bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

1 SIRT1 regulates sphingolipid metabolism and neural

2 differentiation of mouse embryonic stem cells through c-Myc-

3 SMPDL3B

4

5 Wei Fan,1 Shuang Tang, 1, 6 Xiaojuan Fan, 2 Yi Fang,1 Xiaojiang Xu, 3 Leping Li, 4 Jian Xu,

6 5 Jian-Liang Li, 3 Zefeng Wang, 2, * and Xiaoling Li 1, *

7

8 1Signal Transduction Laboratory, National Institute of Environmental Health Sciences,

9 Research Triangle Park, NC 27709, USA

10 2CAS Key Laboratory of Computational Biology, CAS-MPG Partner Institute for

11 Computational Biology, Shanghai Institute of Nutrition and Health, Shanghai Institutes for

12 Biological Sciences, University of Chinese Academy of Sciences, CAS Center for

13 Excellence in Molecular Cell Science, Chinese Academy of Sciences, Shanghai 200031,

14 China

15 3Integrative Bioinformatics Support Group, National Institute of Environmental Health

16 Sciences, Research Triangle Park, NC 27709, USA

17 4Biostatistics & Computational Biology Branch, National Institute of Environmental Health

18 Sciences, Research Triangle Park, NC 27709, USA

19 5Children's Medical Center Research Institute, Department of Pediatrics, Harold C.

20 Simmons Comprehensive Cancer Center, and Hamon Center for Regenerative Science

21 and Medicine, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA.

22 6Current address: Cancer Institute and Department of Nuclear Medicine, Fudan University

23 Shanghai Cancer Center, Shanghai 200032, China

24

25

1 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

26 * Correspondence: [email protected] (X. L.), [email protected] (Z. W.)

27 Short title: SIRT1 regulates sphingolipid metabolism

28 Key words: SIRT1; sphingomyelin degradation; embryonic stem cells; neural development;

29 embryogenesis; c-Myc

30

2 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

31 Abstract

32 Sphingolipids are important structural components of cell membranes and

33 prominent signaling molecules controlling cell growth, differentiation, and apoptosis.

34 Sphingolipids are particularly abundant in the brain, and defects in sphingolipid

35 degradation are associated with several human neurodegenerative diseases. However,

36 molecular mechanisms governing sphingolipid metabolism remain unclear. Here we

37 report that sphingolipid degradation is under transcriptional control of SIRT1, a highly

38 conserved mammalian NAD+-dependent protein deacetylase, in mouse embryonic stem

39 cells (mESCs). Deletion of SIRT1 results in accumulation of sphingomyelin in mESCs,

40 primarily due to reduction of SMPDL3B, a GPI-anchored plasma membrane bound

41 sphingomyelin phosphodiesterase. Mechanistically, SIRT1 regulates transcription of

42 Smpdl3b through c-Myc. Functionally, SIRT1 deficiency-induced accumulation of

43 sphingomyelin increases membrane fluidity and impairs neural differentiation in vitro and

44 in vivo. Our findings discover a key regulatory mechanism for sphingolipid homeostasis

45 and neural differentiation, further imply that pharmacological manipulation of SIRT1-

46 mediated sphingomyelin degradation might be beneficial for treatment of human

47 neurological diseases.

48

49

50

51

3 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

52 Introduction

53 First isolated from brain extract in the 1880s, sphingolipid is a class of natural lipids

54 containing a backbone of sphingoid base sphingosine (1-3). Sphingolipids not only are the

55 structural components of cell membranes, but also act as signaling molecules to control

56 various cellular events, including signal transduction, cell growth, differentiation, and

57 apoptosis (4, 5). Particularly, sphingolipids are enriched in microdomains/lipid rafts, a

58 liquid-ordered phase in plasma membrane, where sphingomyelin, glycosphingolipids and

59 cholesterol form unique platforms for many different proteins that are important for nutrient

60 transport, organelle contact, membrane trafficking, and homotypic fusion (6).

61 The homeostasis of sphingolipids is maintained by a highly coordinated metabolic

62 network that links together various pathways with ceramide as a central node (Figure S1A).

63 Firstly, ceramide can be de novo synthesized in endoplasmic reticulum (ER), starting from

64 the condensation of serine and fatty acyl-CoA by serine palmitoyltransferase (SPT).

65 Ceramide is then transported to the Golgi complex and further converted into more

66 complex forms of sphingolipids, such as glycosphingolipids or sphingomyelin. Secondly,

67 ceramide can be regenerated by hydrolysis of complex sphingolipids in the Golgi complex

68 and plasma membrane, which is catalyzed by a class of specific hydrolases and

69 phosphodiesterases. For example, regeneration of ceramide from sphingomyelin can be

70 mediated by plasma membrane bound sphingomyelin phosphodiesterases (SMPDs),

71 including SMPDL3B, a GPI-anchored lipid raft SMPD (7). By degrading sphingomyelin,

72 SMPDL3B regulates plasma membrane fluidity, which in turn impacts TLR-mediated

73 innate immunity in macrophages (7) and modulates insulin receptor signaling in podocytes

74 (8). Sphingolipid metabolism is highly sensitive to environmental/nutritional perturbations.

