exhibiting severe stress responses in isolation (Weiss et al. 2004; Genaro et al. 2004; Morgan and Tromborg 2007). Familiarity with conspecifics within release groups, such as family groups or social groups, can decrease stress exposure when in captivity and then when released (Shier 2006; Pinter-Wollman et al. 2009; Dickens et al. 2010; Morgan and Tromborg 2007; Teixeira et al. 2007).

Megan Callander – Translocation and Reintroduction of Native Bush Rats

20m

20m Release Release Point 1 Point 2

Release Point 3

Release Release Point 4 Point 5

Chapter 2: General Methods

The bush rats were held for the shortest time possible, until all animals were captured and all animals could be released at the same time. During this time droppings and food consumption was monitored to ensure the bush rats’ gastrointestinal tract was clean of spores and seeds. Release within a short period of time was critical as this minimises the animals stress response (Batson et al. 2017; Adams et al. 2004; Teixeira et al. 2007).

Prior to release all bush rats were uniquely and permanently marked with passive integrated transponder tags (PIT tags) inserted subcutaneously between the shoulder blades. PIT tags help to distinguish individuals when monitoring their movements and interactions. Blood was taken from the bush rats to compare virus status with translocation survival rates. Due to time and resource restriction only 39 out of the 100 bush rats were tested. The blood was tested by Taronga Zoo for Encephalomyocarditis virus (EMCV). This virus is a member of the genus Cardiovirus of the family Picornaviridae, with a worldwide distribution (Carocci and Bakkali-Kassimi 2012). Rodents are considered to be the natural hosts, in which the virus normally persists without causing disease (Spyrou et al. 2004). However, stress that may result from translocation can reduce immune competence, leaving the animal susceptible to disease which can increase mortality (Millspaugh and Washburn 2004; Teixeira et al. 2007; Dickens et al. 2010).

2.3 REINTRODUCTION SITES Bush rats were released on August 11, 2011 into four sites in SHNP: Athol Hall (AH, Site 1 - 33°50’42’’S : 151°14’46’’E), Middle Head (MH, Site 2 - 33°49’33’’S : 151°15’59’’E), North Head 3 (NH3, Site 3 - 33°48’58’’S : 151°17’37’’E), and North Head 6 (NH6, Site 4 - 33°48’37’’S : 151°17’37’’E) (Figure 2.4). These four reintroduction sites were drawn from the 16 sites established as part of the Sydney Bush Rat Project; the other 12 sites were not used in this study. Prior to release each of the four sites were intensively trapped for ten nights to remove black rats (Rattus rattus). Bush rats that were captured in Ku-ring-gai Chase National Park were then released into Athol Hall (Site 1) and Middle Head (Site 2) and those from Muogamarra Nature Reserve were released in North Head 3 (Site 3) and North Head 6 (Site 4).

Megan Callander – Translocation and Reintroduction of Native Bush Rats

North Head 6 (Site 4)

North Head 3 (Site 3)

Middle Head (Site 2)

Athol Hall (Site 1)

From this point on I will refer to the reintroduction sites as Site 1 (previously Athol Hall - AH), Site 2 (previously Middle Head - MH), Site 3 (previously North Head 3 - NH3) and Site 4 (previously North Head 6 – NH6).

2.4 RELEASE TECHNIQUE The bush rats had a soft-release into the four reintroduction sites at dusk, so they could adjust to their new environment (Figure 2.5). They were kept in their original breeder cages, the lids were removed and the animals were allowed to exit at will (breeder cages were left at the release site with no lids until the following week). Soft release gives an animal a period of acclimatisation and is often preferred in reintroductions as it may offer higher survival rate and behavioural benefits because the animal does not have the immediate task

Chapter 2: General Methods acquiring resources or escaping predation (Davis 1983; Bright and Morris 1994; Parker et al. 2008; Tuberville et al. 2005; Armstrong and Seddon 2008; Letty et al. 2000). Supplementary food (peanut butter and oats, approximately one hand full) was placed in PVC tubes at each release site and was left there until breeder cages were removed (one week). There was no observation of bush rats or black rats consuming the food. Food provisioning increases known resource availability and decreases the stress of unknown or unreliable food sources (Dickens et al. 2010). The bush rats were released in the spatial groups in which they were trapped and housed; there were five release points per site with three females and two males being released together (25 animals per site) (see Figure 2.3).

Figure 2.5. Soft-release at dusk. Bush rats were given a conditioning period to the new environment in their breeder cages, where supplementary food was available for one week.

2.5 TRAPPING AND DATA COLLECTION Trapping sessions were conducted one month after release in September 2011 and every two months thereafter for eight sessions. A ninth trapping session was performed 18 months later in May 2014. Trapping occurred over three consecutive nights at each site for each trap session. Trapping provides a means of monitoring translocation success, establishment, population size and density,

Megan Callander – Translocation and Reintroduction of Native Bush Rats health of the population, breeding and survival rate. It also provides a means of being able to see patterns of population fluctuation and to examine social structure and interactions by using spatial proximity (Richards and Short 2003). An Elliott trap and a wire cage trap was set at each of the 36 trap stations on 1ha grids; each trap approximately 20m apart, with each grid line approximately 20m apart (Figure 2.3). Two traps at 36 trap points in four sites over three nights created 864 potential trap nights per trap session. Elliott traps were primarily for bush rats and cage traps for black rats, although both species were caught in both types of traps. Elliott traps were baited with peanut butter, honey and oats and cage traps were baited with jam sandwiches. Each trap contained coconut fibre for bedding and a plastic bag for the trap covering. Traps were checked early each morning. Captured bush rats were identified, weighed (using a Pesola scale), sexed and had their nasal-occipital head length measured using calipers. The reproductive status and condition of the animal was also noted. Females were regarded as sexually mature and breeding when the vagina was perforate. Immature or non-breeding females were imperforate. Their teat status was also a sign of breeding: 1 indicated non-parous females - teats were small, indistinct and inconspicuous; 2 indicated previously parous females - teats were large and raised with or without fur at the base, but not lactating; and 3 indicated females had young - teats were raised with no fur at the base and producing milk (Aplin et al. 2003). Males were considered to be breeding when their testes had descended into the scrotal sac (Aplin et al. 2003). Rats were allocated to an age-class according to reproductive condition and size: they were considered adult if sexually mature (males had testes descended and females had perforate vagina and teat development) and heavier than 90-100g. Juveniles weighed less than 90g and showed no sexual development (no scrotal development in males and imperforate vagina and inconspicuous teats in females) (Stokes et al. 2009a). Bush rats were considered offspring when captured animals were not one of the 100 from the initial release, this was assumed because of the apparent absence of bush rats in SHNP. Offspring and black rats that were captured were marked with individual ear-clipping patterns using a 2mm biopsy punch and micro-chipped for identification. They were also measured and their traits recorded in the same manner previously mentioned for the bush rats. The piece of tissue from the ear

Chapter 2: General Methods notch was kept in 70% ethanol for further genetic analysis. Features used to identify different species of Rattus are described in Table 2.1.

Table 2.1. Different characteristics of Rattus fuscipes and Rattus rattus used to identify each species while trapping and collecting data in Sydney Harbour National Park reintroduction sites.

CHARACTERISTIC BUSH RAT (Rattus fuscipes) BLACK RAT (Rattus rattus)

Colour Grey-brown to red-brown Black, grey to light brown Size 80-220g 90-300g Tail Tail length = Head/body length Tail length > Head/body length Short and thin Long and thick Features Round ears, concave face, round Large pointed ears, pointed face, body shape slender body shape

Bush Rat (Rattus fuscipes) Black Rat (Rattus rattus)

(University of Sydney 2011)

2.6 SITE DESCRIPTION 2.6.1 Source Sites Ku-ring-gai Chase National Park and Muogamarra Nature Reserve has a temperate coastal climate with a mean maximum temperature of 26°C in summer, 22.1°C in autumn, 16.8°C in winter and 22.5°C in spring. The average annual rainfall in summer was 101.4mm, autumn 104.1mm, winter 87.4mm and in spring 78.6mm (annual rainfall 1090.9mm) (Bureau of Meteorology www.bom.gov.au).

Ku-ring-gai Chase NP and Muogamarra NR are made up of heathland, dry eucalypt forests and grassy woodland. The two bush rat source sites are dry sclerophyll forests (Shrubby subformation) (Keith 2004). Dry sclerophyll forests grow on infertile and often rocky, well drained soils where average annual rainfall exceeds 500mm. The forests support many sclerophyllous (hard-leaved) shrubs including banksias, tea-trees, pea-flowers, wattles (Acacia triptera and A. lineata), heaths

Megan Callander – Translocation and Reintroduction of Native Bush Rats

(Melichrus urceolatus and Brachyloma daphnoides), daisies (Cassinia sp.), and members of the Myrtaceae family (Melaleuca uncinata and Calytrix tetragona). The canopy species are mostly eucalypts, including Narrow-leafed Ironbark (Eucalyptus crebra), Mugga Ironbark (E. sideroxylon) and Tumbledown Red Gum (E. dealbata). White Cypress Pine (Callitris glaucophylla) and Black Cypress Pine (C. endlicheri) also occur in these woodlands (Keith 2004).

2.6.2 Reintroduction Sites Sydney has a temperate climate, with warm summers and mild winters. During the 2011/2012 study period the average temperature of 25°C in summer, 23.1°C in autumn, 18.4°C in winter and 23.3°C in spring. Rainfall is spread throughout the year, with peaks in February, March and June. During 2012 the annual average rainfall in summer was 297.3mm, autumn 377.3mm, winter 310.7mm and in spring 229.3mm (Bureau of Meteorology www.bom.gov.au). Bushfire season runs from October to March. Fire, foxes and habitat disturbance are now highly controlled in these areas.

Sydney Harbour National Parks are pockets of natural bushland with various vegetation types, including coastal heathlands, woodlands, eucalypt forests, open banksia heath and littoral forest (Benson and Howell 1990).

Athol Hall (Site 1) and Middle Head (Site 2) have extensive areas of woodland (Benson 2011). Site 1 includes coastal sandstone gully forest with smooth-barked apple (Angophora costata), grey gum (Eucalyptus punctate) and forest red gum (E. tereticornis), and contains a variety of understorey ferns and shrub species including acacias and coastal banksia (Banksia integrifolia) (NPWS 2012). Site 2 includes coastal sandstone ridge-top woodland with Angophora costata and bangalay (E. botryoides). There is also closed coastal scrub dominated by B. integrifolia and scrub she-oak (Allocasuarina distyla) (NPWS 2012). There are 72 recorded fauna species in these headlands including four frog species, 12 reptile species, 45 bird species (six are introduced species), and 11 mammal species. The mammal species include the brush-tailed and ring-tailed possum, native water rats, grey-headed flying-foxes and two species of microbats. The five introduced mammal species are the introduced black rat, house mouse, fox, rabbit and cat (NPWS 2012).

Chapter 2: General Methods

North Head (Site 3 and 4) is mainly coastal sclerophyll heath and scrub on shallow, sandy soils and eucalypt woodland (Benson 2011). Site 3 is the Eastern Suburbs Banksia Scrub, structurally similar to the coastal heath but on lower nutrient sand (Benson 2011; Benson and Howell 1990). Common species include Banksia ericifolia, B. serrata, Eriostemon australasius, Leptospermum laevigatum, Monotoca elliptica, Pteridium esculentum, Ricinicarpos pinifolius and Xanthorrhoea resinifera (NPWS 2012). Site 4 is coastal sandstone gully forest with smooth-barked apple (Angophora costata), grey gum (E. punctate) and forest red gum (E. tereticornis) (NPWS 2012). A total of 146 fauna species have been recorded within the North Head area including 106 bird species (seven of which are introduced species), 20 mammals (nine of which are introduced species), 14 reptiles and six amphibians. However, some of these species such as the brown antechinus (Antechinus stuartii) and the native bush rat (Rattus fuscipes) no longer occur (NPWS 2012).

2.7 HABITAT CHARACTERISTICS Habitat structure is a predictor of rodent trap captures (Monamy and Fox 1999; Maitz and Dickman 2001). To assess site differences in habitat structure, ten structural characteristics of the vegetation were measured within a one metre radius of each trap station (Romero 2012; Cox et al. 2000; Amarasekare 1994). Measurements were taken from the bush rat source sites (Muogamarra Nature Reserve and Ku-ring-gai Chase National Park) and the reintroduction sites (Sydney Harbour National Park). The characteristics can be seen in Table 2.2. To analyse the data, each habitat characteristic was divided into categories. The recorded data was assigned a score using a modified six-point Braun-Blanquet scale (Poore 1955) and categories used in Cox et al. (2000) (Table 2.3).

The Quadrant Cover Method (QCM) was also implemented, which provides a rapid, objective assessment of the degree of concealment that microhabitats provide from visual predators (Glen et al. 2010; Romero 2012). The one metre radius around each trap station was divided into four quadrants. Each quadrant was then assessed to determine whether features within the quadrant would obscure the view of potential predators (Glen et al. 2010, Table 2.2).

Megan Callander – Translocation and Reintroduction of Native Bush Rats

CHARACTERISTIC DESCRIPTION Leaf litter cover Percentage of ground area covered by leaf litter estimated using a 1m quadrat within the trap radius.

Leaf litter depth Measured in cm at 5 points within the trap radius and averaged.

Bare ground cover Percentage of ground area with bare ground estimated using a 1m quadrat within the trap radius.

Plant ground cover Percentage of foliage cover < 2m in height within the trap radius.

Understory cover Percentage of foliage cover between a height of 2m and 4m. Density was scored using a 50cm cover board (divided into 25 squares). Percentage was calculated from the number of squares on the board not visible when viewed from 1m. Four estimates were averaged.

Number of logs All logs ≥ 10cm in diameter lying on or parallel to the ground were counted.

Number of vertical stems All stems standing and less ≤ 10cm in diameter were counted

Canopy height Approximate height of the tallest tree.

Soil moisture Moisture was measured at an approximated depth of 1cm at 5 points within the trap radius and averaged. Measurements were estimated on a sliding scale where 1 is dry and 5 is wet.

Quadrant Cover Method Measured using 4 quadrants scored for whether an animal at (QCM) the central point would have been clearly visible (0%), partially obscured (10%), or fully obscured (20%) by objects within the 1m radius. Another score is assigned to the visibility from above. Scores are summed.

Chapter 2: General Methods

Table 2.3. Categories used to classify characteristics of vegetation structure measured around each trap station in a 1m radius.

CHARACTERISTIC CATEGORY CATEGORY DESCRIPTION Leaf litter cover, bare ground cover, plant 0 Zero cover ground cover, understory cover (%) 1 1-5 2 6-25 3 26-50 4 51-75 5 76-100

Leaf litter depth (cm) 0 Leaf litter absent 1 0.01–1.0 2 > 1.0

Number of logs (≥10cm) 0 Logs absent 1 1–2 2 3–4 3 > 4

Number of vertical stems (≤10cm) 0 Vertical stems absent 1 1–10 2 11–20 3 > 20

Canopy height (m) 0 Canopy absent 1 2.01–7 2 7.01–12 3 > 12

Muogamarra NR and Ku-ring-gai Chase NP both had moderate disturbance with a fire trail running through the sites (traps were placed along these trails). Sydney Harbour NP sites had moderate disturbance, where there was no clearing, but surrounding the sites were roads or paths. Site 1 and Site 2 had further disturbance with a walking path going directly through each site.

CHAPTER 3: Selective Traits Influencing Bush Rat Survival

Megan Callander – Translocation and Reintroduction of Native Bush Rats

3.1 INTRODUCTION Translocation is the intentional, human-facilitated movement of wildlife from one location to another (IUCN 1998). There have been over 200 mammal translocations and/or reintroductions within Australia for conservation purposes (Short 2009; Morris et al. 2015; Martin and McDonald-Madden 2011). Unfortunately, translocations often fail, Australia having one of the highest rates of translocation failure (Griffith et al. 1989; Short et al. 1992; Fischer and Lindenmayer 2000; Martin and McDonald-Madden 2011; Short 2009). Survival of animals directly after their release (establishment phase) is usually the most crucial period (Armstrong and Seddon 2008; Dickens et al. 2010). For translocation to have a higher success rate, the animal’s behaviour, traits and preferred habitat need to be understood (Griffith et al. 1989; Wolf et al. 1996; Sheller et al. 2006; Tuberville et al. 2005; Bakker 2006; Tarszisz et al. 2014). Understanding and comparing the animal’s behaviour and traits in the wild will assist in determining whether a population has become established and viable when translocated (Miller et al. 1999). The traits include: sex ratio, fecundity, body mass, condition and disease status (Carter et al. 2017; Miller et al. 1999).

Animals should be released in sex ratios and classes similar to what is exhibited in wild populations. This is because varying age-sex classes have different reproductive value and the density of the population ensures reproductive encounters (Sarrazin and Legendre 2000; Bosé et al. 2007). This often involves releasing more adult females (Short et al. 1992; Miller et al. 1999; Lewis 2012). Differences between male and female behaviour may also influence release considerations, for example dispersal (Miller et al. 1999). Bush rat (Rattus fuscipes) females are dominant and establish territories to breed and create the new population, while the males will usually disperse (Woodside 1983). Disease status and physical condition should be assessed before translocation to assist in reducing effects of stress and maximising the health of the animal (Miller et al. 1999; IUCN 2013; Carter et al. 2017). Stress that may result from translocation can reduce immune competence, leaving the animal susceptible to disease which can increase mortality (Millspaugh and Washburn 2004; Teixeira et al. 2007; Dickens et al. 2010). Physical condition and weight can indicate energy reserves and the

Chapter 3: Selective Traits Influencing Bush Rat Survival

ability to reproduce, which is then linked to survival and population establishment after translocation (Pinter-Wollman et al. 2009; Molony et al. 2006; McMahon et al. 2000; Hill et al. 2003; Smith and Moore 2005).

The amount and type of habitat in which animals are released is a critical factor for translocation success (Griffith et al. 1989; Wolf et al. 1996; Sheller et al. 2006; Tuberville et al. 2005). Determining the original cause of decline for the species is also an important factor (Miller et al. 1999; Bennett et al. 2012; Griffith et al. 1989). The quality of the habitat, food availability and competition with resident species can all induce stress for the released animal (Shier and Owings 2006; Bennett et al. 2012; Linklater and Swaisgood 2008). If adequate habitat is not available, competitors/predators are abundant or the cause of the species demise has not been removed, translocation will not be an effective solution (Short et al. 1992; Miller et al. 1999; Bennett et al. 2012; Griffith et al. 1989).

3.1.1 Aims To assess the importance of species-specific traits this chapter will look at bush rats that were translocated into Sydney Harbour National Park as part of the Sydney Bush Rat Project. The aim of this chapter is to:

1. Determine whether the bush rat translocation into SHNP has been successful. Success is dependent upon whether the bush rats established and persisted in the release sites. 2. Determine factors that influenced survival rates and population persistence.

In view of this, the hypotheses would be:

1. If sex is related to persistence on a release site, then female bush rats are more likely to persist than males.

2. If weight and body condition is related to age, health and breeding status, then heavier bush rats with a BCI (Body Condition Index) of greater than one (good condition) will breed and create a sustainable population.

3. If disease status increases stress on a bush rats’ health, then bush rats that do not have Encephalomyocarditis virus (EMCV) are more likely to survive.

Megan Callander – Translocation and Reintroduction of Native Bush Rats

4. Increased habitat complexity and shelter will result in a more successful population of bush rats.

To achieve this bush rats were released into Sydney Harbour National Park reintroduction sites and changes of demography were monitored. Sex, body condition, weight and virus status were assessed in relation to survival rates, breeding success and habitat.

3.2 METHODS 3.2.1 Study Species Bush rats (Rattus fuscipes) are widely distributed on the east coast of Australia (Watts and Aslin 1981; Peakall and Lindenmayer 2006). They favour areas with complex structure and high litter cover (Bennett 1993; Holland and Bennett 2007, 2011). The bush rat is terrestrial, nocturnal and nests in burrows during the day (Watts and Aslin 1981; Peakall and Lindenmayer 2006; Wood 1971). They are omnivorous and weigh approximately 80-200g, the males generally the heavier of the sexes (Wood 1971; Holland and Bennett 2010).

Bush rats can have more than one litter per year if conditions are favourable, and produce an average of four young per litter (Heinsohn and Heinsohn 1999; Lindenmayer et al. 2005). They breed from November to January and populations can exceed ten animals per hectare (Kraaijeveld-Smit et al. 2007). Populations increase in summer due to juvenile recruitment and decrease over winter, when juveniles mature into sub-adults, and the number of adults decline. In spring, sub- adults reach maturity and come into breeding condition (Lindenmayer et al. 2005; Peakall et al. 2003).

3.2.2 Translocation and Monitoring 100 bush rats were released on August 11, 2011 into four sites in Sydney Harbour National Parks (SHNP) (see Figure 2.4). Trapping sessions were conducted one month after release in September 2011 and every two months thereafter for eight sessions (October 2012). A ninth trapping session was performed 18 months later in May 2014. Trapping occurred over three consecutive nights at each site. An Elliott trap and a wire cage trap was set at each of the 36 trap stations on 1ha grids (a potential 864 trap nights per session). Each trap was set approximately 20m

Chapter 3: Selective Traits Influencing Bush Rat Survival

apart, with each grid line approximately 20m apart (see Figure 2.3). Traps were checked early each morning. Captured bush rats were identified, weighed, sexed and had their nasal-occipital head length measured using calipers, the reproductive status and condition of the animal was also noted. Rats were allocated to an age-class according to reproductive condition and size (see Chapter 2 for more detail in sampling regimes and study design).

3.2.3 Habitat Characteristics To assess site differences in habitat structure, ten structural characteristics of the vegetation were measured within a one metre radius of each trap station (Romero 2012; Cox et al. 2000; Amarasekare 1994). The characteristics can be seen in Table 2.2. To analyse the data, each habitat characteristic was divided into categories. The recorded data was assigned a score using a modified six-point Braun- Blanquet scale (Poore 1955) and categories used in Cox et al. 2000 (Table 2.3). The Quadrant Cover Method (QCM) was also implemented, which provides a rapid, objective assessment of the degree of concealment that microhabitats provide from visual predators (Glen et al. 2010; Romero 2012). To do this, the one metre radius around each trap station was divided into four quadrants. Each quadrant was then assessed to determine whether features within the quadrant would obscure the view of potential predators (Glen et al. 2010). The four reintroduction sites had moderate disturbance, where there was no clearing, but surrounding the sites were roads or paths. Site 1 and Site 2 had further disturbance with a walking track going directly through each site.

Habitat structure and characteristics were averaged for each site using the 36 trapping stations. Any significant difference between habitat characteristics, source sites (Muogamarra Nature Reserve and Ku-ring-gai Chase National Park) and reintroduction sites (Sydney Harbour National Park) was determined with two-factor Analysis of Variance (ANOVAs). Relationships between survival and habitat was examined by multiple regression.

3.2.4 Statistical Analysis Survival rates using population parameters for bush rats were estimated using Cormack-Jolly-Seber (CJS) modelling of live capture histories using the program

Megan Callander – Translocation and Reintroduction of Native Bush Rats

MARK (White and Burnham 1999). MARK helps determine population and survival estimates, and identify factors influencing survival rates (Armstrong and Ewen 2000; Lettink and Armstrong 2003; Pryde 2003; Easton 2014). MARK finds the most parsimonious model, i.e. a model that includes factors useful for explaining the data but excludes irrelevant factors (Burnham and Anderson 2002; Lettink and Armstrong 2003). It considers data from animals marked and released back into the population and then recaptured. The basic CJS model has four main assumptions:

1. Every animal in the population has the same probability of recapture. 2. Every animal in the population has the same probability of survival. 3. Marks are not lost or overlooked. 4. All samples are instantaneous and each release is made immediately after the sample (Pryde 2003; Lettink and Armstrong 2003; Cooch and White 2015).

The likelihood that the first two assumptions were met was improved by dividing the population into groups, e.g. males vs. females or sites, meaning every animal in that group has the same probability of survival and recapture. The third and fourth assumptions were met as bush rats were micro-chipped which remain in the bush rats for life and the capture sessions were immediate with no rats held over time.

A global (saturated) model was specified and run. The global model was fully interactive (*) in which survival (phi or φ) and recapture (p) changes with group (g) and time (t): φ(g*t) p(g*t). Attribute groups in these models were sex (male vs. female) and site (Site 1, Site 2, Site 3 and Site 4). Phi (φ) is the probability of surviving an interval between recapture occasions (White and Burnham 1999; Hoyle et al. 2001; Pryde et al. 2005; Cooch and White 2015). However, it is not a true indication of survival as emigration cannot be differentiated from mortality (Cooch and White 2015). P is the probability that a marked animal is recaptured if it survives to a particular interval (Cooch and White 2015).

The sin link function was used to fix parameters. The variance-covariance was estimated using 2nd Part, this calculated the standard errors of the estimates.

Chapter 3: Selective Traits Influencing Bush Rat Survival

Goodness-of-Fit (GOF) testing was done to assess whether the global model was a reasonable fit to the data. A poor fit would be if the data violated the assumptions of open population mark-recapture (Lettink and Armstrong 2003). Contingency tables (휒2) from the program RELEASE were used to determine GOF and to see whether parts of the dataset were over-dispersed. Test 1 assesses the overall difference between groups and indicates whether or not to pool the data (Pryde 2003). Test 2 assesses recapture rates and tests whether the data violates the assumptions of equal recapture rate (Pryde 2003). Test 3 assesses the survival results and tests if the data violates the assumption of equal survival rates (Pryde 2003). If each test shows no significant difference (p > 0.05) then the data fits the model (Pryde 2003).

Bootstrap GOF simulations were then used to compare the observed data with predicted data (if the data conforms to the model) and test for dispersal or variability of the data (Pryde 2003). 1000 simulations were run for greater accuracy. To adjust data for over dispersion, c-hat (variance inflation factor) was calculated by dividing the global model deviance by the mean deviance of the bootstrap simulations. Adjusted models have larger than 95% confidence intervals and values are converted to Quasi-AIC (QAIC) to accommodate for extra variance (Pryde 2003; Cooch and White 2015; Easton 2014). From the adjusted global model other models were constructed to account for variation in groups and time for both survival and recapture (Lettink and Armstrong 2003). Akaike’s Information Criterion (AIC) is calculated from the model’s deviance and the number of parameters in the model (Akaike 1974; Lettink and Armstrong 2003). The most parsimonious model was selected based on AIC. The Delta AICc (ΔAICc) is used to rank models (Pryde 2003). If the difference between the model with the lowest AICc and the current model is less than two, then both models are acceptable. If the difference is greater than two but less than seven, there is some support for both models. If the difference is greater than seven, models are different and there is no support (Cooch and White 2015). To account for more than two parsimonious models (models displaying similar weighting), model averaging was performed. The weighted average includes an estimate and a standard error (Pryde 2003; Lettink and Armstrong 2003).

Megan Callander – Translocation and Reintroduction of Native Bush Rats

3.2.4.1 Body Condition Body Condition Index (BCI) was calculated using Microsoft Excel following the method outlined in Krebs and Singleton (1993) by:

1. Estimating the regression between head length and body mass for all of the bush rats released. 2. Using this to predict body mass from observed head length. 3. Estimating condition from the ratio of observed mass to predicted mass (Krebs and Singleton 1993; Richards and Short 2003).

This created a ratio in which an individual in average condition had a ratio of one, an animal in poor condition had a ratio of less than one (< 1), and an animal in good condition had a ratio of greater than one (> 1) (Krebs and Singleton 1993). Measurements for BCI were taken just before the initial release into SHNP, it was only done once due to the potential of inaccurate measurements of head length in the field. Microsoft Excel was used to perform one-factor ANOVAs for comparison of body condition and survival.

3.2.4.2 Virus Status Blood was taken from 39 of the 100 bush rats released and tested for Encephalomyocarditis virus (EMCV). Tests were conducted by Taronga Zoo and Kaplan-Meier survival analysis was used to compare survival rates of rats with the virus to those without.

3.3 RESULTS 3.3.1 Survival of Bush Rats over Time Of the 100 bush rats released into SHNP, 69 were recaptured at least once. Site 4 had the highest recapture rate of 80%, followed by Site 3 with 76%, Site 1 with 64% and Site 2 with 56% (Figure 3.1). Juvenile recruitment occurred at all sites with Site 4 having the highest number with 35 juvenile individuals, followed by Site 1 with 16, Site 3 with 14 and Site 2 with 10 (Figure 3.1).

Chapter 3: Selective Traits Influencing Bush Rat Survival

40 Original 35 Offspring 30 25 20 15 10 5

Number ofIndividuals Captured 0 Site 1 Site 2 Site 3 Site 4 Site

All populations declined over the trapping period (Figure 3.2). Bush rats were first released in August 2011 (before breeding season). Juvenile recruitment increased in summer (December and February) and populations decreased over autumn and winter (April, June and August 2012), when juveniles are maturing into sub- adults, and adults begin to reach the end of their life cycle. During the first sessions (September and October), 31 bush rats were captured in Site 1, 28 in Site 4, 27 in Site 3 and 16 in Site 2 (Figure 3.2). During October 2011 Site 1 and Site 4 began juvenile recruitment, with the first of the offspring being captured. After one year, in October 2012, only new bush rats (offspring) were captured (Figure 3.2).

Megan Callander – Translocation and Reintroduction of Native Bush Rats

15 SITE 1 12 Original Offspring 9

NumberofIndividuals 0 Session 1 Session 2 Session 3 Session 4 Session 5 Session 6 Session 7 Session 8 No Session 9 September October December February April June August October Trapping May 2011 2012 2013 2014 15 SITE 2 12 Original Offspring 9

15 SITE 4 12 Original 9 Offspring

Trap Session and Period (Month and Year)

Chapter 3: Selective Traits Influencing Bush Rat Survival

Site 2 had the most bush rats that were not recaptured again once released (Figure 3.3). Site 3 had the highest number of possible dispersers (13 bush rats caught only once) (Figure 3.3). Site 4 had the greatest number of animals that remained on site (13 residents), as indicated by the number of rats caught over multiple sessions, followed by Site 1 (12 residents, Figure 3.4).

14 14 12 Site 1 12 Site 2 10 10 8 8 6 6 4 4

2 2

NumberofIndividuals NumberofIndividuals 0 0 0 1 2 3 4 5 0 1 2 3 4 5 Number of Times Recaptured Number of Times Recaptured 14 14 12 Site 3 12 Site 4 10 10 8 8 6 6 4 4

2 2

NumberofIndividuals NumberofIndividuals 0 0 0 1 2 3 4 5 0 1 2 3 4 5 Number of Times Recaptured Number of Times Recaptured

Megan Callander – Translocation and Reintroduction of Native Bush Rats

20 Site 1 Site 2 Site 3 Site 4 15

5 NumberofIndividuals 0 0-1 >1 Number of Times Recaptured Figure 3.4. Number of adult bush rats (original 100 released) not recaptured or recaptured only once (0-1 = dispersers), and bush rats recaptured more than once (>1 = residents) over eight sessions of trapping (September 2011 to October 2012) in the four reintroduction sites (n = 864 per session).

3.3.2 Influence of Site on Adult Bush Rat Survival and Recapture After model averaging, the estimated survival probabilities for bush rats over the four sites varied by time only – most parsimonious model = φ(t)p(g) – from 0.58 (95% CI: 0.33-0.79) to 0.85 (95% CI: 0.54-0.97) (see Appendix Model Set 1 for all model selection results). The lowest survival rate in the interval going towards winter (session five to six – April to June) and the highest probability of survival was during the interval going towards spring (session six to seven – June to August) (Figure 3.5A).

Estimated recapture probabilities varied by group only and ranged from Site 2 at 0.57 (95% CI: 0.27-0.82), Site 3 at 0.75 (95% CI: 0.58-0.86), Site 4 at 0.80 (95% CI: 0.66-0.89), Site 1 at 0.86 (95% CI: 0.64-0.95). Indicating there was a higher probability of recapturing the same rat at Site 1 and a lower probability of recapturing bush rats at Site 2 (Figure 3.5B).

Chapter 3: Selective Traits Influencing Bush Rat Survival

A B 1.2 1 1 0.8 0.8 0.6 0.6 0.4 0.4

0.2 0.2 Probability Probability ofSurvival

0 Probability Recaptureod 0 1-2 2-3 3-4 4-5 5-6 6-7 Site 1 Site 2 Site 3 Site 4 Interval Between Trap Sessions Site

Figure 3.5. (A) Model averaged estimates of survival probability for bush rats over time (from September 2011, eight* trapping sessions over one year) and (B) estimates of recapture probability for bush rats over the four different sites (±SE). *Trapping sessions do not include session 7-8 because the parameter cannot be individually identified as there are no more occasions for comparison.

3.3.3 Influence of Sex on Bush Rat Survival and Recapture Fifteen females and 10 males were released on each site. Of the original 15 females 67% were captured at least once after release in Site 4 and Site 3, 60% in Site 1 and 53% in Site 2. Of the original 10 males 100% were recaptured in Site 4, 90% in Site 3, 70% in Site 1 and 60% in Site 2. Site 4 retained the most females (Figure 3.6) and produced the highest number of offspring, 29% of which were female (Figure 3.7). The site that retained the smallest amount of bush rats was Site 3, this site had a good starting population of 15 but offspring only consisted of males (Figure 3.7). Site 3 and Site 1 female population reduced to zero by session 7 (August 2012 – just before breeding season) (Figure 3.6). Bradley’s Head (BH) and North Head 5 (NH5) were control trapping grids within the 16 sites that were part of the Bush Rat Project. Site 1 was the only reintroduction site in the vicinity of BH (500m between sites), with bush connecting the two sites. Therefore it may be assumed that bush rats from Site 1 had dispersed and established in BH, accounting for the offspring found at this site (Figure 3.7). One offspring was captured in NH5 with parents originating in Site 3 (500m from NH5) (see Chapter 5).

Megan Callander – Translocation and Reintroduction of Native Bush Rats

10 SITE 1 8 Male 6 Female

0 NumberofIndividuals Session 1 Session 2 Session 3 Session 4 Session 5 Session 6 Session 7 Session 8 No Session 9 September October December February April June August October Trapping May 2011 2012 2013 2014

8 SITE 2 Male 6 Female

10 8 SITE 3 Male 6 Female 4 2 0 NumberofIndividuals Session 1 Session 2 Session 3 Session 4 Session 5 Session 6 Session 7 Session 8 No Session 9 September October December February April June August October Trapping May 2011 2012 2013 2014

10 8 SITE 4 Male 6 Female 4 2 0

NumberofIndividuals Session 1 Session 2 Session 3 Session 4 Session 5 Session 6 Session 7 Session 8 No Session 9 September October December February April June August October Trapping May 2011 2012 2013 2014 Trap Session and Period (Month and Year)

Chapter 3: Selective Traits Influencing Bush Rat Survival

40 Male 35 Female 30 Unknown 25 20 15 10

NumberofIndividuals 5 0 Site 1 BH Site 2 Site 3 Site 4 Site Figure 3.7. Number of male (dark grey), female (light grey) and unknown sex (stripes) offspring captured over the entire trapping period in the four reintroduction sites (9 sessions, September 2011 to May 2014) and a control site Bradley’s Head (BH – site 500m from Site 1).

After model averaging, the estimated survival probabilities for male and female bush rats varied only slightly, but survival did vary over time – most parsimonious model = φ(t)p(.) – from 0.64 (95% CI: 0.33-0.86) to 0.83 (95% CI: 0.54-0.95) (see Appendix Model Set 2 for all model selection results). The lowest survival rate in the interval going towards winter (session five to six – April to June) and the highest probability of survival was during the interval going towards spring (session six to seven – June to August) (Figure 3.8A).

Estimated recapture probabilities did not vary significantly, so did not depend on sex or the season and ranged from female 0.76 (95% CI: 0.63-0.85) to male 0.78 (95% CI: 0.66-0.87) (Figure 3.8B).

Megan Callander – Translocation and Reintroduction of Native Bush Rats

A 1 B 0.85

0.8 0.8

0.6 0.75

0.4 0.7

0.2 0.65

Male Probability Probability ofSurvival

Female Probability ofRecapture 0 0.6 1-2 2-3 3-4 4-5 5-6 6-7 Male Female Interval Between Trap Sessions Sex

Figure 3.8. (A) Model averaged estimates of survival probability for male and female bush rats over time (from September 2011, eight* trapping sessions over one year) and (B) estimates of recapture probability for male and female bush rats (±SE). *Trapping sessions do not include session 7-8 because the parameter cannot be individually identified as there are no more occasions for comparison.

3.3.4 Influence of Sex on Bush Rat Offspring Survival and Recapture After model averaging, the estimated survival probabilities for male and female bush rat offspring varied only slightly, but survival did vary over time – most parsimonious model = φ(t)p(g) – from 0.67 (95% CI: 0.51-0.80) to 0.83 (95% CI: 0.67-0.92) (see Appendix Model Set 3 for all model selection results). The lowest survival rate in the interval going towards winter (session five to six – April to June) and the highest probability of survival was during the interval going towards spring (session six to seven – June to August) (Figure 3.9A).

Estimated recapture probabilities varied by sex and ranged from female 0.74 (95% CI: 0.56-0.86) to male 0.83 (95% CI: 0.65-0.92). Although not significantly different, male juvenile bush rats were more likely to be recaptured than females (Figure 3.9B).

