DOCSLIB.ORG

Asterotremella Gen. Nov. Albida, an Anamorphic Tremelloid Yeast Isolated from the Agarics Asterophora Lycoperdoides and Asterophora Parasitica

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Asterotremella Gen. Nov. Albida, an Anamorphic Tremelloid Yeast Isolated from the Agarics Asterophora Lycoperdoides and Asterophora Parasitica J. Gen. Appl. Microbiol., 53, 167–175 (2007) Full Paper Asterotremella gen. nov. albida, an anamorphic tremelloid yeast isolated from the agarics Asterophora lycoperdoides and Asterophora parasitica Hansjörg Prillinger,1,* Ksenija Lopandic,1 Takashi Sugita,2 and Michael Wuczkowski1 1 University of Natural Resources and Applied Life Sciences, Institute of Applied Microbiology (IAM), Austrian Center of Biological Resources and Applied Mycology (ACBR), Muthgasse 18, 1190 Wien, Austria 2 Meiji Pharmaceutical University, Department of Microbiology, Noshio, Kiyose 204–8588, Japan (Received October 23, 2006; Accepted March 12, 2007) Using a genotypic approach (PCR-fingerprinting, DNA/DNA reassociation, partial sequences of the 26S rDNA gene, complete sequences of the 18S rDNA gene, and sequences of the internal transcribed spacers) five tremelloid yeast isolates from the agarics Asterophora lycoperdoides and A. parasitica were shown to be conspecific with Cryptococcus ramirezgomezianus. It was not possible to distinguish the yeast strains from A. lycoperdoides and A. parasitica using se- quences from the intergenic spacer (IGS1). Phylogeny based on the 26S (D1/D2-domain), ITS1- 5.8S-ITS2 and complete 18S rDNA demonstrated that C. ramirezgomezianus is closely related to several additional Cryptococcus species (C. humicola, C. longus, C. musci, C. pseudolongus) within the Trichosporonales. A new genus, Asterotremella, and a new family, Asterotremellaceae were introduced for Cryptococcus species clustering within the Trichosporonales having a ubiquinone Q-9. Cryptococcus ramirezgomezianus is a synonym of Asterotremella albida. Key Words—Asterotremella gen. nov. albida; Asterotremellaceae fam. nov.; Cryptococcus humicola; Hymenomycetes; Tremellales; Trichosporonales; 18S-26S-ITS-IGS r-DNA Introduction al., 1988, 1989; Prillinger, 1987a). The term tremelloid was suggested by Oberwinkler (Laaser et al., 1988; When culturing the pileitrama of young fruit bodies Oberwinkler pers. comm.) for budding yeasts having a of the two mycoparasitic agarics, Asterophora lycoper- cup-shaped parenthesom. The yeasts appeared infre- doides (Bull.: Fr.) Ditmar and A. parasitica (Bull.: Fr.) quently after 8–16 days in axenic cultures on different Singer, two tremelloid yeasts were detected (Laaser et media. With A. lycoperdoides the isolation procedure was successfully repeated in the following years, lead- * Address reprint requests to: Dr. Hansjörg Prillinger, Univer- ing to yeast strains from three different localities in sity of Natural Resources and Applied Life Sciences, Institute of Bavaria, Germany. In subcultures of the original yeast Applied Microbiology (IAM), Austrian Center of Biological Re- isolates from both species, Asterophora fruit bodies sources and Applied Mycology (ACBR), Muthgasse 18, A11190 developed after 4–6 weeks (Prillinger, 1986). Attempts Wien, Austria. to isolate yeasts from Asterophora chlamydospores of Tel: ϩ43–1–36006 6207 Fax: ϩ43–1–3697615 E-mail: [email protected] artificially grown fruit bodies were successful in our Abbreviations: ITS, internal transcribed spacer; IGS, inter- first A. lycoperdoides mycelial strain (Prillinger, 1986). genic spacer. The yeast isolates of the two agarics A. lycoperdoides 168 PRILLINGER et al. Vol. 53 and A. parasitica could not be distinguished using each primer, 5–20 ng of DNA preparation and 1.25 U physiological tests (Laaser et al., 1989). These test BioTherm-DNA-Polymerase (GeneCraft). A total of 36 showed also that Cryptococcus humicola and Trich- amplification cycles were performed in a Trio-Ther- osporon cutaneum were the closest relatives. Restric- moblock