75 Sphingolipid biosynthesis and accumulation can be induced by high-fat diet (HFD) feeding

76 in multiple tissues in mice (9). Sphingolipids are also accumulated during aging (10, 11),

77 and caloric restriction, a dietary regimen known to extend life span and delay a number of

4 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

78 age-associated diseases, decreases sphingolipid accumulation by reducing the activity of

79 SPT (12). Dietary serine restriction also alters sphingolipid diversity and synthesis to

80 constrain tumor growth (13).

81 Disruption of sphingolipid homeostasis has been involved in the pathogenesis of

82 a number of human diseases, such as Niemann-Pick disease and neurodegenerative

83 Alzheimer’s, Parkinson’s, and Huntington’s diseases. These human diseases are

84 generally the outcome of defect in enzymes that degrade the sphingolipids (14, 15). Such

85 degradation defect leads to accumulation of sphingolipids, which in turn dramatically alters

86 cellular membrane structure and signaling, thereby triggering various diseases.

87 Consequently, manipulation of one enzyme or metabolite in sphingolipid degradation

88 pathways may result in unexpected changes in cellular metabolic programs and related

89 cellular functions (14, 15). However, molecular mechanisms that regulate the expression

90 of these sphingolipid degrading enzymes remain unclear.

91 In the present study, we investigated the role of SIRT1 in regulation of sphingolipid

92 degradation in mouse embryonic stem cells (mESCs) and mouse embryos. SIRT1 is a

93 NAD+-dependent protein deacetylase critical for multiple cellular processes, including

94 metabolism, inflammation, stress response, and stem cell functions (16-18). SIRT1 is also

95 a key regulator of animal development (19-21), and is particularly important in the central

96 nervous system. For instance, SIRT1 has a major influence on hypothalamic function, and

97 cell-type specific SIRT1 mutations result in defects in systemic energy metabolism,

98 circadian rhythm, and the lifespan of the animal (22-25). SIRT1 also modulates dendritic

99 and axonal growth (26, 27), and regulates synaptic plasticity and memory formation in

100 adult brain (28). Moreover, SIRT1 has been shown to ameliorate neurodegenerative

101 phenotypes in animal models of Alzheimer’s, Parkinson’s, and Huntington’s disease

102 (reviewed in (29)). However, despite multiple mechanisms proposed for these critical roles

103 of SIRT1 in the brain, how SIRT1 regulates neural development and function remain

5 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

104 unclear. Through global metabolomics and cellular metabolic characterizations, we

105 discovered that SIRT1 deficiency in mESCs results in abnormal accumulation of

106 sphingolipids, primarily due to reduced degradation of these lipids. We further found that

107 this abnormal accumulation of sphingolipids does not affect the maintenance of pluripotent

108 mESCs, but delays their neural differentiation during in vitro neural differentiation and in

109 vivo mouse embryogenesis. Moreover, we provide evidence that SIRT1 regulates

110 sphingolipid metabolism through deacetylation of c-Myc transcription factor, which

111 promotes the expression of SMPDL3B and subsequent sphingomyelin degradation in

112 mESCs. Together, our study identifies the SIRT1-c-Myc axis as an important regulatory

113 mechanism for cellular sphingolipid metabolism and neural differentiation.

114

115 Results

116 Deletion of SIRT1 in ESCs results in accumulation of sphingomyelin

117 During a large-scale unbiased metabolomic analysis of WT and SIRT1 KO mESCs

118 cultured in a serum-containing M10 medium, we discovered that SIRT1 KO mESCs

119 display altered lipid metabolism, particularly metabolites involved in sphingolipid

120 metabolism (Figure 1A and Table S1), in addition to previously reported metabolic defects

121 in methionine metabolism (30). Specifically, SIRT1 KO mESCs had a dramatic

122 accumulation of sphingomyelin in both complete medium and a methionine restricted

123 medium (Figure 1B, S1B, and Table S1). Moreover, deletion of SIRT1 in mel1 human

124 ESCs by CRISPR/Cas9-mediated gene editing technology (Figure S1C) also led to

125 accumulation of several types of sphingomyelin regardless of medium methionine

126 contents (Table S2), indicating that SIRT1 regulates sphingolipid metabolism in ESCs

127 independently of cellular methionine metabolism.

128 To confirm that deletion of SIRT1 indeed increases sphingomyelin contents in

129 ESCs, we loaded WT and SIRT1 KO mESCs cultured in serum-free ESGRO medium with

6 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

130 a green-fluorescent dye labeled sphingomyelin, BODIPY FL-C5-sphingomyelin, for 30 min

131 at 4 °C, then chased at 37 °C for 30 min. Both WT and SIRT1 KO mESCs were labeled

132 with this green-fluorescent sphingomyelin (Figure 1C). However, SIRT1 KO mESCs had

133 marked accumulation of BODIPY FL-C5-sphingomyelin inside cells, presumably in ER

134 and Golgi, compared to WT mESCs. Quantitative FACS analysis showed that SIRT1 KO

135 mESCs have about a 50% increase in cellular levels of BODIPY FL-C5-sphingomyelin

136 compared to WT mESCs (Figure 1D). An enzyme-coupled colorimetric assay further

137 revealed a ~60% increase of endogenous sphingomyelin in SIRT1 KO mESCs (Figure

138 1E). Interestingly, the accumulation of sphingomyelin was specific to mESCs, as SIRT1

139 KO MEFs had a comparable staining intensity of BODIPY FL-C5-sphingomyelin as WT

140 MEFs (Figure S1D). Additionally, SIRT1 KO mESCs had a similar staining intensity of

141 BODIPY FL-N6-Ceramide compared to WT mESCs (Figure S1E), suggesting that

142 accumulation of sphingolipids in SIRT1 KO mESCs is specific to sphingomyelin.