Chapter 3: Selective Traits Influencing Bush Rat Survival

B A 1 1

0.9 0.9

0.8 0.8

0.7 0.7

0.6 0.6

0.5 Male Probability Probability ofSurvival 0.5 Male Female Probability ofRecapture Female 0.4 0.4 2-3 3-4 4-5 5-6 6-7 3 4 5 6 7 Capture Session Interval Between Capture Sessions

3.3.5 Influence of Weight and Body Condition There was no significant difference between release weight averages across sites for bush rat females (F3,59 = 0.88, p = 0.46) or males (F3,39 = 2.11, p = 0.12) (Figure 3.10). Between sites, Site 3 males had significantly higher weights than Site 4 males (F1,19 = 10.45, p = 0.005) (Figure 3.10).

140 Site 1 Site 2 120 Site 3 100 Site 4 80

20 Average Average Initial Weight (g) 0 Females Males Sex Figure 3.10. Average initial weight (g) of 60 female and 40 male bush rats released into the four reintroduction sites in August 2011 (±SE).

During the first trap session, one month after release, average weight per site increased for all bush rats, and increased again after the second and fourth month,

Megan Callander – Translocation and Reintroduction of Native Bush Rats where weight reached its peak (Figure 3.11). The second and fourth month were in spring (October) and early summer (December) where breeding and juvenile recruitment would be at its peak. Weight decreased again after six and eight months (February - late summer and April - mid-autumn) (Figure 3.11).

160 Site 1 140 Site 2 120 Site 3 100 Site 4 80 60 40 Average Average Weight (g) 20 0 Release 1 2 4 6 8 12 Weight Months After Release

Three of the four sites had a higher number of bush rats that were released with a good body condition (BCI > 1) compared to poor body condition (BCI < 1) (Site 1 mean = 1.04, F1,17 = 14.13, p = 0.002, Site 2 mean = 1.02, F1,20 = 14.20, p = 0.001, and Site 3 mean = 1.04, F1,19 = 21.26, p < 0.001) (Figure 3.12). Site 4 had the most animals with low body condition (BCI < 1) (mean = 0.93, F1,23 = 59.03, p < 0.0001) (Figure 3.12).

Chapter 3: Selective Traits Influencing Bush Rat Survival

18 BCI > 1 16 BCI < 1 14 12 10 8 6 4 NumberofIndividuals 2 0 Site 1 Site 2 Site 3 Site 4 Site Figure 3.12. Difference in Body Condition Index (BCI) of bush rats upon release into the four reintroduction sites. Dark grey indicates a BCI of greater than 1 (good body condition) and light grey indicates a BCI of less than 1 (poor body condition). Demonstrating the difference in BCI within and between the four reintroduction sites.

Females were in similar condition upon release for each site (Site 1 mean = 0.95,

Site 2 mean = 0.99, Site 3 mean = 1.01, Site 4 mean = 0.92, F3,45 = 19.4, p = 0.14). Males were also in similar body condition upon release except for Site 4 which had a significantly lower BCI compared to the other sites (Site 1 mean = 1.15, Site 2 mean = 1.05, Site 3 mean = 1.08, Site 4 mean = 0.94, F3,36 = 6.50, p = 0.001). Indicating the majority of males at Site 1, Site 2 and Site 3 were in good breeding condition.

Two of the sites with the least number of bush rats surviving (Site 1 and Site 3) have no male bush rats with a BCI of < 1, Site 2 had a significantly higher number of males with a healthy BCI compared to those with a poor BCI (F1,9 = 7.38, p =

0.03) (Figure 3.13). This was the same pattern for females at Site 1 (F1,9 = 38.95, p

= 0.0002) and Site 2 (F1,10 = 10.97, p = 0.009). Site 4 showed the opposite pattern, with a significantly higher number of females that had poor BCI (F1,13 = 34.37, p < 0.0001) (Figure 3.14).

Megan Callander – Translocation and Reintroduction of Native Bush Rats

10 9 BCI > 1 8 BCI < 1 7 6 5 4 3 2 1

NumberofMale Individuals 0 Site 1 Site 2 Site 3 Site 4 Site

12 BCI > 1 10 BCI < 1

0 NumberFemale ofIndividuals Site 1 Site 2 Site 3 Site 4 Site

3.3.6 Influence of Virus Status Virus status did not affect the survival of the bush rats. Of the 100 animals released, 39 were tested for EMCV (Encephalomyocarditis virus) and of these 38% had the virus. Although survival probability was slightly increased for animals without the virus, the result was not significantly different from the rats that had the virus, Log rank 휒2 = 1.71, p = 0.19 (Figure 3.15).

Chapter 3: Selective Traits Influencing Bush Rat Survival

1.2 No Virus 1 Virus 0.8

0.6

0.4

0.2 Survival Survival Probability

0 0 1 2 3 4 Time - Months after Release

Figure 3.15. Survival curve comparing the probability of bush rats surviving after release for six months with Encephalomyocarditis virus (light grey) and without the virus (dark grey).

3.3.7 Habitat Characteristics There was no significant difference in habitat characteristics between the two bush rat source sites Muogamarra Nature Reserve and Ku-ring-gai Chase National

Park (F1,17 = 0.006, p = 0.94). There was no significant difference in habitat characteristics between the four reintroduction sites in Sydney Harbour National

Parks (F2,16 = 1.22, p = 0.32) or between the two source sites compared to the four reintroduction sites (F4,32 = 0.81, p = 0.53) (see Appendix Table A3.7 for habitat measurements for source and reintroduction sites).

There were positive relationships between the number of bush rats on each site compared to percentage of quadrant cover (R2 = 0.80), average canopy height (R2 = 0.74), average soil moisture (R2 = 0.69), average leaf litter depth (R2 = 0.89) and average ground plant cover (R2 = 0.62) (Figure 3.16). There was a negative relationship between the number of bush rats captured on each site compared to percentage of bare ground coverage (R2 = 0.75) (Figure 3.16F). As habitat characteristics increase (indicating complexity) so do the number of bush rats. As bare ground increased (indicating no complexity) the number of bush rats decreased.

Megan Callander – Translocation and Reintroduction of Native Bush Rats

A 18 B 18 16 16 14 14 12 12 10 10 8 8 6 6 4 4 2 2

R² = 0.80 R² = 0.74 Number of Bush Site Bush of Per Rats Number Number of Bush Site Bush of Per Rats Number 0 0 40 50 60 70 0.0 1.0 2.0 3.0 Quadrant Cover Average Canopy Height

C 18 D 18 16 16 14 14 12 12 10 10 8 8 6 6 4 4 2 2

R² = 0.69 R² = 0.89 Number of Bush Site Bush of Per Rats Number Number of Bush Site Bush of Per Rats Number 0 0 0 2 4 6 0.0 1.0 2.0 3.0 4.0 Average Soil Moisture Average Leaf Litter Depth

E 18 F 18 16 16 14 14 12 12 10 10 8 8 6 6 4 4 2 2

R² = 0.62 R² = 0.75 Number of Bush Site Bush of Per Rats Number 0 Site Bush of Per Rats Number 0 2.5 2.7 2.9 3.1 3.3 0.4 0.6 0.8 1.0 1.2 1.4 Average Plant Ground Cover Average Bare Ground Cover

Chapter 3: Selective Traits Influencing Bush Rat Survival

Site 4 had the highest percentage of cover (using the Quadrant Cover Method, QCM) and also had the highest number of bush rat captures (Figure 3.17). The difference was significantly higher compared to all other sites (Site 1, t = 2.03, p = 0.01; Site 2, t = 2.03, p = 0.005; Site 3, t = 2.03, p = 0.003; Figure 3.17). There was, however, no significant difference between the Site 1, 2 and 3 (F2,105 = 0.63, p = 0.63).

80 70 60 50 40 30 20 10

Percentage ofQuadrant Cover 0 Site 1 Site 2 Site 3 Site 4 Reintroduction Sites

3.4 DISCUSSION The successful translocation of bush rats into Sydney Harbour National Park (SHNP) was dependent upon both the survival of individuals and their fidelity to the release sites. In the initial stages of the study (within the first year), populations of bush rats had established and juvenile recruitment had occurred on all sites. Over the entire study period, bush rats persisted in three of the four sites. However, the remaining numbers were low, thus maintaining a self- sustaining population would be difficult (Griffith et al. 1989; Dickens et al. 2010; Letty et al. 2000; Parker et al. 2012; Tarszisz et al. 2014). All sites produced offspring that were present at the sites for at least 14 months. The final trap session, in autumn 2014, represented the third or fourth generation after release, which should be sufficient for long term monitoring as it is temporally independent. The numbers were low (nine animals caught overall), but the trapping occurred in autumn when population density would be at its lowest

Megan Callander – Translocation and Reintroduction of Native Bush Rats

(Lindenmayer et al. 2005; Peakall et al. 2003). A further trap session the following spring may have confirmed whether the bush rats had developed a viable population. Most of the animals were caught in the traps on the edge of the trapping grid, which may indicate dispersal from the original release point and establishment off the trapping grid. In other words, after juveniles matured they could have dispersed off the grid. Further trapping outside of grid boundaries would help in confirming potential dispersal.

For a site to be successful small amounts of females need to establish a breeding territory and recruit juvenile females to keep the population sustainable (Stokes et al. 2009b). Results indicated that sex influenced site success. Sites that retained and recruited more females persisted for longer. This is supported by other studies demonstrating the importance of females establishing and maintaining populations in native rodent communities (Redfield et al. 1977; Danielson and Gaines 1987; Stokes et al. 2009b). The site that retained the smallest number of bush rats was Site 3, this site had a good starting population but offspring only consisted of males. Site 3 and Site 2 female population reduced to zero by the spring of 2012. There were no females to continue the population and establishment of breeding territories did not occur. Further, the remaining males would eventually disperse off the grid in search of mates and territory. Juvenile males in Site 2 continued to occupy the trapping grid, indicating they had dispersed from other areas, or females had moved off site. Site 4 was considered the most successful site, retaining the most females and producing the highest number of offspring, 29% of which were female. Females on all sites seemed to be in breeding condition throughout the year. Of the females caught after release 92% were in reproductive condition with perforate vaginas and teat status were classified as either 2 (previously parous: teats large and raised with or without fur at the base, but not lactating) or 3 (have young: teats raised with no fur at the base and producing milk). Reproductive condition indicates that the females successfully bred, but juvenile survival/establishment was poor, or juveniles were underestimated because they are often difficult to trap (Smith et al. 1975; Holland and Bennett 2011).

Chapter 3: Selective Traits Influencing Bush Rat Survival

Body condition and weight are indicators of an animal’s energy reserves and reproductive ability. Therefore these factors are directly linked to survival and population establishment after translocation (Pinter-Wollman et al. 2009). Arrival at a new environment may have negative effects because the animals are not familiar with food resources or competition (Pinter-Wollman et al. 2009). Higher weight and Body Condition Index (BCI) may improve survival rates after translocation by providing individuals with fat reserves during the acclimatisation period (Pinter-Wollman et al. 2009; Molony et al. 2006; McMahon et al. 2000; Hill et al. 2003; Smith and Moore 2005). Three of the four sites (Site 1, Site 2 and Site 3) had a higher number of bush rats released with a good body condition (BCI > 1). Site 4 was the most successful site in terms of number of bush rats that established and remained on the trapping grid. However, it also had the most animals with low body condition (BCI < 1) and significantly lower average body weight. Males with high BCI would be in good breeding condition, which also means they would disperse to look for mates and territory. The start of the breeding season encourages males to search for females in estrous, resulting in high levels of male dispersal (Wood 1971; Robinson 1987; Stokes et al. 2009b). Increasing BCI may mean dispersal, therefore, less animals occupying the grid. Another possible reason that there were less bush rats on sites with high BCI could be that older and possibly more dominant individuals are negatively affected by handling and translocation (Creel et al. 1996; Letty et al. 2000). Older bush rats are generally heavier (adult compared to sub-adult; Wood 1971), these animals remained on the grid and established territory as they were most likely the dominant individuals, but may have had reduced lifespan in comparison to the smaller animals. Age and the stress resulting from handling and translocation could have caused premature death (Creel et al. 1996; Letty et al. 2000).

Stress through translocation can also lead to increased susceptibility to disease and increased mortality due to disease (Dickens et al. 2010; Millspaugh and Washburn 2004; Teixeira et al. 2007). Bush rats were tested for Encephalomyocarditis virus (EMCV) before release. Rodents are considered to be the natural hosts, in which the virus normally persists without causing disease (Spyrou et al. 2004). The idea behind testing was to see if heightened stress may increase negative effects of the virus. This virus was detected in 38% of tested

Megan Callander – Translocation and Reintroduction of Native Bush Rats bush rats, but it did not have a significant effect on their survival. Thus, the stress of translocation did not reduce the immunity of the bush rats and exacerbate the virus.

There were positive correlations between habitat complexity and bush rat numbers, which confirms the need for suitable dense habitat once the bush rat has established in an area and juvenile recruitment is occurring. Quadrant cover, canopy height, soil moisture, leaf litter depth and plant ground cover were all important to bush rat survival. Bare ground coverage had a negative relationship with bush rat occupancy. Dense habitat provides shelter, food and cover from competition and predation which could account for this negative relationship (Richards and Short 2003). The positive correlation with moist soil could be due to food supply and to assist with burrowing. Bush rats are omnivorous, and will eat a range of seeds, fruit, fungi, plants and insects (Lindenmayer and Lacy 2002). Mycorrhizal fungi and invertebrate richness and abundance will increase in moist habitats (Lindenmayer and Lacy 2002; Burke and Nol 1998; Holland and Bennett 2010). Therefore, release into suitable habitat is shown to be an important factor in the success of reintroductions. Although there was no difference in habitat characteristics between sites, Site 4 had the highest percentage of cover (Quadrant Cover, QC) and also had the highest number of bush rat recaptures and individuals known to be alive. This indicates an importance in habitat structure for the success of the bush rat, as the QC identifies the degree of concealment that microhabitats provide from visual predators or competition (Glen et al. 2010). This is supported by other studies indicating bush rats favour areas with dense, structurally diverse vegetation and high litter cover (Watts and Aslin 1981; Holland and Bennett 2010; Kraaijeveld-Smit et al. 2007; Moro 1991).

The size of the bushland fragment is also an important factor to consider for bush rat establishment and success, as it has an influence on population structure (Holland and Bennett 2011). Bush rat populations in small fragments (<2.5 ha) have lower population densities, younger age structures, and have less immigration than those in large fragments (>49 ha) (Holland and Bennett 2010). Consequently, populations in small fragments and with low quality habitat are vulnerable to extinction. Bush rats will not disperse across urban development

Chapter 3: Selective Traits Influencing Bush Rat Survival

and are unlikely to move between habitat fragments (Seebeck and Menkhorst 2000; Lindenmayer et al. 2005; Peakall and Lindenmayer 2006; Bentley 2008). They do move between fragments in agricultural landscape (Lidicker 1975; Peakall and Lindenmayer 2006; Holland and Bennett 2011). This is probably due to the higher connectivity in these areas, many agricultural fragments are at least partially linked by forested or shrubby corridors along roadsides and drainage lines, which are used by bush rats (Bennett 1990). Thus, habitat corridors enhance functional connectivity and help bush rats and other small animals to disperse (Macqueen et al. 2008; Pardini et al. 2005; Metzger et al. 2009; Holland and Bennett 2011). Each site in SHNP occupied a one hectare grid. Although this size may not be large enough for long term colonisation, the grids were surrounded by larger fragments of bushland. Most had connective bush corridors allowing bush rats to disperse to other fragments. This is evidenced in later chapters where it is seen that bush rats dispersed and bred away from their release points. Bradley’s Head (BH) and North Head 5 (NH5) were control trapping grids within the 16 sites that were part of the Bush Rat Project. Site 1 was the only reintroduction site close to BH (500m), with bush connecting the two sites. Six juvenile bush rats were captured on BH, six months after initial release. It is assumed that bush rats from Site 1 had dispersed and established in BH, accounting for these offspring. One offspring was captured in NH5 with parents originating in Site 3 (see Chapter 5). This demonstrates that the Site 1 and Site 3 population dispersed and if trapping occurred in a wider area, adjacent to reintroduction sites, there may be signs of other population establishments.

The low number of animals released could be a potential limiting factor. An Allee effect is the reduction in individual ﬁtness with decreasing size of populations, in other words there is a positive relationship between individual fitness and density of conspecifics (Allee et al. 1949: cited in Stephens et al. 1999; Somers and Gusset 2009). Difficulty in ﬁnding suitable mates in low density populations is a key mechanism of the Allee effect (Stephens et al. 1999; Mihoub et al. 2011; Bosé et al. 2007). Thus, bush rats may have moved away from release points, in search of mates, because of low density populations. In other studies it has been found that during reintroductions there is an increase in population establishment and survival when larger numbers of animals are released, approximately 100

Megan Callander – Translocation and Reintroduction of Native Bush Rats individuals lead to a higher chance of success (Griffith et al. 1989; Fischer and Lindenmayer 2000). 100 individuals were released in this study, but only 25 individuals per site. Success may be improved with focus on one site with a much larger grid size and a release of 50 to 100 animals. Residual bush rats, even a small population, are usually the ones to recover the population, rather than by immigration (Lindenmayer et al. 2005). The animals released were the only ones in SHNP so there are no stable, permanent residents to recover population. Due to potential dispersal, until trapping is completed outside of these release areas, bush rat persistence is uncertain. Being able to differentiate between dispersal and mortality is difficult, both of which can result in translocation failure and local population extinction (Mihoub et al. 2011).

A large number of animals may not be enough to overcome threatening processes that have not been controlled. In Victoria, seven reintroduced populations of the endangered eastern barred bandicoot had founder sizes from 50 to 130 animals (Watson and Halley 2000). Despite the size, the populations decreased due to unsuccessful predator control and a drought (Watson and Halley 2000; Richards and Short 2003). The Bush Rat Project accounted for predators with fox baiting, reduction of black rat numbers and community awareness programs (keeping cats indoors at night). However weather, habitat disturbance, predators and competition coming from the edges of the grid (black rats were only removed from a 1ha grid) could not be controlled and would have influenced success.

Site 4 was comparatively the most successful site – with the highest recapture rate, juvenile recruitment, resident individuals and females (both adult and juveniles). It was also the site with significantly lower BCI (<1) and significantly higher QC. These two qualities could be considered as important for a successful translocation, but because the population declined over time further support is required. Larger studies with continued monitoring need to be implemented to help in evaluating future success of the populations.

Conservation of ecosystems requires a proactive approach in today’s rapidly changing environment. Translocation and reintroduction are solutions that could maintain ecosystem function and biodiversity. Using common species like the bush rat can help us understand the dynamics of translocation. Due to its

Chapter 3: Selective Traits Influencing Bush Rat Survival

potentially adaptive nature this species could help us manage ecosystems in a way that eventually means self-sustaining populations without further intervention. These techniques then could be used on more vulnerable species and hopefully to greater success as climate change and human disturbance begins to take its toll on native landscapes.

Megan Callander – Translocation and Reintroduction of Native Bush Rats

APPENDIX MODEL SET 1: Influence of Site on Adult Bush Rat Survival and Recapture Data for eight trapping sessions of 100 individual bush rats over four sites (Site = group attribute) was used to develop a global model in MARK. A total of 52 estimable parameters were in the global model φ(g*t)p(g*t). Goodness of Fit test showed that overall difference between groups, recapture rate and survival were not significant (p > 0.05) and therefore did not indicate lack of fit (Table A3.1).

Group 흌2 DF P Site 1 0.6417 2 0.7255 Site 2 3.3638 5 0.6441 Site 3 1.5893 5 0.9025 Site 4 1.9131 4 0.7517 Total 7.508 16 0.9622

The mean deviance of bootstrap GOF (1000 simulations) was 47.31 and the global model deviance was 49.57. This resulted in a deviance based c-hat of 1.05. Although the global model was only slightly over-dispersed, the c-hat was adjusted. The model deviance fell around 588 out of 1000 simulations meaning that there is 0.412 chance that the deviance would be that high if the data fitted the assumptions. Therefore, the factors in the global model used here were sufficient.

Models were run using the adjusted c-hat so are ranked according to QAICc. The first two models are the most parsimonious, and the difference between the ΔQAICc values is less than two. They account for 81% of support in data. The third and fourth model also have considerable support and account for 19% of the data (Table A3.2).

The first model (Table A3.2) shows that survival is dependent on time but not site (group), and recapture probability is dependent on site but not time - φ(t)p(g). In the second model, survival is again dependent on time and recapture is not affected by time or site - φ(t)p(.) (Table A3.2). Because all four models received a

Chapter 3: Selective Traits Influencing Bush Rat Survival

reasonable level of support Akaike weights were summed and model averaging was performed. Akaike weights confirmed that time was the most important factor in survival (81% support) and site was the most important factor in recapture probability (74% support).

Table A3.2. Top four models describing survival (φ) and recapture (p) probabilities of bush rats over four reintroduction sites.

Model Model QAICc ΔQAICc AICc Weight Parameters QDeviance Likelihood φ(t)p(g) 454.7734 0 0.59045 1 10 78.5952 φ(t)p(.) 456.7533 1.9799 0.21941 0.3716 7 87.0233 φ(.)p(g) 457.5270 2.7536 0.14902 0.2524 5 92.0094 φ(.)p(.) 460.1022 5.3288 0.04112 0.0696 2 100.778

φ = phi apparent survival, p = recapture probability, (t) = survival/recapture varies with time, (.) = constant survival/recapture (not affected by time or group), (g) = survival/recapture varies with site. For each model delta Quasi-Akaike information criterion terms (ΔQAICc) represent the difference in AIC between model 1 and subsequent models. The number of parameters and the deviance were used to calculate likelihood ratio tests for comparing the fit of models.

Megan Callander – Translocation and Reintroduction of Native Bush Rats

MODEL SET 2: Influence of Sex on Adult Bush Rat Survival and Recapture Data for eight trapping sessions of 100 individual bush rats grouped into sex (male vs. female) was used to develop a global model in MARK. A total of 26 estimable parameters were in the global model φ(g*t)p(g*t). Goodness of Fit test showed that overall difference between groups, recapture rate and survival were not significant (p > 0.05) and therefore did not indicate lack of fit (Table A3.3).

Group 흌2 DF P Male 2.4474 4 0.6541 Female 9.1836 7 0.2397 Total 11.631 11 0.3920

The mean deviance of bootstrap GOF was 37.38 and the global model deviance was 44.32. This resulted in a deviance based c-hat of 1.19. The global model was over-dispersed so the c-hat was adjusted. The model deviance fell around 827 out of 1000 simulations meaning that there is 0.173 chance that the deviance would be that high if the data fitted the assumptions. Therefore, the factors in the global model used here were sufficient.

Models were run using the adjusted c-hat so are ranked according to QAICc. The first two models are the most parsimonious, and the difference between the ΔQAICc values is less than two. They account for 59% of support in data. The following five models also have considerable support and account for 41% of the data (Table A3.4).

The first model (Table A3.4) shows that survival is dependent on time but not sex (group), and recapture probability is not dependent on sex or time - φ(t)p(.). In the second model, probability of survival and recapture is constant and not dependent on sex or time – φ(.)p(.) (Table A3.4). Because all seven models received a reasonable level of support Akaike weights were summed and model averaging was performed. Akaike weights confirmed that time was the most important factor in survival (51% support) and recapture probability was constant and did not depend on sex or time (72% support).

Chapter 3: Selective Traits Influencing Bush Rat Survival

Table A3.4. Top seven models describing survival (φ) and recapture (p) probabilities of bush rats over four reintroduction sites between sexes.

Model Model QAICc ΔQAICc AICc Weight Parameters QDeviance Likelihood φ(t)p(.) 405.2424 0 0.41516 1 7 50.3593 φ(.)p(.) 406.9894 1.7470 0.17332 0.4175 2 62.5122 φ(.)p(g) 407.5800 2.3376 0.12901 0.3107 3 61.0548 φ(t)p(g) 408.1112 2.8688 0.09891 0.2382 9 48.9469 φ(g)p(.) 408.2496 3.0072 0.09230 0.2223 3 61.7244 φ(g)p(g) 409.2376 3.9952 0.05632 0.1357 4 60.6480 φ(g*t)p(.) 410.1903 4.9479 0.03498 0.0843 13 42.2503

φ = phi apparent survival, p = recapture probability, (t) = survival/recapture varies with time, (.) = constant survival/recapture (not affected by time or group), (g) = survival/recapture varies with sex, (g*t) = survival/recapture varies with group (sex) interacting with time. For each model delta Quasi-Akaike information criterion terms (ΔQAICc) represent the difference in AIC between model 1 and subsequent models. The number of parameters and the deviance were used to calculate likelihood ratio tests for comparing the fit of models.

Megan Callander – Translocation and Reintroduction of Native Bush Rats

MODEL SET 3: Influence of Sex on Bush Rat Offspring Survival and Recapture Data for seven trapping sessions of 69 offspring with the group attribute of sex (male vs. female) was used to develop a global model in MARK. A total of 26 estimable parameters were in the global model φ(g*t)p(g*t). Goodness of Fit test showed that overall difference between groups, recapture rate and survival were not significant (p > 0.05) and therefore did not indicate lack of fit (Table A3.5).

Group 흌2 DF P Male 4.61770 8 0.7975 Female 13.0588 9 0.1600 Total 17.6764 17 0.4095

The mean deviance of bootstrap GOF was 96.96 and the global model deviance was 93.43. This resulted in a deviance based c-hat of 0.96. Although the global model was only slightly under-dispersed, the c-hat was still adjusted. The model deviance fell around 412 out of 1000 simulations meaning that there is 0.588 chance that the deviance would be that high if the data fitted the assumptions. Therefore, the factors in the global model used here were sufficient.

Models were run using the adjusted c-hat so are ranked according to QAICc. The first three models are the most parsimonious, and the difference between the ΔQAICc values is less than two. They account for 64% of support in data. The last eight models also have considerable support and account for 36% of the data (Table A3.6). The first model (Table A3.6) shows that survival is dependent on time but not sex (group), and recapture probability is dependent on sex but not time - φ(t)p(g). In the second model (Table A3.6), survival is again dependent on time and recapture is not affected by time or sex - φ(t)p(.). In the third model survival is dependent on sex and recapture is not affected by time or sex - φ(g)p(.) (Table A3.6). Because all eleven models received a reasonable level of support Akaike weights were summed and model averaging was performed. Akaike weights confirmed that time was the most important factor in survival (52% support) and recapture probability was dependent on sex (51% support).

Chapter 3: Selective Traits Influencing Bush Rat Survival

Table A3.6. Top eleven models describing survival (φ) and recapture (p) probabilities of juvenile bush rats (recruits) over four reintroduction sites between sexes.

Model Model QAICc ΔQAICc AICc Weight Parameters QDeviance Likelihood φ(t)p(g) 655.9327 0 0.31982 1 9 115.1566 φ(t)p(.) 656.9417 1.0090 0.19311 0.6038 8 118.2721 φ(g)p(.) 657.8550 1.9223 0.12232 0.3825 3 129.5362 φ(.)p(g) 658.5103 2.5776 0.08814 0.2756 3 130.1915 φ(g)p(g) 658.5878 2.6551 0.08479 0.2651 4 128.2227 φ(.)p(.) 659.0145 3.0818 0.06850 0.2142 2 132.7303 φ(g)p(t) 659.7242 3.7915 0.04804 0.1502 9 118.9481 φ(.)p(t) 660.9997 5.0670 0.02539 0.0794 8 122.3300 φ(g*t)p(.) 661.4137 5.4810 0.02064 0.0645 15 107.7353 φ(g*t)p(g) 662.3232 6.3905 0.01310 0.0410 16 106.4495 φ(t)p(t) 662.6599 6.7272 0.01107 0.0346 13 113.3331

φ = phi apparent survival, p = recapture probability, (t) = survival/recapture varies with time, (.) = constant survival/recapture (not affected by time or group), (g) = survival/recapture varies with sex, (g*t) = survival/recapture varies with group (sex) interacting with time. For each model delta Quasi-Akaike information criterion terms (ΔQAICc) represent the difference in AIC between model 1 and subsequent models. The number of parameters and the deviance were used to calculate likelihood ratio tests for comparing the fit of models.

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Table A3.7. Measurements of habitat characteristics around each trap station in a 1m radius averaged across each source site (Muogamarra Nature Reserve and Ku-ring-gai Chase National Park) and reintroduction site (Sydney Harbour National Park).

SOURCE SITES REINTRODUCTION SITES HABITAT Muogamarra Ku-Ring-Gai Site 1 Site 2 Site 3 Site 4 CHARACTERISTIC NR Chase NP Leaf litter cover 3.72 3.19 1.97 1.74 2.36 1.97 Leaf litter depth 1.63 1.84 2.22 1.77 1.21 3.34 Bare ground cover 0.75 0.78 1.31 1.11 1.22 0.67 Plant ground cover 3.03 3.44 3.19 2.89 2.56 3.22 Understorey cover 2.34 2.69 2.00 2.17 3.19 2.03 Number of logs 0.69 0.94 2.14 2.29 0.92 1.42 Number of vertical stems 1.66 1.75 2.78 2.34 2.97 2.78 Canopy height 1.69 1.72 1.50 0.89 0.86 2.81 Soil moisture 1.83 1.30 2.27 2.82 0.86 2.76

Habitat characteristics divided into categories and assigned a score using a modified six-point Braun-Blanquet scale (Poore 1955) and categories used in Cox et al. 2000 (see Table 2.2 and 2.3 for characteristic descriptions and categories).

CHAPTER 4: Movement Behaviour of Bush Rats: Exploration and Establishment

Megan Callander – Translocation and Reintroduction of Native Bush Rats

4.1 INTRODUCTION For wildlife translocations to be successful, movement of mammals released into unfamiliar ground needs to be understood. Individual movement decisions can be influenced by resource density, predation risk, competition and reproduction, as well as sex and social status (Sullivan et al. 1983; Lima and Dill 1990; Bowers et al. 1996; Bentley 2008). Translocation may change and further influence these movement decisions, disrupting typical behaviour.

Translocation requires an individual to create a new home range if they are to establish and breed. Understanding animal home ranges and other patterns of space utilisation are important components of ecological studies; predominantly studies focusing on population density, foraging behaviour, habitat selection, distribution of resources, interaction and avoidance behaviour (Harris et al. 1990; Lira and Fernandez 2009). Home range can be defined as the area an individual uses in its normal activities such as foraging, mating and rearing young (Burt 1943; Lira and Fernandez 2009). Occasional exploration outside this area should not be considered as part of the home range (Burt 1943; Brown and Orians 1970). Home ranges allow the animal to become familiar with a specific area which in turn allows them to find resources at lower energy costs, find mates, reproduce, maximise their fitness, and avoid predators more effectively (Lira and Fernandez 2009; Kie et al. 2010; Finlayson and Moseby 2004). Animals outside their home range will need to find and choose new travel routes and apply behaviours such as foraging, avoidance and defense (Bakker 2006). Unfamiliar ground increases likelihood of agonistic encounters with conspecifics, increases risk of predation due to higher encounter rates and a lack of knowledge of escape routes (Bernays and Wcislo 1994; Price et al. 1990; Bélichon et al. 1996; Sakai and Noon 1997; Bakker 2006). Thus, movement behaviour may differ when an animal is not on its home range.

Spatial organisation like territory and hierarchy of mammalian groups also need to be developed after translocation. These structures are influenced much like home range, through abundance and dispersion of resources, predation and intraspecific interactions (Travis and Slobodchikoff 1993; Clutton-Brock and Harvey 1978; Crook et al. 1976; Bujalska 1973; Bond and Wolff 1999). Spatial

Chapter 4: Movement Behaviour of Bush Rats organisation of mammalian males and females often differ. For small rodents such as Arvicolinae, the limiting resource for males is receptive females whereas for females it is food (Ims 1990; Ostfeld 1990; Ściński and Borowski 2007). Females exploiting food resources that are sparse are often territorial and have discrete home ranges (Ostfeld 1990). Rodent studies have shown that associations (a continuous state such as spatial proximity and overlap of home range) are often made rather than interactions (an instantaneous event like defense or mating), and social organisation is defined by spatial or temporal proximity and presence in the same group (Behrends et al. 1986; Karlsson 1988; Marinelli and Messier 1993; Whitehead and Dufault 1999).

Translocation can be highly stressful for animals, potentially eliciting a fight or flight response and affecting subsequent behaviour (Dickens et al. 2010; Heidinger et al. 2009). Animals that have been translocated have not actively chosen to move or select a new habitat. As a result, they often exhibit extensive dispersal movements away from the release area or have larger home ranges than established individuals (Mihoub et al. 2011; Russell et al. 2010; Burns 2005). For example, male prairie voles moved more extensively in outdoor enclosures that were unfamiliar than conspecifics in familiar enclosures (Jacquot and Solomon 1997). During bird reintroductions the typical movement behaviour after release into unfamiliar environments is extensive and rapid, even in normally sedentary species (Armstrong et al. 1999; Clarke and Schedvin 1997). Males, in particular, often disperse away from release sites, not contributing to the population establishment (Richards and Short 2003). When females are present this dispersal is less likely to occur because males do not need to search for breeding females. Thus, translocating both sexes together is more effective in population establishment (Short and Turner 2000), as this immediate movement of individuals influences their population establishment and long term survival (Russell et al. 2010).

Home ranges of bush rats vary from 0.1 to 0.4ha (Maitz and Dickman 2001; Lindenmayer et al. 2005). Male home ranges are larger than females and overlap extensively (Lindenmayer et al. 2005). Whereas females occupy permanent, stable, exclusive home ranges (Robinson 1987; Holland and Bennett 2010; Wood

Megan Callander – Translocation and Reintroduction of Native Bush Rats

1971). Bush rat movement is over short distances and mean distance movement has been found to be as little as 35m to 365m (Peakall et al. 2006; Wood 1971), maximum dispersal distance for males 762m, and females 213m (Banks et al. 2011b). Spatial genetic analysis has suggested movement occurs on a scale of less than 200m (Peakall et al. 2003).

There are differences in seasonal movements within and between sexes (Barnett et al. 1977). However, there is no consistent evidence for sex-biased dispersal or distances moved by either sex across studies (Peakall and Lindenmayer 2006; Kraaijeveld-Smit et al. 2007; White et al. 1996; Banks et al. 2011b). Males tend to move further (Barnett et al. 1977), especially during breeding season (Wood 1971; Robinson 1987; Holland and Bennett 2011). This has been referred to as density independent dispersal, to increase access to potential mates (Holland and Bennett 2011). Females that undergo density dependent dispersal are often less- fit individuals dispersing to establish a home range (Holland and Bennett 2011). Juveniles disperse quickly from maternal territory to find small home ranges, necessary for winter survival (Wood 1971; White et al. 1996). However, it is unusual for juvenile movement to be more than a few hundred metres (Peakall et al. 2003; Macqueen et al. 2008; Holland and Bennett 2010).

4.1.1 Aims The aim of this chapter is to describe patterns in the movement behaviour of translocated bush rats in the area they were released. For a site to be successful, bush rats should rapidly display behaviour that is considered typical.

If the translocation process results in typical movement behaviour then:

1. Initial exploration movements of bush rats would be relatively high in comparison to permanent home ranges. Initial release would result in bush rats exploring the area, followed by more restricted movement as they settle into permanent home ranges in preparation for breeding (Wauters et al. 1997; Kelt et al. 2014).

2. Female bush rats will have smaller home ranges than males, as females have stable breeding territories and males disperse as they continue to

Chapter 4: Movement Behaviour of Bush Rats

search for mates after they have established (Barnett et al. 1977; Wood 1971; Robinson 1987; Holland and Bennett 2011).

3. Male and female home ranges will overlap, but females are territorial and will stay separated from other females, creating discrete territories for breeding (Lindenmayer et al. 2005; Robinson 1987; Holland and Bennett 2010; Wood 1971).

4.2 METHODS 4.2.1 Radio Tracking To characterise spatial relationships among adult individuals, five bush rats per site (20 individuals out of 100) were fitted with very-high-frequency (VHF) radio transmitters prior to their release. One animal from each release point per site (five per site) were selected (see Chapter 2, Figure 2.3 for release point locations). Radio tracking was mainly carried out at night as bush rats are nocturnal. Each radio transmitter (single stage VHF collars Sirtrack®) weighed 3.0g which is less than 5% of the bush rat’s bodyweight so as not to impede the bush rats comfort or movement (Figure 4.1 and Appendix Table A4.1).

Radio tracking began on the night of the bush rat release and continued for two months in three distinct phases of the reintroduction process. The first phase of radio tracking was done during the first week, starting on the first night of release, 11 August 2011 until 19 August 2011. This was done to determine where the bush rats go, whether they stayed in their release sites or explored further. The second

Megan Callander – Translocation and Reintroduction of Native Bush Rats

phase was done during weeks 2-3 of the reintroduction from 20 August 2011 until 9 September 2011. This was done to determine whether the bush rats had settled in the area where they were nesting at the sites. The third and final phase was done to determine the home ranges of established and settled bush rats. This occurred at night and during the day, from 19 September 2011 until 29 September 2011. For clarification of terms I will refer to the period of bush rat release and exploration as the exploratory phase (combining phase 1 and phase 2) and the creation of permanent home ranges as establishment phase (phase 3). I will be comparing these two phases for the bush rats that were radio tracked. The periods for exploration and establishment were assigned as small mammal movements after translocation were found to reduce after 200 hours or approximately eight days (Banks et al. 2002). After release, voles (Microtus rossiaemeridionalis) would disperse and explore, displaying relatively high movement for one week. This movement would decline and level out at 300 hours or approximately two weeks (Banks et al. 2002).