TB1 thermocycler (Biometra): 98°C, 15 s; tion fragment analysis of the mitochondrial DNA 59°C, 1 min; 72°C, 2 min. The reaction was completed (Prillinger, 1987a) and of the ribosomal DNA (Laaser by a last elongation step at 72°C for 10 min. To remove et al., 1989) showed insignificant differences between the remaining primers and nucleotides, the PCR pro- the two yeast strains. These differences, however, ducts were purified by QIAquick PCR Purification Kit could not be corroborated by PCR-fingerprinting (Qiagen). A 611 bp long fragment was sequenced with (Prillinger, unpublished data). primers NL1 (GCATATCAATAAGCGGAGGAAAAG) To clarify the taxonomic and phylogenetic relation- and NL4 (GGTCCGTGTTTCAAGACGG) (White et al., ship of the A. lycoperdoides and A. parasitica yeast 1990) on an ABI 3100 Avant Sequencer (Applied isolates we have performed DNA/DNA reassociation Biosystems, Foster City, USA). Sequences of the experiments and DNA sequencing of the following ri- strains HB81 (AM265553) and HB82 (AM265554) bosomal DNA regions: 18S rDNA; D1/D2-domain of were deposited at the EMBL data library. 26S rDNA; ITS1-5.8-ITS2 and IGS1. We propose a Sequencing of 18S rRNA encoding gene. A frag- new genus for Cryptococcus species with a ment of approximately 2 kb was amplified with the ubiquinone Q-9 clustering within the Trichosporonales primers NS0 (TATCTGGTTGATCCTGCC) and ITS2p (Takashima et al., 2001). (GCTGCGTTCTTCATCGATGC) under the conditions described in the former paragraph. Primers used for Materials and Methods the sequencing of a 1,795 bp long fragment of the 18S rRNA encoding gene were those as described by Strains.Yeast isolates from the agaric fungus Lopandic et al. (2004). Sequences of the strains HB81 Asterophora lycoperdoides (MB 215ϭCBS 170.86): (AJ496260) and HB82 (AJ496261) were deposited at HB 81ϭCBS 10411 leg. H. Prillinger, 10.10. 1984, the EMBL data library. Pirkensee near Regensburg, Bavaria, Germany; HB Sequencing of ITS regions. A fragment of approx. 466ϭCBS 10413 leg. U. Passauer, 20. 9. 1994, Of- 2 kb was amplified by the primers 18/1184 (GACT- fensee near Ebensee, O.Ö. Austria. Yeast isolates CAACACGGGGAAACTC) and NL4 (GGTCCGTGT- from the agaric fungus A. parasitica (MB 217ϭCBS TTCAAGACGG) under the above described condi- 683.82): HB 82ϭCBS 7989 leg. H. Prillinger, 19. 9. tions. A 496 bp long fragment of the ITS1-5.8S-ITS2 1985, Paintner Forst near Regensburg, Bavaria, Ger- region was sequenced with primers ITS1p (TCCG- many; HB 467ϭCBS 10414 and HB 468ϭCBS 10415 TAGGTGAACCTGCGG) and ITS4p (TCCTCCGCT- leg. H. Schmid, 20. 9. 1994, Offensee near Ebensee, TATTGATATGC) (White et al., 1990). Sequences of O.Ö. Austria. Cryptococcus ramirezgomezianus CBS the strains HB81 (AM265555) and HB82 (AM265556) 2839TϭJCM 1460TϭHB 1256T; leg C. Ramirez were deposited at the EMBL data library. Gómez, rotten toadstool, France. Additional yeast Sequencing of IGS1 region. The IGS1 regions strains and accession numbers are listed in Table 1. were determined according to Sugita et al. (2002) by DNA preparation. Genomic DNA was extracted using the primers 26SF (ATCCTTTGCAGACGACT- and purified as described by Lopandic et al. (2004). TGA) and 5SR (AGCTTGACTTCGCAGATCGG). Am- Partial sequencing of 26S rRNA encoding gene. plification was conducted under the following condi- Sequencing of the D1/D2 domain of 26S rDNA was tions: initial denaturation at 94°C, 3 min, followed by carried out as described by Lopandic et al. (2004) with 30 cycles of 94°C, 30 s, 57°C, 30 s and 72°C, 1 min minor modification. A fragment of about 2 kb was am- and a final extension at 72°C, 10 min. The 687 bp plified by polymerase chain reaction with the primers long IGS1 sequences of strains HB81 (AM265557), ITS3p (GCATCGATGAAGAACGCAGC) and YAM2 HB82 (AM265558), HB466 (AM265559) and HB467 (CGACTTCCCTTATCTACATT). The PCR was per- (AM265560) were deposited at the EMBL data library. formed in 50 ml reaction mixture containing Tris-based Phylogenetic analysis. Sequences of the 26S buffer