143 SIRT1 KO mESCs in above analyses were previously generated in R1 mES cell

144 line using traditional gene targeting technology (19). To further confirm our observation

145 that SIRT1 deficiency in mESCs induces accumulation of sphingomyelin, we deleted Sirt1

146 gene in another widely-used full pluripotent mES cell line, E14 cells (31), by

147 CRISPR/Cas9-mediated gene editing technology (Figure 1F). Consistent with

148 observations in SIRT1 KO mESCs, these SIRT1 KO E14 mESC clones also had an

149 enhanced staining of BODIPY FL-C5-sphingomyelin when analyzed by confocal

150 fluorescence imaging (Figure 1G) and by quantitative FACS analysis (Figure 1H). Taken

151 together, our results indicate that deletion of SIRT1 in ESCs results in accumulation of

152 sphingomyelin in independent ES cell lines.

153

154 Deletion of SIRT1 induces accumulation of sphingomyelin through SMPDL3B

7 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

155 Cellular levels of sphingomyelin are regulated by a tight balance between their synthesis

156 and breakdown, which are mediated by activities of sphingomyelin synthases (SGMSs)

157 and sphingomyelin phosphodiesterases (SMPDs), respectively (Figure S1A). Many of

158 these enzymes were highly expressed in mESCs (Figure S2A and S2B). To better

159 understand how SIRT1 deficiency in mESCs leads to sphingomyelin accumulation, we

160 surveyed the expression levels of these enzymes in WT and SIRT1 KO mESCs. SIRT1

161 KO mESCs had significantly reduced expression of a sphingomyelin synthase Sgms2

162 (Figure 2A and S2B), and a dramatic reduction of a sphingomyelin phosphodiesterase

163 SMPDL3B, one of most highly expressed SMPDs in mESCs (Figure S2A), in both ESGRO

164 and M10 media (Figure 2A-2C). Since sphingomyelin was accumulated in SIRT1 KO

165 mESCs, we focused on the reduction of Smpdl3b. As shown in Figure 2D, the reduced

166 expression of SMPDL3B in SIRT1 KO mESCs was coupled with a decreased rate to clear

167 away preloaded BODIPY FL-C5-sphingomyelin in a time-lapse video analysis, suggesting

168 that reduction of SMPDL3B-mediated sphingomyelin degradation may be responsible for

169 accumulation of sphingomyelin observed in SIRT1 KO mESCs.

170 To test this possibility, we manipulated the levels of SMPDL3B in WT and SIRT1

171 KO mESCs and analyzed their impacts on cellular levels of sphingomyelin. Stable

172 overexpression of SMPDL3B significantly reduced accumulation of BODIPY FL-C5-

173 sphingomyelin in SIRT1 KO but not WT mESCs when cells were cultured in serum-

174 containing M10 medium (Figure 3A-3C). In serum-free ESGRO medium, overexpression

175 of SMPDL3B reduced accumulation of BODIPY FL-C5-sphingomyelin and endogenous

176 sphingomyelin in both WT and SIRT1 KO mESCs (Figure 3D-3F). These results indicate

177 that SMPDL3B is capable of removing sphingomyelin in mESCs, particularly in SIRT1 KO

178 mESCs. Conversely, shRNA-mediated stable knockdown of SMPDL3B (Figure 3G)

179 enhanced the accumulation of BODIPY FL-C5-sphingomyelin (Figure 3H and 3I) and

180 endogenous sphingomyelin (Figure 3J) in WT mESCs but not further in SIRT1 KO mESCs,

8 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

181 indicating that accumulation of sphingomyelin observed in SIRT1 KO mESCs is primarily

182 due to reduced expression of SMPDL3B.

183

184 SIRT1 promotes transcription of Smpdl3b through c-Myc

185 As an NAD+-dependent protein deacetylase that deacetylates histones, transcription

186 factors, cofactors, as well as splicing factors, SIRT1 has been shown to modulate gene

187 expression at multiple levels. We confirmed that SIRT1 indeed regulates the expression

188 of Smpdl3b and sphingomyelin degradation through its catalytic activity, as a SIRT1

189 catalytic inactive mutant (H355Y, HY) failed to rescue defective Smpdl3b expression and

190 reduce BODIPY FL-C5-sphingomyelin accumulation in SIRT1 KO mESCs compared to

191 WT SIRT1 protein (Figure 4). When interrogated each step along the expression of

192 Smpdl3b gene in SIRT1 KO mESCs, we found that qPCR primers designed to amplify

193 different segments of mature Smpdl3b mRNA all detected a reduced abundance of the

194 full-length mature Smpdl3b mRNA upon SIRT1 deletion in mESCs (Figure S3A and S3B).