Radio tagged individuals were located using triangulation techniques using 2-3 observers so as not to disturb the animals. Triangulation does not interfere as much with the activity of radio-collared animals compared with homing (Ebensperger et al. 2008). Triangulation consisted of at least three directional bearings with an angle of no less than 30° between them, obtained within a ten minute period, to determine the animal’s location. The animal was assumed to be located at the intersection of the bearings (or within the middle of the formed triangle) (Figure 4.2). The animal’s frequency, compass bearing, GPS waypoint, time and activity were all recorded. The night time radio tracking was between the hours of 18:00-1:00, the individual was normally located 4-5 times at least an hour apart. Given the high mobility of the animals, these locations are considered to be independent. During the day the fixes were done in the afternoon, before sunset, 1-2 locations were taken.

Chapter 4: Movement Behaviour of Bush Rats

Figure 4.2. An example of how triangulation of three directional bearings are taken to locate a radio collared bush rat, with an angle of no less than 30° between each bearing.

Radio collared animals captured during trapping had their collars checked. They were removed if there was some cause for concern regarding animal welfare. Collars were removed from three animals (one from Site 1, Site 3 and Site 4), each of these animals had patches of hair missing from under the collar and friction sores developing. Betadine was applied to the wounds and rats were released. To maintain sample sizes when a collar was removed, a new radio collar was placed on another trapped animal in the same site that was the same sex and appropriate body weight. Collars were put on new animals at Site 1, Site 3 and Site 4, thus for each of these sites there is one rat with radio tracking data for only the establishment phase (see Appendix Table A4.1). When data collection was complete, the radio-collared animals were recaptured and the transmitters were removed.

4.2.2 Statistical Analysis To determine bush rat movement, several programs were used. Firstly, radio tracking data was analysed using Locate III (Nams 2011), a graphical radiotelemetry triangulation program, which uses maximum likelihood to allocate fix locations from multiple bearings with 95% error ellipses. This was used to help keep the most accurate fixes and discard inaccurate ones. Location data points

Megan Callander – Translocation and Reintroduction of Native Bush Rats

were then separated into exploratory phase and establishment phase for each individual. These points were used to calculate and map Kernel Utilisation Distributions (KUD) of each phase using the software program ZoaTrack (Dwyer et al. 2015). ZoaTrack is an open access program that uses open-source software (Dwyer et al. 2015). Calculations were undertaken within R using the adehabitatHR library of functions (Calenge 2006).

Kernel analysis is a probabilistic method accounting for location and probability of occurrence of an animal at a specific geographical location (Dwyer et al. 2015). Kernel estimators work well with small amounts of data, are robust to autocorrelation, are nonparametric (not based on assumption that data conforms to specified distribution), allow multiple centers of activity, and result in a utilisation distribution (UD) rather than a simple home range outline (Seaman and Powell 1996; Kie et al. 2010; Jacques et al. 2009). A UD is a grid where the value for each cell represents the probability of the animal occurring and proportion of time spent in that cell, giving higher weight to areas of more intensive use (Mitchell 2007; Seaman and Powell 1996; Katajisto and Moilanen 2006; Worton 1989; Oliveira et al. 2012).

This study uses Kernel Utilisation Distributions (KUD) with least-squares cross- validation (LSCV) algorithm for smoothing parameter (h), grid size of 200 with a variable h. The size of the grid effects the kernel surface, the larger the grid size the smoother the kernel surface, identifying relatively compact areas of usage. The h estimator is a kernel smoothing parameter. As h decreases, the kernel becomes more fragmented and less continuous, increasing detail within the home range (Worton 1989; Wauters et al. 2007). These parameters are the most common and accurate for most situations (Mitchell 2007) and have been shown to have the least biased and most accurate results (Row and Blouin-Demers 2006; Seaman and Powell 1996). LSCV varies h and identifies the value of h that produces the minimum estimated error (Row and Blouin-Demers 2006). The ellipse boundary used to represent the total exploratory phase and establishment phase size was 95% (Worton 1989), to represent the core areas 50% was used (Harris et al. 1990; Row and Blouin-Demers 2006). The core represents the most frequently used area for each individual.

Chapter 4: Movement Behaviour of Bush Rats

The KUDs were mapped for each bush rat individual and exported to Google Earth (Google Inc. 2015) to manipulate. Polygon mapping was used to find the area (ha) of the exploratory phase (50% and 95%) and the establishment phase (50% and 95%) of all individual bush rats. Percentage of overlap was also calculated whenever one bush rat’s home range (establishment phase 50% and 95%) overlapped another (Maher 2009).

Size of exploratory phase kernels and establishment phase kernels (ha) were compared between sexes and sites using Analysis of Variance (ANOVA) and 2- tailed t-tests in Microsoft Excel, significance level was set at 0.05 (Oliveira et al. 2012; Herr and Rosell 2004). Nonparametric Mann-Whitney U-test was also used to compare individual sites and overlap because of small sample size. Logistic regression was used to determine if size of establishment phase area influenced survival of bush rats. Analysis of Covariance (ANCOVA) was performed to reduce within group error and eliminate the possible confounding variable of weight. Patterns of bush rat dispersal (movement in metres) was calculated via movement between traps of all animals released, not just radio tracked animals. Linear distance was calculated between the location of initial release and the final trap position the animal was caught. This served as an indication of how far a bush rat might travel from the release point (presumably located within its home range) (Feierabend and Kielland 2014).

4.3 RESULTS 4.3.1 Bush Rat Exploration, Establishment and Survival For the exploratory phase of radio tracking (50% kernel), bush rat areas ranged from 0.05-0.85ha for females and 0.06-0.59ha for males. For 95% exploratory phase, females ranged from 0.25-3.86ha and males ranged from 0.35-3.38ha (see Appendix Table A4.2). Bush rat 50% establishment phase area ranged from 0.04- 0.68ha for females and 0.08-1.52ha for males. For 95% establishment phase, females ranged from 0.15-2.32ha and males ranged from 0.38-7.82ha (see Appendix Table A4.2).

Exploratory phase was smaller than establishment phase in Site 1, although not significantly (50% KUD F1,10 = 0.42, p = 0.54 and 95% KUD F1,10 = 0.52, p = 0.49).

Megan Callander – Translocation and Reintroduction of Native Bush Rats

This was also true for Site 2 (50% KUD F1,9 = 0.71, p = 0.42 and 95% KUD F1,9 =

0.67, p = 0.44), and Site 3 (50% KUD F1,9 = 0.06, p = 0.81 and 95% KUD F1,9 = 0.03, p = 0.87) (Figure 4.3 and Appendix Figure A4.1 for 95% KUD). Site 4 was the only site to have a significant difference with exploratory phase being larger than establishment (50% KUD F1,9 = 7.48, p = 0.03 and 95% KUD F1,9 = 8.39, p = 0.02) (Figure 4.3 and Appendix Figure A4.1 for 95% KUD) (see Appendix Figure A4.2, A4.3, A4.4, A4.5 for KUD contour maps for comparisons across sites).

1 Exploratory Phase 0.8 Establishment Phase 0.6

0.4

0.2 50% KUD Average KUD 50% (ha) Area 0 Site 1 Site 2 Site 3 Site 4 Sites

Figure 4.3. Mean area (ha ± SE) 50% KUD exploratory phase (dark grey) compared to 50% KUD establishment phase (light grey) across four reintroduction sites.

Size of exploratory phase did not influence survival of bush rats, 휒2 = 0.19, df = 1, p = 0.67. However, the size of establishment phase did influence survival over time. Animals with larger establishment areas were more likely to survive than those with small areas, 휒2 = 4.63, df = 1, p = 0.03.

4.3.2 Movement of Female and Male Bush Rats Overall, during the 50% KUD exploratory and establishment phase, male mean area was larger than females, however not significantly (exploratory phase F1,18 =

0.45, p = 0.51; establishment phase F1,19 = 2.16, p = 0.16) (Figure 4.4). During the 95% KUD exploratory and establishment phase, males again had a larger area than females but the size was not significant (exploratory phase F1,18 = 0.68, p = 0.42; establishment phase F1,19 = 2.36, p = 0.14) (see Appendix Figure A4.6 for 95% KUD).

Chapter 4: Movement Behaviour of Bush Rats

0.7 Exploratory 0.6 50% KUD

0.5 Establishment 50% KUD 0.4

0.3

0.2 Average Average Area(ha) 0.1

0 Females Males Sex Figure 4.4. Mean area (ha ± SE) comparison of male and female 50% KUD exploratory phase (dark grey) compared to 50% KUD establishment phase (light grey) across four reintroduction sites.

For three of the four sites (Site 1, 2 and 4), female exploratory movement was greater than the establishment area, however not significantly (Figure 4.5 and

Appendix Figure A4.7 for 95% KUD). Site 4 had the largest difference (50% F1,3 =

1.24, p = 0.38, 95% F1,3 = 1.02, p = 0.42). Site 3 on the other hand had an establishment area that was larger than the exploratory phase, but not significantly (50% F1,5 = 0.41, p = 0.56, 95% F1,5 = 0.17, p = 0.69) (Figure 4.5 and Appendix Figure A4.7 for 95% KUD). For the males, Site 1 and Site 2 had exploratory phases that were smaller than their establishment areas, whereas, Site 3 and Site 4 had smaller establishment areas (Figure 4.6 and Appendix Figure A4.8 for 95% KUD). Site 4 had the greatest difference between the two phases, however not significantly (50% F1,3 = 2.25, p = 0.27, 95% F1,3 = 3.30, p = 0.21).

Megan Callander – Translocation and Reintroduction of Native Bush Rats

1.2 Exploratory 1.0 50% KUD Establishment 0.8 50% KUD

0.6

0.4 Average Average Area(ha) 0.2

0.0 Site 1 Site 2 Site 3 Site 4 Sites Figure 4.5. Mean area (ha ± SE) for female bush rats (n = 11). 50% KUD exploratory phase core area (dark grey) compared to 50% KUD establishment phase core area (light grey) across four reintroduction sites.

1.2 Exploratory 1.0 50% KUD

0.8 Establishment 50% KUD 0.6

0.4 Average Average Area(ha) 0.2

0.0 Site 1 Site 2 Site 3 Site 4 Sites Figure 4.6. Mean area (ha ± SE) for male bush rats (n = 10). 50% KUD exploratory phase core area (dark grey) compared to 50% KUD establishment phase core area (light grey) across four reintroduction sites.

Furthest distance moved for females compared to males from original release point (measured in a straight line) was significantly different. These figures include all bush rats that were recaptured at least once, not just the radio tracked animals (female n = 37, male n = 32). The furthest distance dispersed by males from their original release point was 4.2 km and for females it was 0.8 km. Female individuals tended to move shorter distances than males (Figure 4.7). The overall mean distance moved by males was significantly greater than females (F1,68 = 5.35, p = 0.02, Figure 4.8). Males dispersed the greatest distance in Site 1 followed by Site 4. Females dispersed more in Site 3 followed by Site 1. Site 4 had the least female movement followed by Site 2 (Figure 4.9). The only sites which were

Chapter 4: Movement Behaviour of Bush Rats significantly different in distance moved was males in Site 4 and Site 2 (Site 4 distance > Site 2 distance F1,15 = 5.21, p = 0.04).

20 18 Males 16 Females 14 12 10 8 6

4 NumberofIndividuals 2 0 20-50 51-100 101-500 501-1000 1000+ Dispersal Distance (m)

600

500

400

300

200

100 Average Average Distance Moved(m) 0 Males Females Sex Figure 4.8. Mean dispersal distance (m ± SE) from release points for male (dark grey) and female (light grey) bush rats across four reintroduction sites. Distance measured in a straight line from release point to final trap position if recaptured.

Megan Callander – Translocation and Reintroduction of Native Bush Rats

1600 Males 1400 Females 1200 1000 800 600 400

200 Average Average Distance Moved(m) 0 Site 1 Site 2 Site 3 Site 4 Site Figure 4.9. Mean dispersal distance (m ± SE) from release points for male (dark grey) and female (light grey) bush rats in the four reintroduction sites. Distance measured in a straight line from release point to final trap position if recaptured.

ANCOVA was performed to reduce within group error and eliminate the possible confounding variable of weight, the results were not significant (exploratory 50%

KUD F1,17 = 0.71, p = 0.41; 95% KUD F1,17 = 0.73, p = 0.40; establishment 50% KUD

F1,17 = 0.17, p = 0.69; 95% KUD F1,17 = 0.24, p = 0.63). Therefore the size of the animal did not influence the size of the establishment area or the distance travelled.

4.3.3 Overlap of Establishment Area: Home Range Sharing or Separation On average, radio tracked females shared 7.25 ± 2.30% of their core establishment area (50%) and 23.28 ± 7.93% of their larger establishment area (95%) with other females (n = 11 females; Figure 4.10, compare with Figure 4.11). Site 3 had no females sharing establishment areas, with Site 4 only having a small amount of overlap (Figure 4.11). Males shared 23.04 ± 8.47% of their core establishment areas (50%) and 45.51 ± 11.52% of their larger establishment area (95%) with other males (n = 10 males; Figure 4.10, compare with Figure 4.12). Site 3 again had the least amount of shared establishment areas between males followed by Site 4 (Figure 4.12).

Chapter 4: Movement Behaviour of Bush Rats

60 50% KUD 50 95% KUD

20 Mean%of Overlap 10

0 Female with Female Male with Male

Megan Callander – Translocation and Reintroduction of Native Bush Rats

A. Site 1 Female Overlap B. Site 2 Female Overlap

N N

100m 100m

C. Site 3 Female Overlap D. Site 4 Female Overlap

N 100m 100m

Chapter 4: Movement Behaviour of Bush Rats

A. Site 1 Male Overlap B. Site 2 Male Overlap

N N

100m 100m

C. Site 3 Male Overlap D. Site 4 Male Overlap

N N 100m 100m

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Intra-sexual overlap was not significantly different between sexes. Females overlapping females in 50% establishment areas had a median of 7.25% (mean rank = 5.4) and males overlapping males had a median of 15.61% (mean rank 8,

Mann-Whitney U = 12, Z = 1.10, two-tailed, F1,11 = 1.63, p = 0.27). 95% establishment area females had a median of 15.55% (mean rank = 9.3) and males had a median of 23.08% (mean rank 13.33, Mann-Whitney U = 38, Z = 1.42, two- tailed, F1,21 = 2.33, p = 0.14).

Male bush rats overlapping female establishment areas averaged 42.00 ± 9.57% for the females core area (50%) and 40.07 ± 7.50% of their larger establishment area (95%). Whereas, female bush rats overlapping male establishment area averaged 20.40 ± 10.21% of male core area (50%) and 17.13 ± 4.52% of their larger establishment area (95%) (Figure 4.13). Intersexual overlap for 50% establishment was not significant; percentage of male establishment areas occupied by females (median 9.64%, mean rank 5.71) compared to percentage of female establishment areas occupied by males (median 34.84%, mean rank 9.29,

Mann-Whitney U = 12, Z = -1.53, two-tailed F1,13 = 2.38, p = 0.15). It was, however, significant for 95% establishment, females occupying 7.47% (median, mean rank 18) of male establishment areas and males occupying 28.05% (median, mean rank 27) of female establishment areas (Mann-Whitney U = 143, Z = -2.31, two-tailed,

F1,43 = 6.85, p = 0.01).

There was not enough data to compare the difference in overlap between the four sites except for females overlapping males and males overlapping females in 95% establishment areas. There was no significant difference, in other words, no site had a greater overlap of bush rat establishment areas compared to any other site.

Chapter 4: Movement Behaviour of Bush Rats

60 50% KUD 50 95% KUD

20 Mean%Overlap 10

0 Female overlap by Male Male overlap by Female

4.4 DISCUSSION Successful translocation potentially requires an animal to quickly display typical behaviour. The behaviour is exhibited through dispersal and establishment of home ranges, which leads to breeding and the establishment of a sustainable population. When bush rats were first released it was expected that they would explore the area (one week of high movement – exploratory phase). This would be followed by a period of more restricted movement as they settled into permanent home ranges in preparation for breeding (approximately after two weeks – establishment phase) (Banks et al. 2002; Wauters et al. 1997; Kelt et al. 2014). Site 4 was the most successful site in population establishment and was the only site to have the expected behaviour, where establishment area (home range) was significantly smaller than the exploratory phase area. In the other sites exploratory phase was smaller than the establishment phase, but the size difference was not significant. Once an animal reduces their movements it suggests that the stress response to the translocation is reducing and they are beginning to settle (Dickens et al. 2010; Christie et al. 2011). Site 4 and Site 1 were the only sites to produce offspring in the first trapping season (spring 2011, see Chapter 3), Site 4 having the highest number of offspring by summer, indicating that quick establishment and display of typical behaviours led to increased population growth.

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Even though Site 4 had a smaller establishment phase than exploratory phase, overall mean establishment phases (0.36 to 1.24ha) were still larger than previous studies; where the average bush rat home range was from 0.1 to 0.4ha or < 200m in diameter (Maitz and Dickman 2001; Lindenmayer et al. 2005; Wood 1971; Robinson 1987). Home ranges and roaming behaviour may be affected by translocation but also vary by season (Heidinger et al. 2009; Robinson 1987; Finlayson and Moseby 2004). Winter movements are often greater, for the purpose of foraging, whereas summer exploration is about finding mates and new territory (Stewart and Barnett 1981; White et al. 1996). This study took place in spring when exploration for mates and territory would be occurring, but because the environment was new to the animals, foraging behaviour and extended exploration would also be taking place, explaining the home range size increase. Extended movement may also be indicative of resource requirements and food availability (Molyneux et al. 2011; Warren et al. 2015). Site 4 was the most structurally complex habitat (see Chapter 3), so may have provided the resources bush rats required and as such restricted the necessity for movement in comparison to the other sites.

Density of individuals could have similarly influenced movement behaviour (Woodside 1983; Mazurkiewicz and Rajska-Jurgiel 1998). Some of the bush rats that dispersed great distances were potential parents to offspring found in the new areas (see Chapter 5). Bush rats were not necessarily displaying normal behaviours by staying close to conspecifics, instead they travelled to other areas to breed. Conspecific density is often related to home range size (Mazurkiewicz and Rajska-Jurgiel 1998; Finlayson and Moseby 2004). Conspecific competitive pressure for these bush rats would be less likely to occur as there were no resident bush rats in the release sites (Christie et al. 2011). Low densities of conspecifics leads to larger ranges, where animals are more mobile and move away from their release site (Wauters et al. 1997; Russell et al. 2010).

On average male bush rats exploratory and establishment phases were larger than females, although not significantly. This trend is expected, as males have density independent movement which increases access to potential mates (Wood 1971; Robinson 1987; Holland and Bennett 2011). Adult females maintain stable home

Chapter 4: Movement Behaviour of Bush Rats ranges throughout the year (Wood 1971). Females undergo density dependent movement; often less-fit individuals disperse to establish a home range (Holland and Bennett 2011). This could be the case for Site 3 females, whose establishment phase was slightly larger than the exploratory phase, indicating the continued search for territory and resources rather than settling.

In this study males had significantly greater linear dispersal from release sites than females. The movement was also greater when compared to earlier research, indicating a response to translocation (Peakall et al. 2006; Wood 1971; Banks et al. 2011b). It is most likely a flight response due to the stress of being released into an unfamiliar environment (Dickens et al. 2010; Christie et al. 2011). Animals can quickly undergo linear dispersal away from the release site, suggesting unfamiliarity and perhaps homing behaviour (Bright and Morris 1994; Moehrenschlager and MacDonald 2003; Attum and Cutshall 2015). All sites were connected to other bushland areas through habitat corridors. This continuous habitat may have allowed the animals to move further because corridors provide less resistance and risk (Attum and Cutshall 2015). These factors could also explain the establishment phase’s similarity to the exploratory phase. Although male bush rats are often wider ranging than females, bush rat movement is over relatively short distances and extended dispersal is not common (Wood 1971). Extensive dispersal away from the release site often reduces the likelihood of translocation success (Moehrenschlager and MacDonald 2003; Tuberville et al. 2005; Yott et al. 2010). Even so, when comparing to other small mammal translocation studies, not all bush rat males had excessive movement. This could be due to the release of more females than males as the males do not need to search as extensively for mates (Christensen and Burrows 1994; Short and Turner 2000; Jacquot and Solomon 1997; Richards and Short 2003).

The final display of typical behaviour would be that male/female home ranges overlap, and female/female home ranges stay separate, creating discrete territory for breeding (Robinson 1987; Holland and Bennett 2010; Wood 1971). Males overlap territories both with each other and with females, especially during mating season (Kraaijeveld-Smit et al. 2007). Breeding adult females tend to be intolerant of other females and occupy discrete home ranges with little overlap

Megan Callander – Translocation and Reintroduction of Native Bush Rats

between territories (Robinson 1987; Kraaijeveld-Smit et al. 2007). This trend was demonstrated in the findings with females sharing less home range than males, however it was not significant. Site 3 had virtually no overlap for males or females and females moved the greatest distances. This could indicate that resources in the site were insufficient; territory separation was unlikely because breeding success was relatively low. Animals translocated into poor habitat often have excessive movement and low survival (Germano and Bishop 2009; Attum and Cutshall 2015). Many female mammal species will have smaller home ranges if they have access to quality food resources, they will also occupy richest habitats first (Boutin 1990; Maher and Lott 2000; Jonsson et al. 2002; Finlayson and Moseby 2004; Fustec et al. 2001).

Usually animals are more likely to suffer mortality if they move greater distances (Attum and Cutshall 2015; Kleiman 1989; Shier 2006). Extensive movements can lead to greater predation risk and anthropogenic encounters. They will also have little or no range overlap with conspecifics, which leads to low breeding capabilities and low population growth (Kleiman 1989; Moehrenschlager and MacDonald 2003; Jones and Witham 1990; Eastridge and Clark 2001; Pinter- Wollman et al. 2009; Larkin et al. 2004). However, in this study even though the home ranges were larger, the smaller the establishment phase, the less likely the bush rat would survive after three months. This seems contradictory to previous findings but it could mean that the animals that moved further and more often were more likely to survive. Instead of reducing predation exposure, it is possible that limited movement may increase risks due to the accumulation of odorous wastes that are attractants for potential predators (Banks et al. 2002; Banks et al. 2000). Bush rats were unfamiliar with the area, therefore unfamiliar with predators, competition and resources. Survival rate may have improved over time due to increased juvenile local experience, such as safe sources of food and escape routes from predators, thus motility may have also reduced (Banks et al. 2002; Russell et al. 2010; Sakai and Noon 1997; Bakker 2006; Bright and Morris 1994; Russell et al. 2010). To confirm a move back to typical behaviour, radio tracking would need to be extended past the two month period. This may gain insights into whether the effect of the translocation is limited to a certain time period after release, or if the animals (adults or recruits) become more familiar with the area

Chapter 4: Movement Behaviour of Bush Rats and reduce the size of their home ranges. Increasing the number of animals radio tracked would increase data reliability and see whether typical behaviour is displayed.

After translocation animals need to establish territory and home ranges to create sustainable populations. Because translocation disrupts typical behaviour, understanding movement and dispersal of animals is crucial in the understanding and management of translocated populations.

Megan Callander – Translocation and Reintroduction of Native Bush Rats

APPENDIX

Table A4.1. Bush rat individuals attached with radio transmitters for radio tracking across the four reintroduction sites in Sydney Harbour National Park.

Release Weight Reproductive Date of Date of Total ID Site Sex Point (g) Condition First Fix Last Fix Fixes R6165 1 B5 F 117 VO 11-08-11 29-09-11 46 R5363 1 E5 F 120 VO 11-08-11 29-09-11 55 R2781 1 E2 F 118 VC 11-08-11 07-09-11 26 R3578 1 D4 M 140 TD 11-08-11 07-09-11 27 R4577 1 B2 M 128 TA 11-08-11 07-09-11 30 R0000 1 E2 M 140 TD 20-09-11 29-09-11 31 R5163 2 B2 F 135 VO 11-08-11 29-09-11 69 R2582 2 D4 F 95 VO 11-08-11 29-09-11 51 R2994 2 E2 F 120 VO 11-08-11 29-09-11 27 R4181 2 B5 M 122 TD 11-08-11 29-09-11 62 R5774 2 E5 M 150 TD 11-08-11 29-09-11 51 R5962 3 D4 F 103 VO 11-08-11 06-09-11 34 R2394 3 B2 F 128 VO 11-08-11 27-09-11 60 R3186 3 E5 F 132 VO 11-08-11 29-09-11 57 R1782 3 E2 F 110 VO 19-09-11 29-09-11 22* R3940 3 B5 M 134 TD 11-08-11 24-08-11 28 R4951 3 E2 M 118 TD 11-08-11 29-09-11 59 R5568 4 D4 F 107 VO 11-08-11 28-09-11 73 R3358 4 E5 F 122 VO 11-08-11 28-09-11 78 R3781 4 B2 F 115 VO 11-08-11 14-08-11 5* R4367 4 E2 M 139 TD 11-08-11 28-09-11 63 R4761 4 B5 M 110 TA 11-08-11 23-08-11 29 R0575 4 E5 M 111 TD 19-09-11 28-09-11 35

Weight (g): this is the weight the bush rat was upon release into reintroduction sites. They are all appropriate weight to carry a 3.0g radio transmitter collar. Reproductive condition: VO = vagina perforate, VC = vagina closed, TD = testes descended, TA = testes ascended. VO and TD indicates the animal is in breeding condition and may have already begun mating. *Animals with < 25 total fixes was excluded from analysis.

Chapter 4: Movement Behaviour of Bush Rats

Site 1 Exploratory Phase Area (ha) Establishment Phase Area (ha) ID Sex 50% KUD 95% KUD 50% KUD 95% KUD R6165 F 0.339 1.510 0.140 0.937 R5363 F 0.074 0.303 0.051 0.251 R2781 F 0.131 0.585 0.168 0.957 R3578 M 0.347 1.857 0.383 1.712 R4577 M 0.226 0.998 1.520 7.815 R0000 M - - 0.083 0.379 Site 2 Exploratory Phase Area (ha) Establishment Phase Area (ha) ID Sex 50% 95% 50% 95% R5163 F 0.080 0.301 0.038 0.239 R2582 F 0.050 0.251 0.121 0.435 R2994 F 0.990 0.565 0.036 0.148 R4181 M 0.064 0.34 0.078 0.459 R5774 M 0.164 0.638 0.863 3.292 Site 3 Exploratory Phase Area (ha) Establishment Phase Area (ha) ID Sex 50% 95% 50% 95% R5962 F 0.669 2.727 0.684 2.323 R2394 F 0.221 0.669 0.491 1.890 R3186 F 0.271 0.941 0.325 1.054 R3940 M 0.595 1.934 0.147 0.553 R4951 M 0.347 1.277 0.624 2.170 Site 4 Exploratory Phase Area (ha) Establishment Phase Area (ha) ID Sex 50% 95% 50% 95% R5568 F 0.353 1.290 0.120 0.550 R3358 F 0.852 3.858 0.430 1.738 R4367 M 0.551 3.376 0.472 1.982 R4761 M 0.585 2.338 - - R0575 M - - 0.090 0.610

Individuals with missing values either had their radio collar removed due to animal welfare concern or a radio collar attached at a later date as a replacement for the ones removed.

Megan Callander – Translocation and Reintroduction of Native Bush Rats

4 Exploratory Phase 3 Establishment Phase 2

1 95% KUD 95%KUD Average Area (ha) 0 Site 1 Site 2 Site 3 Site 4 Sites Figure A4.1. Mean area (ha ± SE) 95% KUD exploratory phase (dark grey) compared to 95% KUD establishment phase (light grey) across four reintroduction sites.

Chapter 4: Movement Behaviour of Bush Rats

A. Exploratory 50% B. Exploratory 95%

C. Establishment 50% D. Establishment 95%

100m

Megan Callander – Translocation and Reintroduction of Native Bush Rats

A. Exploratory 50% B. Exploratory 95%

C. Establishment 50% D. Establishment 95%

100m

Chapter 4: Movement Behaviour of Bush Rats

A. Exploratory 50% B. Exploratory 95%

C. Establishment 50% D. Establishment 95%

100m

Megan Callander – Translocation and Reintroduction of Native Bush Rats

A. Exploratory 50% B. Exploratory 95%

C. Establishment 50% D. Establishment 95%

100m

Chapter 4: Movement Behaviour of Bush Rats

3.5 Exploratory 3 95% KUD 2.5 Establishment 95% KUD 2

1.5

1 Average Average Area(ha) 0.5

0 Females Males Sex Figure A4.6. Mean area (ha ± SE) comparison of male and female 95% KUD exploratory phase (dark grey) compared to 95% KUD establishment phase (light grey) across four reintroduction sites.

6.0 Exploratory 5.0 95% KUD Establishment 4.0 95% KUD

3.0

2.0 Average Average Area(ha) 1.0

0.0 Site 1 Site 2 Site 3 Site 4 Sites Figure A4.7. Mean area (ha ± SE) for female bush rats (n = 11). 95% KUD exploratory phase (dark grey) compared to 95% KUD establishment phase (light grey) across four reintroduction sites.

6.0 Exploratory 5.0 95% KUD Establishment 4.0 95% KUD

3.0

2.0 Average Average Area(ha) 1.0

0.0 Site 1 Site 2 Site 3 Site 4 Sites Figure A4.8. Mean area (ha ± SE) for male bush rats (n = 10). 95% KUD exploratory phase (dark grey) compared to 95% KUD establishment phase (light grey) across four reintroduction sites.

CHAPTER 5: Genetic Relatedness of Bush Rats: Social Dynamics and Population Structures

Megan Callander – Translocation and Reintroduction of Native Bush Rats

5.1 INTRODUCTION Behavioural research is increasingly a part of species conservation (Moore et al. 2008). This research is important in understanding animal community dynamics and species interaction mechanisms (Dickman and Woodside 1983). Population structures are not made up of randomly mating subpopulations; many organisms have distinct patterns of mating and dispersal through which they form social groups (Sugg et al. 1996; Piertney et al. 1999). Social animals live and interact with each other, displaying complex relationships and social structures (Wey et al. 2008). Knowledge of social structure (group size and composition) and spatial structure (spacing, dispersion and territoriality) can be useful for conservation. It allows researchers to understand the appropriate management practices that can be implemented for population interventions. The way in which individuals of a species react to each other brings about spacing patterns and this spacing is known to greatly influence population dynamics, persistence, genetics, and evolution of species (Brown and Orians 1970; Wolf et al. 2007).

The composition of a group (ratio of sex, age, relatedness) and the size of the breeding population has direct effects on reproductive performance and survival of individuals (Silk 2007). Structures can limit the number of breeding individuals and control dispersal of individuals and sexes (Greenwood 1980; Pusey 1987; Piertney et al. 1999). Social structure may also increase potential for parasite, disease transmission and intraspecific competition between individuals, resulting in reproductive suppression (Alexander 1974; West et al. 2002). However, it can also provide reduced risk of predation, increase success in finding and maintaining resources and create mating opportunities (Wolf et al. 2007; Blundell et al. 2004; Alexander 1974). These relationships vary according to abundance and spatial distribution of resources, population density and predation pressure (Wey et al. 2008). Fitness benefits can occur directly (individual level) through reproductive success, or indirectly through reproductive success of related individuals (kin selection) (Blundell et al. 2004).

For many animals, information on social structures and interaction is unknown (e.g. cryptic or endangered wildlife). For this reason, assumptions are made, animals that are clustered (spatially and temporally, e.g. share a proportion of

Chapter 5: Genetic Relatedness of Bush Rats their home range) are likely to interact with one another and thus are seen as being associated (Whitehead and Dufault 1999). However, with the growing development and application of molecular markers, research into social structures of wild populations has improved; contributing information that could not be obtained from field observations alone (Berger-Wolf et al. 2007; Harrison et al. 2013). The ability to infer genetic relationships within populations has enhanced many areas of research in behaviour, evolution and conservation (Blouin 2003). Knowledge of kinship and reconstruction of pedigrees allows the investigation of mating systems and reproductive success, selection and adaptation, kin selection and dispersal patterns (Berger-Wolf et al. 2007; Harrison et al. 2013).

Kinship or pedigree reconstruction are important in investigations of wild populations (Ashley et al. 2009). The aim is to identify family groups and relationships between a pair of individuals, including parent-offspring, full siblings, half siblings, or unrelated (Wagner et al. 2006; Ashley et al. 2009). Parentage studies and sibship reconstructions have become increasingly popular approaches to estimate population parameters such as population structure, sexual selection (Nussey et al. 2005; Yezerinac et al. 1995) and connectivity through migration, dispersal or recruitment (Nathan et al. 2003; Planes et al. 2009; Harrison et al. 2013; Jones et al. 2010). They have revealed aspects of inbreeding and trait heritability (Ritland 2000), genetic adaptation of wild species to captivity (Christie et al. 2012) and assisted in the restoration of captive and endangered populations (Keller and Waller 2002).

Bush rats are generally a solitary breeding species grouped by local clusters of higher density, less than 200m across at local spatial scales (Fst = 0.041-0.072) (Peakall et al. 2003; McEachern et al. 2007). Adult females maintain stable home ranges throughout the year (Wood 1971). Adults have considerable overlap of ranges with juveniles. Adult females may also share their burrow with juveniles (both males and females) (Woodside 1983). Bush rats can have high fecundity and produce litters of up to eight, with an average of four (Lindenmayer et al. 2005). Most individuals nest alone and their offspring (both sexes) disperse once they are weaned (Peakall et al. 2003). Breeding adult females are intolerant of other

100

Megan Callander – Translocation and Reintroduction of Native Bush Rats females and occupy discrete home ranges (Robinson 1987). Individuals have an average life span of 12 to 15 months and populations have an annual turnover (Warneke 1971; Wood 1971; Taylor and Calaby 1988).

Spatial autocorrelation is a statistical tool used in landscape genetics to identify fine scale genetic patterns. It compares genetic and geographic distance between individuals to identify extent of spatial genetic structure in a population. Positive spatial genetic structure indicates patterns of local relatedness due to restricted dispersal or social organisation. Bush rats have a positive spatial genetic structure indicating restricted gene flow where proximate bush rats (within 500m) are more genetically similar than distant individuals (Peakall et al. 2003). This restricted gene flow is consistent across sites, age-class and sex (Peakall et al. 2003). Due to this, breeding and population establishment could be negatively affected by translocation, if bush rats are moved with unfamiliar individuals. It is expected that conserving familiar bonds (including relationships between individuals e.g. siblings) will improve the chances of translocation success (Letty et al. 2007; Kleiman 1989; Shier 2006; Armstrong 1995). Founder groups that are familiar with each other may have lower aggression and dispersal; heightened aggression and dispersal are stressful for the animal and exclude individuals from quality resources (Armstrong and Craig 1995; Armstrong 1995). Familiar groups will be able to pair quickly and thus have higher reproductive success, recruitment and survival of juveniles (Ylönen et al. 1990; Beletsky and Orians 1989; Letty et al. 2007; Armstrong and Craig 1995), thus improving overall survival and population growth (Anstee et al. 1997; Letty et al. 2007). Genetic studies can help determine if individuals are related and help researchers to maximise the success of such translocations by releasing in familiar groups.

5.1.1 Aims The aim of this chapter is to determine genetic relatedness of bush rats released into Sydney Harbour National Parks (SHNP), and to establish if spatial structure and breeding success is being influenced by genetic structure. This study will find sibships and parent-offspring relatedness to determine the following hypotheses:

1. If there is a higher incidence of sibship relatedness on site, then the survival/retention rate of bush rats will increase.

101

Chapter 5: Genetic Relatedness of Bush Rats

2. If bush rats do not display structured breeding hierarchies (where a small amount of animals produces the majority of offspring), then translocation has disrupted the breeding structure. 3. If body mass relates to breeding success, then larger bush rats will produce a greater number of offspring. 4. If relatedness influences movement and virus susceptibility, then related individuals would overlap in territory and Encephalomyocarditis virus (EMCV) would have an increased rate of occurrence.

The study will also demonstrate whether the method of grouping animals that were caught close together was an effective strategy in predicting relatedness. Also if genetic testing is a more accurate way of determining post release survival of bush rats than trapping alone.