pH 8.8, 4.5 mM MgSO4, 0.2 mM of each de- (D1/D2 region), 5.8S-ITS and 18S rDNA were com- oxynucleotide triphosphate (Peqlab), 0.1 pmol mlϪ1 of bined and aligned using the ClustalX program (Thomp- 2007 Asterotremella gen. nov. 169 Table 1. Yeast and fungal isolates used in this study with their respective Genbank accession numbers. Genbank accession numberc Other Strain ACBR No.a designationb 18S rDNA 26S rDNA 5.8S-ITS Agaricus campestris DQ113914 AY207134 Asterophora lycoperdoides MB 215 CBS 170.86 AJ496254 AF223190 A. parasitica MB 217 CBS 683.82 AJ496255 AF223191 AF357038 Asterotremella albida HB 81 CBS 10411 AJ496260 AM265553 AM265555 A. albida HB 82 CBS 7989 AJ496261 AM265554 AM265556 A. albida HB 466 AM265559 A. albida HB 467 AM265560 A. albida HB 468 A. albida (Cryptococcus ramirezgomezianus) HB 1256T CBS 2839T AB039285 AB126584 AB035578 A. (Cryptococcus) humicola CBS 571T AB032637 AF189836 AB035572 A. (Cryptococcus) longa CBS 5920T AB035586 AB126585 AB035577 A. (Cryptococcus) pseudolonga CBS 8297T AB051047 AB126587 AB051048 Bullera dendrophila CBS 6074T D31649 AF189870 AF444443 Cryptococcus aerius CBS 155T AB032614 AF075486 AF145324 C. albidus CBS 142T AB032616 AF075474 AF14532 C. amylolentus CBS 6039T AB032619 AF105391 AF444306 C. curvatus CBS 570T AB032626 AF189834 AB035574 C. daszewskae CBS 5123T AB035582 AB126588 AB035580 C. fragicola CBS 8898T AB035588 AB126585 AB035588 C. musci CBS 8899T AB039378 AB126586 AB035579 C. neoformans ATCC 24067 L05428 Filobasidium uniguttulatum CBS 1730T AB032664 AF075468 AB032692 Guehomyces pullulans CBS 2532T AB001766 AF105394 AF444417 Kurtzmanomyces nectairei CBS 6405T D64122 AF177409 AF444494 Sporobolomyces roseus CBS 486T X60181 AF070441 AB030351 Tremella globospora Un. Of Calif. U00976 Trichosporon brassicae CBS 6382T AB001731 AF075521 AF444436 T. caseorum HB 819T CBS 9052T AJ319754 AJ319757 AJ319758 T. cutaneum CBS 2466T AB001753 AF075483
Load more

Recommended publications
  • Laboulbeniomycetes, Eni... Historyâ
    Laboulbeniomycetes, Enigmatic Fungi With a Turbulent Taxonomic History☆ Danny Haelewaters, Purdue University, West Lafayette, IN, United States; Ghent University, Ghent, Belgium; Universidad Autónoma ̌ de Chiriquí, David, Panama; and University of South Bohemia, Ceské Budejovice,̌ Czech Republic Michał Gorczak, University of Warsaw, Warszawa, Poland Patricia Kaishian, Purdue University, West Lafayette, IN, United States and State University of New York, Syracuse, NY, United States André De Kesel, Meise Botanic Garden, Meise, Belgium Meredith Blackwell, Louisiana State University, Baton Rouge, LA, United States and University of South Carolina, Columbia, SC, United States r 2021 Elsevier Inc. All rights reserved. From Roland Thaxter to the Present: Synergy Among Mycologists, Entomologists, Parasitologists Laboulbeniales were discovered in the middle of the 19th century, rather late in mycological history (Anonymous, 1849; Rouget, 1850; Robin, 1852, 1853; Mayr, 1853). After their discovery and eventually their recognition as fungi, occasional reports increased species numbers and broadened host ranges and geographical distributions; however, it was not until the fundamental work of Thaxter (1896, 1908, 1924, 1926, 1931), who made numerous collections but also acquired infected insects from correspondents, that the Laboulbeniales became better known among mycologists and entomologists. Thaxter set the stage for progress by describing a remarkable number of taxa: 103 genera and 1260 species. Fewer than 25 species of Pyxidiophora in the Pyxidiophorales are known. Many have been collected rarely, often described from single collections and never encountered again. They probably are more common and diverse than known collections indicate, but their rapid development in hidden habitats and difficulty of cultivation make species of Pyxidiophora easily overlooked and, thus, underreported (Blackwell and Malloch, 1989a,b; Malloch and Blackwell, 1993; Jacobs et al., 2005; Gams and Arnold, 2007).