195 Moreover, the abundance of Smpdl3b mRNA was reduced in both nuclear and cytosolic

196 fractions in SIRT1 KO mESCs (Figure S3C). Northern blotting analysis using random

197 probes generated from full-length Smpdl3b cDNA further showed that deletion of SIRT1

198 in mESCs reduces the abundance of full-length Smpdl3b mRNA without detectable

199 accumulation of other minor isoforms (Figure S3D). Finally, RNA-seq analysis of total

200 Ribo-minus RNA (total RNA after depletion of ribosomal RNAs) revealed that the

201 abundance of RNA species from both exonic and intronic regions of Smpdl3b gene were

202 reduced in SIRT1 KO mESCs (Figure S3E and Table S3), and no defective splicing of

203 Smpdl3b pre-mRNA was detected in these cells (not shown). All these observations

204 strongly suggest that the reduction of SMDPL3B expression in SIRT1 KO mESCs is due

205 to defective transcription of Smpdl3b gene. In support of this notion, SIRT1 KO mESCs

206 had a drastic depletion of Pol II near the TSS of Smpdl3b gene, along with decreased

9 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

207 association of activation mark H3K4me3 yet increased association of repression mark

208 H3K27me3 (Figure 5A), indicative of a strong attenuation of transcriptional activation of

209 Smpdl3b gene in SIRT1 KO mESCs.

210 Sequence analysis of the TSS region revealed multiple potential transcription

211 factors (TFs) that may target Smpdl3b gene, including two known SIRT1 deacetylation

212 substrates c-Myc and N-Myc (30, 32) (Figure 5B). To determine the promoter region(s)

213 and associated TF(s) that are responsible for the transcription suppression of Smpdl3b

214 gene in SIRT1 KO mESCs, we designed small gRNAs (sgRNAs) to target different

215 potential TF loci along the Smpdl3b promoter (Figure S4A, top), then analyzed their

216 impacts on the expression of Smpdl3b after transfecting into WT and SIRT1 KO mESCs

217 generated from a mouse ES cell line stably expressing a dox-inducible dCas9 and BirA-

218 V5 (dCas9 mESCs, Figure S4B) (33). It has been demonstrated that transfected sgRNAs

219 in these cells are able to guide the deactivated Cas9 (dCas9) to bind to their targeting loci

220 without further cleavage, resulting in altered transcription of the target gene (33).

221 Compared to control Gal4 sgRNA and other sgRNAs, a sgRNA targeting a locus near 528

222 bp downstream of the TSS of Smpdl3b gene rescued the defective expression of Smpdl3b

223 mRNA in SIRT1 KO dCas9mESCs (Figure 5C). Further bioinformatic analysis showed

224 that this locus is overlapped with previously mapped binding regions of two TFs, c-Myc

225 and EZH2 (Figure S4A, bottom).

226 c-Myc is a known SIRT1 deacetylation substrate, and deacetylation of c-Myc by

227 SIRT1 has been reported to increase its stability and activity (32). We have previously

228 shown that c-Myc is hyperacetylated but unstable in SIRT1 KO mESCs, which reduces its

229 binding to target promoters thereby decreasing their transcription (30). The association of

230 c-Myc protein to the promoter of Smpdl3b gene was indeed significantly reduced in SIRT1

231 KO mESCs by a ChIP-qPCR assay (Figure 5A, c-Myc). Moreover, inhibition of c-Myc

232 activity by 10058-F4 (34) (Figure 5D) or knocking down c-Myc with siRNAs (Figure 5E)

10 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

233 significantly reduced the mRNA abundance of Smpdl3b in WT mESCs but not or to a less

234 extend in SIRT1 KO mESCs, indicating that c-Myc is a key transcription factor in SIRT1-

235 mediated regulation of Smpdl3b. Furthermore, SIRT1 promoted the transcription of

236 Smpdl3b in part through deacetylating c-Myc, as a c-Myc mutant with its major acetylation

237 site mutated to R to mimic deacetylated c-Myc (K323R, KR), partially rescued the

238 expression of Smpdl3b in SIRT1 KO mESCs compared to empty vector (V), WT c-Myc,

239 and a c-Myc mutant with its major acetylation site mutated Q to mimic acetylated c-Myc

240 (K323Q, KQ) (Figure S5C and Figure 5F). Finally, a Smpdl3b promoter luciferase reporter

241 containing a mutant c-Myc binding site (E-box) displayed a dramatically reduced activity

242 in mESCs compared to a WT Smpdl3b promoter luciferase reporter (Figure 5G, pGL3-

243 Smpdl3b E-box Mut vs pGL3-Smpdl3b WT in WT mESCs). Additionally, this mutant

244 luciferase reporter had a comparable low activity in SIRT1 KO mESCs vs WT mESCs,

245 further suggesting that the differential expression levels of Smpdl3b in WT and SIRT1 KO

246 mESCs is mediated by c-Myc.