5.2 METHODS 5.2.1 Study Species As described in chapter 2, the bush rats (Rattus fuscipes) were sourced from two populations north of Sydney in August 2011; 50 individuals (30 females and 20 males) from Ku-ring-gai Chase National Park and 50 individuals from Muogamarra Nature Reserve (over 6km between the two sites). Animals caught closest together were kept together to maintain familiar groups (Armstrong 1995). Individuals were kept in these two populations and released into four sites in SHNP. Bush rats from Ku-ring-gai Chase NP were released into Site 1 and Site 2, 15 females and 10 males in each site. Bush rats from Muogamarra NR were released into Site 3 and Site 4. Site 1 and Site 2 were geographically close to each other, as were Site 3 and Site 4, but Site 1 and 2 were not close to Site 3 and 4 as they were on opposite headlands of Sydney Harbour (see Figure 2.4). Thus, two genetic populations were analysed, Site 1 and Site 2 (S1+S2) and Site 3 and Site 4 (S3+S4). A small piece of ear tissue was taken from each individual prior to release using a 2mm biopsy punch. The tissue was kept in 70% ethanol for genetic analysis. New individuals trapped after the release of the 100 bush rats were considered offspring and ear tissue was collected and added to the pool of data for

102

Megan Callander – Translocation and Reintroduction of Native Bush Rats each population (for further details on site layout, trapping and handling methods please see Chapter 2 and 3).

5.2.2 Microsatellites Microsatellites were used to examine the genetic relationships between the bush rats. Microsatellites are short tandem repeats in DNA sequences (Maher 2009; Lindenmayer and Peakall 2000). The number of repeats is variable in populations of DNA and within the alleles of an individual (Lindenmayer and Peakall 2000). Microsatellites are highly polymorphic (hypervariable), locus- and species- specific and codominant (heterozygote), which means individuals in a population carry two different alleles at a locus (Jones et al. 2010; Karaket and Poompuang 2012; Hughes 1998; Maher 2009; Ellegren 2004). Gene flow can then be analysed with the transfer of alleles within and between populations that comes from migration and dispersal (Ellegren 2004). Microsatellites contain null alleles, have high mutation rates and can work with degraded DNA (Jones et al. 2010; Karaket and Poompuang 2012; Hughes 1998; Maher 2009). For this study, 11 microsatellite loci were chosen to determine relatedness between individual bush rats in SHNP (see Appendix Table A5.1 for microsatellite makers used). These loci were taken from studies by Peakall et al. (2006) and Peakall et al. (2003). Eleven loci is a sufficient number in determining parent-offspring pairs and full sibship from unrelated dyads (Blouin 2003). Peakall et al. (2006) selected two microsatellite loci that had been described in Peakall et al. (2003), with an additional nine loci from the public list of mapped microsatellite markers for the black rat (Rattus rattus) (Genetic Maps of the Rat Genome 2000 http://www.broadinstitute.org/rat/public/). There have been a large number of microsatellite loci developed for genetic mapping in the black rat and with cross species amplification can be used for studies in the bush rat. Peakall et al. (2006) chose the loci described here based on the criteria that the loci were all commercially available as fluorescently labeled primers; they exhibited high heterozygosity and allele numbers; and there were no more than two autosomal loci per chromosome. The loci produced amplification products of appropriate size and were polymorphic (Peakall et al. 2006). The characteristics of

103

Chapter 5: Genetic Relatedness of Bush Rats microsatellites and the selected loci make them appropriate for the genetic analysis being undertaken in this study.

5.2.3 DNA Extraction and Laboratory Procedures Ear tissue was available from 100 bush rats that were initially released into SHNP. It was also collected from 25 newly captured individuals from S1+S2 and 42 newly captured individuals from S3+S4. DNA was extracted from this ear tissue by Australian Genome Research Facility Ltd (AGRF, Adelaide, SA). After extraction, AGRF isolated and amplified the 11 microsatellite loci chosen following the PCR procedure outlined in Peakall et al. (2006), with supporting documents from Peakall et al. (2003), Gilmore and Peakall (2003) and Schuelke (2000). One primer for each locus was re-synthesised with the addition of the –21M13 (5’- TGTAAAACGACGGCCAGT) sequence at the 5’ tail for genotyping (Schuelke 2000). Each of the PCR reactions was then labeled with a different-colored fluorescent tag, which was attached to a –21M13 primer and added to the PCR reaction (Peakall et al. 2006). The length of each microsatellite was determined using capillary electrophoresis of the amplified product, which was performed by AGRF using a 3730 DNA Analyser (Applied Biosystems, California, USA). The internal size standard LIZ 1200 (Applied Biosystems) was applied to each sample. GeneMapper® Software Version 4.0 Microsatellite Analysis (Applied Biosystems) was used to sample files, size and genotype the alleles.

5.2.4 Statistical Analysis Loci characteristics were calculated using the likelihood-based software CERVUS 3.0.7 (Marshall et al. 1998; Kalinowski et al. 2007). Allele frequencies, PIC

(Polymorphic Information Content), the observed (Ho) and expected (He) heterozygosity, exclusion probabilities and estimate potential null-allele rates were all identified. GENEPOP 4.2 (Raymond and Rousset 1995) was then used to determine departure from Hardy-Weinberg equilibrium (HWE) via Fis estimates (Weir and Cockerham 1984; methodology Guo and Thompson 1992). Hardy- Weinberg exact tests were performed using Markov chain parameters for all tests and 1000 iterations per 500 batches (S.E. > 0.01). GENEPOP was also used to test for genetic linkage disequilibrium between each pair of loci using the log likelihood ratio statistic and Markov chain parameters for all tests at 1000

104

Megan Callander – Translocation and Reintroduction of Native Bush Rats iterations per 1000 batches (S.E. > 0.01). If the loci did not deviate from the HWE (p > 0.05 after Bonferroni correction), or have linkage disequilibrium (p > 0.000) and the null allele frequency was < 0.05, it was accepted as a potential microsatellite marker to determine relatedness.

Simulations were conducted in CERVUS to estimate the statistical confidence of Δ (the difference between log likelihood (LOD) scores of the two most likely candidate parents) (Marshall et al. 1998; Onorato et al. 2011). Simulation of Parentage Analysis was used with parent pair (sexes known) parameters. Offspring cycles were set to 100,000, with 0.95 proportion of candidate parents sampled. Genotyping error rate was set at 0.025 and confidence levels for ΔLOD were 80% (relaxed) and 95% (strict) (Kalinowski et al. 2007; Marshall et al. 1998; Wiszniewski et al. 2011; Wang 2004).

CERVUS was then used to assign each offspring to a parent pair, based on a pair- wise maximum likelihood approach (Jones and Wang 2010; Karaket and Poompuang 2012). Parents were defined as the 100 original released bush rats and offspring were defined as any subsequent new individuals caught at each site. Two genetic populations were analysed, S1+S2 (bush rats sourced from Ku-ring- gai Chase National Park) and S3+S4 (bush rats sourced from Muogamarra Nature Reserve). Parentage analysis (parent pair – sexes known) was used to find the most likely candidate parent (with the highest LOD score) for each bush rat offspring (Marshall et al. 1998; Kalinowski et al. 2007). Parentage was assigned when Δ was strict confidence = 95%, LOD > 0.0 and a maximum of one allele mismatched (Marshall et al. 1998). A LOD of 3.0 means that the assigned parent is around 20 times more likely than not to be the true parent (Slate at al. 2000).

COLONY 2.0.6.1 (Jones and Wang 2010; Wang and Santure 2009; Wang 2012) is a full-pedigree maximum likelihood based program that assigns parentage and sibship among individuals with multilocus genotypes (Ferrie et al. 2013). Potential full- and half-sibships among adult bush rats were examined, and family clusters with offspring were created. Polygamous Mating System was used for both male and female bush rats and a full likelihood analysis was run. COLONY gives a probability value to each result, for this study only those with a probability higher than or equal to 50% were taken into account. Visualisation of offspring-

105

Chapter 5: Genetic Relatedness of Bush Rats parent relationships was implemented with NodeXL Network Graphs (Social Media Research Foundation 2014). Microsoft Excel was used to make comparisons of siblings across sites. Regression was used to see if there was any relationship between likelihood of being a parent and initial weight. Survival probability was assessed using Kaplan Meier tests.

5.3 RESULTS 5.3.1 Genetic Diversity and Properties of Microsatellite Markers Eleven microsatellite loci were genotyped for 60 adult females, 40 adult males and 67 newly caught individuals (offspring) across the four reintroduction sites (Site 1, Site 2, Site 3 and Site 4). Out of the potential 167 tissues samples, 151 individual’s microsatellite markers amplified sufficiently for genetic analysis. In the S1+S2 genetic population, 23 females, 15 males and 25 offspring microsatellites were amplified and subsequently were able to be analysed. In the S3+S4 genetic population 27 females, 19 males and 42 offspring microsatellites were amplified and subsequently were able to be analysed.

Of 11 microsatellite loci analysed in this study, all were highly informative, with average expected heterozygosity (He) of 0.82 (for both populations), observed heterozygosity (Ho) of 0.82 and a PIC score (polymorphism information content) of 0.80. Expected heterozygosity ranged from 0.66 to 0.92 and PIC ranged from 0.60 to 0.91. All were greater than 0.5, polymorphic and informative, thus remaining in the study. The number of alleles per locus varied from 6 to 16 (mean 11.27) and 7 to 20 (mean 12.72) for populations S1+S2 and S3+S4, respectively (see Appendix Table A5.2 for genetic diversity estimates of the 11 microsatellites).

5.3.2 Sibship Assignment COLONY was used to assign sibship to 100 bush rats released in S1+S2 and S3+S4 populations. Likelihood is calculated for all possible relationships and a probability is assigned to each relationship; any pair that was not identified with a probability > 0.5 as being full siblings or half siblings was considered unrelated.

In the release groups (five bush rats per group, five groups per site) only 33% on average were actually related, although, 67.25% on average, were siblings across the whole site (across all five groups released, 25 bush rats per site). This indicates

106

Megan Callander – Translocation and Reintroduction of Native Bush Rats that the bush rats released in family groups may not have been allocated correctly but bush rats caught closer together are still more likely to be siblings (R2 = 0.66, Figure 5.1).

NumberofSiblings 10

0 0-100 101-200 201-300 301-400 401-500 501-600 601-700 701-800 801-900 901-1000 Distance Between Sibling Captures (m)

Figure 5.1. The number of siblings that were captured at the source sites (Muogamarra Nature Reserve and Ku-ring-gai Chase National Park, August 2011) and the distance (m) between their captures.

In S1+S2 population there were 38 possible sibling pairs. Within Site 1 there were 17 pairs and Site 2 had 11 possible sibling pairs. There were 10 sibling pairs that were released onto separate sites (i.e. one sibling on Site 1 and the other on Site 2). In S3+S4 population there were 44 possible sibling pairs. Within Site 3 there were 15 pairs and Site 4 had 9 possible sibling pairs. There were 20 sibling pairs that were released onto separate sites (i.e. one sibling on Site 3 and the other on Site 4). Although not significant, Site 4 has the smallest number of potential siblings followed by Site 2 (F3,19 = 0.38, p = 0.77). These two sites were also the most successful in terms of bush rats remaining on the release site and breeding.

Males and females had a similar number of related animals per site (p = 0.91). Survival over time was similar between related and unrelated individuals across all sites, log rank 휒2 = 0.09, p = 0.77 (Figure 5.2). The difference between probability of survival over time for related and unrelated males was also similar, log rank 휒2 = 0.52, p = 0.47 (Figure 5.3), and for females log rank 휒2 = 0.78, p = 0.38 (Figure 5.4).

107

Chapter 5: Genetic Relatedness of Bush Rats

1.2 Unrelated 1 Related 0.8

0.6

0.4

Survival Survival Probability 0.2

0 0 1 2 3 4 5 Time - Months after Release

Figure 5.2. Probability of survival from time released (months) for related (light grey) and unrelated (dark grey) bush rats across all four reintroduction sites.

1.2 Unrelated 1 Related 0.8

0.6

0.4

0.2 Male Survival MaleSurvival Probability 0 0 1 2 3 4 Time - Months after Release

Figure 5.3. Probability of survival from time released (months) for related (light grey) and unrelated (dark grey) male bush rats across all four reintroduction sites.

1.2 Unrelated 1 Related 0.8

0.6

0.4

0.2 Female Survival FemaleSurvival Probability 0 0 1 2 3 4 Time - Months after Release

Figure 5.4. Probability of survival from time released (months) for related (light grey) and unrelated (dark grey) female bush rats across all four reintroduction sites.

The percentage of animals remaining on each site over time was similar for both related and unrelated bush rats (Site 1: F1,11 = 0.16, p = 0.70; Site 2: F1,11 = 0.14, p

108

Megan Callander – Translocation and Reintroduction of Native Bush Rats

= 0.71; Site 3: F1,11 = 0.04, p = 0.86; Site 4: F1,11 = 1.70, p = 0.22) (Figure 5.5). After 10 months, Site 4 was the only site to have only unrelated individuals left (Figure 5.5).

80 Site 1 60 Unrelated Related 40

20 %Remaining on Site 0 1 2 4 6 8 10 Months after Release 80 Site 2 60 Unrelated Related 40

20 %Remaining on Site 0 1 2 4 6 8 10 Months after Release 80 Site 3 60 Unrelated Related 40

20 %Remaining on Site 0 1 2 4 6 8 10 Months after Release 80 Site 4 60 Unrelated Related 40

20 %Remaining on Site 0 1 2 4 6 8 10 Months after Release Figure 5.5. Percentage of related (light grey) bush rats remaining on each of the four reintroduction sites compared to unrelated (dark grey) bush rats over a ten month period after release in August 2011.

109

Chapter 5: Genetic Relatedness of Bush Rats

Out of the animals remaining on each site that also produced offspring, seven out of 13 individuals (54%) in S1+S2 populations were considered related to another individual (> 0.5 probability of sibling relationship) and in S3+S4 populations 13 out of 24 individuals (54%) were considered related to another individual (Figure 5.6, only sibling relatedness highlighted. Figure 5.8 has parent/offspring relationships highlighted).

110

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Figure 5.6. Assigned sibship and parent-offspring relationship for bush rats in S1+S2 population (A) and S3+S4 population (B). Relationships identified as full sibling and half sibling, pairs assigned if the probability of the relationship is > 0.5. Each node (adult/adult or adult/offspring) relationship is connected by an edge. Only adult sibling relationships (parents) are highlighted with colours. Groups are clustered by families – Mother and/or Father with Offspring. Colour-coded to distinguish male from female and different sites. Red = Mother in Site 1 or Site 3, Blue = Mother in Site 2 or Site 4, Orange = Father in Site 1 or Site 3, Purple = Father in Site 4, no males from Site 2 were both fathers and related to another adult. Mothers and fathers also have sites assigned to them after their number, this indicates where the adults were originally released (e.g. Father 4-S1 = father number 4 was released into Site 1). For offspring, the site indicates where the new individual was first captured (e.g. Offspring 7-S4 = offspring number 7 was first captured in Site 4). Larger circles indicate parent with a greater number of offspring. Populations are grouped in S1+S2 and S3+S4 because bush rats were from the same source population, so two related individuals may have been released on separate sites (e.g. Mother 2-S2 is related to Father 4-S1).

111

Chapter 5: Genetic Relatedness of Bush Rats

Approximately a quarter of the population (26%, Figure 5.7) was not recaptured but had offspring, so it could be assumed they survived but may have been trap shy or dispersed. Thus, trapping alone may underestimate the number of animals known to be alive.

120 % Recaptured 100 % Not Recaptured 80 With Offspring

20 Percentage ofBush Rats

0 Site 1 Site 2 Site 3 Site 4 Site

Kin sharing home ranges could not be determined as no genetically related individuals that were radio tracked (see Chapter 4) overlapped in 50% core home ranges (50% KUD establishment phase).

Relatedness was compared with virus status. Out of the 39 rats that were tested for the Encephalomyocarditis virus, 27 were related. Of the 27, eight were positive (28%). Out of the 12 rats tested that were unrelated, seven were positive (48%). The difference, however, was not significant (p = 0.37).

5.3.3 Parentage Assignment Parentage analysis in CERVUS used 37 candidate parents and 25 offspring from S1+S2 and 44 candidate parents and 42 offspring from S3+S4, which resulted in 33 and 53 positive assignments respectively. CERVUS excluded any individual that had loci amplification of three or less. The criteria for accurate assignment was Δ strict confidence (95%), pair LOD (logarithm of the likelihood ratio) score > 0, and a mismatch of loci pair ≤ 1.

112

Megan Callander – Translocation and Reintroduction of Native Bush Rats

For individuals’ assigned parentage, LOD scores ranged from 2.49-13 (mean = 6.54) for S1+S2 population and 0.97-17.3 (mean = 7.16) for S3+S4 population. Delta values (difference in LOD scores between most likely and second most likely parent) ranged from 1.93-13 (mean = 6.23) for S1+S2 population and 1.64-17.3 (mean = 7.02) for S3+S4 population. Mismatching rates, likely reflecting miss- scorings or mutations, were found to be fairly low in most cases. Mean observed mismatching was 1.05 across all loci (see Appendix Table A5.3 for parentage assignment).

Eleven (44%) parent-offspring trios were assigned at S1+S2 population and ten (40%) parent-offspring pairs, giving a total of 21 (84%) offspring positively assigned (Figure 5.8A). 19 (45%) parent-offspring trios were assigned at S3+S4 population and 12 (29%) parent-offspring pairs, giving a total of 31 (74%) offspring positively assigned (Figure 5.8B). In S1+S2 population, offspring were assigned to eight of the 23 females (five from Site 1 and three from Site 2) and five of the 14 males (four from Site 1 and one from Site 2). In S3+S4 population, offspring were assigned to fifteen of the 25 females (eight from Site 3 and seven from Site 4) and nine of the 19 males (six from Site 3 and three from Site 4). Two females from Site 1 had offspring in Site 2 and BH (Bradley’s Head trapping site is part of the Bush Rat Project and is 500m from Site 1), one male from Site 1 had offspring in BH, and one female from Site 2 had offspring in Site 1 (Figure 5.8A). Three females from Site 3 had offspring in Site 4 and NH5 (North Head 5 trapping site is part of the Bush Rat Project and is 500m from Site 3 and 4), two males from Site 3 had offspring in Site 4 and NH5, two females from Site 4 had offspring in Site 3 and two males had offspring in Site 3 (Figure 5.8B). CERVUS and COLONY had very similar assignment results, the difference being CERVUS positively assigned three additional candidate mothers for both S1+S2 and S3+S4 populations, which are included in the analysis.

There was no obvious dominant breeder (male or female that produced the majority of offspring) for any of the sites. But Site 3 did have the highest number of mothers with a single offspring (Figure 5.8). Overall 52% of mothers produced one offspring and 4% produced five offspring. 29% of fathers produced one offspring and 14% produced five offspring (Figure 5.9 and Figure 5.10).

113

Chapter 5: Genetic Relatedness of Bush Rats

Figure 5.8. Assigned parent-offspring relationship for bush rats in S1+S2 population (A) and S3+S4 population (B). Each node (adult/offspring) relationship is connected by a directional edge. Each site, parent and offspring is colour-coded and clustered by families – Mother and/or Father with Offspring. Red = Mother in Site 1 or Site 3, Blue = Mother in Site 2 or Site 4, Orange = Father in Site 1 or Site 3, Purple = Father in Site 2 or Site 4, Teal = Offspring in Site 1 or Site 3, Pink = Offspring in Site 2 or Site 4, Green = Offspring in BH or NH5. Mothers and fathers also have sites assigned to them after their number, this indicates where the adults were originally released (e.g. Mother 5-S1 = mother number 5 was released into Site 1). For offspring, the site indicates where the new individual was first captured (e.g. Offspring 3-S2 = offspring number 3 was first captured in Site 2). Bradley’s Head (BH) and North Head 5 (NH5) are two trapping grids within the 16 sites that were part of the Bush Rat Project, BH is 500m from Site 1 and NH5 is 500m from Site 3 and Site 4. Larger circles indicate parent with a greater number of offspring. Populations are grouped in S1+S2 and S3+S4 because adult bush rats may move to an adjacent site to breed (e.g. Mother 5-S1 is parent to Offspring 3-S2, each on a different site).

114

Megan Callander – Translocation and Reintroduction of Native Bush Rats

10 Mothers 9 8 Fathers 7 6 5 4 3

NumberofParents 2 1 0 1 2 3 4 5 Number of offspring

Figure 5.9. The number of parents and the corresponding number of offspring produced at S1+S2. Three out of 8 mothers (dark grey) produced one offspring each and one mother produced five offspring. Two out of five fathers (light grey) produced one offspring each and one father produced five offspring.

10 9 Mothers 8 Fathers 7 6 5 4 3

NumberofParents 2 1 0 1 2 3 4 5 Number of Offspring

Initial weight of male bush rats upon release did not significantly influence whether they bred and their offspring survived (F1,39 = 1.36, p = 0.25). However, female initial weight of mothers compared to non-mothers was closer in significance, with mother’s initial weight being slightly heavier than non-mothers

(F1,59 = 3.14, p = 0.08). There was no relationship between the number of offspring and the weight of the parent (Figure 5.11).

115

Chapter 5: Genetic Relatedness of Bush Rats

A 6 R² = 0.024 5

NumberofOffspring 1

0 70 80 90 100 110 120 130 140 Female Weight

B 6 R² = 0.003 5

NumberofOffspring 1

0 70 90 110 130 150 170 Male Weight

Figure 5.11. Relationship between the number of offspring produced and the initial weight of the mother (A) and father (B).

5.4 DISCUSSION Genetic analysis determined if degree of relatedness influenced survival, fecundity of parents, breeding structure, movement or virus status. Bush rat spatial relatedness in this study was consistent with previous studies; proximate bush rats are more genetically alike than more distant animals, with a high degree of relatedness amongst animals captured close together (Peakall et al. 2003; Macqueen et al. 2008). The number of related individuals per site was on average 68% and the closer the bush rats were caught at the source sites, the more likely they would be related. However, there was a trend indicating that the higher the number of sibling pairs the less successful the site would be, with fewer animals remaining. Site 4 had the lowest number of sibships. This site was also the most successful in terms of having the most females and offspring remaining on site at the final trapping session (see Chapter 3). However, the difference was not

116

Megan Callander – Translocation and Reintroduction of Native Bush Rats significant and the unrelated bush rats had equal chance at surviving and remaining on sites as the related individuals.

Previous studies suggests translocations work best when social groups are maintained (Letty et al. 2007). In other studies, however, familiarity among released individuals did not affect translocation success (Boonstra and Hogg 1988; Armstrong 1995; Anstee and Armstrong 2001; Letty et al. 2007). This could be due to translocation destabilising the structure of the moved familiar groups (Richard-Hansen et al. 2000; Fritts et al. 1984; Letty et al. 2007). Groups can be disrupted because translocation can lead to a high mortality rate, dispersal and influence the establishment period and breeding. There was also no difference between males and females, in terms of remaining on site. Again translocation may have broken familiar bonds between individuals as other studies have indicated that female bush rats stay in the natal area, although not in close proximity to other females, and males disperse to find mates (Woodside 1983; Lindenmayer et al. 2005; Peakall et al. 2003; Macqueen et al. 2008).

The bush rats released in SHNP were polygamous with both sexes sharing offspring with multiple partners. But there was no clear indication of a structured female or male breeding hierarchy in the populations; where a small number of animals produce the majority of offspring. Typically female bush rats are highly territorial and will exclude other females from breeding in the same area (Woodside 1983). Adult females maintain discrete spacing in all seasons and the first female to enter estrous is socially dominant and the only female to breed (Woodside 1983). The establishment of a new hierarchy after translocation may have allowed more females to breed in a closer proximity to each other. Average female home ranges in this study were larger than typically expected (0.26-0.84ha larger, see Chapter 4), and the majority of the mothers had offspring in the same release area. This indicates that the females were tolerating each other and allowing home range/breeding overlap. This could also indicate the establishment of a hierarchy with multiple females breeding at once, perhaps to be the first, most dominant breeding female (Woodside 1983). Out of the animals that bred in each population, 54% had related individuals released with them, which indicates that if there was any socially dominant breeding it was not influenced by the genetic

117

Chapter 5: Genetic Relatedness of Bush Rats structure of the population. Site 3 had the highest number of mothers with a single offspring (75% of mothers), indicating the least potential for a structured hierarchy. This site was also the least successful site in terms of having animals remaining on site to produce a second and third generation. Again, this could be due to translocation disrupting breeding structure – when the environment is not stable the animals may disperse away from the site to find other territory for breeding. Resource limitation may also result in low breeding success in rodents which can lead to low recruitment (Koskela et al. 1998; Singleton et al. 2001). Low recruitment could also be the result of low capture rates, as juveniles are often difficult to trap and juvenile survival and establishment is poor, especially with translocation (Smith et al. 1975; Holland and Bennett 2011). Further, juvenile survival can be aided through mutual familiarity which decreases antagonism (Ylönen et al. 1990).

Vertebrate social systems are not necessarily fixed. Many species are socially flexible in response to spatial or temporal variations in the environment and variation is not often attributable to any single factor (Lott 1984, 1991; Travis et al. 1995; Streatfeild et al. 2011; Schradin and Pillay 2005; Moehlman 1998; Randall et al. 2005). Many small rodent species can alter both the structure and size of their groups in response to changing demographic and ecological conditions (Lott 1991; Travis et al. 1995). For example, intraspecific variation in social mating systems may be influenced by ecological factors like environmental variability, food resources, population density and spatial distribution (Lott 1991; Lott 1984; Streatfeild et al. 2011; Schradin and Pillay 2005). The great gerbil (Rhombomys opimus) has flexible social behavior that is adaptive in desert conditions (Randall et al. 2005). Females are solitary when social behaviour is disrupted because of limited food and high mortality. Female kin will form groups and share territories when conditions for survival and reproduction are favourable. Male systems will adjust depending on the distribution of females (Randall et al. 2005). Different populations of Prairie voles (Microtus ochrogaster) can occur as single females, in pairs, or in groups of many adults of both sexes, this variation can also occur within the same population (Roberts et al. 1998; McGuire and Getz 1998; Schradin and Pillay 2005). The striped mouse (Rhabdomys pumilio) from different environments in southern Africa demonstrate differences

118

Megan Callander – Translocation and Reintroduction of Native Bush Rats in social organisation (Schradin and Pillay 2005). Striped mice in the arid succulent karoo (a desert with dwarf succulent shrubs) live in social groups made up of multiple adults of both sexes that share the same nest and territory. In the moist grasslands they are solitary and females occupy exclusive territories, while males will overlap territories of several females (Schradin and Pillay 2005). Parallels could be drawn here in comparison to the bush rat populations in this study. However, it is not known if any of the animals in this study shared nests. This information would be helpful in determining if translocation changed social structures by enhancing familiar group relationships, as nesting together is not known to be a common behaviour in bush rats (Woodside 1983; Peakall et al. 2003).

Initial weight for male bush rats was not a factor in determining if they bred and produced viable offspring or the number they produced. Females were similar as their initial weight did not influence the number of offspring they produced. There was also no obvious breeding structure, so translocation and dispersal could have influenced the reproduction hierarchy – with many females breeding to establish dominance, as the first female to breed is usually the dominant in the area (Woodside 1983).

Genetic testing is complimentary to trapping and adds data that would have otherwise been missed. Trapping alone underestimated the number of bush rats remaining by approximately 25%. Because of genetic testing we can see that both male and female bush rats dispersed after translocation. If the trapping grids were expanded further the number of bush rats known to be alive could increase. Although dispersal was not influenced by relatedness, genetic analysis did help in its detection, evidenced by the location of offspring. Bush rats released in one site had offspring in another site (indicating dispersal), or several sites (adult and/or juvenile dispersal). The majority of movement occurred in S3+S4 populations; at least five females and four males moved to other areas to breed and produce offspring. In the S1+S2 populations three females and one male dispersed to reproduce. Translocation stress may have prompted this movement, but the fact that animals began to produce offspring could indicate that they found suitable

119

Chapter 5: Genetic Relatedness of Bush Rats habitats, gained new territory and established home ranges away from potentially dominant individuals.

Genetic analysis cannot be used in isolation as not all potential parents were sampled, and not all microsatellites were amplified enough to include all adults. Complete sampling of offspring population was also not possible due to juvenile trapping success and potential survival. Most bush rat litters consist of 3-4 individuals which is a higher number than found in this study. Further, this study only consisted of one generation, because of the bush rats’ short life span more than one generation would need to be analysed to see any trends emerge. The use of more microsatellite loci could define more relationships, more than 30 loci are needed to get accurate third degree removed relationships (Ferrie et al. 2013). Additional markers would have also reduced effects of potential error (Ferrie et al. 2013) and led to more accurate conclusions.

Overall social familiarity was not necessary for bush rats to survive and stay on the release site, there was equal chance that all animals would disperse. They also displayed a polygamous social structure rather than a few animals producing the majority of young. However, translocation and variable habitat may have disrupted the typical behaviour of the bush rats. With continued observation of these populations it may have been observed that the system stabilised over time, returning to a hierarchical state. Or, if the system stayed in a polygamous non sex- biased dispersal system, this would mean bush rats have a fluid social structure that can adapt to changing environments, making it an excellent species to use in translocation. For translocation success, community dynamics, group size and composition, spacing, dispersion and territory within populations need to be understood. Genetic analysis aids in the understanding of these population structures and can be a very useful tool of conservation biology.

120

Megan Callander – Translocation and Reintroduction of Native Bush Rats

APPENDIX

Table A5.1. Eleven microsatellite loci and primer sequences (5’ – 3’) used for relatedness analysis of bush rats reintroduced into Sydney Harbour National Park.

Name Locus Forward Primer Reverse Primer C2* C2 CCTCCCACACTGCCCAAACA TGCCCTAAATTCCATCCTTAGCA D14 D14Rat75 GCACACTGCAGTGAGACAAAA TGACCCTTCAGTTGCAAATTC D15 D15Rat123 CCCCTACATCCATGGCATAC TTCCCCCTCTTGTTCTTCCT D17 D17Rat70 TGGGACCTTCTCCATTGTTC ACCAACAGCACACATGCAAG D18 D18Rat96 TGGACATCCTCAATGGACCT GCAGATCTCTCCTCCACAGC D2 D2Rat118 TGACCTAACCCAGGTGGGTA CCTCATGAGTCTCTCCCCAT D3 D3Rat80 AGGAGTGTCGACGCATTCAT TTGTTTTGTAAATTGGATGCTCA D5 D5Rat33 TGGAGAAAAGAAGAACCTCCA GTGCCCCTCAGACTGAACTC D7 D7Rat128 TTAAGGCCCTTGCAGATTT GCTTCTGGGGCACCTATACT D8 D8Rat123 ACACAGGGGAGCAGCTAGTG CTTTGAACAGAGCAGCCTGG E5* E5 CATGAAGAAGGCTCAGCAAGCA GCTAGGCTCCTCTCTAAGCACTGA

* All primers were obtained from Peakall et al. 2006, except those highlighted that were from Peakall et al. 2003. CERVUS indicated the presence of significant null allele frequencies (> 0.05) at four of the loci, C2 and D3 at S1+S2, and D18 and D2 at S3+S4 (Table A5.2). This indicates that these loci should be excluded from the analysis. However, as there was no deviation from Hardy-Weinberg equilibrium (HWE), they were included in analysis. No significant deviations from HWE were found after applying exact tests and using Bonferroni correction (p > 0.05). Tests for linkage disequilibrium demonstrated independent assortment of all 11 loci, and no disequilibrium was detected for any pairs (p < 0.000). For these reasons, all 11 loci were included in the analysis.

CERVUS also calculates the non-exclusion probability for each locus to quantify the degree of statistical confidence for those assignments (Onorato et al. 2011). The combined non-exclusion probability over 11 loci was close to zero due to high levels of polymorphism of the loci (Table A5.2). The average non-exclusion probability for each locus is the probability of not excluding a candidate parent (NE-1P), a candidate parent with a known genotype of the second parent (NE-2P) and a candidate parent pair of an offspring (NE-PP) (Karaket and Poompuang 2012).

121

Chapter 5: Genetic Relatedness of Bush Rats

S1+S2 Population

Locus NA Ho He PIC F (Null) NE-1P NE-2P NE-PP C2 6 0.638 0.794 0.757 0.1067 0.590 0.411 0.227 D14 15 0.904 0.914 0.898 0.0015 0.322 0.191 0.059 D15 12 0.889 0.881 0.862 -0.0089 0.404 0.252 0.096 D17 11 0.729 0.792 0.758 0.0391 0.582 0.403 0.213 D18 11 0.911 0.866 0.843 -0.0329 0.443 0.282 0.117 D2 9 0.830 0.859 0.834 0.0111 0.461 0.297 0.129 D3 14 0.746 0.834 0.808 0.0553 0.503 0.333 0.154 D5 11 0.733 0.753 0.724 0.0065 0.623 0.437 0.231 D7 16 0.831 0.861 0.839 0.0116 0.446 0.286 0.117 D8 12 0.882 0.828 0.801 -0.0412 0.510 0.339 0.154 E5 7 0.750 0.659 0.604 -0.0808 0.753 0.586 0.400 Mean* 11.273 0.804 0.822 0.793 0.006 4.9x10-4 5.6x10-6 1.1x10-9

S3+S4 Population

Locus NA Ho He PIC F (Null) NE-1P NE-2P NE-PP C2 8 0.765 0.784 0.747 0.0097 0.603 0.425 0.240 D14 17 0.972 0.908 0.894 -0.0377 0.330 0.197 0.062 D15 15 0.944 0.906 0.893 -0.0234 0.331 0.198 0.061 D17 12 0.829 0.758 0.730 -0.0482 0.615 0.430 0.226 D18 11 0.687 0.819 0.791 0.0876 0.531 0.358 0.175 D2 14 0.718 0.807 0.784 0.0530 0.536 0.359 0.164 D3 15 0.855 0.832 0.809 -0.0179 0.497 0.328 0.147 D5 10 0.841 0.819 0.795 -0.0172 0.523 0.348 0.162 D7 20 0.975 0.917 0.905 -0.0348 0.302 0.178 0.051 D8 11 0.853 0.881 0.862 0.0120 0.402 0.250 0.094 E5 7 0.721 0.721 0.677 -0.0046 0.688 0.509 0.318 Mean* 12.727 0.833 0.832 0.808 -0.002 2.5x10-4 2.4x10-6 2.2x10-10

NE-1P: Average non-exclusion probability for one candidate parent. NE-2P: Average non- exclusion probability for one candidate parent given the genotype of a known parent of the opposite sex. NE-PP: Average non-exclusion probability for a candidate parent pair. * Mean calculations are done for NA, Ho, He, PIC and F (Null). Non-exclusion probabilities (NE-1P, NE- 2P, NE-PP) are combined.