    [Show full text]
  • Fungal Allergy and Pathogenicity 20130415 112934.Pdf
    Fungal Allergy and Pathogenicity Chemical Immunology Vol. 81 Series Editors Luciano Adorini, Milan Ken-ichi Arai, Tokyo Claudia Berek, Berlin Anne-Marie Schmitt-Verhulst, Marseille Basel · Freiburg · Paris · London · New York · New Delhi · Bangkok · Singapore · Tokyo · Sydney Fungal Allergy and Pathogenicity Volume Editors Michael Breitenbach, Salzburg Reto Crameri, Davos Samuel B. Lehrer, New Orleans, La. 48 figures, 11 in color and 22 tables, 2002 Basel · Freiburg · Paris · London · New York · New Delhi · Bangkok · Singapore · Tokyo · Sydney Chemical Immunology Formerly published as ‘Progress in Allergy’ (Founded 1939) Edited by Paul Kallos 1939–1988, Byron H. Waksman 1962–2002 Michael Breitenbach Professor, Department of Genetics and General Biology, University of Salzburg, Salzburg Reto Crameri Professor, Swiss Institute of Allergy and Asthma Research (SIAF), Davos Samuel B. Lehrer Professor, Clinical Immunology and Allergy, Tulane University School of Medicine, New Orleans, LA Bibliographic Indices. This publication is listed in bibliographic services, including Current Contents® and Index Medicus. Drug Dosage. The authors and the publisher have exerted every effort to ensure that drug selection and dosage set forth in this text are in accord with current recommendations and practice at the time of publication. However, in view of ongoing research, changes in government regulations, and the constant flow of information relating to drug therapy and drug reactions, the reader is urged to check the package insert for each drug for any change in indications and dosage and for added warnings and precautions. This is particularly important when the recommended agent is a new and/or infrequently employed drug. All rights reserved. No part of this publication may be translated into other languages, reproduced or utilized in any form or by any means electronic or mechanical, including photocopying, recording, microcopy- ing, or by any information storage and retrieval system, without permission in writing from the publisher.
    [Show full text]
  • November 2014
    MushRumors The Newsletter of the Northwest Mushroomers Association Volume 25, Issue 4 December 2014 After Arid Start, 2014 Mushroom Season Flourishes It All Came Together By Chuck Nafziger It all came together for the 2014 Wild Mushroom Show; an October with the perfect amount of rain for abundant mushrooms, an enthusiastic volunteer base, a Photo by Vince Biciunas great show publicity team, a warm sunny show day, and an increased public interest in foraging. Nadine Lihach, who took care of the admissions, reports that we blew away last year's record attendance by about 140 people. Add to that all the volunteers who put the show together, and we had well over 900 people involved. That's a huge event for our club. Nadine said, "... this was a record year at the entry gate: 862 attendees (includes children). Our previous high was in 2013: 723 attendees. Success is more measured in the happiness index of those attending, and many people stopped by on their way out to thank us for the wonderful show. Kids—and there were many—were especially delighted, and I'm sure there were some future mycophiles and mycologists in Sunday's crowd. The mushroom display A stunning entry display greets visitors arriving at the show. by the door was effective, as always, at luring people in. You could actually see the kids' eyes getting bigger as they surveyed the weird mushrooms, and twice during the day kids ran back to our table to tell us that they had spotted the mushroom fairy. There were many repeat adult visitors, too, often bearing mushrooms for identification.