247 EZH2, an H3K27me3 methyltransferase and the functional enzymatic component

248 of the Polycomb Repressive Complex 2 (PRC2), is also a deacetylation substrate of SIRT1

249 (35). Deacetylation of K348 of EZH2 by SIRT1 has been reported to reduce its stability

250 and activity (35), which is consistent with our current observations that deletion of SIRT1

251 in mESCs significantly increased the occupancy of EZH2 and H3K27me3 on the promoter

252 of Smpdl3b gene (Figure 4A, EZH2, H3K27me3). However, in contrast to c-Myc, neither

253 inhibition of EZH2 activity by its inhibitor EPZ6438 (Figure S4D) nor knockdown of EZH2

254 by siRNAs (Figure S4E-S4G) significantly affected the expression of Smpdl3b in mESCs,

255 particularly in SIRT1 KO mESCs, indicating that blocking EZH2-catalyzed H3K27

256 trimethylation alone is not sufficient to rescue SIRT1 deficiency-induced transcriptional

257 suppression of Smpdl3b in mESCs. Collectively, our data demonstrate that SIRT1

258 activates the expression of Smpdl3b in mESCs primarily through deacetylation of c-Myc.

11 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

259

260 SIRT1-regulated sphingolipid metabolism affects in vitro neural differentiation

261 SMPDL3B-catalyzed sphingomyelin degradation has been shown to reduce plasma

262 membrane fluidity (7). As expected from their reduced expression of SMPDL3B, SIRT1

263 KO mESCs had a reduced fraction of ordered structures (thereby increased membrane

264 fluidity) compared to WT mESCs when probed with Di-4-ANEPPDHQ, an electrical

265 potential sensitive fluorescent dye for detection of microdomains and (dis)ordered

266 membrane in live cells, (Figure 6A, vehicle). Treatment with methyl-b-cyclodextrin (MbCD),

267 a cholesterol-extracting agent, further decreased the membrane order, particularly in

268 SIRT1 KO mESCs (Figure 6A, MbCD). In line with this observation, pathways involved in

269 membrane function and signaling were among the most significantly disrupted GO terms

270 in SIRT1 KO mESCs when compared with WT mESCs in our Ribo-minus RNA-seq

271 dataset (Figure S5).

272 Sphingolipids are bioactive lipids important for stem cell survival and differentiation

273 (36, 37). Since we previously observed that SIRT1 KO mESCs have a compromised

274 pluripotency (30), we investigated whether sphingomyelin accumulation in SIRT1 KO

275 mESCs is responsible for their reduced pluripotency. Compared to WT mESCs, SIRT1

276 KO mESCs had a reduced staining intensity of Alkaline Phosphatase (AP), a marker of

277 undifferentiated ESCs (Figure 6B), along with decreased expression of OCT3/4 and

278 Nanog, two pluripotent stem cell markers, and increased expression of Nestin, a

279 neuroectodermal stem cell (NSC) marker (Figure 6C). However, sphingomyelin treatment

280 did not consistently affect the AP staining intensity (Figure 6B) nor induced any

281 significantly changes on the expression of pluripotency markers in either WT or SIRT1 KO

282 mESCs (Figure 6C, OCT3/4 and Nanog). In contrast, sphingomyelin dose-dependently

283 increased the expression of Nestin, a neuroectodermal stem cell (NSG) marker that was

12 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

284 induced in SIRT1 KO mESCs, in WT mESCs (Figure 6C, Nestin), suggesting that

285 sphingomyelin accumulation may interfere neural differentiation in SIRT1 KO mESCs

286 instead of their pluripotency.

287 Consistent with this observation, during a 4-week in vitro neural differentiation of

288 mESCs (Figure 7A) (38, 39), the mRNA levels of Sirt1 were significantly reduced in WT

289 E14 mESCs, along with dramatic decrease of Nanog and Oct4 and massive induction of

290 several NSC and neural differentiation factors, such as Sox3, Nestin, Notch3, and Tau

291 (Figure 7B, WT). However, both the reduction of pluripotency markers and the induction

292 of NSC/neural differentiation factors were significantly blunted when SIRT1 was deleted

293 in E14 mESCs (Figure 7B, KO), indicating that SIRT1 deficiency impairs in vitro neural

294 differentiation of these cells. Further cellular and morphological analyses by

295 immunofluorescence staining of progenitor and neuronal markers showed that progenitors

296 and neurons differentiated from WT E14 mESCs have high expression of marker proteins

297 and typical mature neuronal morphology, including elongated axons and dendrites, after

298 4-week differentiation (Figure 7C, WT). Progenitors and neurons differentiated from SIRT1

299 KO E14 mESCs, on the other hand, had low levels of these markers and lacked typical

300 neuronal morphology (Figure 7C, KO). Additionally, SIRT1 KO mESCs also displayed

301 defective neural differentiation after in vitro differentiation (Figure 7D), indicating that

302 SIRT1 deficiency in mESCs impairs neural differentiation in vitro in a cell line independent

303 manner.