122

Megan Callander – Translocation and Reintroduction of Native Bush Rats

S1+S2 Population

Candidate Candidate Offspring LOD Δ MM C LOD Δ MM C Mother Father

1-S1 1-S1 8.22 8.22 0 * 1-S1 5.50 5.50 0 * 2-S1 1-S2 7.24 1.93 1 * 1-S1 -6.92 0.00 3 ◊ 3-S1 2-S1 5.87 5.87 0 * 1-S1 5.38 5.38 0 *

4-S1 1-S1 2.62 2.62 1 * 1-S1 7.95 7.95 0 * 5-S1 1-S1 -1.93 0.00 2 ◊ 2-S1 6.57 6.57 0 * 6-S1 1-S1 5.88 5.88 0 * 3-S1 5.62 3.76 0 * 7-S1 1-S1 6.21 6.21 0 * 1-S1 2.49 2.49 1 * 8-S1 1-S1 9.56 9.56 0 * 4-S1 13.0 13.0 0 * 9-S1 3-S1 10.9 10.9 0 * 2-S1 6.58 6.58 0 * 10-S1 2-S1 -6.06 0.00 3 ◊ 1-S1 3.27 3.27 0 * 11-S1 4-S1 7.50 7.50 0 * 2-S1 1.99 0.19 0 + 12-S1 2-S1 6.23 6.23 0 * 4-S1 5.18 5.18 0 *

13-S1 2-S1 6.74 6.74 0 * 4-S1 10.6 10.6 0 * 14-S1 6-S1 -5.32 0.00 2 ◊ 5-S1 -5.92 0.00 2 ◊

1-BH 3-S1 5.56 5.12 0 * 3-S2 -0.98 0.00 2 ◊ 2-BH 3-S1 10.4 10.4 0 * 2-S1 4.44 4.44 0 *

1-S2 5-S1 -2.65 0.00 2 ◊ 1-S2 -7.51 0.00 4 ◊ 2-S2 2-S2 2.77 2.72 1 * 1-S2 9.52 9.52 0 * 3-S2 5-S1 3.98 3.98 0 * 4-S2 -6.75 0.00 4 ◊ 4-S2 1-S2 9.52 7.93 0 * 4-S2 -5.2 0.00 2 ◊

5-S2 2-S2 -0.26 0.00 2 ◊ 1-S2 -2.42 0.00 3 ◊ 6-S2 2-S2 3.21 3.21 0 * 2-S2 1.19 1.19 1 + 7-S2 5-S1 -2.33 0.00 2 ◊ 4-S1 2.27 2.27 2 * 8-S2 3-S2 2.78 2.78 1 * 1-S1 -4.70 0.00 2 ◊ 9-S2 2-S2 7.60 7.60 0 * 5-S2 -9.13 0.00 4 ◊

S3+S4 Population

Candidate Candidate Offspring LOD Δ MM C LOD Δ MM C Mother Father

1-S3 1-S3 15.7 14.1 0 * 1-S3 5.26 5.26 0 * 2-S3 1-S3 17.3 17.3 0 * 2-S3 8.18 8.18 0 * 3-S3 2-S3 3.30 3.30 1 * 2-S3 8.96 8.96 0 *

123

Chapter 5: Genetic Relatedness of Bush Rats

4-S3 3-S3 11.9 11.9 0 * 3-S3 8.69 8.69 0 * 5-S3 1-S3 15.7 15.7 0 * 2-S3 6.09 6.09 0 * 6-S3 9-S3 -5.30 0.00 2 ◊ 2-S3 6.34 6.34 0 * 7-S3 9-S3 -4.42 0.00 2 ◊ 2-S3 6.64 6.64 0 * 8-S3 4-S3 6.62 5.17 1 * 1-S3 5.90 5.90 0 * 9-S3 1-S4 10.1 10.1 0 * 1-S4 8.64 8.64 0 * 10-S3 8-S4 -5.16 0.00 3 ◊ 2-S4 9.82 9.82 0 * 11-S3 5-S3 8.67 8.67 0 * 4-S3 4.13 4.13 0 * 12-S3 2-S4 14.5 14.0 0 * 1-S3 7.83 7.83 0 *

13-S3 7-S4 -0.23 0.00 2 ◊ 4-S4 -2.18 0.00 2 ◊

1-NH5 6-S3 6.92 6.92 0 * 5-S3 6.65 5.28 0 *

1-S4 3-S4 2.91 2.91 0 * 3-S4 8.53 6.45 0 * 2-S4 4-S4 4.94 4.94 1 * 2-S4 5.33 4.63 0 * 3-S4 5-S4 4.29 4.29 1 * 5-S4 -6.48 0.00 3 ◊ 4-S4 5-S4 1.84 1.84 1 * 2-S4 7.42 7.42 0 * 5-S4 6-S4 8.16 8.16 0 * 4-S4 0.97 0.00 1 ◊ 6-S4 7-S4 5.56 5.56 1 * 5-S4 -5.78 0.00 3 ◊ 7-S4 6-S4 6.23 1.64 0 * 4-S4 2.09 0.00 1 ◊

8-S4 7-S3 7.63 7.63 1 * 1-S4 9.14 9.14 0 * 9-S4 7-S4 7.83 7.83 0 * 3-S4 6.84 2.22 0 * 10-S4 4-S4 2.58 2.58 1 * 2-S4 6.51 6.51 0 * 11-S4 6-S3 -4.31 0.00 3 ◊ 1-S4 5.28 5.28 1 * 12-S4 6-S4 5.89 5.89 0 * 6-S4 -8.65 0.00 4 ◊ 13-S4 6-S3 12.7 12.7 0 * 5-S3 2.11 2.11 1 * 14-S4 8-S3 7.08 5.41 0 * 6-S3 6.6 6.60 0 * 15-S4 10-S3 -0.71 0.00 2 ◊ 6-S3 8.7 8.70 0 *

16-S4 11-S3 -4.55 0.00 2 ◊ 7-S3 0.64 0.64 2 * 17-S4 7-S4 9.21 9.21 0 * 1-S4 -1.37 0.00 2 ◊ 18-S4 4-S4 2.77 2.77 1 * 6-S4 -13.0 0.00 5 ◊ 19-S4 4-S4 4.06 4.06 1 * 3-S4 11.1 11.1 0 * 20-S4 3-S4 -5.83 0.00 3 ◊ 5-S4 -1.86 0.00 2 ◊ 21-S4 3-S4 -3.14 0.00 2 ◊ 1-S3 -2.57 0.00 2 ◊ 22-S4 5-S4 -0.43 0.00 2 ◊ 5-S4 -4.46 0.00 3 ◊ 23-S4 7-S4 1.99 1.99 2 * 6-S3 -6.54 0.00 4 ◊ 24-S4 5-S4 -1.99 0.00 2 ◊ 2-S4 -1.7 0.00 2 ◊

25-S4 11-S3 -4.53 0.00 2 ◊ 7-S4 -8.03 0.00 4 ◊ 26-S4 9-S3 -8.11 0.00 3 ◊ 1-S4 -1.42 0.00 2 ◊ 27-S4 11-S3 -4.53 0.00 2 ◊ 7-S4 -8.03 0.00 4 ◊

124

Megan Callander – Translocation and Reintroduction of Native Bush Rats

28-S4 7-S4 0.71 0.71 2 * 1-S3 -8.47 0.00 4 ◊

LOD = Pair LOD score: Log-likelihood ratio for a parent-offspring relationship between the candidate parent and the offspring. Δ = Pair Delta: If this is the most likely candidate parent its Delta score is shown, otherwise = 0. MM = Pair loci mismatching: Number of loci where the offspring and the candidate parent have no shared alleles. C = Pair confidence: For a most likely candidate parent, the confidence of parentage assignment is shown: * = Δ strict confidence (95%), + = Δ relaxed confidence (80%). If the candidate parent is not the most likely: ◊ = Δ no confidence. The criteria for positive assignment of parentage = LOD > 0, mismatch ≤ 1, and Δ strict confidence (95%).

125

CHAPTER 6: Coexistence or Competition: Avoidance Patterns of Bush Rats and Black Rats

Megan Callander – Translocation and Reintroduction of Native Bush Rats

6.1 INTRODUCTION Coexistence of potentially competing species is possible through niche differentiation and resource partitioning (Emmons 1980; Brown et al. 1994; Ferretti et al. 2015). However, with invasive or alien species, competitive exclusion of native species may occur as they have not yet had time to evolve adaptations for niche differentiation or coexistence (Ferretti et al. 2015; Gurnell et al. 2004).

Interspecific competition occurs when two species use the same, limited resource, which results in negative effects for the inferior species; like reduced reproductive success, survival, habitat availability and increased dispersal (Wauters et al. 2000; Gurnell et al. 2004; Lovari et al. 2014). Interspecific competition is usually divided into two categories: exploitation competition – use of resources, thus depriving others, and interference competition – direct impact through territorial defense or aggressive encounters (Schoener 1983; Harris and MacDonald 2007; Higgs and Fox 1993). Resources must be limited for exploitation competition to occur, but interference competition can happen even when resources are abundant (Schoener 1983; Harris and MacDonald 2007).

Competition can be used as a control mechanism for invasive species and is a widespread feature of natural resource management (Bodey et al. 2009). The Sydney Bush Rat Project was implemented to improve management of black rat (Rattus rattus) populations by developing a new pest control method; using the reintroduction of the native bush rat (Rattus fuscipes) to block their reinvasion. Previous studies have shown that densities of black rats are low in the presence of native rats and dominance depends on residency advantage (Stokes et al. 2009a, 2009b). Experimental reduction of black rat numbers resulted in significant and sustained increases in populations of bush rats from immigration, juvenile recruitment and increased residency of females (Stokes et al. 2009b). Dominance was site specific in accordance with the residency effect (Stokes et al. 2009a, 2009b, 2012).

Since its introduction in the late 1700s with European settlers, the black rat has successfully populated much of coastal (Watts and Aslin 1981; Stokes et al.

127

Chapter 6: Coexistence or Competition

2009a), suburban (Cox et al. 2000; Williams et al. 2003) and rural Australia (Downes et al. 1997; Dunstan and Fox 1996). They are found in disturbed forests, but have also been recorded in intact forests and heath (Braithwaite and Gullan 1978). Large scale black rat eradications have had mixed results, with reinvasion presenting the major challenge (Hone 2007). In Australia, declines in native biodiversity are mainly attributed to deforestation and feral predators (Burbidge and McKenzie 1989; Smith and Quin 1996). But the black rats’ movement into intact ecosystems could lead to competition, hyper-predation and displacement of native species (Stokes et al. 2009a). Successful invasion by black rats is due to characteristics such as opportunistic diet, rapid growth, early sexual maturity, high fecundity, the ability to quickly disperse and colonise, and being able to live in modified landscapes (Caughley et al. 1998). These traits may give them a competitive advantage over native fauna (Braithwaite et al. 1978; Stokes et al. 2009a). However, invasive species could be hampered by the presence of native competitors because of biotic resistance; an important characteristic that allows native communities to resist invasive species. Species rich environments are more resistant to predation, competition, parasitism, disease and aggression (Elton 1958: cited in Kennedy et al. 2002).

Black rats and bush rats overlap in their omnivorous diet of invertebrates, fungi, seeds, fruit and vegetation (Watts and Braithwaite 1978). Both species are normally seasonal breeders, but will breed throughout the year when conditions and resources are favourable (Banks and Dickman 2000; Harris and Macdonald 2007; Stokes et al. 2009b). Both species have a preference for complex habitat structure (Braithwaite and Gullan 1978; Cox et al. 2000). Thus bush rats are a potential competitor of the black rat (Braithwaite et al. 1978; Stokes et al. 2009a). However, in this study bush rats will not have residency advantage and will have the increased stress of translocation into a new environment. Further, black rats will already be occupying the potential bush rat niche.

Translocation is often unsuccessful (Griffith et al. 1989). The amount and type of habitat in which animals are released is a critical factor for translocation success (Dickens et al. 2010; Wolf et al. 1996). Habitat effects food availability and competition with resident species, both of which can induce stress for the released

128

Megan Callander – Translocation and Reintroduction of Native Bush Rats animal (Dickens et al. 2010; Linklater and Swaisgood 2008). Microhabitat can be a source of coexistence or competition in small mammals (Price and Kramer 1984). Competition may encourage differential use of habitat components such as bushes, trees or open spaces (Price 1978; Dickman 1988; Maitz and Dickman 2001). Spatial segregation may be maintained through interspecific territoriality or resource and/or space partitioning (Bowers et al. 1987; Monamy and Fox 1999; Schoener 1974; Ferretti et al. 2015), or a shift in temporal activity patterns (Ziv et al. 1993; Harris et al. 2006). Because of the behavioural overlap in bush and black rats these could be the deciding factors on bush rat translocation success.

6.1.1 Aims The general aim of this chapter is to determine if invasive black rats influence the success of reintroduced bush rats. Specifically, whether the persistence of bush rats was correlated with the number of black rats. In view of this, the hypotheses would be:

1. If the number of either species is negatively affected and both species do not occupy the same space, then there is competition and spatial segregation occurring (trap level association). If there is no effect, then it will be expected that spatial and resource partitioning is occurring and they are living in coexistence.

2. If numbers are instead associated with site carrying capacity, then the number of individuals (one or both species) will be limited to the original number of black rats removed from each site.

6.2 METHODS Prior to the bush rat release the four reintroduction sites were intensively trapped to reduce black rat numbers. The black rat population would pose as competition for resources if the numbers were not reduced. Black rats were removed one week prior to release with intensive trapping over ten nights (Table 6.1). Live-trapping was used to remove black rats, which were euthanized with a lethal injection of 0.5mL of sodium pentobarbitone (Lethabarb, Virbac, Australia) into the intra- peritoneal space (Stokes et al. 2009b). A total of 26 black rats were removed from Site 1, 14 from Site 2, 38 from Site 3 and 21 from Site 4 (Table 6.1).

129

Chapter 6: Coexistence or Competition

Day of Black Rat Removal

SITE Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 Day 7 Day 8 Day 9 Day 10 TOTAL Site 1 16 5 2 1 0 0 0 1 1 0 26 Site 2 6 6 1 0 0 0 0 0 0 1 14 Site 3 12 10 4 2 2 2 2 0 3 1 38 Site 4 10 5 5 0 0 0 0 0 1 0 21

The bush rats were released at higher density than is usual for normal wild populations (25 animals instead of 10 per hectare); to account for high predation and mortality due to establishing territory, dispersal and genetic variation. The density was also similar to the previous black rat population found at the sites, this will support the residency advantage theory (Stokes et al. 2009a, 2009b). Capture-mark-recapture trapping sessions were conducted one month after release in September 2011, and every two months thereafter for eight sessions. A ninth trapping session was performed 18 months later in May 2014. Trapping occurred over three consecutive nights at each site for each trap session. To capture both black rats and bush rats Elliott traps and wire cage traps were set at each of the 36 trap stations on 1ha grids; each trap station approximately 20m apart, with each grid line approximately 20m apart (two traps at 36 trap points in four sites over three nights created 864 potential trap nights per trap session – see Chapter 2 for further trapping details). Elliott traps were primarily for bush rats and cage traps for black rats. Black rats were captured in cage traps for the majority of the trap period (September 2011 to May 2014), whereas bush rats showed no preference for either trap type (Table 6.2). Both species were very rarely caught at the same trap station at the same time, i.e. one species in an Elliott trap the other in a cage trap (Table 6.2). Elliott traps were baited with peanut butter, honey and oats, and cage traps had jam sandwiches. Captured rats were identified, weighed, sexed and had their nasal-occipital head length measured. The reproductive status and condition of the animal was also noted (see Chapter 2 for more details on identification). Black rats and juvenile bush rats that were

130

Megan Callander – Translocation and Reintroduction of Native Bush Rats captured were marked with individual ear-clipping patterns using a 2mm biopsy punch and micro-chipped for identification.

Both BUSH RATS (%) BLACK RATS (%) Species SITE Elliott Traps Cage Traps Elliott Traps Cage Traps Detected Site 1 45 55 10 90 12 Site 2 40 60 5 95 2 Site 3 50 50 2 98 16 Site 4 46 54 21 79 15

6.2.1 Statistical Analysis The trapping sessions identified whether a bush rat, black rat or both were occupying a particular space within the trapping grids of Site 1, Site 2, Site 3 and Site 4. Total number comparisons were made for black rats and bush rats over the entire trapping period (September 2011 to May 2014) to determine if one species influenced the other. General linear models were used to show whether there was a positive or negative relationship between the number of black rats and bush rats. Black rats and time were set as continuous variables and site was set as a random factor. Whether an animal occupied a trap or not was analysed with occupancy modelling to determine if there was any overlap in space and therefore interaction between species. Kernel Utilisation Distribution (KUD) was used to determine the most frequented area of the trapping grid for both species and to show any overlap of the two.

6.2.1.1 Occupancy Modelling Occupancy modelling is an important tool in monitoring and management of wildlife programs (MacKenzie et al. 2003). It can estimate the proportion of sites occupied by a target species and draw inferences about species ranges, habitat associations and multi-species interactions. (MacKenzie et al. 2003, 2006; Bailey et al. 2014; Hines et al. 2014).

131

Chapter 6: Coexistence or Competition

A site occupancy matrix was made up for each species and each site, with either ‘1’ (species was detected – occupied a trap) or ‘0’ (not detected – no animal was trapped). This data was recorded for each trap (72 traps over four sites) and trap sampling period (three days) over eight trapping periods or seasons for both black and bush rats. The program PRESENCE 10.0 (Hines 2006) was used to analyse the data with a multi-season, two-species occupancy model (MacKenzie et al. 2004, 2006). Maximum likelihood estimates were obtained for occupancy and detection probabilities for both black rats and bush rats and to assess whether the presence of one species influenced the occurrence or detection of the other (MacKenzie et al. 2004, 2006). Each site was modelled separately to focus on the difference in estimated parameters within each study site and not between sites (Lazenby et al. 2014).

The Akaike Information Criterion (AIC) was used to rank models; a small AIC value indicates a greater model likelihood, and the difference between models was evaluated using ΔAIC, where models with values ≤ 2 are considered to be the most parsimonious, have strong support and are good descriptors of the data (Burnham and Anderson 2002). Three alternative parameterizations can be used in PRESENCE for multi-season, two-species occupancy model (MacKenzie et al. 2006). The first alternative (phi/delta parameterization) was used in this study as it is conceptually the simplest alternative; the probability of occurrence for each animal is not dependent on the other and instead has species co-occurrence or species interaction factor (SIF) (Lazenby et al. 2014). The second and third parameterizations, however, assume one of the species is dominant (Steen et al. 2014). For this study either species could be dominant due to the potential of residency advantage. Parameterization one consists of the parameters found in Appendix Table A6.1.

If the Occupancy Species Interaction Factor (SIF or ϕ) is less than one, it would indicate that two species co-occur less frequently than if they were distributed independently, suggesting possible avoidance or exclusion. While ϕ greater than one indicates a tendency for species to co-occur more frequently than expected, suggesting a positive association. If ϕ is equal to one, then the species occupy the sites independently (MacKenzie et al. 2006). If the Detection SIF or δ is less than

132

Megan Callander – Translocation and Reintroduction of Native Bush Rats one, it would indicate that it is less likely to detect both species in a survey than if the species were detected independently, again suggesting avoidance. While δ greater than one suggests that it is more likely to detect both species during a survey (MacKenzie et al. 2006). The logit link function is used for all parameters except the interaction factors (ϕ and δ) where the log link function is used instead as these parameters are not bounded between 0 and 1 (Bailey et al. 2009; MacKenzie et al. 2004, 2006).

The objective of this study was to explore the co-occurrence and detection of two species of Rattus – native bush rat and invasive black rat. Specifically, whether the species co-occurred independently or if there was evidence of competitive exclusion (ϕ < 1). Whether one species had a higher detection than the other (pA > pB or pA < pB), and whether the detection process was independent (δ ≈ 1) or one species influenced the probability of detecting the other (δ ≠ 1). It also examined whether the presence of one species influenced the detection of the other (rA < pA or rB < pB). To achieve this, models were set beginning with the global model of ѱ(season)p(season)γ(season)ε(season); probability of site occupancy, detection, colonisation and extinction varied with season (session). Then the most constrained model of ѱ(.)p(.)γ(.)ε(.); site occupancy, probability of detection, colonisation and extinction are not effected by time or other covariates but instead are constant. These models were then varied by species, season and constant parameters. The models were kept very simple so the comparison could be made primarily between the two species site occupancy and detection within sites between successive trapping sessions. Models can also incorporate covariates such as habitat. However, because sites were modelled separately in this study and the models were kept as simple as possible, covariates were not used.

6.2.1.2 Trapping Pattern and Overlap Kernel Utilisation Distribution (KUD) was performed using the software program ZoaTrack (Dwyer et al. 2015). Calculations are undertaken within R using the adehabitatHR library of functions (Calenge 2006). Location data points for each individual were used to calculate and map where both bush rats and black rats were most likely to be trapped. The fixed kernel density estimator is a method of

133

Chapter 6: Coexistence or Competition

home-range analysis, which uses the utilisation distribution (UD) to estimate the probability that an animal will be found at a specific geographical location (Dwyer et al. 2015).

This study used the ad hoc method algorithm for a bivariate normal kernel for the h estimator, ellipse boundaries 20% and 50% kernels, a grid size of 300, with a variable h. The home range was not being represented, only the area black rats and bush rats were most trapped and the overlap of the two. Thus, 20% and 50% core areas were used for the ellipse boundary. These core areas represent the areas that were used more frequently than other parts of the trapping grid. Polygons were used to find the total area of the KUD and the percentage of overlap.

6.3 RESULTS 6.3.1 Interspecific Competition A total of 26 black rats were removed from Site 1, 14 from Site 2, 38 from Site 3 and 21 from Site 4. 25 bush rats were released into each of these sites (Figure 6.1). The number of black rats caught over the three year period was 46 in Site 1 (32 males and 14 females), 68 in Site 2 (37 males, 28 females and 3 unknown), 76 in Site 3 (49 males, 24 females and 3 unknown) and 69 in Site 4 (36 males and 33 females). Bush rat numbers were significantly lower (F1,7 = 9.6, p = 0.02) with Site 1 having 32 rats (15 males and 17 females), 24 in Site 2 (13 males, 10 females and 1 unknown), 33 in Site 3 (23 males and 10 females) and 55 in Site 4 (32 males, 20 females and 3 unknown). After black rats were removed and bush rats were released into each site, bush rat numbers were highest in the first three sessions (September to December 2011, Figure 6.1). However, after one year the black rat numbers had increased and bush rats declined (Figure 6.1). By the end of the trapping period (May 2014), both species had decreased, even in comparison to June 2012, the start of winter (Figure 6.1). Neither species regained their initial numbers. Although, in Site 2 and Site 4 total rat numbers remaining for October 2012 were close to the initial black rat numbers removed in August 2011 (Figure 6.1). Suggesting a specific carrying capacity for these two sites.

134

Megan Callander – Translocation and Reintroduction of Native Bush Rats

60 50 Site 1 40 Bush Rats 30 Black Rats 20 10 0

60 50 Site 3 40 Bush Rats 30 Black Rats 20 10 0

Release / Session 1 Session 2 Session 3 Session 4 Session 5 Session 6 Session 7 Session 8 No Session 9 NumberofIndividuals Removal September October December February April June August October Trapping May August 2011 2012 2013 2014 60 50 Site 4 40 Bush Rats 30 Black Rats 20 10 0

NumberofIndividuals Release / Session 1 Session 2 Session 3 Session 4 Session 5 Session 6 Session 7 Session 8 No Session 9 Removal September October December February April June August October Trapping May August 2011 2012 2013 2014 Trap Session and Period (Month and Year) Figure 6.1. Number of black rats (light grey) removed from the four reintroduction sites and bush rats (dark grey) released into the four reintroduction sites compared to total number of black rats and bush rats captured over the entire trapping period (9 sessions, September 2011 to May 2014, n = 864 per session). Black rats were removed in August 2011 and bush rats were reintroduced one week after removal.

135

Chapter 6: Coexistence or Competition

Site 4 had the greatest number of black rats that possibly dispersed in comparison to the bush rats that dispersed (caught only once) (Figure 6.2A). Site 3 had the highest number of possible black rat residents (caught multiple times) (Figure 6.2B).

A. Dispersers 0-1 B. Residents > 1 60 60 Bush Rats Bush Rats 50 Black Rats 50 Black Rats 40 40

30 30

20 20

10 10 Number ofIndividual Rats Number ofIndividual Rats 0 0 Site 1 Site 2 Site 3 Site 4 Site 1 Site 2 Site 3 Site 4 Site Site

Adults dominated all sites throughout the trapping sessions with low levels of juvenile recruitment for both bush rats and black rats. Juvenile recruitment occurred in summer as expected and in winter and spring. Adults (especially black rats) were more abundant when competition for resources would be at its peak. The number of black rats did not have a significant (positive or negative) relationship with the number of bush rats, F = 0.12, df = 1, p = 0.73. However, time (F = 23.71, df = 1, p < 0.00) and site (F = 3.96, df = 3, p = 0.02), did have a significant relationship with bush rat numbers.

6.3.2 Occupancy Models Multi-season, two-species models comparing occupancy and detection probabilities of black rats and bush rats at four reintroduction sites are shown in Appendix Table A6.2. In the most parsimonious model for Site 1 detection probability is dependent on season: ѱ(.)p(s), for Site 2 occupancy probability is dependent on season: ѱ(s)p(.), in Site 3 and Site 4 occupancy and detection are dependent on season: ѱ(s)p(s). All other parameters are constant (.). The outputs

136

Megan Callander – Translocation and Reintroduction of Native Bush Rats for the most parsimonious models (ΔAIC ≤ 2) for each site are shown in Appendix Table A6.3 and Appendix Table A6.4.

Bush rats had a higher probability of trap occupancy compared to black rats (ѱA < ѱB – A represents black rats and B represents bush rats), ѱB was close to if not equal to one for all models (Appendix Table A6.3). The rate of co-occurrence (ϕ) or species interaction factor, was greater than one for Site 1 (1.12 ± 0.39), Site 2 (1.06 ± 0.13) and Site 3 (3.83 ± 1.70) models. This indicates that bush rats and black rats were living in co-occurrence (they were likely to occur at the site regardless if the other species was also there). Site 4 was less than one (0.95 ± 0.24), which means there is possible avoidance or competitive exclusion. Although, both Site 2 and Site 4 were fairly close to one so more likely indicates the animals were independent (neither species had influence over the other).

Detection of bush rats and black rats in Site 1, Site 3 and Site 4 were constant (pA = pB = rA = rB) which indicates that detection of both species is independent (Appendix Table A6.4). The numbers did, however change over time which indicates the time of trapping did have an effect on detection but only slightly.

In Site 2 detection was constant over time but varied between species. In model 1, black rats were detected more often than bush rats (pA > pB, 0.37 ± 0.05 > 0.01 ± 0.03) but black rats were detected less in the presence of bush rats (rA < pA, 0.08 ± 0.02 < 0.37 ± 0.05), Bush rat detection was not affected by black rat presence (rB > pB, 0.32 ± 0.06 > 0.01 ± 0.03) (see Appendix Table A6.4).

Over all sites detection co-occurrence (δ) was below one (Site 1: 0.45 ± 0.11, Site 2: 0.33 ± 0.22, Site 3: 0.53 ± 0.12, Site 4: 0.42 ± 0.09) (Appendix Table A6.4). In other words, detection of each species is affected by the other and there is some indication of avoidance.

6.3.3 Trapping Pattern and Overlap Two traps (Elliott or cage) were set at each of the 36 trap stations within the four reintroduction sites. Both black rats and bush rats were captured. In all of the sites the trapping patterns for bush rats and black rats at least partially overlapped (Figure 6.3, 6.4, 6.5, 6.6). Site 3 had the least amount of overlapping space between the species (Figure 6.5A), with bush rats only having 7.98% of its trapping area

137

Chapter 6: Coexistence or Competition

shared with the black rat (Table 6.3). In three of the four sites black rats’ occupied a greater percentage of bush rat space, compared to the area bush rats occupied in black rat space, although not significantly (Site 1, F1,3 = 3.39, p = 0.21; Site 2, F1,3

= 5.09, p = 0.15; Site 3, F1,3 = 0.02, p = 0.89). Site 4 bush rats occupied a greater percentage of black rat space, again not significantly (F1,3 = 0.07, p = 0.81). This also gave the bush rats occupancy of 83.92% of the black rats’ space, the largest overlapped space (Figure 6.6 and Table 6.3). Size comparison of black rat and bush rat trapping areas (ha) did not show significant difference (F1,7 = 1.23, p = 0.29).

A B

138

Megan Callander – Translocation and Reintroduction of Native Bush Rats

A B

139

Chapter 6: Coexistence or Competition

A B

Table 6.3. Percentage of overlap for black rats and bush rats in the four reintroduction sites within 20% KUD and 50% KUD.

20% KUD 50% KUD SITE Black Rat % Bush Rat % Black Rat % Bush Rat % Site 1 22.07 < 50.69 42.10 < 82.06 Site 2 26.11 < 44.36 37.92 < 53.84 Site 3 6.86 < 7.98 56.55 < 67.20 Site 4 55.59 > 52.38 83.92 > 76.96

Black rat % = the percentage of black rat space the bush rats and black rats shared. Bush rat % = the percentage of bush rat space the bush rats and black rats shared. < = less than, > = greater than.

6.4 DISCUSSION After the removal of black rats and the reintroduction of bush rats, over all sites bush rat numbers were significantly lower than black rat numbers. However, there was no significant relationship between the persistence of bush rats and the number of black rats. Neither species regained their initial numbers from spring 2011 (number of black rats removed or number of bush rats released), but after one year, with the combined numbers of both species, two of the sites (Site 2 and

140

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Site 4) had numbers close to the total number of black rats removed. Although black rat numbers did not have an influence on bush rat numbers, time and site were significant to the bush rat survival. This was recognised in a study showing bush rats recover to site-specific population densities after experimental removal (Lindenmayer et al. 2005). Both species in the Site 1 and Site 3 had less than half of the initial populations remaining, this could be a reaction to the environment rather than each other. These two sites had significantly less quadrant cover than Site 4 (see Chapter 3), and systems such as weather, would likely impact the habitat and ecosystem. A stochastic event may have altered these two sites initial carrying capacity and thus both bush and black rat populations were reduced. There were no controls used (e.g. black rat removal with no bush rat reintroduction) so it cannot be certain if external systems had an effect.

Bush rats and black rats did, however, occupy the same space. Black rats occupied a larger area and thus shared less of their space with bush rats (i.e. bush rats shared more of their space with black rats). Site 3 had the least amount of space overlap, but the difference in space size between bush rats and black rats was non- significant. Neither species had influence over the other’s occurrence. Site 1 and Site 3 populations were living in co-occurrence, meaning that both the bush rat and black rat would be at these sites regardless of the other species presence. Site 2 and Site 4 populations were co-occurring independently, meaning neither species had influence over the other species occurrence. Bush rats were more likely to occupy traps than black rats, and the detection of one species was affected by the other. This shows some indication of avoidance, meaning both species are occupying the same area but are temporally segregated, not being detected at the same trap station after the other species was present.

Bush rats are ‘trap happy’ and have increased capture probability after first capture (Free and Leung 2008). Studies have also demonstrated that same trap, successive bush rat captures are more often conspecifics than other species. This is attributed to odours that assist the bush rat in detecting conspecific competitors, enabling the establishment of micro-scale spatial segregation (Woodside 1983; Dickman and Woodside 1983; Cunningham et al. 2005; Lindenmayer et al. 2005). This may explain why the bush rats were more likely to

141

Chapter 6: Coexistence or Competition

occupy traps than black rats. The black rats may also recognise the bush rat odour, choosing not to remain at the trap station. Olfactory communication is often used to assess competition and avoid inter- and intraspecific aggressive encounters (Maitz and Dickman 2001; Heavener et al. 2014). Black rats have been shown to investigate bush rat odour, although bush rats are naïve to the black rat odour (Heavener et al. 2014). Traps were not washed after capture of an animal during trap sessions, only between trap sessions. Black rats may be avoiding the traps altogether because of bush rat odour. However, it has been demonstrated that odour is not the only mechanism for spatial separation and that direct interactions are also involved between the two species (Stokes et al. 2009b). Symmetrical, interference competition has been shown during bush and black rat interactions, with dominance shifting to the bush rats once the black rats were removed (Stokes et al. 2009b). In this study the dominance did not shift completely to bush rats once black rats were removed. There was spatial avoidance, but bush rat numbers did not increase past black rat numbers. In previous studies competitive dominance between two similar sympatric rodents was shown to be site-specific and not species-specific. Resident animals defending their territory win a higher number of encounters than the intruder (Wolff et al. 1983). Interspecific competition is best demonstrated when one species is experimentally excluded from an area and in response the other species increases in abundance or use of resources (Brown 1987: cited in Harper et al. 2005). When removal of black rats took place, it was unlikely that every black rat was removed, and they were also not removed from the immediate surrounding areas. Resident individuals may have still existed and returned to the sites before bush rats were released. In this study black rats were only removed from a 1ha grid for 10 days before the bush rats were reintroduced. Consequently there may not have been enough black rats removed from the system, or they were not removed over a long enough time period, or perhaps more black rats from the surrounding area quickly filled the vacuum. If black rats were experimentally removed again and the bush rats were already established in the area, this could show an increase in population, and would be a clear indication of interspecific competition.

142

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Even with strong competition, if the area is spatially and/or temporally heterogeneous, it could still support species coexistence (Hutchinson 1961: cited in Harris et al. 2006). Bush rats and black rats overlapped in space (living in co- occurrence or independently) but were not detected at the same time (some indication of avoidance). This could mean the two species are coexisting and partitioning microhabitat. Habitat and resource partitioning are complementary mechanisms for interspecific coexistence. Different species of rodents in the same habitat, with similar life history traits, will partition resources spatially and temporally in order to coexist (Gause 1934; Grant 1972). There are different mechanisms for partitioning; species can use resources at different times (Kotler et al. 1993), they can forage different food sizes or densities (Ziv et al. 1995) or they can divide habitat into microhabitats (Higgs and Fox 1993; Seamon and Adler 1996). Partitioning is often dependent on the species vulnerability to predators and ability to use and defend a resource compared to another species’ ability (Morris et al. 2000; Harper et al. 2005). Black rats, when compared to Pacific and Norway rats (Rattus norvegicus) in New Zealand, were the most generalist, abundant and pervasive species, and were found in all vegetation types (Harper et al. 2005). Black rats preferred structural complexity, like forests (Braithwaite and Gullan 1978; Cox et al. 2000; King et al. 1996), but did not vary with the amount of forest litter or canopy height (Harper et al. 2005). In Sydney, black rats preferred forest over scrub, heath, or more open urban habitats; which had a more complex and dense understorey (Cox et al. 2000; Banks and Hughes 2012). Black rats have been shown to nest in trees and tree-ferns when sympatric with Pacific rats (Rattus exulans) that would nest below ground (Lindsey et al. 1999). Data on the tree use of either species was not collected for this study, this may have been a variable that allowed the two species to partition microhabitat. Bush rats rarely climb (Peakall and Lindenmayer 2006; Wood 1971) so the black rats could be utilising this space.

With the potential influence of other species, competition between conspecifics, predator abundance, food availability or habitat preferences, the models used here are a considerable simplification of the real system, but there is still evidence of interspecific avoidance and thus possible competition. Bush rats and black rats were occupying the same area but avoiding spaces where the other was previously

143

Chapter 6: Coexistence or Competition

detected. Meaning that there may have been initial interference competition which resulted in coexistence through microhabitat partitioning, but only if the site had adequate resources to support both species. However, this competition was not the limiting factor for bush rat occupancy. There was lower occupancy of black rats after the bush rat introduction, but bush rat numbers remained low so they did not gain residency advantage in the sites. Other factors, like colonisation ability, still need to be considered to discover all of the mechanisms behind the resulting population structures.

Competition can be a big part of translocation failure or success. Thus, understanding community dynamics and how species interact will also help in determining population viability. Further, if translocation of competitive native species could also be used as a form of biological control, then this technique may reduce invasive species numbers and in turn help maintain healthy ecosystem function.

144

Megan Callander – Translocation and Reintroduction of Native Bush Rats

APPENDIX

Table A6.1. Parameters for multi-season, two-species occupancy model in PRESENCE 10.0.

PARAMETER DESCRIPTION

Probability that the area is occupied by species A, regardless of occupancy PsiA or ψA status of species B.

Probability that the area is occupied by species B, regardless of occupancy PsiB or ψB status of species A.

Species co-occurrence, whether two species co-occur independently at survey sites - Species Interaction Factor (SIF). Defined by the equation: Phi or ϕ ψAB/(ψA*ψB Where ψAB = probability that area is occupied by both species.

pA Probability of detecting species A, given species B is not present.

pB Probability of detecting species B, given species A is not present.

rA Probability of detecting species A, given both species are present.

rB Probability of detecting species B, given both species are present.

Species co-detection, whether two species are detected independently at survey sites -Detection Species Interaction Factor. Defined by the equation: Delta or δ rAB/(rA*rB Where rAB = probability of detecting both species, given both are present.

Gamma or γ Probability that an unoccupied site becomes occupied - colonisation.

Probability that the area is colonised by species A in the interval, t,t+1, given γAB species B is present in survey t.

Probability that the area is colonised by species A in the interval, t,t+1, given γAb species B is not present in survey t.

Probability that the area is colonised by species B in the interval, t,t+1, given γBAA species A is present in survey t and persists in the interval, t,t+1.

Probability that the area is colonised by species B in the interval, t,t+1, given γBAa species A is present in survey t and species A goes extinct in the interval, t,t+1.

Probability that the area is colonised by species B in the interval, t,t+1, given γBaA species A is not present in survey t and species A colonises in the interval, t,t+1.

145

Chapter 6: Coexistence or Competition

Probability that the area is colonised by species B in the interval, t,t+1, given γBaa species A is not present in survey t and species A does not colonise in the interval, t,t+1.

Epsilon or ε Probability that an occupied site becomes unoccupied - local extinction.

Probability that the area goes extinct by species A in the interval, t,t+1, given εAB species B is present in survey t.

Probability that the area goes extinct by species A in the interval, t,t+1, given εAb species B is not present in survey t.

Probability that the area goes extinct by species B in the interval, t,t+1, given εBAA species A is present in survey t and species A persists in the interval, t,t+1.

Probability that the area goes extinct by species B in the interval, t,t+1, given εBAa species A is present in survey t and species A goes extinct in the interval, t,t+1.

Probability that the area goes extinct by species B in the interval, t,t+1, given εBaA species A is not present in survey t and species A goes extinct in the interval, t,t+1.

Probability that the area goes extinct by species B in the interval, t,t+1, given εBaa species A is not present in survey t and species A does not colonise in the interval, t,t+1.