    [Show full text]
  • 2006 Summer Workshop in Fungal Biology for High School Teachers Hibbett Lab, Biology Department, Clark University
    2006 Summer Workshop in Fungal Biology for High School Teachers Hibbett lab, Biology Department, Clark University Introduction to Fungal Biology—Morphology, Phylogeny, and Ecology General features of Fungi Fungi are very diverse. It is hard to define what a fungus is using only morphological criteria. Features shared by all fungi: • Eukaryotic cell structure (but some have highly reduced mitochondria) • Heterotrophic nutritional mode—meaning that they must ingest organic compounds for their carbon nutrition (but some live in close symbioses with photosynthetic algae—these are lichens) • Absorptive nutrition—meaning that they digest organic compounds with enzymes that are secreted extracellularly, and take up relatively simple, small molecules (e.g., sugars). • Cell walls composed of chitin—a polymer of nitrogen-containing sugars that is also found in the exoskeletons of arthropods. • Typically reproduce and disperse via spores Variable features of fungi: • Unicellular or multicellular—unicellular forms are called yeasts, multicellular forms are composed of filaments called hyphae. • With or without complex, multicellular fruiting bodies (reproductive structures) • Sexual or asexual reproduction • With or without flagella—if they have flagella, then these are the same as all other eukaryotic flagellae (i.e., with the “9+2” arrangement of microtubules, ensheathed by the plasma membrane) • Occur on land (including deserts) or in aquatic habitats (including deep-sea thermal vent communities) • Function as decomposers of dead organic matter or as symbionts of other living organisms—the latter include mutualists, pathogens, parasites, and commensals (examples to be given later) Familiar examples of fungi include mushrooms, molds, yeasts, lichens, puffballs, bracket fungi, and others. There are about 70,000 described species of fungi.
    [Show full text]
  • Aboveground Deadwood Deposition Supports Development of Soil Yeasts
    Diversity 2012, 4, 453-474; doi:10.3390/d4040453 OPEN ACCESS diversity ISSN 1424-2818 www.mdpi.com/journal/diversity Article Aboveground Deadwood Deposition Supports Development of Soil Yeasts Andrey Yurkov 1,*, Thorsten Wehde 2, Tiemo Kahl 3 and Dominik Begerow 2 1 Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures, Inhoffenstraße 7B, 38124 Braunschweig, Germany 2 Department of Evolution and Biodiversity of Plants, Faculty of Biology and Biotechnology, Ruhr- Universität Bochum, Universitätsstraße 150, 44780 Bochum, Germany; E-Mails: [email protected] (T.W.); [email protected] (D.B.) 3 Institute of Silviculture, University of Freiburg, Tennenbacherstraße 4, 79085 Freiburg, Germany; E-Mail: [email protected] (T.K.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +49-531-2616-239; Fax: +49-531-2616-418. Received: 16 October 2012; in revised form: 27 November 2012 / Accepted: 4 December 2012 / Published: 10 December 2012 Abstract: Unicellular saprobic fungi (yeasts) inhabit soils worldwide. Although yeast species typically occupy defined areas on the biome scale, their distribution patterns within a single type of vegetation, such as forests, are more complex. In order to understand factors that shape soil yeast communities, soils collected underneath decaying wood logs and under forest litter were analyzed. We isolated and identified molecularly a total of 25 yeast species, including three new species. Occurrence and distribution of yeasts isolated from these soils provide new insights into ecology and niche specialization of several soil- borne species. Although abundance of typical soil yeast species varied among experimental plots, the analysis of species abundance and community composition revealed a strong influence of wood log deposition and leakage of organic carbon.
    [Show full text]
  • Suomen Helttasienten Ja Tattien Ekologia, Levinneisyys Ja Uhanalaisuus
    Suomen ympäristö 769 LUONTO JA LUONNONVARAT Pertti Salo, Tuomo Niemelä, Ulla Nummela-Salo ja Esteri Ohenoja (toim.) Suomen helttasienten ja tattien ekologia, levinneisyys ja uhanalaisuus .......................... SUOMEN YMPÄRISTÖKESKUS Suomen ympäristö 769 Pertti Salo, Tuomo Niemelä, Ulla Nummela-Salo ja Esteri Ohenoja (toim.) Suomen helttasienten ja tattien ekologia, levinneisyys ja uhanalaisuus SUOMEN YMPÄRISTÖKESKUS Viittausohje Viitatessa tämän raportin lukuihin, käytetään lukujen otsikoita ja lukujen kirjoittajien nimiä: Esim. luku 5.2: Kytövuori, I., Nummela-Salo, U., Ohenoja, E., Salo, P. & Vauras, J. 2005: Helttasienten ja tattien levinneisyystaulukko. Julk.: Salo, P., Niemelä, T., Nummela-Salo, U. & Ohenoja, E. (toim.). Suomen helttasienten ja tattien ekologia, levin- neisyys ja uhanalaisuus. Suomen ympäristökeskus, Helsinki. Suomen ympäristö 769. Ss. 109-224. Recommended citation E.g. chapter 5.2: Kytövuori, I., Nummela-Salo, U., Ohenoja, E., Salo, P. & Vauras, J. 2005: Helttasienten ja tattien levinneisyystaulukko. Distribution table of agarics and boletes in Finland. Publ.: Salo, P., Niemelä, T., Nummela- Salo, U. & Ohenoja, E. (eds.). Suomen helttasienten ja tattien ekologia, levinneisyys ja uhanalaisuus. Suomen ympäristökeskus, Helsinki. Suomen ympäristö 769. Pp. 109-224. Julkaisu on saatavana myös Internetistä: www.ymparisto.fi/julkaisut ISBN 952-11-1996-9 (nid.) ISBN 952-11-1997-7 (PDF) ISSN 1238-7312 Kannen kuvat / Cover pictures Vasen ylä / Top left: Paljakkaa. Utsjoki. Treeless alpine tundra zone. Utsjoki. Kuva / Photo: Esteri Ohenoja Vasen ala / Down left: Jalopuulehtoa. Parainen, Lenholm. Quercus robur forest. Parainen, Lenholm. Kuva / Photo: Tuomo Niemelä Oikea ylä / Top right: Lehtolohisieni (Laccaria amethystina). Amethyst Deceiver (Laccaria amethystina). Kuva / Photo: Pertti Salo Oikea ala / Down right: Vanhaa metsää. Sodankylä, Luosto. Old virgin forest. Sodankylä, Luosto. Kuva / Photo: Tuomo Niemelä Takakansi / Back cover: Ukonsieni (Macrolepiota procera).