304 To validate that defective neural differentiation of SIRT1 KO mESCs is related to

305 its accumulation of sphingomyelin, we analyzed whether adding back SMPDL3B in these

306 cells will rescue their neural differentiation defects. Morphologically, putting back

307 SMPDL3B into SIRT1 KO mESCs increased neurons with elongated axons and dendrites

308 (Figure 8A and 8B, SIRT1 KO SMPDL3B), which was associated with increased

309 expression of several progenitor and neuronal markers when analyzed by

13 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

310 immunofluorescence staining (Figure 8B, SIRT1 KO SMPDL3B) or by qPCR (Figure 8C,

311 SIRT1 KO SMPDL3B). Overexpression of SMPDL3B in WT mESCs, however, disrupted

312 the expression of progenitor markers and morphology of neurons (Figure 8B, SIRT1 WT

313 SMPDL3B), suggesting that a balanced sphingomyelin degradation is required to maintain

314 normal neural differentiation. Quantification of the fraction of cells positive of several

315 neural markers by FACS analysis further confirmed that putting back SMPDL3B partially

316 rescues the neural differentiation defects in SIRT1 KO mESCs, whereas overexpression

317 of SMPDL3B inhibits normal neural differentiation in WT mESCs (Figure 8D). Conversely,

318 in vitro neural differentiation of WT and SIRT1 KO mESCs with or without stable

319 knockdown of SMPDL3B revealed that reduction of this enzyme disrupts neural

320 differentiation in both WT and SIRT1 KO mESCs (Figure 8E), indicative the importance of

321 this enzyme in normal neural differentiation. Finally, putting back WT SIRT1 protein into

322 SIRT1 KO mESCs rescued expression of progenitor marker SOX1 and NSC marker

323 Nestin as well as neuronal morphology after in vitro neural differentiation (Figure 8F,

324 SIRT1 KO-WT). In contrast, putting back a catalytic inactive SIRT1 mutant failed to restore

325 marker protein expression and/or neuronal morphology (Figure 8F, SIRT1 KO-HY),

326 confirming that the neural differentiation defects observed in SIRT1 KO mESCs are

327 primarily due to a lack of SIRT1 deacetylase activity. Taken together, our observations

328 indicate that SIRT1-mediated transcription of Smpdl3b and sphingolipid degradation

329 influence neural differentiation in vitro.

330

331 Maternal high-fat diet feeding induces accumulation of sphingomyelin and impairs

332 neural development in SIRT1 deficient embryos

333 To assess the importance of sphingolipid metabolism in SIRT1-regulated neural

334 differentiation in vivo, we investigated whether embryonic SIRT1 deficiency is associated

335 with altered sphingomyelin accumulation and neural differentiation in mice. Consistent

14 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

336 with our previous observations (30), systemic deletion of SIRT1 in C57BL/6J mice leads

337 to intrauterine growth retardation when dams were fed on a regular chow diet (containing

338 4% fat) (Figure 9A, chow). The mRNA levels of Smpdl3b were significantly reduced in the

339 brain of SIRT1 KO E18.5 embryos (Figure 9B). However, these embryos did not display

340 any detectable defects in brain sphingomyelin levels, nor in expression of a number of

341 neural progenitor and neuron markers (Figure 9C and 9D, chow) despite reported

342 developmental defects in other systems(19-21). Since high-fat diet (HFD) feeding has

343 been shown to induce sphingolipid biosynthesis and turnover of sphingolipids in multiple

344 tissues (9), we tested whether maternal HFD feeding could induce sphingomyelin

345 accumulation and disrupt neural development in SIRT1 KO embryos. Intriguingly,

346 maternal feeding of an HFD diet containing 36% fat for 4-8 weeks before breeding

347 significantly reduced intrauterine growth of embryos, particularly on SIRT1 KO embryos,

348 at E18.5 (Figure 9A, HFD). Maternal HFD feeding also elevated sphingomyelin contents

349 in all tested regions of brain in SIRT1 KO but not WT E18.5 embryos (Figure 9C, HFD).

350 These maternal HFD feeding-induced gross and metabolic alterations were associated

351 with reduced expression of many intermediate progenitor and mature neuron markers

352 (Figure 9D, HFD) without significant changes on early stage neuroepithelial cell markers

353 and oligodendrocyte marker (not shown), suggesting that SIRT1 deficiency-induces

354 sphingomyelin accumulation specifically delays neuron maturation in mouse embryos.

355

356 Discussion

357 Highly enriched in the nervous system, sphingolipids are important for the development

358 and maintenance of the functional integrity of the nervous system (40, 41). Perturbations

359 of the sphingolipid metabolism has been shown to rearrange the plasma membrane,

360 resulting in development of various human diseases, particularly neurological diseases

361 (42). However, despite these diverse biological functions, the transcriptional regulation of

15 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

362 sphingolipid metabolism is largely unknown. In the present study, we show that cellular

363 sphingomyelin degradation is under transcriptional control of SIRT1, an important cellular

364 metabolic sensor. We provide evidence that the SIRT1-Myc axis is vital for transcriptional

365 activation of SMPDL3B, a major GPI-anchored plasma membrane bound sphingomyelin

366 phosphodiesterase in mESCs. This transcriptional regulation directly impacts cellular

367 levels of sphingomyelin and membrane fluidity, and is important in regulation of neural

368 differentiation in response to developmental signals (Figure 9E). Our findings therefore

369 identify a unique genetic regulatory pathway for sphingolipid homeostasis. Given the high

370 sensitivity of SIRT1 to nutritional and environmental perturbations (e.g. activation upon

371 caloric restriction and repression after HFD feeding or during aging (43, 44), our study

372 further suggests that SIRT1-Myc-regulatetd sphingolipid degradation may be an important

373 element in mediating reported environmental influence on sphingolipid metabolism (9-12).