(MacKenzie et al. 2004, 2006)

146

Megan Callander – Translocation and Reintroduction of Native Bush Rats

AIC Model Model AIC ΔQAIC Parameter -2*LogLike Weight Likelihood Site 1 ѱ(.) p(s) γ(.) ε(.) 1089.66 0.00 0.6417 1.0000 13 1063.66 ѱ(s) p(s) γ(.) ε(.) 1091.22 1.56 0.2942 0.4584 13 1065.22 ѱ(s) p(.) γ(.) ε(.) 1095.71 6.05 0.0312 0.0486 10 1075.71 ѱ(.) p(.) γ(.) ε(s) 1102.17 12.51 0.0012 0.0019 51 1000.17 ѱ(s) p(.) γ(s) ε(.) 1105.08 15.42 0.0003 0.0004 51 1003.08 ѱ(.) p(.) γ(s) ε(.) 1106.38 16.72 0.0002 0.0002 51 1004.38 Site 2 ѱ(s) p(.) γ(.) ε(.) 1047.53 0.00 0.3738 1.0000 10 1027.53 ѱ(s) p(.) γ(s) ε(.) 1048.37 0.84 0.2456 0.6570 51 946.370 ѱ(.) p(s) γ(.) ε(.) 1057.24 9.71 0.0029 0.0078 13 1031.24 ѱ(s) p(.) γ(.) ε(s) 1059.38 11.85 0.0010 0.0027 51 957.380 ѱ(.) p(.) γ(.) ε(s) 1065.53 18.00 0 0.0001 51 963.530 ѱ(.) p(.) γ(s) ε(.) 1073.18 25.65 0 0 51 971.180 Site 3 ѱ(s) p(s) γ(s) ε(.) 1443.63 0.00 0.5141 1.0000 54 1335.63 ѱ(.) p(s) γ(s) ε(.) 1443.78 0.15 0.4769 0.9277 54 1335.78 ѱ(.) p(.) γ(s) ε(s) 1454.02 10.39 0.0029 0.0055 92 1270.02 ѱ(s) p(s) γ(s) ε(s) 1454.92 11.29 0.0018 0.0035 95 1264.92 ѱ(.) p(s) γ(s) ε(s) 1456.01 12.38 0.0011 0.0020 95 1266.01 ѱ(.) p(s) γ(.) ε(.) 1460.39 16.76 0.0001 0.0002 13 1434.39 Site 4 ѱ(s) p(s) γ(.) ε(.) 1528.46 0.00 0.4994 1.0000 13 1502.46 ѱ(s) p(.) γ(.) ε(.) 1541.99 13.53 0.0006 0.0012 10 1521.99 ѱ(.) p(.) γ(.) ε(s) 1558.13 29.67 0 0 51 1456.13 ѱ(s) p(.) γ(s) ε(.) 1560.00 31.54 0 0 51 1458.00 ѱ(s) p(s) γ(.) ε(s) 1563.98 35.52 0 0 54 1455.98 ѱ(s) p(s) γ(s) ε(.) 1564.61 36.15 0 0 54 1456.61 Factors in the models (s) = occupancy, detection, colonisation or extinction varies with trapping session, (.) = constant occupancy, detection, colonisation or extinction (i.e. not affected by time). For each model Delta Akaike information criterion terms (ΔQAIC) represent the difference in AIC between model 1 and subsequent models. Parameter is the number of estimated parameters in the model. The number of parameters and the -2*LogLike (twice the negative log-likelihood) were used to calculate likelihood ratio tests for comparing the fit of models.

147

Chapter 6: Coexistence or Competition

Table A6.3. Model outputs from multi-season, two-species occupancy models for bush rats and black rats in four reintroduction sites. Output describing occupancy (ѱ), co-occurrence (ϕ), colonisation (γ) and extinction (ε) probabilities with standard errors (SE). ‘A’ represents black rat, ‘B’ represents bush rat. Outputs are shown for models that were within two ΔAIC of the most supported model.

SITE 1 MODEL 1: ѱ(.) p(s) γ(.) ε(.) ѱ A SE ѱ B SE Φ SE γ SE ε SE 0.11 0.07 0.80 0.11 1.12 0.39 γ AB 0.15 0.03 ε AB 0.30 0.05 γ Ab 0.15 0.03 ε Ab 0.30 0.05 γ BAA 0.15 0.03 ε BAA 0.30 0.05 γ BAa 0.15 0.03 ε BAa 0.30 0.05 γ BaA 0.15 0.03 ε BaA 0.30 0.05 γ Baa 0.15 0.03 ε Baa 0.30 0.05 SITE 1 MODEL 2: ѱ(s) p(s) γ(.) ε(.) ѱ A SE ѱ B SE ϕ SE γ SE ε SE 0.19 0.10 1.00 0.00 2.26 1.59 γ AB 0.10 0.03 ε AB 0.26 0.05 γ Ab 0.10 0.03 ε Ab 0.26 0.05 γ BAA 0.10 0.03 ε BAA 0.26 0.05 γ BAa 0.10 0.03 ε BAa 0.26 0.05 γ BaA 0.10 0.03 ε BaA 0.26 0.05 γ Baa 0.10 0.03 ε Baa 0.26 0.05 SITE 2 MODEL 1: ѱ(s) p(.) γ(.) ε(.) ѱ A SE ѱ B SE ϕ SE γ SE ε SE 0.62 0.13 1.00 0.00 1.06 0.13 γ AB 0.31 0.06 ε AB 0.42 0.07 γ Ab 0.31 0.06 ε Ab 0.42 0.07 γ BAA 0.31 0.06 ε BAA 0.42 0.07 γ BAa 0.31 0.06 ε BAa 0.42 0.07 γ BaA 0.31 0.06 ε BaA 0.42 0.07 γ Baa 0.31 0.06 ε Baa 0.42 0.07 SITE 2 MODEL 2: ѱ(s) p(.) γ(s) ε(.) ѱ A SE ѱ B SE ϕ SE γ SE ε SE 0.13 0.00 0.99 0.00 7.78 0.00 γ AB 0.42 0.11 ε AB 0.62 0.06 γ Ab 0.29 0.09 ε Ab 0.62 0.06 γ BAA 0.46 0.20 ε BAA 0.62 0.06 γ BAa 0.20 0.15 ε BAa 0.62 0.06 γ BaA 0.35 0.03 ε BaA 0.62 0.06 γ Baa 0.05 0.05 ε Baa 0.62 0.06

148

Megan Callander – Translocation and Reintroduction of Native Bush Rats

SITE 3 MODEL 1: ѱ(s) p(s) γ(s) ε(.) ѱ A SE ѱ B SE ϕ SE γ SE ε SE 0.00 0.00 1.00 0.00 3.83 1.70 γ AB 0.47 0.10 ε AB 0.40 0.04 γ Ab 0.47 0.20 ε Ab 0.40 0.04 γ BAA 0.43 0.00 ε BAA 0.40 0.04 γ BAa 0.39 78.86 ε BAa 0.40 0.04 γ BaA 0.14 0.00 ε BaA 0.40 0.04 γ Baa 0.35 14.48 ε Baa 0.40 0.04 SITE 3 MODEL 2: ѱ(.) p(s) γ(s) ε(.) ѱ A SE ѱ B SE ϕ SE γ SE ε SE 0.00 0.00 1.00 0.00 3.83 3.67 γ AB 0.50 1.04 ε AB 0.40 0.04 γ Ab 0.47 0.19 ε Ab 0.40 0.04 γ BAA 0.43 0.00 ε BAA 0.40 0.04 γ BAa 0.43 2.82 ε BAa 0.40 0.04 γ BaA 0.14 0.00 ε BaA 0.40 0.04 γ Baa 0.35 0.51 ε Baa 0.40 0.04 SITE 4 MODEL 1: ѱ(s) p(s) γ(.) ε(.) ѱ A SE ѱ B SE ϕ SE γ SE ε SE 0.23 0.09 0.82 0.10 0.95 0.24 γ AB 0.35 0.05 ε AB 0.26 0.06 γ Ab 0.35 0.05 ε Ab 0.26 0.06 γ BAA 0.35 0.05 ε BAA 0.26 0.06 γ BAa 0.35 0.05 ε BAa 0.26 0.06 γ BaA 0.35 0.05 ε BaA 0.26 0.06 γ Baa 0.35 0.05 ε Baa 0.26 0.06

See Table A6.1 for parameter descriptions for γ and ε for multi-season, two-species occupancy model.

149

Chapter 6: Coexistence or Competition

SITE 1 Model 1: ѱ(.) p(s) γ(.) ε(.) s p A SE p B SE r A SE r B SE δ SE 1 0.33 0.05 0.33 0.05 0.33 0.05 0.33 0.05 0.49 0.12 2 0.28 0.05 0.28 0.05 0.28 0.05 0.28 0.05 0.39 0.10 3 0.47 0.04 0.47 0.04 0.47 0.04 0.47 0.04 0.89 0.15 4 0.36 0.06 0.36 0.06 0.36 0.06 0.36 0.06 0.56 0.15 5 0.45 0.05 0.45 0.05 0.45 0.05 0.45 0.05 0.83 0.18 6 0.07 0.03 0.07 0.03 0.07 0.03 0.07 0.03 0.08 0.04 7 0.32 0.08 0.32 0.08 0.32 0.08 0.32 0.08 0.46 0.18 8 0.06 0.03 0.06 0.03 0.06 0.03 0.06 0.03 0.06 0.03 SITE 1 Model 2: ѱ(s) p(s) γ(.) ε(.) s p A SE p B SE r A SE r B SE δ SE 1 0.24 0.04 0.24 0.04 0.24 0.04 0.24 0.04 0.31 0.06 2 0.22 0.04 0.22 0.04 0.22 0.04 0.22 0.04 0.29 0.07 3 0.47 0.04 0.47 0.04 0.47 0.04 0.47 0.04 0.88 0.15 4 0.35 0.06 0.35 0.06 0.35 0.06 0.35 0.06 0.54 0.13 5 0.45 0.05 0.45 0.05 0.45 0.05 0.45 0.05 0.82 0.18 6 0.08 0.03 0.08 0.03 0.08 0.03 0.08 0.03 0.08 0.04 7 0.33 0.08 0.33 0.08 0.33 0.08 0.33 0.08 0.50 0.19 8 0.06 0.03 0.06 0.03 0.06 0.03 0.06 0.03 0.07 0.04 SITE 2 Model 1: ѱ(s) p(.) γ(.) ε(.) s p A SE p B SE r A SE r B SE δ SE 1 0.37 0.05 0.01 0.03 0.08 0.02 0.32 0.06 0.32 0.22 2 0.37 0.05 0.01 0.03 0.08 0.02 0.32 0.06 0.32 0.22 3 0.37 0.05 0.01 0.03 0.08 0.02 0.32 0.06 0.32 0.22 4 0.37 0.05 0.01 0.03 0.08 0.02 0.32 0.06 0.32 0.22 5 0.37 0.05 0.01 0.03 0.08 0.02 0.32 0.06 0.32 0.22 6 0.37 0.05 0.01 0.03 0.08 0.02 0.32 0.06 0.32 0.22 7 0.37 0.05 0.01 0.03 0.08 0.02 0.32 0.06 0.32 0.22 8 0.37 0.05 0.01 0.03 0.08 0.02 0.32 0.06 0.32 0.22 SITE 2 Model 2: ѱ(s) p(.) γ(s) ε(.) s p A SE p B SE r A SE r B SE δ SE 1 0.44 0.04 0.50 0.08 0.11 0.03 0.31 0.04 0.33 0.22

150

Megan Callander – Translocation and Reintroduction of Native Bush Rats

2 0.44 0.04 0.50 0.08 0.11 0.03 0.31 0.04 0.33 0.22 3 0.44 0.04 0.50 0.08 0.11 0.03 0.31 0.04 0.33 0.22 4 0.44 0.04 0.50 0.08 0.11 0.03 0.31 0.04 0.33 0.22 5 0.44 0.04 0.50 0.08 0.11 0.03 0.31 0.04 0.33 0.22 6 0.44 0.04 0.50 0.08 0.11 0.03 0.31 0.04 0.33 0.22 7 0.44 0.04 0.50 0.08 0.11 0.03 0.31 0.04 0.33 0.22 8 0.44 0.04 0.50 0.08 0.11 0.03 0.31 0.04 0.33 0.22 SITE 3 Model 1: ѱ(s) p(s) γ(s) ε(.) s p A SE p B SE r A SE r B SE δ SE 1 0.29 0.04 0.29 0.04 0.29 0.04 0.29 0.04 0.41 0.08 2 0.40 0.04 0.40 0.04 0.40 0.04 0.40 0.04 0.66 0.11 3 0.40 0.04 0.40 0.04 0.40 0.04 0.40 0.04 0.66 0.11 4 0.35 0.05 0.35 0.05 0.35 0.05 0.35 0.05 0.54 0.12 5 0.34 0.07 0.34 0.07 0.34 0.07 0.34 0.07 0.52 0.16 6 0.44 0.06 0.44 0.06 0.44 0.06 0.44 0.06 0.77 0.20 7 0.40 0.06 0.40 0.06 0.40 0.06 0.40 0.06 0.66 0.17 8 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 SITE 3 Model 2: ѱ(.) p(s) γ(s) ε(.) s p A SE p B SE r A SE r B SE δ SE 1 0.29 0.04 0.29 0.04 0.29 0.04 0.29 0.04 0.41 0.08 2 0.40 0.04 0.40 0.04 0.40 0.04 0.40 0.04 0.66 0.11 3 0.40 0.04 0.40 0.04 0.40 0.04 0.40 0.04 0.66 0.11 4 0.35 0.05 0.35 0.05 0.35 0.05 0.35 0.05 0.54 0.12 5 0.34 0.07 0.34 0.07 0.34 0.07 0.34 0.07 0.51 0.16 6 0.42 0.06 0.42 0.06 0.42 0.06 0.42 0.06 0.74 0.17 7 0.40 0.06 0.40 0.06 0.40 0.06 0.40 0.06 0.67 0.17 8 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 SITE 4 Model 1: ѱ(s) p(s) γ(.) ε(.) s p A SE p B SE r A SE r B SE δ SE 1 0.30 0.05 0.30 0.05 0.30 0.05 0.30 0.05 0.43 0.10 2 0.34 0.04 0.34 0.04 0.34 0.04 0.34 0.04 0.53 0.10 3 0.43 0.04 0.43 0.04 0.43 0.04 0.43 0.04 0.76 0.11 4 0.27 0.05 0.27 0.05 0.27 0.05 0.27 0.05 0.38 0.09 5 0.16 0.04 0.16 0.04 0.16 0.04 0.16 0.04 0.19 0.05 6 0.31 0.05 0.31 0.05 0.31 0.05 0.31 0.05 0.45 0.11 7 0.31 0.05 0.31 0.05 0.31 0.05 0.31 0.05 0.45 0.11 8 0.14 0.03 0.14 0.03 0.14 0.03 0.14 0.03 0.17 0.05

151

CHAPTER 7: Translocation and Wildlife Restoration: Returning Ecosystem Function

Megan Callander – Translocation and Reintroduction of Native Bush Rats

7.1 TRANSLOCATION CRITERIA AND SUCCESS With increasing habitat loss, fragmentation, urbanisation and introduced species comes the loss of ecosystem viability and function (Griffith et al. 1989; Watson and Watson 2015). Adding to the pressure is rapid climate change, possibly the most significant threat, changing ecosystems too quickly for natural repair (King 2004). Due to these factors, restoration of ecosystems and free-ranging populations cannot be achieved through natural dispersal and recruitment alone, thus, translocation is an increasingly used tool for conservation management of wild populations (Tear et al. 1993; Griffith et al. 1989; Ricketts and Imhoff 2003; Vitousek et al. 1997; Sutton 2015; Seddon 2010).

Reintroduction is relatively new within the broader context of conservation and has only become a commonly used scientific tool within the past 40 years, as such, there are no definitive guidelines for best practice (Sarrazin and Barbault 1996; Seddon et al. 2007; Robert et al. 2015). Wildlife translocations and reintroductions are complex, expensive, and time-consuming, often meaning that many of them fail to establish viable populations (Griffith et al. 1989; Dodd and Seigel 1991; Clark and Westrum 1989; Kleiman 1989; Seddon et al. 2007; Short et al. 1992; Short 2009; Gibson et al. 1994; Moseby et al. 2011). The low success rate has been attributed to inadequate knowledge of species-specific behaviour, poor release site selection, environmental pressures, predation, competition and stress (Dickens et al. 2010; Short 2009; Moseby et al. 2011; Sutton 2015; Griffith et al. 1989).

Monitoring populations after reintroduction is important to identify the success or potential causes for failure, to adapt and improve management strategies (Mihoub et al. 2011; Griffith et al. 1989; Kleiman 1989; IUCN 1998; Fischer and Lindenmayer 2000; Ewen and Armstrong 2007; Seddon et al. 2007; Armstrong and Seddon 2008; Sheean et al. 2012). Ideally, successful translocation is indicated by the ability of the translocated, or augmented population, to become self- sustaining, free-ranging and viable in the long term (Griffith et al. 1989; Fischer and Lindenmayer 2000; IUCN 1998). More specifically, common criteria that are used to assess stages of successful translocation include: 1. Survival and growth of individuals: i.e. a defined proportion of released individuals would increase in

153

Chapter 7: Translocation and Wildlife Restoration

body size or body condition. Meaning that there is suitable habitat and suggesting that stress for the translocated animal is minimal (Miller et al. 2014). 2. Evidence of reproduction: i.e. verifying the detection of recruits in the translocated population (Sarrazin and Barbault 1996; Seddon 1999). Meaning that animals are able to reach breeding condition, find mates, and find suitable nesting sites (Miller et al. 2014). 3. Population growth: i.e. capturing more animals than were initially released (including founders) in a defined monitoring period. Meaning that there is evidence of breeding by second or third generation animals (IUCN 1998; Moseby et al. 2011; Miller et al. 2014). 4. Viable population: i.e. consistently high number of individuals caught in each monitoring period (more than released), and juvenile animals regularly observed. Meaning that population size is stable and recruitment is successful; the population is persisting without intervention (Seddon 1999; Wolf et al. 1998; Moseby et al. 2011).

7.1.1 Key Findings The Bush Rat Project was the first study to reintroduce a native species into Sydney Harbour National Parks (SHNP) in an attempt to restore the ecosystem and reduce invasive species populations. Three main elements that may influence the reintroduction process were examined; properties of the individuals, behaviour/social structure, and competition. To assess these elements and the success of bush rat translocation the following were examined: population dynamics and survival, movement behaviour and establishment, population genetics, and biological control of an invasive species via competition.

Success of translocation in this study can be shown through site fidelity, body condition, habitat suitability and reproduction. In the initial stages (within the first year), populations of bush rats had established on all sites and juvenile recruitment occurred, indicating survival, growth and evidence of reproduction. Over the entire study period bush rats persisted in three of the four sites but the remaining numbers were low (less than the numbers released), thus maintaining a viable, self-sustaining population would be difficult. Although animals remained after three or four generations (2011 to 2014) long-term persistence could be affected by major environmental change or demographic stochasticity if populations remain small (Short 2009). It has been shown that residual bush rats

154

Megan Callander – Translocation and Reintroduction of Native Bush Rats in habitat fragments, even a small population, are usually the ones to recover and re-establish populations following extinction rather than by immigration (Holland and Bennett 2010; Lindenmayer et al. 2005; Banks et al. 2016). This means that with the removal of limiting factors even small numbers of bush rats establishing on sites could be enough to create a population (Greene et al. 2016). Because there was no original population in SHNP the study relied on population growth of translocated bush rats, and due to translocation pressures did not create a viable population.

Genetic analysis was complimentary to trapping, adding data that would have otherwise been missed. It helped detect bush rats that were not trapped and had dispersed after translocation, as they had produced offspring in other locations. The verification of subsequent generations being recruited allowed confirmation of successful breeding, rather than trapped individuals potentially coming from immigration. Bush rat spatial relatedness in this study was consistent with previous studies; proximate bush rats are more genetically alike than more distant animals, with high degree of relatedness amongst animals captured close together. That is, the closer the bush rats were caught at the source sites, the more likely it was that they would be related. Translocation of intact social groups has also been shown to increase success rates of reintroductions in some instances (Shier and Owings 2006; Bennett et al. 2012). However, social familiarity was not necessary for bush rats to survive and stay on the release site, there was equal chance that all animals would disperse.

There was some indication that sex influenced site success. Sites that retained and recruited more females persisted for longer. Females will sustain the population in the release area even if the males disperse. Site 4 was considered the most successful site, it also retained the most females and produced the highest number of offspring, 29% of which were female. Female establishment is a critical component of demographic viability of small populations. Reintroduction studies that have a small proportion of females fail in 50 to 80% of cases (Mihoub et al. 2011).

Site fidelity can be seen as an indicator of successful translocation (Sullivan et al. 2004; Bertolero and Oro 2009; Griffith et al. 1989; Miller et al. 1999). Bush rat

155

Chapter 7: Translocation and Wildlife Restoration

movement was greater when compared to earlier research, indicating site fidelity was affected by translocation (Peakall et al. 2006; Wood 1971; Banks et al. 2011b). Animals were dispersing extensive distances, resulting in poor juvenile recruitment and population growth on release sites. It is most likely a flight response due to the stress of being released into an unfamiliar environment. Low densities of conspecifics will also lead to larger ranges because of difficulty in ﬁnding suitable mates in low density populations (Stephens et al. 1999; Mihoub et al. 2011; Bosé et al. 2007). However, the smaller the establishment phase, the less likely the bush rat would survive after three months. This seems contradictory to previous findings (Daly et al. 1990; Metzgar 1967; Norrdahl and Korpimäki 1998; Letty et al. 2000), but it could mean that the animals that moved further and more often were more likely to survive. Instead of reducing predation exposure, limited movement may increase risks due to the accumulation of odorous wastes that are attractants for potential predators (Banks et al. 2002; Banks et al. 2000). Bush rats were unfamiliar with the area, therefore unfamiliar with predators, competition and resources. Survival rate may have improved over time due to increased juvenile local experience, such as safe sources of food and escape routes from predators (Banks et al. 2002; Russell et al. 2010; Sakai and Noon 1997; Bakker 2006; Bright and Morris 1994; Russell et al. 2010). Site 3 females moved the greatest distances, this could indicate that resources in the site were insufficient. Territory separation was unlikely because breeding success was relatively low. However, Banks et al. (2016) found that dispersal of females increased during recovery of a population after fire, contrasting with the usual male-biased dispersal. This behavioural adaptation can potentially increase recovery rates of small populations, making bush rats an excellent species for translocation.

Another indicator of successful translocation is the ability of translocated animals to find mates and reproduce (Berry 1986; Pedrono and Sarovy 2000; Griffith et al. 1989; Wolf et al. 1996; Nussear et al. 2012). The bush rats released in SHNP were polygamous with both sexes sharing offspring with multiple partners. But there was no clear indication of a structured female or male breeding hierarchy in the populations; where a small number of animals produce the majority of offspring. This is unusual for bush rats (Woodside 1983), however, translocation and dispersal could have influenced the structured hierarchy. The establishment of a

156

Megan Callander – Translocation and Reintroduction of Native Bush Rats new hierarchy after translocation may have allowed more females to breed in a closer proximity to each other. Average female home ranges in this study were larger than what is typically expected, and the majority of the mothers had offspring in the same release area. This indicates that the females were tolerating each other and allowing home range/breeding overlap. This could also indicate the re-establishment of a hierarchy with multiple females breeding at once, as the first female to breed is usually the dominant in the area (Woodside 1983). Vertebrate social systems are not necessarily fixed. Many species are socially flexible in response to spatial or temporal variations in the environment and is not often attributable to any single factor (Lott 1984, 1991; Travis et al. 1995; Streatfeild et al. 2011; Schradin and Pillay 2005; Moehlman 1998; Randall et al. 2005). With continued observation of these populations it may have been observed that the system stabilised overtime, returning to a hierarchical state. Or, if the system stayed in a polygamous non sex-biased dispersal system, this would mean bush rats have a fluid social structure that can adapt to changing environments. This type of adaptation could increase chances of translocation success, making it an ideal species for studies into translocation.

Body condition of released individuals is also used as an indicator of translocation success (Bertolero and Oro 2009; Pinter-Wollman et al. 2009). Site 4 had the most animals with low body condition and significantly lower average body weight, but it also had the greatest site fidelity and recruitment. Male bush rats with high BCI are potentially in good breeding condition, which would also mean they would disperse to look for mates and territory, in turn reducing numbers of animals remaining on site. Further, older, heavier and possibly more dominant individuals could be negatively affected by handling and translocation. There was no indication of stress reducing bush rat immunity (virus detection did not affect survival), but acute stress has been shown to impact socially dominant individuals (Letty et al. 2000). Therefore, translocation fitness could be negatively correlated with previous social ranking and age (Creel et al. 1996; Letty et al. 2000). Another consideration is that bush rats usually have a lifespan of 12 to 15 months and larger individuals may be at the end of their lifespan (Warneke 1971; Wood 1971). It has been found that younger Beach Mice (Peromyscus polionotus trissyllepsis) had higher survival rate than their older counterparts after reintroduction

157

Chapter 7: Translocation and Wildlife Restoration

(Greene et al. 2016). Thus, it could be beneficial to choose younger individuals for the translocation process. These factors make weight a difficult but important element to consider. This suggests that before translocation researchers need to look at species-specific behaviours that are linked to weight and body condition, for example dominance, territoriality and breeding age.

Competition is an important element in the success of translocation. If translocated animals are encountering exploitation or interference competition, the chance of survival could be significantly diminished (Richards and Short 2003; Short et al. 1992; Schoener 1983; Glen and Dickman 2005; Sih et al. 1985). If resources are separated, competition theory predicts two competing species can coexist, if there is no separation and the two species are within the same ecological niche, competitive exclusion predicts one species will exclude or eliminate the other (Gause 1934; Hardin 1960). The findings of this study indicate interspecific avoidance, meaning both species (bush rats and black rats) are temporally segregated; occupying the same area but avoiding spaces where the other was previously detected. Meaning the two species are coexisting and partitioning microhabitat. Bush rats were more likely to occupy traps than black rats, and the detection of one species was affected by the other. Habitat and resource partitioning are complementary mechanisms for interspecific coexistence; but only if the site has adequate resources to support both species. In previous studies competitive dominance between two similar sympatric rodents was shown to be site-specific and not species-specific. Even with strong competition, if the area is spatially and/or temporally heterogeneous, it could still support species coexistence (Hutchinson 1961: cited in Harris et al. 2006). Different species of rodents in the same habitat, with similar life history traits, will partition resources spatially and temporally in order to coexist. There was lower occupancy of black rats after the bush rat introduction, however, bush rat numbers remained low so they did not take up residency in the sites. Other factors, like colonisation ability, still need to be considered to discover all of the mechanisms behind the resulting population structures. Greater numbers of bush rats may be needed for adequate competition, thus, future reintroductions to replenish resident bush rat populations could help translocation success and invasive species control.

158

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Habitat suitability and use is very important in determining translocation success (Rittenhouse et al. 2008; Griffith et al. 1989; Wolf et al. 1996; Richards and Short 2003). Species considered for reintroduction may lack their original habitat types or lack unaltered habitat (e.g. due to human land use), it is essential for successful reintroductions to find suitable environments that can meet a species’ habitat requirements (Schmitz et al. 2015). Bush rats favour areas with dense, structurally diverse vegetation and high litter cover (Watts and Aslin 1981; Holland and Bennett 2010; Kraaijeveld-Smit et al. 2007; Moro 1991). This was supported in this study, as there were positive correlations between habitat complexity and bush rat numbers. Quadrant cover (QC), canopy height, soil moisture, leaf litter depth and plant ground cover were all important to bush rat survival. Whereas, bare ground coverage had a negative relationship with bush rat occupancy. Quadrant cover would increase chances of survival for bush rats unfamiliar with the area, as it is the degree of concealment that microhabitats provide from visual predators or competition (Glen et al. 2010).

Site 4 was comparatively the most successful site – with the highest recapture rate, juvenile recruitment, resident individuals and females (both adult and juveniles. It was also the site with significantly lower BCI (<1) and significantly higher Quadrant Cover (QC). These two qualities could be considered as important for a successful translocation, but because the population declined over time further support is required. Larger studies with continued monitoring need to be implemented to help in evaluating future success of the populations. Trapping in larger areas (outside of trapping grids) and extending the radio tracking period may have shown bush rat persistence and whether the effect of the translocation is limited to a certain time period after release. Continued monitoring may have indicated whether bush rats are able to adapt to a changing environment and be flexible with social structure to regain population density. Further genetic testing could also lead to a better understanding of social structures and mating systems. Continued removal of black rats from the system may allow bush rats to establish territories, increasing population densities and possibly indicating whether interspecific competition is a viable option for the control of invasive species in SHNP. The sites in this study are too new, therefore more introductions to stabilise population would assist bush rat persistence if changes in the environment occur.

159

Chapter 7: Translocation and Wildlife Restoration

This is supported by other studies that have shown that repeated releases of large numbers of individuals were generally required to successfully establish a translocated population and create a self-sustaining ecosystem where minimal intervention is required (Veit and Lewis 1996; Dolev et al. 2002; Mihoub et al. 2011; Moseby et al. 2011; Griffith et al. 1989; Wolf et al. 1996).

7.2 CONSERVATION OF COMMON SPECIES Ecosystem restoration assumes that with repair of habitat structure and increase of resource availability, animals will progressively return (Palmer et al. 1997). This is true for more mobile species in less fragmented landscapes (Huxel and Hastings 1999), but many animals are either unable or unwilling to cross highly fragmented systems created by urbanisation and development (Craig et al. 2012; Vergnes et al. 2013). Translocations and reintroductions are useful tools to recover these dispersal-limited animals.

Traditionally, ecological restoration has sought to return ecosystems to pre- disturbance states (Hobbs and Cramer 2008). Restoration ecologists are now starting to manage ecosystem function, focusing on establishing characteristics for a resilient system (Hobbs et al. 2006; Harris et al. 2006; Seastedt et al. 2008) to enable persistence of viable self-sustaining populations in future environments (Choi 2007; Seddon 2010). All species interact with other species both directly and indirectly, through mechanisms such as predation, competition, mutualism, facilitation and herbivory. The outcomes of such interactions are among the major factors that shape ecological communities and in turn create ecosystem function (Hunter et al. 2015).

The restoration of ecosystem functions and processes has recently been discussed as rewilding (Louys et al. 2014; Donlan 2005). Rewilding is a form of conservation that involves reintroducing or returning species or populations to their historical range (areas where they became extinct in recent history, hundreds of years ago or less) (Louys et al. 2014; Donlan 2005). This active management and reintroduction of species has become more common; leading to species assemblages functioning independently, without further interference (Ritchie 2013; Louys et al. 2014; Donlan 2005; Fortin et al. 2005). Wildlife restoration is

160

Megan Callander – Translocation and Reintroduction of Native Bush Rats another form of conservation that has been suggested by Watson and Watson (2015). Wildlife restoration complements the concept of rewilding, but instead of using large, keystone species, it uses locally abundant, common species that are dispersal-limited and may help restore ecosystem function. Translocation for conservation purposes is often targeted at rare or endangered species (Armstrong and Seddon 2008; Watson and Watson 2015). Wildlife restoration relies on information gleaned from translocations of rare or endangered animals and applies it to free living individuals of common species. Common species are disproportionately important in ecosystem structure and function (Gaston 2010). Thus, declines in their abundance and distribution can lead to loss of less common species and ecosystem function (Watson and Watson 2015). Wildlife restoration and thus ecosystem function can be restored to ecosystems that are biodiversity poor or have a high element of invasive species. Wildlife restoration increases the functional diversity of remnant habitats, making them more resistant to invasion (Atkinson 1996; Courchamp et al. 2003; Watson and Watson 2015). As well as being far more cost-effective than reactive management in reversing declines, this proactive approach also helps to determine underlying mechanisms that are required for successful translocation, thus, producing best practice for the reintroduction of rarer species (Bright and Morris 1994; Watson and Watson 2015).

Bush rat reintroduction into SHNP uses the wildlife restoration concept to reintroduce a common species to restore ecosystem function, increase biodiversity and attempt to control invasive species. Bush rats are good candidates for translocation and reintroduction, because they are adaptable and not endangered, therefore can be safely used for multiple reintroductions (Watts and Aslin 1981; Peakall and Lindenmayer 2006). Bush rats existed in SNHP as recently as 100 years ago (Banks et al. 2011a) and have conspecifics close by in comparable habitats (Cox et al. 2000). They can be sourced from original sites and usually display a rapid population recovery (Lindenmayer et al. 2005; Watts and Aslin 1981; Peakall and Lindenmayer 2006). Therefore bush rat characteristics make them ideal for investigating translocation, colonisation, recovery and competition, within a fragmented habitat (Lindenmayer et al. 2005; Holland and Bennett 2011).

161

Chapter 7: Translocation and Wildlife Restoration

The decline of native species in SHNP was chiefly due to anthropogenic effects and urbanisation (DEWHA 2009). Other possible reasons include intraspecific competition, resource availability, predation and disease (DEWHA 2009). Allowing the reintroduction of native species could make SHNP an independently functioning ecosystem (Fortin et al. 2005; Ripple et al. 2001; Louys et al. 2014). If native species are given the chance to re-establish, biodiversity within the area would increase and invading species would be less capable of returning to the site (Stokes et al. 2009b; Stokes et al. 2012), restoring ecosystem function (Fortin et al. 2005; Ripple et al. 2001; Hunter et al. 2015).

Reintroducing strongly interactive species helps reduce the effects of invasive species or fills niches that are dominated by suites of invasive species (Hunter et al. 2015). Bush rats will replace a demographically similar (but potentially more destructive) species, black rats (Watts and Braithwaite 1978; Braithwaite and Gullan 1978; Cox et al. 2000). Black rats that are known to negatively impact native species and can impede the restoration of ecosystem functions (Atkinson 1996; Courchamp et al. 2003; Banks and Hughes 2012; Blackburn et al. 2004; Jones et al. 2008; DSEWPC 2011). By returning bush rats, functional diversity and ecosystem service provision could be augmented, thereby reducing the likelihood of colonisation by invasive species (Watson and Watson 2015). Wildlife restoration via bush rats creates a situation in which less resources need to be invested in ecological management, as the environment will eventually be capable of self-maintenance. Thus, creating a self-sustaining ecosystem that does not require further interventions. By reintroducing locally-extirpated animals into modified landscapes, wildlife restoration is a proactive approach that will maintain biodiversity, ecosystem function and avoid future species decline.

162

REFERENCES

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Adams, L.W., Hadidian, J. and Flyger, V., 2004. Movement and mortality of translocated urban-suburban grey squirrels. Animal Welfare, 13: 45-50.

Akaike, H., 1974. A new look at the statistical model identification. IEEE Transactions on Automatic Control, 19 (6): 716-723.

Alexander, R.D., 1974. The evolution of social behaviour. Annual Review of Ecology and Systematics, 5: 325-383.

Amarasekare, P., 1994. Ecology of Introduced Small Mammals on Western Mauna Kea, Hawaii. Journal of Mammalogy, 75 (1): 24-38.

Anstee, S. and Armstrong, K., 2001. The effect of familiarity and mound condition in translocations of the western pebble-mound mouse, Pseudomys chapmani, in the Pilbara region of Western Australia. Wildlife Research, 28: 135-140.

Anstee, S.D., Roberts, J.D. and O’Shea, J.E., 1997. Social Structure and Patterns of Movement of the Western Pebble-mound Mouse, Pseudomys chapmani, at Marandoo, Western Australia. Wildlife Research, 24: 295-305.

Aplin, K.P., Brown, P.R., Jacob, J., Krebs, C.J. and Singleton, G.R., 2003. Field Methods for Rodent Studies in Asia and the Indo-Pacific. Australian Centre for International Agricultural Research: Canberra.

Armstrong, D.P., 1995. Effects of familiarity on the outcome of translocations, II: A test using New Zealand robins. Biological Conservation, 71: 281-288.

Armstrong, D.P. and Craig, J.L., 1995. Effects of familiarity on the outcome of translocations, I: A test using saddlebacks Philesturnus caruncatulatus rufusater. Biological Conservation, 71: 133-141.

Armstrong, D.P. and Ewen, J.G., 2000. Estimating impacts of poison operations using mark-recapture analysis and population viability analysis: an example with New Zealand robins (Petroica australis). New Zealand Journal of Ecology, 25: 29- 38.

Armstrong, D.P. and Seddon, P.J., 2008. Directions in reintroduction biology. Trends in Ecology and Evolution, 23: 20-25.

164

References

Armstrong, D.P., Castro, I., Alley, J.C., Feenstra, B., Perrott, J.K., 1999. Mortality and behaviour of hihi, an endangered New Zealand honeyeater, in the establishment phase following translocation. Biological Conservation, 89 (3): 329-339.

Ashley, M.V., Caballero, I.C., Chaovalitwongse, W., Dasgupta, B., Govindan, P., Sheikh, S.I. and Berger-Wolf, T.Y., 2009. KINALYZER, a computer program for reconstructing sibling groups. Molecular Ecology Resources, 9: 1127-1131.

Atkinson, I.A., 1996. Introductions of wildlife as a cause of species extinctions. Wildlife Biology, 2: 135-141.

Attum, O. and Cutshall, C.D, 2015. Movement of translocated turtles according to translocation method and habitat structure. Restoration Ecology, 23 (5): 588- 594.

Bailey, L.L., Reid, J.A., Forsman, E.D. and Nichols, J.D., 2009. Modeling co- occurrence of northern spotted and barred owls: Accounting for detection probability differences. Biological Conservation, 142: 2983-2989.

Bailey, L.L., MacKenzie, D.I. and Nichols, J.D., 2014. Advances and applications of occupancy models. Methods in Ecology and Evolution, 5 (12): 1269-1279.

Bajomi, B., Pullin, A.S., Stewart, G.B. and Takács-Sánta, A., 2010. Bias and dispersal in the animal reintroduction literature. Oryx, 44: 358-365.

Bakker, V.J., 2006. Microhabitat Features Influence the Movements of Red Squirrels (Tamiasciurus hudsonicus) on Unfamiliar Ground. Journal of Mammalogy, 87: 124-130.

Banks, P.B. and Dickman, C.R., 2000. Effects of winter food supplementation on reproduction, body mass, and numbers of small mammals in montane Australia. Canadian Journal of Zoology, 78: 1775-1783.

Banks, P.B. and Hughes, N.K., 2012. A review of the evidence for potential impacts of black rats (Rattus rattus) on wildlife and humans in Australia. Wildlife Research, 39: 78-88.