    [Show full text]
  • Towards an Integrated Phylogenetic Classification of the Tremellomycetes
    http://www.diva-portal.org This is the published version of a paper published in Studies in mycology. Citation for the original published paper (version of record): Liu, X., Wang, Q., Göker, M., Groenewald, M., Kachalkin, A. et al. (2016) Towards an integrated phylogenetic classification of the Tremellomycetes. Studies in mycology, 81: 85 http://dx.doi.org/10.1016/j.simyco.2015.12.001 Access to the published version may require subscription. N.B. When citing this work, cite the original published paper. Permanent link to this version: http://urn.kb.se/resolve?urn=urn:nbn:se:nrm:diva-1703 available online at www.studiesinmycology.org STUDIES IN MYCOLOGY 81: 85–147. Towards an integrated phylogenetic classification of the Tremellomycetes X.-Z. Liu1,2, Q.-M. Wang1,2, M. Göker3, M. Groenewald2, A.V. Kachalkin4, H.T. Lumbsch5, A.M. Millanes6, M. Wedin7, A.M. Yurkov3, T. Boekhout1,2,8*, and F.-Y. Bai1,2* 1State Key Laboratory for Mycology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, PR China; 2CBS Fungal Biodiversity Centre (CBS-KNAW), Uppsalalaan 8, Utrecht, The Netherlands; 3Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures, Braunschweig 38124, Germany; 4Faculty of Soil Science, Lomonosov Moscow State University, Moscow 119991, Russia; 5Science & Education, The Field Museum, 1400 S. Lake Shore Drive, Chicago, IL 60605, USA; 6Departamento de Biología y Geología, Física y Química Inorganica, Universidad Rey Juan Carlos, E-28933 Mostoles, Spain; 7Department of Botany, Swedish Museum of Natural History, P.O. Box 50007, SE-10405 Stockholm, Sweden; 8Shanghai Key Laboratory of Molecular Medical Mycology, Changzheng Hospital, Second Military Medical University, Shanghai, PR China *Correspondence: F.-Y.
    [Show full text]
  • Addis Ababa University School of Graduate Studies
    ADDIS ABABA UNIVERSITY SCHOOL OF GRADUATE STUDIES DEPARTMENT OF MICROBIAL, CELLULAR AND MOLECULAR BIOLOGY ISOLATION OF OLEAGINOUS YEASTS AND OPTIMIZATION OF SINGLE CELL OIL FOR BIODIESEL PRODUCTION BY TAMENE MILKESSA JIRU SUPERVISOR DAWIT ABATE (PHD) MAY, 2017 ADDIS ABABA ADDIS ABABA UNIVERSITY SCHOOL OF GRADUATE STUDIES ISOLATION OF OLEAGINOUS YEASTS AND OPTIMIZATION OF SINGLE CELL OIL FOR BIODIESEL PRODUCTION By Tamene Milkessa Jiru A Thesis submitted to School of Graduate Studies of the Addis Ababa University in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy (PhD) in Biology (Applied Microbiology) Approved by Examining Board Name Signature Dr. Gurja Belay Chairperson ------------------------------- Dr. Dawit Abate Advisor --------------------------------- Prof. James Chukwuma External Examiner -------------------------------- Dr. Amare Gessesse Internal Examiner -------------------------------- Abstract Oleaginous yeasts are known to produce oil with high potential as source of biodiesel. In this study, 340 yeast colonies were isolated from 200 samples that were collected from natural sources in Ethiopia. All the yeast isolates were screened using Sudan III staining for oil production. Among these, 18 were selected as possible oleaginous yeasts. Identification of the 18 isolates was done using morphological and physiological methods as well as sequencing of the internal transcribed spacer regions (ITS; ITS 1, ITS 2 and the intervening 5.8S rRNA gene), and the D1/D2 domain of the 26S rRNA gene. Molecular phylogenetic analyses indicate that isolates PY39, SY89 and SY94 are species of Cryptococcus curvatus, Rhodosporidium kratochvilovae and Rhodotorula dairenensis, respectively, while the rest (SY09, SY18, SY20, PY21, PY23, PY25, SY30, PY32, SY43, PY44, SY52, PY55, PY61, SY75, and PY86) were identified as Rhodotorula mucilaginosa.