374 It will be of great interest to test this possibility in future studies.

375 As the most conserved mammalian NAD+-dependent protein deacetylase, SIRT1

376 has a number of important functions in the brain, including regulation of late stage of neural

377 development and protection against a number of neurodegenerative diseases (29). In

378 particular, SIRT1 has been shown to modulate the neural and glial specification of neural

379 precursors (45, 46) and repress low glucose induced proliferation and neurogenesis of

380 neural stem and progenitor cells (NSCs) in vitro (47). Our observations in the present

381 study demonstrate that SIRT1 is also a key metabolic regulator for the differentiation of

382 neural progenitors/NSCs from ESCs. Our results show that SIRT1 is highly expressed in

383 mESCs cells (Figure 7B), where it functions to promote c-Myc-mediated transcriptional

384 activation of SMPDL3B and sphingomyelin degradation (Figure 1-4). This action of SIRT1

385 appears to have minimal impacts on the pluripotency of mESCs (Figure 6B and 6C), but

386 instead is important for maintenance of a proper membrane fluidity for normal neural

387 differentiation in response to nutritional/developmental cues (Figure 9E). Thus, by

16 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

388 interacting with different protein factors, SIRT1 is important for neural differentiation and

389 development at multiple stages.

390 Our observations that Smpdl3b promoter is targeted by both c-Myc and EZH2,

391 consequently with “co-localization” of antagonistic epigenetic marks H3K4me3 and

392 H3K27me3 at the same locus near its TSS (Figure 4A and S5A), suggest that Smpdl3b in

393 mESCs might be a bivalent promoter-associated gene (48-50). The bivalent chromatin

394 domains in ESCs often mark lineage regulatory genes, and it has been proposed that

395 bivalent domains might repress lineage control genes by H3K27me3 during pluripotency

396 while keeping them poised for activation upon differentiation with H3K4me3 (50).

397 Interestingly, the bivalent chromatin domain on Smpdl3b appears to keep it active in

398 mESCs while poising it to be repressed upon differentiation. Moreover, while long-

399 recognized as a transcription repressor through deacetylation of histones, SIRT1 plays

400 an active role in remodeling this bivalent domain by stabilizing c-Myc while restricting

401 EZH2-induced H3K27me3 in mESCs (Figure 9E). Our present study reveals that this

402 SIRT1/c-Myc/EZH2-regulated bivalent domain remodeling enables swift membrane

403 remodeling in response to developmental signals, allowing more efficient and

404 synchronous neural differentiation. Premature disruption of this chromatin remodeling

405 complex in mESCs alters membrane fluidity (Figure 5A), which may in turn affect

406 developmental signaling transduction (e.g. insulin, bFGF) and impair neural differentiation.

407 Future studies will be needed to elucidate the general role of this bivalent chromatin switch

408 in regulation of pluripotency vs lineage genes, as well as in process of somatic cell

409 reprogramming and/or transformation.

410 The transcriptional regulation of sphingolipid metabolism and neural differentiation

411 by the SIRT1-Myc axis in mESCs revealed in our present study is very intriguing, as we

412 have previously reported that the same regulatory axis is key for methionine metabolism

413 and maintenance of pluripotency in mESCs (30). While our data show that accumulation

17 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

414 of sphingomyelin in SIRT1 KO mESCs is independently of methionine metabolism (Figure

415 S1B and Table S1), additional studies are needed to assess how the SIRT1-Myc

416 regulatory axis coordinates diverse metabolic processes to shape stem cell fates in

417 response to different environmental signals. It is also worth noting that SIRT1 KO mESCs

418 have additional lipid metabolic defects, including depletion of monoacyglycerols,

419 accumulation of plasmalogens, acetylcholine, and monohydroxy fatty acids, and altered

420 phospholipids, regardless of medium methionine concentrations (Figure S1B and Table

421 S1). It will be of importance to evaluate the contribution of these lipid metabolic defects to

422 the observed hypersensitivity of SIRT1 KO embryos to maternal HFD feeding-induced

423 intrauterine growth retardation (Figure 7A) in future studies.

424 Our study has a number of important implications. Firstly, the previously

425 uncharacterized transcriptional regulation of SIRT1 on sphingomyelin degradation directly

426 links cellular levels of sphingomyelin and membrane fluidity with cellular energy status,

427 and provides a possible molecular mechanism for the beneficial impacts of SIRT1 small

428 molecule activators and/or NAD+-boosting dietary supplements on human

429 neurodegenerative diseases. Secondly, given the prevalence of obesity and metabolic

430 syndrome in the reproductive population in modern society, the hypersensitivity of SIRT1

431 KO embryos to maternal HFD feeding-induced intrauterine growth retardation and

432 neurodevelopmental defects suggests that pharmacological activation of SIRT1 by small

433 molecule activators and/or NAD+-boosting dietary supplements might be able to attenuate

434 maternal obesity-associated neonatal complications and defective childhood

435 neurodevelopment (51-53).