165

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Banks, P. and Smith, H., 2015. The ecological impacts of commensal species: black rats, Rattus rattus, at the urban-bushland interface. Wildlife Research, 42 (2): 86-97.

Banks, P.B., Norrdahl, K., Korpimäki, E., 2000. Nonlinearity in the predation risk of prey mobility. Proceedings of the Royal Society of London B, 267: 1621-1625.

Banks, P.B., Norrdahl, K., Korpimäki, E., 2002. Mobility decisions and the predation risks of reintroduction. Biological Conservation, 103: 133-138.

Banks, P.B., Cleary, G.P. and Dickman, C.R., 2011a. Sydney’s bubonic plague outbreak 1900-1910: A disaster for foreshore wildlife? Australian Zoologist, 35: 1033-1039.

Banks, S.C., Dujardin, M., McBurney, L., Blair, D., Barker, M. and Lindenmayer, D.B., 2011b. Starting points for small mammal population recovery after wildfire: recolonisation or residual populations? Oikos, 120: 26-37.

Banks, S.C., McBurney, L., Blair, D., Davies, I.D. and Lindenmayer, D.B., 2016. Where do animals come from during post-fire population recovery? Implications for ecological and genetic patterns in post-fire landscapes. Ecography, 40: 1325- 1338.

Barnett, J.L., How, R.A. and Humphreys, W.F., 1977. Small mammal populations in pine and native forests in north-eastern New South Wales. Australian Wildlife Research, 4: 233-240.

Batson, W.G., Gordon, I.J., Fletcher, D.B. and Manning, A.D., 2015. Translocation tactics: a framework to support the IUCN Guidelines for wildlife translocations and improve the quality of applied methods. Journal of Applied Ecology, 52: 1598- 1607.

Batson, W.G., Gordon, I.J., Fletcher, D.B., Portas, T.J. and Manning, A.D., 2017. The effect of pre-release captivity on the stress physiology of a reintroduced population of wild eastern bettongs. Journal of Zoology, 303 (4): 311-319.

Begon, M., Harper, J.L. and Townsend, C.R., 1986. Ecology: Individuals, Populations and Communities. Blackwell Science: Oxford.

166

References

Behrends, P., Daly, M. and Wilson, M.I., 1986. Range use patterns and spatial relationships of Merriam’s kangaroo rats (Dipodomys merriami). Behaviour, 96: 187-209.

Beletsky, L.D. and Orians, G.H., 1989. Familiar neighbors enhance breeding success in birds. Proceedings of the National Academy of Sciences of the United States of America, 86: 7933-7936.

Bélichon, S., Clobert, J. and Massot, M., 1996. Are there differences in fitness components between philopatric and dispersing individuals? Acta Oecologica, 17: 503-517.

Bennett, A.F., 1990. Habitat corridors and the conservation of small mammals in a fragmented forest environment. Landscape Ecology, 4 (2): 109-22.

Bennett, A., 1993. Microhabitat use by the long-nosed potoroo, Potorous tridactylus, and other small mammals in remnant forest vegetation, south- western Victoria. Wildlife Research, 20: 267-285.

Bennett, V.A., Doerr, V.A.J., Doerr, E.D., Manning, A.D. and Lindenmayer, D.B., 2012. The anatomy of a failed reintroduction: a case study with the Brown Treecreeper. Emu, 112: 298-312.

Benson, D., 2011. Native plants of Sydney Harbour National Park: historical records and species lists, and their value for conservation monitoring. Cunninghamia, 12 (1): 61-84.

Benson, D. and Howell, J., 1990. Taken for Granted: The Bushland of Sydney and its Suburbs. Kangaroo Press: Sydney.

Bentley, J.M., 2008. Role of movement, interremnant dispersal and edge effects in determining sensitivity to habitat fragmentation in two forest-dependent rodents. Austral Ecology, 33 (2): 184-96.

Berger-Wolf, T.Y., Sheikh, S.I., DasGupta, B., Ashley, M.V., Caballero, I.C., Chaovalitwongse, W. and Putrevu, S.L., 2007. Reconstructing sibling relationships in wild populations. Bioinformatics, 23: i49-i56.

167

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Bernays, E.A. and Wcislo, W.T., 1994. Sensory capabilities, information processing, and resource specialization. Quarterly Review of Biology, 69: 187-204.

Berry, K.H., 1986. Desert tortoise (Gopherus agassizii) relocation: implications of social behavior and movements. Herpetologica, 42: 113-125.

Bertolero, A. and Oro, D., 2009. Conservation diagnosis of reintroducing Mediterranean pond turtles: what is wrong? Animal Conservation, 12: 581-591.

Blackburn, T.M., Cassey, P., Duncan, R.P., Evans, K.L. and Gaston, K.J., 2004. Avian extinction and mammalian introductions on oceanic islands. Science, 305: 1955- 1958.

Blouin, M.S., 2003. DNA-based methods for pedigree reconstruction and kinship analysis in natural populations. Trends in Ecology and Evolution, 18: 503-511.

Blundell, G.M., Ben-David, M., Groves, P., Bowyer, RT. and Geffen, E., 2004. Kinship and sociality in coastal river otters: are they related? Behavioral Ecology, 15 (5): 705-714.

Bodey, T.W., McDonald, R.A. and Bearhop, S., 2009. Mesopredators constrain a top predator: Competitive release of ravens after culling crows. Biology Letters, 5: 617-620.

Bomford, M., 2008. Risk Assessment Models for Establishment of Exotic Vertebrates in Australia and New Zealand. Invasive Animals Cooperative Research Centre: Canberra.

Bond, M.L. and Wolff, J.O., 1999. Does Access to Females or Competition among Males Limit Male Home-Range Size in a Promiscuous Rodent? Journal of Mammalogy, 80 (4): 1243-1250.

Boonstra, R. and Hogg, I., 1988. Friends and strangers: A test of the Charnov– Finerty Hypothesis. Oecologia, 77: 95-100.

Bosé, M., Le Gouar, P., Arthur, C., Lambourdière, J., Choisy, J.P., Henriquet, S., Lecuyer, P., Richard, M., Tessier, C. and Sarrazin, F., 2007. Does sex matter in reintroduction of griffon vultures Gyps fulvus? Oryx, 41 (4): 503-508.

168

References

Boutin, S., 1990. Food supplementation experiments with terrestrial vertebrates: patterns, problems, and the future. Canadian Journal of Zoology, 68: 203-220.

Bowers, M.A., Thompson, D.B. and Brown, J.H., 1987. Spatial organization of a desert rodent community: food addition and species removal. Oecologia, 72: 77- 82.

Bowers, M.A., Gregario, K., Brame, C.J., Matter, S.F. and Dooley, J.L. Jr., 1996. Use of space and habitats by meadow voles at the home range, patch and landscape scales. Oecologia, 105: 107-115.

Braithwaite, R.W. and Gullan, P.K., 1978. Habitat selection by small mammals in a Victorian heathland. Australian Journal of Ecology, 3: 109-127.

Braithwaite, R.W., Cockburn, A. and Lee, A.K., 1978. Resource partitioning by small mammals in lowland heath communities of south-eastern Australia. Australian Journal of Ecology, 3: 423-445.

Bright, P.W., 1993. Habitat fragmentation-problems and predictions for British mammals. Mammal Review, 23 (3-4): 101-111.

Bright, P.W. and Morris, P.A., 1994. Animal Translocation for Conservation: Performance of Dormice in Relation to Release Methods, Origin and Season. Journal of Applied Ecology, 31 (4): 699-708.

Brown, J.L. and Orians, G.H., 1970. Spacing Patterns in Mobile Animals. Annual Review of Ecology and Systematics, 1: 239-262.

Brown, J.S., Kotler, B.P. and Mitchell, W.A., 1994. Foraging theory, patch use and the structure of a Negev desert granivore community. Ecology, 75: 2286-2300.

Bujalska, G., 1973. The role of spacing behavior among females in the regulation of reproduction in the bank vole. Journal Reproduction and Fertility, Supplement, 19: 465-474.

Burbidge, A.A. and McKenzie, N.L., 1989. Patterns in the modern decline of Western Australia’s vertebrate fauna: causes and conservation implications. Biological Conservation, 50: 143-198.

169

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Burke, D.M. and Nol, E., 1998. Influence of food abundance, nest-site habitat, and forest fragmentation on breeding ovenbirds. The Auk, 115: 96-104.

Burnham, K.P. and Anderson, D.R., 2002. Model selection and multimodel inference: a practical information-theoretic approach. Springer: New York.

Burns, C.E., 2005. Behavioural ecology of disturbed landscapes: the response of territorial animals to relocation. Behavioral Ecology, 16 (5): 898-905.

Burt, W.H., 1943. Territoriality and home range concepts as applied to mammals. Journal of Mammalogy, 24 (3): 346-352.

Calenge, C., 2006. The package adehabitat for the R software: a tool for the analysis of space and habitat use by animals. Ecological Modelling, 197: 516-519.

Carocci, M. and Bakkali-Kassimi, L., 2012. The encephalomyocarditis virus. Virulence, 3 (4): 351-367.

Carter, I., Newbery, P., Grice, P. and Hughes, J., 2008. The role of reintroductions in conserving British birds. British Birds, 101: 2-25.

Carter, I., Foster, J. and Lock, L., 2017. The Role of Animal Translocations in Conserving British Wildlife: An Overview of Recent Work and Prospects for the Future. EcoHealth, 14: S7-S15.

Caughley, J., Bomford, M., Parker, R., Sinclair, R., Griffiths, J. and Kelly, D., 1998. Managing Vertebrate Pests: Rodents. Bureau of Resource Sciences and Grains Research and Development Corporation: Canberra.

Chipman, R., Slate, D., Rupprecht, C. and Mendoza, M., 2008. Downside risk of wildlife translocation. Developments in Biologicals, 131: 223-232.

Choi, Y.D., 2007. Restoration ecology to the future: a call for new paradigm. Restoration Ecology, 15: 351-353.

Christensen, P. and Burrows, N., 1994. Project Desert Dreaming: the reintroduction of mammals to the Gibson Desert, Western Australia. In M. Serena (ed.), Reintroduction Biology of Australian and New Zealand Fauna, Surrey Beatty and Sons: Chipping Norton, NSW, 199-207.

170

References

Christie, K., Craig, M.D., Stokes V.L. and Hobbs, R.J., 2011. Movement patterns by Egernia napoleonis following reintroduction into restored jarrah forest. Wildlife Research, 38: 475-481.

Christie, M.R., Marine, M.L., French, R.A. and Blouin, M.S., 2012. Genetic adaptation to captivity can occur in a single generation. Proceedings of the National Academy of Sciences of the United States of America, 109: 238-242.

Clark, T.W. and Westrum, R., 1989. High-performance teams in wildlife conservation: a species reintroduction and recovery example. Environmental Management, 13: 663-670.

Clarke, M.F. and Schedvin, N., 1997. An experimental study of the translocation of the noisy miner Manorina melanocephala. Biological Conservation, 80: 161-167.

Clutton-Brock, T.H. and Harvey, P.H., 1978. Mammals, resources and reproductive strategies. Nature, 273 (5659): 191-195.

Coates, P.S., Stiver, S.J. and Delehanty, D.J., 2006. Using sharp-tailed grouse movement patterns to guide release site selection. Wildlife Society Bulletin, 34 (5): 1376-1382.

Cooch, E. and White, G., 2015. Program MARK: A Gentle Introduction (14th edition). Overview, viewed November 2015: http://www.phidot.org/software/mark/docs/book/

Courchamp, F., Chapuis, J.L. and Pascal, M., 2003. Mammal invaders on islands: impact, control and control impact. Biological Reviews, 78: 347-383.

Cox, M.P., Dickman, C.R. and Cox, W.G., 2000. Use of habitat by the black rat (Rattus rattus) at North Head, New South Wales: an observational and experimental study. Austral Ecology, 25: 375-385.

Craig, M.D., Hardy, G.E.S.J., Fontaine, J.B., Garkakalis, M.J., Grigg, A.H., Grant, C.D., Fleming, P.A. and Hobbs, R.J., 2012. Identifying unidirectional and dynamic habitat filters to faunal recolonisation in restored mine-pits. Journal of Applied Ecology, 49 (4): 919-928.

171

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Creel, S., Creel, N.M. and Monfort, S.L., 1996. Social stress and dominance. Nature, 379: 212.

Crook, J.H., Ellis, J.E. and Goss-Custard, J.D., 1976. Mammalian social systems: Structure and function. Animal Behaviour, 24 (2): 261-274.

Cunningham, R.B., Lindenmayer, D.B., MacGregor, C., Barry, S. and Welsh, A., 2005. Effects of trap position, trap history, microhabitat and season on capture probabilities of small mammals in a wet eucalypt forest. Wildlife Research, 32: 657-671.

Cushman, S.A., 2006. Effects of habitat loss and fragmentation on amphibians: a review and prospectus. Biological Conservation, 128 (2): 231-240.

Daly, M., Wilson, M., Behrends, P.R. and Jacobs, L.F., 1990. Characteristics of kangaroo rats, Dipodomys merriami, associated with differential predation risk. Animal Behaviour, 40 (2): 380-389.

Danielson, B.J. and Gaines, M.S., 1987. The influences of conspecific and heterospecific residents on colonization. Ecology, 68: 1778-1784.

Davis, M.H., 1983. Post-release movements of introduced marten. The Journal of Wildlife Management, 47 (1): 59-66.

DEWHA (Department of the Environment, Water, Heritage and the Arts), 2009. Assessment of Australia’s Terrestrial Biodiversity 2008, Report prepared by the Biodiversity Assessment Working Group of the National Land and Water Resources Audit for the Australian Government, Canberra.

Dickens, M.J., Delehanty, D.J. and Romero, L.M., 2009. Stress and Translocation: alterations in the stress physiology of translocated birds. Proceedings of the Royal Society B: Biological Sciences, 276 (1664): 2051-2056.

Dickens, M.J., Delehanty, D.J. and Romero, L.M., 2010. Stress: An inevitable component of animal translocation. Biological Conservation, 143: 1329-1341.

Dickman, C.R., 1988. Body size, prey size, and community structure in insectivorous mammals. Ecology, 69: 569-580.

172

References

Dickman, C.R. and Woodside, D.P., 1983. A test of a competition model with reference to three species of small mammals in south-eastern Australia. Oecologia, 60: 127-134.

Dodd, C.K.J. and Seigel, R.A., 1991. Relocation, repatriation, and translocation of amphibians and reptiles: are they conservation strategies that work? Herpetologica, 47: 336-350.

Dolev, A., Saltz, D., Bar-David, S. and Yom-Tov, Y., 2002. Impact of repeated releases on space-use patterns of Persian fallow deer. Journal of Wildlife Management, 66: 737-746.

Donlan, C.J., 2005. Re-wilding North America. Nature, 436 (7053): 913-914.

Downes, S.J., Handasyde, K.A. and Elgar, M.A., 1997. Variation in the use of corridors by introduced and native rodents in south-eastern Australia. Biological Conservation, 82: 379-383.

DSEWPC (Department of Sustainability, Environment, Water, Population and Communities), 2011. Feral animals in Australia. Canberra ACT: Commonwealth of Australia, viewed October 2011: http://www.environment.gov.au/biodiversity/invasive/ferals/index.html

Dunstan, C.E. and Fox, B.J., 1996. The effects of fragmentation and disturbance of rainforest on ground-dwelling small mammals on the Robertson Plateau, New South Wales, Australia. Journal of Biogeography, 23: 187-201.

Dwyer, R.G., Brooking, C., Brimblecombe, W., Campbell, H.A., Hunter, J., Watts, M.E. and Franklin, C.E., 2015. An open Web-based system for the analysis and sharing of animal tracking data. Animal Biotelemetry, 3 (1): 1-11.

Easton, L., 2014. Mark-resight analysis of kaki (Himantopus novaezelandiae) sightings: a novel approach for the Kaki Recovery Programme. Wildlife Management Report, 279. University of Otago: Dunedin.

Eastridge, R. and Clark, J.D., 2001. Evaluation of 2 soft-release techniques to reintroduction black bears. Wildlife Society Bulletin, 29: 1163-1174.

173

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Ebensperger, L.A., Sobrero, R., Campos, V. and Giannoni, S.M., 2008. Activity, range areas, and nesting patterns in the viscacha rat, Octomys mimax. Journal of Arid Environments, 72: 1174-1183.

Ellegren, H., 2004. Microsatellites: Simple sequences with complex evolution. Nature Reviews, Genetics, 5: 435-445.

Emmons, L.H., 1980. Ecology and resource partitioning among nine species of African rainforest squirrels. Ecological Monographs, 50: 31-54.

Ewen, J.G. and Armstrong, D.P., 2007. Strategic monitoring of reintroductions in ecological restoration programmes. Ecoscience, 14: 401-409.

Fasola, L., Chehébar, C., Macdonald, D.W., Porro, G. and Cassini, M.H., 2009. Do alien North American mink compete for resources with native South American river otter in Argentinean Patagonia? Journal of Zoology, 277: 187-195.

Feierabend, D. and Kielland, K., 2014. Movements, activity patterns, and habitat use of snowshoe hares (Lepus americanus) in interior Alaska. Journal of Mammalogy, 95 (3): 525-533.

Ferretti, F., Corazza, M., Campana, I., Pietrocini, V., Brunetti, C., Scornavacca, D. and Lovari, S., 2015. Competition between wild herbivores: reintroduced red deer and Apennine chamois. Behavioral Ecology, 26 (2): 550-559.

Ferrie, G.M., Cohen, O.R., Schutz, P., Leighty, K.A., Plasse, C., Bettinger, T.L. and Hoffman, E.A., 2013. Identifying Parentage Using Molecular Markers: Improving Accuracy of Studbook Records for a Captive Flock of Marabou Storks (Leptoptilus crumeniferus). Zoo Biology, 9999: 1-9.

Field, K.J., Tracy, C.R., Medica, P.A., Marlow, R.W. and Corn, P.S., 2007. Return to the wild: Translocation as a tool in conservation of the Desert Tortoise (Gopherus agassizii). Biological Conservation, 136: 232-245.

Finlayson, G.R. and Moseby, K.E., 2004. Managing confined populations: the influence of density on the home range and habitat use of reintroduced burrowing bettongs (Bettongia lesueur). Wildlife Research, 31: 457-463.

174

References

Fischer, J. and Lindenmayer, D.B., 2000. An assessment of the published results of animal relocations. Biological Conservation, 96: 1-11.

Ford, H.A., Barrett, G.W., Saunders, D.A. and Recher, H.F., 2001. Why have birds in the woodlands of southern Australia declined? Biological Conservation, 97: 71- 88.

Forsyth, D.M., Duncan, R.P., Bomford, M. and Moore, G., 2004. Climatic suitability, life history traits, introduction effort, and the establishment and spread of introduced mammals in Australia. Conservation Biology, 18 (2): 557-569.

Fortin, D., Beyer, H.L., Boyce, M.S., Smith, D.W., Duchesne, T. and Mao, J.S., 2005 Wolves Influence Elk Movements: Behavior Shapes a Trophic Cascade in Yellowstone National Park. Ecology, 86 (5): 1320-1330.

Free, C.L. and Leung, L.K-P., 2008. How effective are grid trapping, oil cards and track boards in monitoring bush rat populations? Australian Mammalogy, 29: 149-155.

Fritts, S.H., Paul, W.J. and Mech, L.D., 1984. Movements of translocated wolves in Minnesota. Journal of Wildlife Management, 48: 709-721.

Fustec, J., Lode, T., Le Jacques, D. and Cormier, J.P., 2001. Colonization, riparian habitat selection and home range size in a reintroduced population of European beavers in the Loire. Freshwater Biology, 46: 1361-1371.

Gaston, K.J., 2010. Valuing common species. Science, 327: 154-155.

Gause, G.F., 1934. Experimental Analysis of Vito Volterra's Mathematical Theory of the Struggle for Existence. Science, New Series, 79 (2036): 16-17.

Genaro, G., Schmidek, W. and Franci, C.R., 2004. Social condition affects hormone secretion and exploratory behavior in rats. Brazilian Journal of Medical and Biological Research, 37 (6): 833-840.

Germano, J. and Bishop, P.J., 2009. Review of the suitability of amphibians and reptiles for reintroductions. Conservation Biology, 23: 7-15.

Gibson, D.F., Lundie-Jenkins, G., Langford, D.G., Cole, J.R., Clarke, J.E., Johnson, K.A., 1994. Predation by feral cats, Felis catus, on the rufous hare-wallaby,

175

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Lagorchestes hirsutus, in the Tanami Desert. Australian Mammalogy, 17: 103- 107.

Gilmore, S. and Peakall, R., 2003. Isolation of microsatellite markers in Cannabis sativa L. (marijuana). Molecular Ecology, Notes 3: 105-107.

Glen, A.S. and Dickman, C.R., 2005. Complex interactions among mammalian carnivores in Australia, and their implications for wildlife management. Biological Reviews, 80: 387-401.

Glen, A.S., Sutherland, D.R. and Cruz, J., 2010. An improved method of microhabitat assessment relevant to predation risk. Ecological Research, 25 (2): 311-314.

Gong, W., Sinden, J., Braysher, M. and Jones, R., 2009. The economic impacts of vertebrate pests in Australia. Invasive Animals Cooperative Research Centre: Canberra.

Gouirand, A.M. and Matuszewich, L., 2005. The effects of chronic unpredictable stress on male rats in the water maze. Physiology and Behavior, 86: 21-31.

Grant, P.R., 1972. Interspecific competition among rodents. Annual Review of Ecology and Systematics, 3: 79-106.

Green, R.E., 1997. The influence of numbers released on the outcome of attempts to introduce exotic bird species to New Zealand. Journal of Animal Ecology, 66: 25-35.

Greene, D.U., Gore, J.A. and Stoddard, M.A., 2016. Reintroduction of the endangered Perdido Key beach mouse (Peromyscus polionotus trissyllepsis): fate and movements of captive-born animals. Florida Scientist, 79 (1): 1-13.

Greenwood, P.J., 1980. Mating systems, philopatry and dispersal in birds and mammals. Animal Behaviour, 28 (4): 1140-1162.

Griffith, B., Scott, J.M., Carpenter, J.W. and Reed, C., 1989. Translocation as a species conservation tool: status and strategy. Science, 245: 477-480.

Guo, S.W. and Thompson, E.A., 1992. Performing the exact test of Hardy- Weinberg proportion for multiple alleles. Biometrics, 48: 361-372.

176

References

Gurnell, J., Wauters, L.A., Lurz P.W.W. and Tosi, G., 2004. Alien species and interspecific competition: effects of introduced eastern grey squirrels on red squirrel population dynamics. Journal of Animal Ecology, 73: 26-35.

Hardin, G., 1960. The competitive exclusion principle. Science, 131: 1292-1297.

Harper, G.A., Dickinson K.J.M. and Seddon, P.J., 2005. Habitat use by three rat species (Rattus spp.) on Stewart Island/ Rakiura, New Zealand. New Zealand Journal of Ecology, 29 (2): 251-260.

Harris, D.B. and Macdonald, D.W., 2007. Interference competition between introduced black rats and endemic Galapagos rice rats. Ecology, 88: 2330-2344.

Harris, S., Cresswell, W.J., Forde, P.G., Trewhella, W.J., Woollard, T. and Wray, S., 1990. Home-range analysis using radio-tracking data: a review of problems and techniques particularly as applied to the study of mammals. Mammal Review, 20 (2-3): 97-123.

Harris, D.B., Gregory, S.D. and Macdonald, D.W., 2006. Space invaders? A search for patterns underlying the coexistence of alien black rats and Galápagos rice rats. Oecologia, 149: 276-288.

Harrison, H.B., Saenz-Agudelo, P., Planes, S., Jones, G.P. and Berumen, M.L., 2013. Relative accuracy of three common methods of parentage analysis in natural populations. Molecular Ecology, 22: 1158-1170.

Hart, Q. and Bomford, M., 2006. Australia’s Pest Animals: new approaches to old problems. Department of Agriculture, Fisheries and Forestry: Bureau of Rural Sciences, viewed October 2011: http://adl.brs.gov.au/brsShop/html/brs_prod_90000003288.html

Hartup, B.K., Kollias, G.V., Jacobsen, M.C., Valentine, B.A. and Kimber, K.R., 1999. Exertional myopathy in translocated river otters from New York. Journal of Wildlife Diseases, 35 (23): 542-547.

Heavener, S., Carthey, A. and Banks, P., 2014. Competitive naïveté between a highly successful invader and a functionally similar native species. Oecologia, 175 (1): 73-84.

177

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Heidinger, I.M.M., Poethke, H.J., Bonte, D. and Hein, S., 2009. The effect of translocation on movement behaviour—A test of the assumptions of behavioural studies. Behavioural Processes, 82: 12-17.

Heinsohn, G. and Heinsohn, R., 1999. Long-term dynamics of a rodent community in an Australian tropical rainforest. Wildlife Research, 26: 187-198.

Henderson, W., Bomford, M. and Cassey, P., 2011. Managing the risk of exotic vertebrate incursions in Australia. Wildlife Research, 38: 501-508.

Herr, J. and Rosell, F., 2004. Use of space and movement patterns in monogamous adult Eurasian beavers (Castor fiber). Journal of Zoology, 262 (3): 257-264.

Higgs, P. and Fox, B.J., 1993. Interspecific competition: a mechanism for rodent succession after fire in wet heathland. Australian Journal of Ecology, 18: 193-201.

Hill, M.R.J., Alisauskas, R.T., Ankney, C.D. and Leafloor, J.O., 2003. Influence of body size and condition on harvest and survival of juvenile Canada geese. The Journal of Wildlife Management, 67 (3): 530-541.

Hines, J.E., 2006. PRESENCE10: software to estimate patch occupancy and related parameters. USGS-PWRC. Available from: http://www.mbr- pwrc.usgs.gov/software/presence.html.

Hines, J.E., Nichols, J.D. and Collazo, J.A., 2014. Multiseason occupancy models for correlated replicate surveys. Methods in Ecology and Evolution, 5: 583-591.

Hobbs, R. J. and Cramer, V.A., 2008. Restoration ecology: interventionist approaches for restoring and maintaining ecosystem function in the face of rapid environmental change. Annual Review of Environment and Resources, 33: 39-61.

Hobbs, R.J., Arico, S., Aronson, J., Baron, J.S., Bridgewater, P., Cramer, V.A., Epstein, P.R., Ewel, J.J., Klink, C.A., Lugo, A.E., Norton, D., Ojima, D., Richardson, D.M., Sanderson, E.W., Valladares, F., Vilà, M., Zamora, R. and Zobel, M., 2006. Novel ecosystems: theoretical and management aspects of the new ecological world order. Global Ecology and Biogeography, 15 (1): 1-7.

178

References

Holland, G.J. and Bennett, A.F., 2007. Occurrence of small mammals in a fragmented landscape: the role of vegetation heterogeneity. Wildlife Research, 34: 387-397.

Holland, G.J. and Bennett, A.F., 2010. Habitat fragmentation disrupts the demography of a widespread native mammal. Ecography, 33: 841-853.

Holland, G.J. and Bennett, A.F., 2011. Recolonization of forest fragments by a native rodent following experimental ‘extinctions’. Austral Ecology, 36: 521-529.

Hone, J., 2007. Wildlife damage control. CSIRO Publishing: Melbourne.

Hoyle, S.D., Pople, A.R. and Toop, G.J., 2001. Mark recapture may reveal more about ecology than about population trends: Demography of a threatened ghost bat (Macroderma gigas) population. Austral Ecology, 26 (1): 80-92.

Hughes, C. 1998. Integrating molecular techniques with field methods in studies of social behavior: a revolution results. Ecology, 79: 383-400.

Hunter, D. and Letnic, M., 2015. Bringing devils back to the mainland could help wildlife conservation. The Conversation, viewed August 2016: https://theconversation.com/bringing-devils-back-to-the-mainland-could-help- wildlife-conservation-43121

Huxel, G.R. and Hastings, A., 1999. Habitat loss, fragmentation and restoration. Restoration Ecology, 7 (3): 309-315.

Ims, R.A., 1990. Mate detection success of male Clethrionomys rufocanus in relation to the spatial distribution of sexually receptive females. Evolutionary Ecology, 4 (1): 57-61.

Invasive Animals CRC, 2013. Annual Report 2012-2013. Invasive Animals Cooperative Research Centre: Canberra.

IUCN (International Union for the Conservation of Nature and Natural Resources), 1998. Guidelines for Reintroductions. Prepared by the IUCN/SSC Reintroduction Specialist Group: Gland, Switzerland and Cambridge, UK.

IUCN (International Union for the Conservation of Nature and Natural Resources), 2013. Guidelines for Reintroductions and Other Conservation

179

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Translocations Version 1.0. Prepared by IUCN Species Survival Commission: Gland, Switzerland.

Jacques, C.N., Jenks, J.A. and Klaver, R.W., 2009. Seasonal Movements and Home- Range Use by Female Pronghorns in Sagebrush-Steppe Communities of Western South Dakota. Journal of Mammalogy, 90 (2): 433-441.

Jacquot, J.J. and Solomon, N.G., 1997. Effects of site familiarity on movement patterns of male prairie voles Microtus ochrogaster. American Midland Naturalist, 138 (2): 414-417.

Jones, O. and Wang, J., 2010. COLONY: a program for parentage and sibship inference from multilocus genotype data. Molecular Ecology Resources, 10: 551- 555.

Jones, J.M. and Witham, J.H., 1990. Post-translocation survival and movements of metropolitan white-tailed deer. Wildlife Society Bulletin, 18: 434-441.

Jones, H.P., Tershy, B.R., Zavaleta, E.S., Croll, D.A., Keitt, B.S., Finkelstein, M.E. and Howald, G.R., 2008. Severity of the effects of invasive rats on seabirds: a global review. Conservation Biology, 22: 16-26.

Jones, A.G., Small, C.M., Paczolt, K.A. and Ratterman, N.L., 2010. Technical Review: A practical guide to methods of parentage analysis. Molecular Ecology Resources, 10: 6-30.

Jonsson, P., Hartikainen, T., Koskela, E. and Mappes, T., 2002. Determinants of reproductive success in voles: space use in relation to food and litter size manipulation. Evolutionary Ecology, 16: 455-467.

Kalinowski, S.T., Taper, M.L. and Marshall, T.C., 2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology, 16: 1099-1106.

Karaket, T. and Poompuang, S., 2012. CERVUS vs. COLONY for successful parentage and sibship determinations in freshwater prawn Macrobrachium rosenbergii. Aquaculture, 324-325: 307-311.

180

References

Karesh, W.B., Cook, R.A., Gilbert, M. and Newcomb, J., 2007. Implications of wildlife trade on the movement of avian influenza and other infectious diseases. Journal of Wildlife Diseases, 43: S55-S59.

Karlsson, A.F., 1988. Social organization of a low density spring population of the bank vole, Clethrionomys glareolus. Oikos, 52: 19-26.

Katajisto, J. and Moilanen, A., 2006. Kernel-based home range method for data with irregular sampling intervals. Ecological Modelling, 194 (4): 405-413.

Keith, D.A., 2004. Ocean Shores to Desert Dunes. The Native Vegetation of New South Wales and the ACT. NSW Department of Environment and Conservation, Sydney, NSW.

Keller, L.F. and Waller, D.M., 2002. Inbreeding effects in wild populations. Trends in Ecology and Evolution, 17: 230-241.

Keller, R.P., Lodge, D.M. and Finoff, D.C., 2007. Risk assessment for invasive species produces net bioeconomic benefits. Proceedings of the National Academy of Sciences, USA 104: 203-207.

Kelt, D.A., Kelly, P.A., Phillips, S.E. and Williams, D.F., 2014. Home range size and habitat selection of reintroduced Sylvilagus bachmani riparius. Journal of Mammalogy, 95 (3): 516-524.

Kennedy, T.A., Naeem, S., Howe, K.M., Knops, J.M.H., Tilman, D. and Reich, P., 2002. Biodiversity as a barrier to ecological invasion, Nature, 417: 636-638.

Kie, J.G., Matthiopoulos, J., Fieberg, J., Powell, R.A., Cagnacci, F., Mitchell, M.S., Gaillard, J.M. and Moorcroft, P.R., 2010. The home-range concept: are traditional estimators still relevant with modern telemetry technology? Philosophical Transactions of the Royal Society, Biological Sciences, 365 (1550): 2221-2231.

King, D.A., 2004. Climate change science: adapt, mitigate, or ignore? Science, 303: 176-177.

King, C.M., Innes, J.G., Flux, M., Kimberley, M.O., Leathwick, J.R. and Williams, D.S., 1996. Distribution and abundance of small mammals in relation to habitat in Pureora Forest Park. New Zealand. Journal of Ecology, 20: 215-240.

181

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Kingsford, R.T., Watson, J.E.M., Lundquist, C.J., Venter, O., Hughes, L., Johnston, E.L., Atherton, J., Gawel, M., Keith, D.A., Mackey, B.G., Morley, C., Possingham, H.P., Raynor, B., Recher, H.F. and Wilson, K.A., 2009. Major conservation policy issues for biodiversity in Oceania. Conservation Biology, 23: 834-840.

Kleiman, D.G., 1989. Reintroduction of captive mammals for conservation. BioScience, 39: 152-161.

Koskela, E., Jonsson, P., Hartikainen, T. and Mappes, T., 1998. Limitation of reproductive success by food availability and litter size in the bank vole, Clethrionomys glareolus. Proceedings of the Royal Society B: Biological Sciences, 265: 1129-1134.

Kotler, B.P., Brown, J.S. and Subach, A., 1993. Mechanisms of species coexistence of optimal foragers: temporal partitioning by two species of sand dune gerbils. Oikos, 67: 548-556.

Kraaijeveld-Smit, F.J.L., Lindenmayer, D.B., Taylor, A.C., Macgregor, C. and Wertheim, B., 2007. Comparative genetic structure reflects underlying life histories of three sympatric small mammal species in continuous forest of south- eastern Australia. Oikos, 116: 1819-1830.

Krebs, C.J. and Singleton, G.R., 1993. Indexes of Condition for Small Mammals. Australian Journal of Zoology, 41 (4): 317-323.

Larkin, J.L., Cox, J.J., Wichrowski, M.W., Dzialak, M. and Maehr, D.S., 2004. Influences on release-site fidelity of translocated elk. Restoration Ecology, 12: 97- 105.

Lazenby, B.T., Mooney, N.J. and Dickman, C.R., 2014. Effects of low-level culling of feral cats in open populations: a case study from the forests of southern Tasmania. Wildlife Research, 41: 407-420.

Lettink, M. and Armstrong, D.P., 2003. An introduction to using mark-recapture analysis for monitoring threatened species. Department of Conservation Technical Series, 28A: 5-32.

182

References

Letty, J., Marchandeau, S., Clobert, J. and Aubineau, J., 2000. Improving translocation success: an experimental study of anti-stress treatment and release method for wild rabbits. Animal Conservation, 3: 211-219.

Letty, J., Marchandeau, S. and Aubineau, J., 2007. Problems encountered by individuals in animal translocations: Lessons from field studies. EcoScience, 14 (4): 420-431.

Lewis, J.C., Powell, R.A. and Zielinski, W.J., 2012. Carnivore Translocations and Conservation: Insights from Population Models and Field Data for Fishers (Martes pennanti). PLoS ONE, 7 (3): e32726.

Lima, S.L. and Dill, L.M., 1990. Behavioural decisions made under the risk of predation: a review and prospectus. Canadian Journal of Zoology, 68: 619-40.

Lindenmayer, D.B. and Lacy, R.C., 2002. Small mammals, habitat patches and PVA models: A field test of model predictive ability. Biological Conservation, 103: 247- 265.

Lindenmayer, D.B. and Peakall, R., 2000. The Tumut experiment integrated demographic and genetic studies to unravel fragmentation effects: a case study of the native bush rats. In A. Young and G. Clarke (eds.), Genetics, demography, and the viability of fragmented populations, Cambridge University Press: Cambridge, UK, 173-201.

Lindenmayer, D.B., Cunningham, R.B. and Peakall, R., 2005. The recovery of populations of bush rat Rattus fuscipes in forest fragments following major population reduction. Journal of Applied Ecology, 42: 649-658.

Lindsey, G.D., Mosher, S.M., Fancy, S.G. and Smucker, T.D., 1999. Population structure and movements of introduced rats in an Hawaiian rainforest. Pacific Conservation Biology, 5 (2): 94-102.

Linklater, W.L. and Swaisgood, R.R., 2008. Reserve size, conspecific density, and translocation success for black rhinoceros. Journal of Wildlife Management, 72: 1059-1068.

183

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Lira, P.K. and Fernandez, F.A.S., 2009. A comparison of trapping- and radiotelemetry-based estimates of home range of the neotropical opossum Philander frenatus. Mammalian Biology - Zeitschrift für Säugetierkunde, 74: 1-8.

Lott, D.F., 1984. Intraspecific variation in the social systems of wild vertebrates. Behaviour, 88: 266-325.

Lott, D.F., 1991. Intraspecific Variation in the Social Systems of Wild Vertebrates. Cambridge University Press: Cambridge.

Louys, J., Corlett, R.T., Price, G.J., Hawkins, S. and Piper, P.J., 2014. Rewilding the tropics, and other conservation translocations strategies in the tropical Asia- Pacific region. Ecology and Evolution, 4 (22): 4380-4398.