    [Show full text]
  • Johnnie Forest Management Project Tiller Ranger District Umpqua National Forest Johnnie Forest Management Project Environmental Assessment
    Johnnie Forest United States Department of Agriculture Forest Service Management Project Pacific Northwest Region Umpqua National Forest Tiller Ranger District March 2013 2 Johnnie Forest Management Project Tiller Ranger District Umpqua National Forest Johnnie Forest Management Project Environmental Assessment Douglas County, Oregon March 2013 Lead Agency: USDA Forest Service, Umpqua National Forest Responsible Official: Donna L. Owens, District Ranger Tiller Ranger District Umpqua National Forest 27812 Tiller Trail Highway Tiller, Oregon 97484 Phone: (541)-825-3100 For More Information Contact: David Baker, ID Team Leader Tiller Ranger District Umpqua National Forest 27812 Tiller-Trail Highway Tiller, OR 97484 Phone: (541) 825-3149 Email: [email protected] Electronic comments can be mailed to: [email protected] Abstract: This Environmental Assessment (EA) analyzes a no-action alternative, and one action alternative that includes fuels treatment, pre-commercial thinning and commercially harvesting timber on approximately 3,305 acres, treating activity-generated fuels, conducting road work, and other connected actions. The proposed thinning units are located within Management Areas 10 and 11 of the Umpqua National Forest Land and Resource Management Plan (LRMP), as well as the Matrix, Late Seral Reserve (LSR) and Riparian Reserve land-use allocations defined by the Northwest Forest Plan (NWFP). The project area is located within the Middle South Umpqua watershed on the Tiller Ranger District. 3 Johnnie Forest Management Project Tiller Ranger District Umpqua National Forest The U.S. Department of Agriculture (USDA) prohibits discrimination in all its programs and activities on the basis of race, color, national origin, age, disability, and where applicable, sex, marital status, familial status, parental status, religion, sexual orientation, genetic information, political beliefs, reprisal, or because all or part of an individual’s income is derived from any public assistance program.
    [Show full text]
  • 12 Tremellomycetes and Related Groups
    12 Tremellomycetes and Related Groups 1 1 2 1 MICHAEL WEIß ,ROBERT BAUER ,JOSE´ PAULO SAMPAIO ,FRANZ OBERWINKLER CONTENTS I. Introduction I. Introduction ................................ 00 A. Historical Concepts. ................. 00 Tremellomycetes is a fungal group full of con- B. Modern View . ........................... 00 II. Morphology and Anatomy ................. 00 trasts. It includes jelly fungi with conspicuous A. Basidiocarps . ........................... 00 macroscopic basidiomes, such as some species B. Micromorphology . ................. 00 of Tremella, as well as macroscopically invisible C. Ultrastructure. ........................... 00 inhabitants of other fungal fruiting bodies and III. Life Cycles................................... 00 a plethora of species known so far only as A. Dimorphism . ........................... 00 B. Deviance from Dimorphism . ....... 00 asexual yeasts. Tremellomycetes may be benefi- IV. Ecology ...................................... 00 cial to humans, as exemplified by the produc- A. Mycoparasitism. ................. 00 tion of edible Tremella fruiting bodies whose B. Tremellomycetous Yeasts . ....... 00 production increased in China alone from 100 C. Animal and Human Pathogens . ....... 00 MT in 1998 to more than 250,000 MT in 2007 V. Biotechnological Applications ............. 00 VI. Phylogenetic Relationships ................ 00 (Chang and Wasser 2012), or extremely harm- VII. Taxonomy................................... 00 ful, such as the systemic human pathogen Cryp- A. Taxonomy in Flow
    [Show full text]
  • New and Bemarkable Hymenomycetes from Tropical Forests in Indonesia (Java) and Australasia E