Lovari, S., Ferretti, F., Corazza, M., Minder, I., Troiani, N., Ferrari C. and Saddi, A., 2014. Unexpected consequences of reintroductions: competition between increasing red deer and threatened Apennine chamois. Animal Conservation, 17: 359-370.

Macdonald, D.W. and Thom, M.D., 2001. Alien carnivores: unwelcome experiments in ecological theory. In J.L. Gittleman, M.S. Funk, D.W. Macdonald and R.K. Wayne (eds.), Carnivore Conservation, Cambridge University Press: Cambridge, 93-122.

MacKenzie, D.I., Nichols, J.D., Hines, J.E., Knutson, M.G. and Franklin, A.B., 2003. Estimating Site Occupancy, Colonization, and Local Extinction When a Species Is Detected Imperfectly. Ecology, 84 (8): 2200-2207.

MacKenzie, D.I., Bailey, L.L. and Nichols, J.D., 2004. Investigating species co- occurrence patterns when species are detected imperfectly, Journal of Animal Ecology, 73: 546-555.

MacKenzie, D.I., Nichols, J.D., Royle, J.A., Pollock, K.H., Bailey, L.L. and Hines, J.E., 2006. Occupancy Estimation and Modeling: Inferring Patterns and Dynamics of Species Occurrence. Elsevier Publishing: London.

Macqueen, P.E., Nicholls, J.A., Hazlitt, S.L. and Goldizen, A.W., 2008. Gene flow among native bush rat, Rattus fuscipes (Rodentia: Muridae), populations in the

184

References fragmented subtropical forests of south-east Queensland. Austral Ecology, 33: 585-593.

Maher, C.R., 2009. Genetic relatedness and space use in a behaviorally flexible species of marmot, the woodchuck (Marmota monax). Behavioral Ecology and Sociobiology, 63: 857-868.

Maher, C.R. and Lott, D.F., 2000. A review of ecological determinants of territoriality within vertebrate species. American Midlands Naturalist, 143: 1-29.

Maitz, W.E. and Dickman, C.R., 2001. Competition and habitat use in native Australian Rattus: is competition intense, or important? Oecologia, 128: 526-538.

Marinelli, L. and Messier, F., 1993. Space use and the social system of muskrats. Canadian Journal of Zoology, 71: 869-875.

Marshall, T.C., Slate, J., Kruuk, L.E.B. and Pemberton, J.M., 1998. Statistical confidence for likelihood-based paternity inference in natural populations. Molecular Ecology, 7: 639-655.

Martin, T.G. and McDonald-Madden, E., 2011. Relocating Species to Ensure Survival in a Changing Climate. Issues, 94: 41-43.

Mazurkiewicz, M. and Rajska-Jurgiel, E., 1998. Spatial behaviour and population dynamics of woodland rodents. Acta Theriologica, 43 (2): 137-161.

McEachern, M.B., Eadie, J.M. and Van Vuren, D.H., 2007. Local genetic structure and relatedness in a solitary mammal, Neotoma fuscipes. Behavioral Ecology and Sociobiology, 61 (9): 1459-1469.

McGuire, B., and Getz, L.L., 1998. The nature and frequency of social interactions among free-living prairie voles (Microtus ochrogaster). Behavioral Ecology and Sociobiology, 43: 271-279.

McKinney, M.L. and Lockwood, J.L., 1999. Biotic homogenizaton: a few winners replacing many losers in the next mass extinction. Trends in Ecology and Evolution, 14: 450-453.

McLeod, R., 2004. Counting the Cost: Impact of Invasive Animals in Australia. Cooperative Research Centre for Pest Animal Control: Canberra.

185

Megan Callander – Translocation and Reintroduction of Native Bush Rats

McMahon, C.R., Burton, H.R. and Bester, M.N., 2000. Weaning mass and the future survival of juvenile southern elephant seals, Mirounga leonina, at Macquarie Island. Antarctic Science, 12 (2): 149-153.

Metzgar, L.H., 1967, An Experimental Comparison of Screech Owl Predation on Resident and Transient White-Footed Mice (Peromyscus leucopus). Journal of Mammalogy, 48 (3): 387-391.

Metzger, J.P., Martensen, A.C., Dixo, M., Bernacci, L.C., Ribeiro, M.C., Teixeira, A.M.G and Pardini, R., 2009. Time-lag in biological responses to landscape changes in a highly dynamic Atlantic forest region. Biological Conservation, 142 (6): 1166-1177.

Mihoub, J-B., Robert, A., Le Gouar, P. and Sarrazin, F., 2011. Post-Release Dispersal in Animal Translocations: Social Attraction and the “Vacuum Effect”. PLoS ONE, 6 (12): e27453.

Miller, B., Ralls, K., Reading, R.P., Scott, J.M. and Estes, J., 1999. Biological and technical considerations of carnivore translocation: a review. Animal Conservation, 2: 59-68.

Miller, K., Bell, T. and Germano, J., 2014. Understanding Publication Bias in Reintroduction Biology by Assessing Translocations of New Zealand's Herpetofauna. Conservation Biology: The Journal of the Society for Conservation Biology, 28 (4): 1045-1056.

Millspaugh, J.J. and Washburn, B.E., 2004. Use of fecal glucocorticoid metabolite measures in conservation biology research: considerations for application and interpretation. General and Comparative Endocrinology, 138: 189-199.

Mitchell, B.R., 2007. Comparison of programs for fixed kernel home range analysis. Remotely Wild, 21: 1-7.

Moehlman, P.D., 1998. Feral asses (Equus africanus): intraspecific variation in social organization in arid and mesic habitats. Applied Animal Behaviour Science, 60: 171-195.

186

References

Moehrenschlager, A. and Macdonald, D.W., 2003. Movement and survival parameters of translocated and resident swift foxes Vulpes velox. Animal Conservation, 6: 199-206

Molony, S.E., Dowding, C.V., Baker, P.J., Cuthill, I.C. and Harris, S., 2006. The effect of translocation and temporary captivity on wildlife rehabilitation success: An experimental study using European hedgehogs (Erinaceus europaeus). Biological Conservation, 130 (4): 530-537.

Molyneux, J., Taggart, D.A., Corrigan, A. and Frey, S., 2011. Home-range studies in a reintroduced brush-tailed rock-wallaby (Petrogale penicillata) population in the Grampians National Park, Victoria. Australian Mammalogy, 33: 128-134.

Monamy, V. and Fox, B.J., 1999. Habitat selection by female Rattus lutreolus drives asymmetric competition and co-existence with Pseudomys higginsi. Journal of Mammalogy, 80: 232-242.

Moore, J.A., Bell, B.D. and Linklater, W.L., 2008. The debate on behavior in conservation: New Zealand integrates theory with practice. Forum Report. BioScience, 58 (5): 454-459.

Morgan, K.N. and Tromborg, C.T., 2007. Sources of stress in captivity. Applied Animal Behaviour Science, 102: 362-302.

Moro, D., 1991. The Distribution of small mammal species in relation to heath vegetation near Cape Otway, Victoria. Wildlife Research, 18 (5): 605-617.

Morris, D.W., Davidson, D.L. and Krebs, C.J., 2000. Measuring the ghost of competition: insights from density-dependent habitat selection on the coexistence and dynamics of lemmings. Evolutionary Ecology Research, 2: 41-67.

Morris, K., Page, M., Kay, R., Renwick, J., Desmond, A., Comer, S., Burbidge, A., Kuchling, G. and Sims, C., 2015. Forty years of fauna translocations in Western Australia: lessons learned. In D. Armstrong, M. Hayward, D. Moro and P. Seddon (eds.), Advances in Reintroduction Biology of Australian and New Zealand Fauna, CSIRO Publishing: Australia, 217-236.

187

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Moseby, K.E., Read, J.L., Paton, D.C., Copley, P., Hill, B.M. and Crisp, H.A., 2011. Predation determines the outcome of 10 reintroduction attempts in arid South Australia. Biological Conservation, 144 (12): 2863-2872.

Mueller, J.M. and Hellmann, J.J., 2008. An assessment of invasion risk from assisted migration. Conservation Biology, 22 (3), 562-567.

Murray, B.R. and Hose, G.C., 2005. Life-history and ecological correlates of decline and extinction in the endemic Australian frog fauna. Austral Ecology, 30: 564-571.

Nams, V.O., 2011. Locate III (version 3.34). Radiotelemetry Triangulation Program, viewed May 2013: http://www.locateiii.com/index.htm

Nathan, R., Perry, G., Cronin, J.T., Strand, A.E. and Cain, M.L., 2003. Methods for estimating long-distance dispersal. Oikos, 103: 261-273.

NCRIS (National Research Infrastructure for Australia), 2011. The Atlas of Living Australia. Global Biodiversity Information Facility (GBIF), viewed November 2015: http://www.ala.org.au/

Norrdahl, K. and Korpimäki, E., 1998. Does mobility or sex of voles affect risk of predation by mammalian predator? Ecology, 79: 226-232.

NPWS (National Parks and Wildlife Service), 2012. Plan of Management: Sydney Harbour National Park. Office of Environment and Heritage, NSW.

Nussear, K.E., Tracy, C.R., Medica, P.A., Wilson, D.S., Marlow, R.W. and Corn, P.S., 2012. Translocation as a Conservation Tool for Agassiz’s Desert Tortoises: Survivorship, Reproduction, and Movements. The Journal of Wildlife Management, 76 (7): 1341-1353.

Nussey, D.H., Coltman, D.W., Coulson, T. Kruuk, L.E.B., Donald, A., Morris, S.J., Clutton-Brock, T.H. and Pemberton, J., 2005. Rapidly declining fine-scale spatial genetic structure in female red deer. Molecular Ecology, 14 (11): 3395-3405.

OEH (Office of Environment and Heritage), 2015. Atlas of NSW Wildlife. New South Wales Government, viewed November 2015: http://www.environment.nsw.gov.au/

188

References

Oliveira, P.A., Souto Lima, R.B. and Chiarello, A.G., 2012. Home range, movements and diurnal roosts of the endangered thin-spined porcupine, Chaetomys subspinosus (Rodentia: Erethizontidae), in the Brazilian Atlantic Forest. Mammalian Biology, 77: 97-107.

Onorato, D., Desimone, R., White, C. and Waits, L.P., 2011. Genetic Assessment of Paternity and Relatedness in a Managed Population of Cougars. The Journal of Wildlife Management, 75 (2): 378-384.

Ostfeld, R.S., 1990. The ecology of territoriality in small mammals. Trends in Ecology and Evolution, 5 (12): 411-415.

Palmer, M.A., Ambrose, R.F. and Poff, N.L., 1997. Ecological theory and community restoration ecology. Restoration Ecology, 5 (4): 291-300.

Pardini, R., de Souza, S.M., Braga-Neto, R. and Metzger, J.P., 2005. The role of forest structure, fragment size and corridors in maintaining small mammal abundance and diversity in an Atlantic forest. Biological Conservation, 124 (2): 253-266.

Parker, I.D., Watts, D.E., Lopez, R.R., Silvy, N.J., Davis, D.S., McCleery, R.A. and Frank, P.A., 2008. Evaluation of the efficacy of Florida Key deer translocations. Journal of Wildlife Management, 72: 1069-1075.

Parker, K.A., Dickens, M.J., Clarke, R.H. and Lovegrove, T.J., 2012. The theory and practice of catching, holding, moving and releasing animals. In J.G. Ewen, D.P. Armstrong, K.A. Parker, P.J. Seddon (eds.), Reintroduction Biology: Integrating Science and Management, Wiley-Blackwell: Oxford, UK, 105-137.

Peakall, R. and Lindenmayer, D., 2006. Genetic insights into population recovery following experimental perturbation in a fragmented landscape. Biological Conservation, 132: 520-532.

Peakall, R., Ruibal, M. and Lindenmayer, D.B., 2003. Spatial autocorrelation analysis offers new insights into gene flow in the Australian bush rat, Rattus fuscipes. Evolution, 57: 1182-1195.

189

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Peakall, R., Ebert, D., Cunningham, R. and Lindenmayer, D., 2006. Mark-recapture by genetic tagging reveals restricted movements by bush rats (Rattus fuscipes) in a fragmented landscape. Journal of Zoology, 268: 207-216.

Pedrono, M. and Sarovy, A., 2000. Trial release of the world’s rarest tortoise Geochelone yniphora in Madagascar. Biological Conservation, 95: 333-342.

Pérez-Tris, J., Díaz, J.A. and Tellería, J.L., 2004. Loss of body mass under predation risk: cost of antipredatory behaviour or adaptive fit-for-escape? Animal Behaviour, 67 (3): 511-521.

Piertney, S.B., MacColl, A.D.C., Lambin, X., Moss, R. and Dallas, J.F., 1999. Spatial distribution of genetic relatedness in a moorland population of red grouse (Lagopus lagopus scoticus). Biological Journal of the Linnean Society, 68: 317- 331.

Pinter-Wollman, N., Isbell, L.A. and Hart, L.A., 2009. The relationship between social behaviour and habitat familiarity in African elephants (Loxodonta Africana). Proceedings of the Royal Society B: Biological Sciences, 276: 1009-1014.

Planes, S., Jones, G.P. and Thorrold, S.R., 2009. Larval dispersal connects fish populations in a network of marine protected areas. Proceedings of the National Academy of Sciences of the United States of America, 106: 5693-5697.

Poore M.E.D., 1955. The Use of Phytosociological Methods in Ecological Investigations: I. The Braun-Blanquet System. The Journal of Ecology, 43 (1): 226- 244.

Price, M.V., 1978. The role of microhabitat in structuring desert rodent communities. Ecology, 59: 910-921.

Price, M.V. and Kramer, K.A., 1984. On measuring microhabitat affinities with special reference to small mammals. Oikos, 42: 349-354.

Price, K., Boutin, S. and Ydenberg, R., 1990. Intensity of territorial defense in red squirrels: an experimental test of the asymmetric war of attrition. Behavioral Ecology and Sociobiology, 27: 217-222.

190

References

Pryde, M.A., 2003. Using program MARK for assessing survival in cryptic threatened species: a case study using long-tailed bats (Chalinolobus tuberculatus). Department of Conservation Technical Series, 28B: 33-63.

Pryde, M.A., O’Donnell, C.F.J. and Barker, R.J., 2005. Factors influencing survival and long-term population viability of New Zealand long-tailed bats (Chalinolobus tuberculatus): implications for conservation. Biological Conservation, 126: 175- 185.

Pusey, A., 1987. Sex-biased dispersal and inbreeding avoidance in birds and mammals. Trends in Ecology and Evolution, 2: 295-299.

Randall, J.A., Rogovin, K., Parker, P.G. and Eimes, J.A. 2005. Flexible social structure of a desert rodent, Rhombomys opimus: philopatry, kinship, and ecological constraints. Behavioral Ecology, 16: 961-973.

Raymond, M. and Rousset, F., 1995. GENEPOP: population genetics software for exact tests and ecumenicism. Journal of Heredity, 86: 248-249.

Redfield, J.A., Krebs, C.J. and Taitt, M.J., 1977. Competition between Peromyscus maniculatus and Microtus townsendii in grasslands of coastal British Columbia. Journal of Animal Ecology, 46: 607-616.

Ricciardi, A., Simberloff, D., 2009. Assisted colonisation is not a viable conservation strategy. TREE, 24: 248-253.

Richard-Hansen, C., Vié, J.C. and de Thoisy, B., 2000. Translocation of red howler monkeys (Alouatta seniculus) in French Guiana. Biological Conservation, 93: 247- 253.

Richards, J.D. and Short, J., 2003. Reintroduction and establishment of the western barred bandicoot Perameles bougainville (Marsupialia: Peramelidae) at Shark Bay, Western Australia. Biological Conservation, 109 (2): 181-195.

Ricketts, T. and Imhoff, M., 2003. Biodiversity, urban areas, and agriculture: locating priority ecoregions for conservation. Conservation Ecology, 8 (2): 1.

191

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Ripple, W.J., Larsen, E.J., Renkin, R.A. and Smith, D.W., 2001. Trophic cascades among wolves, elk and aspen on Yellowstone National Park's northern range. Biological Conservation, 102: 227-234.

Ritchie, E., 2013. Should we move Tasmanian Devils back to the mainland? The Conversation, viewed August 2016: https://theconversation.com/should-we- move-tasmanian-devils-back-to-the-mainland-16388

Ritland, K., 2000. Marker-inferred relatedness as a tool for detecting heritability in nature. Molecular Ecology, 9: 1195-1204.

Rittenhouse, C., Millspaugh, J., Hubbard, M., Sheriff, S. and Dijak, W., 2008. Resource selection by translocated three-toed box turtles in Missouri. Journal of Wildlife Management, 72: 268-275.

Robert, A., Colas, B., Guigon, I., Kerbiriou, C., Mihoub, J.B., Saint-Jalme, M. and Sarrazin, F., 2015. Defining reintroduction success using IUCN criteria for threatened species: a demographic assessment. Animal Conservation, 18 (5): 397-406.

Roberts, R.L., Williams, J.R., Wang, A.K. and Carter, C.S., 1998. Cooperative breeding and monogamy in prairie voles: influence of the sire and geographic variation. Animal Behaviour, 55: 1131-1140.

Robinson, A.C., 1987. The ecology of the bush rat, Rattus fuscipes (Rodentia: Muridae), in Sherbrooke forest, Victoria. Australian Mammalogy, 11: 35-49.

Romero, D., 2012. Reinvasion of black rats across the urban/bushland interface: a test of ideal-free distribution models. School of Biological Sciences Honours Thesis, Sydney, University of Sydney.

Row, J.R. and Blouin-Demers, G., 2006. Kernels are not accurate estimators of home-range size for herpetofauna. Copeia, 2006 (4): 797-802.

Russell, J.C., McMorland, A.J.C. and MacKay, J.W.B., 2010. Exploratory behaviour of colonizing rats in novel environments. Animal Behaviour, 79: 159-164.

192

References

Sakai, H.F. and Noon, B.R., 1997. Between-habitat movement of dusky-footed woodrats and vulnerability to predation. Journal of Wildlife Management, 61: 343-350.

Sandler, R., 2010. The value of species and the ethical foundations of assisted colonisation. Conservation Biology, 24: 424-431.

Sarrazin, F. and Barbault, R., 1996. Reintroduction: challenges and lessons for basic ecology. Trends in Ecology and Evolution, 11: 474-478.

Sarrazin, F. and Legendre, S., 2000. Demographic Approach to Releasing Adults versus Young in Reintroductions. Conservation Biology, 14 (2): 488-500.

Schmitz, P., Caspers, S., Warren, P. and Witte, K., 2015. First Steps into the Wild – Exploration Behavior of European Bison after the First Reintroduction in Western Europe. PLoS ONE, 10 (11): e0143046.

Schoener, T.W., 1974. Resource partitioning in ecological communities. Science, 185: 27-39.

Schoener, T.W., 1983. Field experiments on interspecific competition. The American Naturalist, 122: 240-285.

Schradin, C. and Pillay, N., 2005. Intraspecific variation in the spatial and social organization of the African striped mouse. Journal of Mammalogy, 86 (1): 99-107.

Schuelke, M., 2000. An economic method for the fluorescent labelling of PCR fragments. Nature Biotechnology, 18: 233-234.

Ściński, M. and Borowski, Z., 2007. Spatial organization of the fat dormouse (Glis glis) in an oak-hornbeam forest during the mating and post-mating season. Mammalian Biology - Zeitschrift für Säugetierkunde, 73 (2): 119-127.

Seaman, D.E. and Powell, R.A., 1996. An Evaluation of the Accuracy of Kernel Density Estimators for Home Range Analysis. Ecology, 77 (7): 2075-2085.

Seamon, J.O. and Adler, G.H., 1996. Population performance of generalist and specialist rodents along habitat gradients. Canadian Journal of Zoology, 74: 1130- 1139.

193

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Seastedt, T.R., Hobbs, R.J. and Suding, K.N., 2008. Management of novel ecosystems: are novel approaches required? Frontiers in Ecology and Environment, 6: 547-553.

Seddon, P.J., 1999. Persistence without intervention: assessing success in wildlife reintroductions. Trends in Ecology and Evolution, 14: 503-503.

Seddon, P.J., 2010. From Reintroduction to Assisted Colonization: Moving along the Conservation Translocation Spectrum. Restoration Ecology, 18 (6): 796-802.

Seddon, P.J., Armstrong, D.P. and Maloney, R.F., 2007. Developing the science of reintroduction biology. Conservation Biology, 21: 303-312.

Philip J. Seddon, P.J., Moehrenschlager, A. and Ewen, J., 2014. Reintroducing resurrected species: selecting DeExtinction candidates. Trends in Ecology and Evolution, 29 (3): 140-147.

Seebeck, J. and Menkhorst, P., 2000. Status and conservation of the rodents of Victoria. Wildlife Research, 27: 357-369.

Seigel, R.A. and Dodd, C.K., 2002. Translocations of Amphibians: Proven Management Method or Experimental Technique? Conservation Biology, 16 (2): 552-554.

Sheean, V.A., Manning, A.D. and Lindenmayer, D.B., 2012. An assessment of scientific approaches towards species relocations in Australia. Austral Ecology, 37: 204-215.

Sheller, F.J., Fagan, W.F. and Unmack, P.J., 2006. Using Survival Analysis to Study Translocation Success in the Gila Topminnow (Poeciliopsis Occidentalis). Ecological Applications, 16 (5): 1771-1784.

Shier, D.M., 2006. Effect of family support on the success of translocated black- tailed prairie dogs. Conservation Biology, 20: 1780-1790.

Shier, D.M. and Owings, D.H., 2006. Effects of predator training on behavior and post-release survival of captive Prairie Dogs (Cynomys ludovicianus). Biological Conservation, 132: 126-135.

194

References

Short, J., 2009. The characteristics and success of vertebrate translocations within Australia: a progress report to Department of Agriculture, Fisheries and Forestry. Wildlife Research and Management: Western Australia.

Short, J. and Smith, A., 1994. Mammal Decline and Recovery in Australia. Journal of Mammalogy, 75 (2): 288-297.

Short, J. and Turner, B., 2000. Reintroduction of the burrowing bettong Bettongia lesueur (Marsupialia: Potoroidae) to mainland Australia. Biological Conservation, 96: 185-196.

Short, J., Bradshaw, S.D., Giles, J., Prince, R.I.T. and Wilson, G.R., 1992. Reintroduction of macropods (Marsupialia: Macropodoidea) in Australia - a review. Biological Conservation, 62: 189-204.

Sih, A., Crowley, P., McPeek, M., Petranka, J. and Strohmeier, K., 1985. Predation, competition and prey communities: a review of field experiments. Annual Review of Ecology and Systematics, 16: 269-311.

Silk, J.B., 2007. The Adaptive Value of Sociality in Mammalian Groups. Philosophical Transactions: Biological Sciences, 362: 539-559.

Singleton, G.R., Krebs, C.J., Davies, S., Chambers, L. and Brown, P.R., 2001. Reproductive changes in fluctuating house mouse populations in south-eastern Australia. Proceedings of the Royal Society B: Biological Sciences, 268: 1741-1748.

Slate, J., Marshall, T.C. and Pemberton, J.M., 2000. A retrospective assessment of the accuracy of the paternity inference program CERVUS. Molecular Ecology, 9: 801-808.

Smith, R.J. and Moore, F.R., 2005. Fat stores of American redstarts Setophaga ruticilla arriving at northerly breeding grounds. Journal of Avian Biology, 36 (2): 117-126.

Smith, A.P. and Quin, D.G., 1996. Patterns and causes of extinction and decline in Australian conilurine rodents. Biological Conservation, 77: 243-267.

Smith, M.H., Gardner, R.H., Gentry, J.B., Kaufmam, D.W. and O’Farrell, M.H., 1975. Density estimations of small mammal populations. In F.B. Golley, K. Petrusewicz

195

Megan Callander – Translocation and Reintroduction of Native Bush Rats

and L. Ryszkowski (eds.), Small Mammals: Their Productivity and Population Dynamics, Cambridge University Press: Cambridge, 25-53.

Social Media Research Foundation, 2014. NodeXL Network Graphs (version 539). NodeXL: Network Overview, Discovery and Exploration for Excel, viewed February 2016: https://nodexl.codeplex.com/

Somers, M.J. and Gusset, M., 2009. The Role of Social Behaviour in Carnivore Reintroductions. In M.W. Hayward and M.J. Somers (eds.), Reintroduction of Top- Order Predators, Blackwell Publishing Ltd: online, 270-281.

Southgate, R. and Possingham, H., 1995. Modelling the reintroduction of the greater bilby Macrotis lagotis using the metapopulation model Analysis of the Likelihood of Extinction (ALEX). Biological Conservation, 73: 151-160.

Spyrou, V., Maurice, H., Billinis, C., Papanastassopoulou, M., Psalla, D., Nielen, M., Koenen, F. and Papadopoulos, O., 2004. Transmission and pathogenicity of encephalomyocarditis virus (EMCV) among rats. Veterinary Research, 35 (1): 113-22.

Steen, D.A., McClure, C.J.W., Brock, J.C., Rudolph, D.C., Pierce, J.B., Lee, J.R., Humphries, W.J., Gregory, B.B., Sutton, W.B., Smith, L.L., Baxley, D.L., Stevenson, D.J. and Guyer, C., 2014. Snake co-occurrence patterns are best explained by habitat and hypothesized effects of interspecific interactions. Journal of Animal Ecology, 83: 286-295.

Stephens, P.A., Sutherland, W.J. and Freckleton, R.P., 1999. What is the Allee effect? Oikos, 87: 185-190.

Stewart, P. and Barnett, S.A., 1981. Seasonal Influences on the Movements of Bush Rats, Rattus fuscipes, in an Artificial Environment. Australian Journal of Zoology, 29 (1): 41-48.

Stokes, V.L., Banks, P.B., Pech, R.P. and Williams, R.L., 2009a. Invasion by Rattus rattus into native coastal forests of south-eastern Australia: are native small mammals at risk? Austral Ecology, 34: 395-408.

196

References

Stokes, V.L., Banks, P.B., Pech, R.P. and Spratt, D.M., 2009b. Competition in an invaded rodent community reveals black rats as a threat to native bush rats in littoral rainforest of south-eastern Australia. Journal of Applied Ecology, 46: 1239-1247.

Stokes, V.L., Banks, P.B. and Pech, R.P., 2012. Influence of residency and social odors in interactions between competing native and alien rodents. Behavioral Ecology and Sociobiology, 66: 329-338.

Streatfeild, C.A., Mabry, K.E., Keane, B., Crist, T.O. and Solomon, N.G., 2011. Intraspecific variability in the social and genetic mating systems of prairie voles, Microtus ochrogaster. Animal Behaviour, 82: 1387-1398.

Sugg, D.W., Chesser, R.K., Dobson, F.S. and Hoogland, J.L., 1996. Population genetics meets behavioral ecology. TREE, 11 (8): 338-342.

Sullivan, T.P., Sullivan, D.S. and Krebs, C.J., 1983. Demographic responses of a chipmunk (Eutamias townsendii) population with supplemental food. Journal of Animal Ecology, 52 (3): 743-755.

Sullivan, B.K., Kwiatkowski, M.A. and Schuett, G.W., 2004. Translocation of urban Gila monsters: a problematic conservation tool. Biological Conservation, 17: 235- 242.

Sundell, J., Dudek, D., Klemme, I., Koivisto, E., Pusenius, J. and Ylönen, H., 2004. Variation in predation risk and vole feeding behaviour: a field test of the risk allocation hypothesis. Oecologia, 139: 157-162.

Sutton, A.E., 2015. Leadership and management influences the outcome of wildlife reintroduction programs: findings from the Sea Eagle Recovery Project. PeerJ, 3: e1012.

Tarszisz, E., Dickman, C.R. and Munn, A.J., 2014. Physiology in conservation translocations. Conservation Physiology, 2: 1-19.

Taylor, J.M. and Calaby, J.H., 1988. Rattus fuscipes. Mammalian Species, 298: 1-8.

197

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Tear, T.H., Scott, J.M., Hayward, P.H. and Griffith, B., 1993. Status and prospects for success of the Endangered Species Act: a look at recovery plans. Science, 262: 976-977.

Teixeira, C.P., De Azevedo, C.S., Mendl, M., Cipreste, C.F. and Young, R.J., 2007. Revisiting translocation and reintroduction programmes: the importance of considering stress. Animal Behaviour, 73: 1-13.

Travis, S.E. and Slobodchikoff, C.N., 1993. Effects of food resource distribution on the social system of Gunnison's prairie dog (Cynomys gunnisoni). Canadian Journal of Zoology, 71 (6): 1186-1192.

Travis, S.E., Slobodchikoff, C.N. and Keim, P., 1995. Ecological and demographic effects on intraspecific variation in the social system of prairie dogs. Ecology, 76: 1794-1803.

Tuberville, T.D., Clark, E.E., Buhlmann, K.A. and Gibbons, J.W., 2005. Translocation as a conservation tool: site fidelity and movement of repatriated gopher tortoises (Gopherus polyphemus). Animal Conservation, 8: 349-358.

University of Sydney, 2011. The real rat race, how to tell the difference between native rats and pest black rats, viewed November 2015: http://sydney.edu.au/news/84.html?newsstoryid=7489

Van Zant, J.L. and Wooten, M.C., 2003. Translocation of Choctawhatchee beach mice (Peromyscus polionotus allophrys): hard lessons learned. Biological Conservation, 112 (3): 405-413.

Veit, R.R. and Lewis, M.A., 1996. Dispersal, population growth, and the Allee effect: dynamics of the house finch invasion of eastern North America. The American Naturalist, 148 (2): 255-274.

Vergnes, A., Kerbirious, C. and Clergeau, P., 2013. Ecological corridors also operate in an urban matrix: a test case with garden shrews. Urban Ecosystems, 16 (3): 511-525.

198

References

Vincent, C., Goettel, M.S. and Lazarovits, G., 2007. Biological Control: A Global Perspective. Case Studies from Around the World. CAB International: Oxfordshire, UK.

Vitousek, P.M., D’Antonio, C.M., Loope, L.L. and Westbrooks, R., 1996. Biological invasions as global environmental change. American Scientist, 84: 468-478.

Vitousek, P.M., D’Antonio, C.M., Loope, L.L., Rejmanek, M. and Westbrooks, R., 1997. Introduced species: a significant component of human induced global change. New Zealand Journal of Ecology, 21: 1-16.

Wagner, A.P., Creel, S. and Kalinowski, S.T., 2006. Estimating relatedness and relationships using microsatellite loci with null alleles. Heredity, 97: 336-345.

Wang, J., 2004. Sibship reconstruction from genetic data with typing errors. Genetics, 166: 1963-1979.

Wang, J., 2012. Computationally efficient sibship and parentage assignment from multilocus marker data. Genetics, 191: 183-194.

Wang, J, and Santure, A.W., 2009. Parentage and sib-ship inference from multilocus genotype data under polygamy. Genetics, 181: 1579-1594.

Warneke, R.M., 1971. Field study of the bush rat (Rattus fuscipes). Wildlife Contributions Number 14, Fisheries and Wildlife Department: Victoria, Australia.

Warren, C.C., Motyka, P.J. and Mounce, H.L., 2015. Home range sizes of two Hawaiian honeycreepers: implications for proposed translocation efforts. Journal of Field Ornithology, 86 (4): 305-316

Watson, A.J. and Halley, M., 2000. Draft Recovery Plan for the Eastern Barred Bandicoot Perameles gunnii (mainland subspecies). Department of Natural Resources and Environment: Victoria.

Watson, D.M. and Watson, M.J., 2015. Wildlife restoration: Mainstreaming translocations to keep common species common. Biological Conservation, 191: 830-838.

Watts, C.H.S. and Aslin, H.J., 1981. The Rodents of Australia. Angus and Robertson: Sydney.

199

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Watts, C.H.S. and Braithwaite, R.W., 1978. The diet of Rattus lutreolus and five other rodents in southern Victoria. Australian Wildlife Research, 5: 47-57.

Wauters, L., Casale. P. and Fornasari, L., 1997. Post‐release behaviour, home range establishment and settlement success of reintroduced red squirrels. Italian Journal of Zoology, 64 (2): 169-175.

Wauters, L.A., Lurz, P.W.W. and Gurnell, J., 2000. The interspecific effects of grey squirrels (Sciurus carolinensis) on the space use and population demography of red squirrels (S. vulgaris) in conifer plantations. Ecological Research, 15: 271- 284.

Wauters, L.A., Preatoni, D.G., Molinari, A. and Tosi, G., 2007. Radio-tracking squirrels: Performance of home range density and linkage estimators with small range and sample size. Ecological Modelling, 202: 333-344.

Weir, B.S. and Cockerham, C.C., 1984. Estimating F-statistics for the analysis of population structure. Evolution, 38: 1358-1370.

Weiss, I.C., Pryce, C.R., Jongen-Relo, A.L., Nanz-Bahr, N.I. and Feldon, J., 2004. Effect of social isolation on stress-related behavioural and neuroendocrine state in the rat. Behavioural Brain Research, 152: 279-295.

West, S.A., Pen, I. and Griffin, A.S., 2002. Cooperation and competition between relatives. Science, 296: 72-75.

Wey, T., Blumstein, D.T., Shen, W. and Jordán, F., 2008. Social network analysis of animal behaviour: a promising tool for the study of sociality. Animal Behaviour, 75: 333-344.

White, G.C. and Burnham, K.P., 1999. Program mark: survival estimation from populations of marked animals. Bird Study, 46: 120-139.

White, R.M., Kennaway, D.J. and Seamark, R.F., 1996. Reproductive Seasonality of the Bush Rat (Rattus fuscipes greyi) in South Australia. Wildlife Research, 23: 317-336.

200

References

Whitehead, H. and Dufault, S., 1999. Techniques for analysing vertebrate social structure using identified individuals: Review and recommendations. Advances in the Study of Behavior, 28: 33-74.

Williams, R.L., Singleton, G.R. and Dickman, C.R., 2003. The role of interspecific competition in determining macrohabitat use by the black rat and brown rat at Bradley's Head, NSW. In G.R. Singleton, L.A. Hinds, C.J. Krebs and D.M. Spratt (eds.), Rats, Mice and People: Rodent Biology and Management, ACIAR: Canberra, 366-370.

Wiszniewski, J., Corrigan, S., Beheregaray L.B. and Möller, L.M., 2011. Male reproductive success increases with alliance size in Indo-Pacific bottlenose dolphins (Tursiops aduncus). Journal of Animal Ecology, 81 (2): 423-431.

Wolf, C.M., Griffith, B., Reed, C. and Temple, S.A., 1996. Avian and mammalian translocations: update and reanalysis of 1987 survey data. Conservation Biology, 10: 1142-1154.

Wolf, C.M., Garland, T.J., Griffith, B., 1998. Predictors of avian and mammalian translocation success: reanalysis with phylogenetically independent contrasts. Biological Conservation, 86: 243-255.

Wolf, J.B.W., Mawdsley, D., Trillmich, F. and James, R., 2007. Social structure in a colonial mammal: unravelling hidden structural layers and their foundations by network analysis. Animal Behaviour, 74: 1293-1302.

Wolff, J.O., Freeberg, M.H. and Dueser, R.D., 1983. Interspecific territoriality in two species of Peromyscus (Rodentia: Cricetidae). Behavioral Ecology and Sociobiology, 12: 237-242.

Wood, D.H., 1971. The ecology of Rattus fuscipes and Melomys cervinipes (Rodentia: Muridae) in a South-East Queensland rain forest. Australian Journal of Zoology, 19: 371-392.

Woodside, D.P., 1983. The role of social behaviour and spacing in populations of the bush rat, Rattus fuscipes. Doctor of Philosophy in Zoology, Australian National University.

201

Megan Callander – Translocation and Reintroduction of Native Bush Rats

Worton, B.J., 1989. Kernel methods for estimating the utilisation distribution in home range studies. Ecology, 70: 164-168.

Yezerinac, S.M., Weatherhead, P.J. and Boag, P.T., 1995. Extra-pair paternity and the opportunity for sexual selection in a socially monogamous bird (Dendroica petechia). Behavioral Ecology and Sociobiology, 37: 179-188.

Ylönen, H., Mappes, T. and Viitala, J., 1990. Different demography of friends and strangers: An experiment on the impact of kinship and familiarity in Clethrionomys glareolus. Oecologia, 83: 333-337.

Yoder, J.M., Marschall, E.A. and Swanson, D.A., 2004. The cost of dispersal: predation as a function of movement and site familiarity in ruffed grouse. Behavioral Ecology, 15 (3): 469-476.

Yott, A., Rossatte, R., Schaefer, J.A., Hamr, J. and Fryxell, J., 2010. Movement and spread of a founding population of reintroduced elk (Cervus elaphus) in Ontario, Canada. Restoration Ecology, 19: 70-77.

Ziv, Y., Abramsky, Z., Kotler, B.P. and Subach, A., 1993. Interference competition and temporal and habitat partitioning in two gerbil species. Oikos, 66: 237-246.

Ziv, Y., Kotler, B.P., Abramsky, Z. and Rosenzweig, M.L., 1995. Foraging efficiencies of competing rodents: why do gerbils exhibit shared-preference habitat selection? Oikos, 73: 260-268.

202