    ZOBODAT - www.zobodat.at Zoologisch-Botanische Datenbank/Zoological-Botanical Database Digitale Literatur/Digital Literature Zeitschrift/Journal: Sydowia Jahr/Year: 1980 Band/Volume: 33 Autor(en)/Author(s): Horak Egon Artikel/Article: New and Remarkable Hymenomycetes from Tropical Forests in Indonesia (Java) and Australasia. 39-63 ©Verlag Ferdinand Berger & Söhne Ges.m.b.H., Horn, Austria, download unter www.biologiezentrum.at New and Bemarkable Hymenomycetes from Tropical Forests in Indonesia (Java) and Australasia E. HORAK Geobotanical Institute, BTHZ, CH-8092 Zürich, Switzerland Zusammenfassung. Aus Neuseeland, Neu Kaledonien, Neu Guinea und Java werden neue Arten von Boletales (Boletus perroseus sp. n. (1), B. phytolaccae sp. n. (2)) und Agaricales (Microcollybia conidiophora sp. n. (8), Macrocystidia reducta HK. & CAPELLANO sp. n. (11), Copelandia affinis sp. n. (14), Cuphocybe ferruginea sp. n. (17)) abgebildet und beschrieben. Anhand von frischem topo- typischem Material konnten Xerocomus junghuhnii (v. HOEHNEL) SINGER (3), Vanromburghia silvestris HOLTERMANN (5) und Camarophyllus lactarioides HENNINGS (7) — alle aus Java — nachuntersucht und deren systematische Stellung diskutiert werden. Neue Standorte werden für Mycenoporella lutea v. OVEREEM (6) in Neu Guinea und Afrika (Gabon) und für Pulveroboletus frians CORNER (4) in Neu Guinea mitgeteilt. Folgende Agaricales (deren Vorkommen nach bisheriger Kenntnis auf die temperierte Zone der Nord- und Südhemisphäre beschränkt war) sind jetzt auch in tropisch-montanen Wäldern des Fernen Ostens nachgewiesen: Asterophora parasitica (FB.) SINGER (9), A. lycoperdoides S. F. GRAY (10), Crueispora naucorioides HORAK (12), C. rhombisperma (HONGO) comb. iiov. (13), Descolea pretiosa HORAK (15) und D. gunnii (BERKELEY) HOEAK (16). Acknowledgements My thanks are duo to tho authorities of the Department of Forest both in New Zealand and Papua New Guinea for the opportunity to study tho fungi in these countries.
    [Show full text]
  • Panelli Fungalecology 2017
    Fungal Ecology 30 (2017) 1e9 Contents lists available at ScienceDirect Fungal Ecology journal homepage: www.elsevier.com/locate/funeco A metagenomic-based, cross-seasonal picture of fungal consortia associated with Italian soils subjected to different agricultural managements * Simona Panelli a, b, Enrica Capelli a, c, , Francesco Comandatore b, Angela Landinez-Torres a, d, Mirko Umberto Granata a, Solveig Tosi a, Anna Maria Picco a a Department of Earth and Environmental Sciences, University of Pavia, Via Ferrata 7, 27100, Pavia, Italy b Pediatric Clinical Research Center Romeo ed Enrica Invernizzi, University of Milan, Via G.B. Grassi 74, 20157, Milan, Italy c Centre for Health Technologies (C.H.T.), University of Pavia, Via Ferrata 1, 27100, Pavia, Italy d Fundacion Universitaria Juan de Castellanos, Carrera 11 No.11-40, Tunja, Boyaca, Colombia article info abstract Article history: This work pictures the biodiversity of fungal consortia inhabiting real agroecosystems, sampled in one Received 14 March 2017 production farm in two seasons (spring, autumn), coinciding with climate gradients and key moments of Received in revised form the agricultural cycle. Soil was sampled from three plots differently managed in terms of fertilization, 16 June 2017 pesticide and tillage application: conventional, organic, no-tillage. Metagenomic analyses on ITS1 Accepted 28 July 2017 amplicons depicted the highest indexes of richness for organic. No-tillage resulted in inhabitation by the most divergent communities, with their own composition, prevalence and seasonal trends. Ascomycota Corresponding Editor: Gareth W. Griffith. always predominated, with the exception of conventional, that had high abundance of a single basid- iomycete species. Our results showed evidence that agricultural soils under organic and no-tillage sys- Keywords: tems harbour distinct mycobiota, even in neighbouring fields.
    [Show full text]