436 In summary, our study uncovers a SIRT1-Myc-mediated transcriptional regulation

437 of sphingomyelin degradation that modulates neural differentiation of ESCs. This finding

438 highlights the importance of SIRT1 and its regulation in mESC differentiation and

439 embryonic development, and may have important implications in potential therapeutic

18 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

440 strategies again human neurodegenerative diseases and/or maternal obesity-induced

441 adverse developmental outcomes.

442

443

444

19 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

445 Materials and Methods

446 Mammalian cell lines

447 WT ad SIRT1 KO mESCs generated in R1 mESC line have been reported previously (17,

448 19). WT and SIRT1 KO E14 mESCs were generated by CRISPR/Cas9 mediated gene

449 editing technology using lentivirus carrying either all-in-one empty vector pCRISPR-CG01

450 vector or pCRISPR-CG01 containing different sgRNAs targeting mouse Sirt1 gene

451 (GeneCopoeia). Stable single colonies were picked up and screened with immunoblotting

452 assay using anti-SIRT1 antibodies. Three independent WT and SIRT1 KO E14 mESCs

453 were used for the experiments to minimize the potential off-target effects of each individual

454 line. mESCs stably transfected with pEF1α-FB-dCas9-puro(Addgene #100547) and

455 pEF1α-BirA-V5-neo (Addgene #100548) vectors (dCas9 mESCs) are described

456 previously (33). WT and SIRT1 KO dCas9 mESCs were generated by a similar strategy

457 as WT and SIRT1 KO E14 mESCs. Different sgRNA sequences targeting promoter region

458 of Smpdl3b (Table S4) were cloned into plasmid pSLQ1651-sgRNA(F+E)-sgGal4

459 (Addgene #100549) and then were packed into lentivirus. The WT and SIRT1 KO dCas9

460 mESCs were infected with those lentiviruses to deliver sgRNA into cells, by which the

461 dCas9 was able to be guided to bind on promotor region of Smpdl3b and interfere its

462 functions.

463 WT and SIRT1 KO mESCs with stable Smpdl3b knockdown were generated by

464 infecting WT and SIRT1 KO mESCs with lentivirus containing vector pLKO.1 or constructs

465 expressing shRNAs against Smpdl3b (B11, B12, and C1) (Sigma). WT and SIRT1 KO

466 mESCs with stable overexpression of SMPDL3B were generated with lentivirus carrying

467 vector Plenti-III-ef1α (Abm) or constructs expressing the full-length SMPDL3B protein. The

468 expression of SMPDL3B in these cells was analyzed by immunoblotting.

20 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

469 WT and SIRT1 KO mESCs with stable overexpression of WT or a catalytic inactive

470 H355Y mutant (HY) were generated using lentivirus carrying empty vector Plenti-III-ef1α

471 (Abm) or constructs expressing the full-length WT or HY SIRT1 proteins.

472 To knockdown the Ezh2 and C-Myc gene expression, WT and Sirt1 KO mESCs

473 were transfected with siRNA against mouse Ezh2 (Thermofisher, 4390771-s65775; siNeg:

474 4390843) and c-Myc (Santa Cruz sc-29227; siNeg: siRNA-A sc-37007), with

475 Lipofectamine RNAiMAX (ThermoFisher Scientific). The knockdown of genes expression

476 was evaluated by Quantitative real-time PCR 48 hours after transfection.

477 All mouse stem cells were maintained on gelatin-coated plates in the ESGRO

478 Complete Clonal Grade Medium (Millipore), and then cultured in the M10 medium (High

479 glucose DMEM, 10% ES cell FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 0.1 mM

480 nonessential amino acids, 10 μM 2-mercaptoethanol, and 500 units/ml leukocyte inhibitory

481 factor) for some experiments.

482 WT and SIRT1 KO mel1 hESCs were generated by CRISPR/Cas9 mediated gene

483 editing technology using a plasmid containing Cas9, gRNA

484 (AGAGATGGCTGGAATTGTCC (- strand)) and a GFP indicator. The GFP positive cells

485 were purified by flow cytometry, and were either grown on 10-cm dishes with a serial

486 dilution, or in the 96-well plates at a density of 1 cell/well. Single colonies were picked up

487 and subjected to immunofluorescence assay with anti-SIRT1 antibodies. The cell colonies

488 without SIRT1 staining were sequenced to confirm the mutation. Three independent

489 SIRT1 KO mel1 lines were used for the experiments to minimize the potential offtarget

490 effects of each individual line.

491

492 Mouse models

493 Whole body SIRT1 knockout, heterozygote and their age-matched littermate WT

494 mice on the C57BL/6J background have been reported before (17). They were housed in

21 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

495 individualized ventilated cages (Techniplast, Exton, PA) with a combination of autoclaved

496 nesting material (Nestlet, Ancare Corp., Bellmore, NY and Crink-l’Nest, The Andersons,

497 Inc., Maumee, OH) and housed on hardwood bedding (Sani-chips, PJ Murphy, Montville,

498 NJ). Mice were maintained on a 12:12-h light:dark cycle at 22±0.5 °C and relative humidity

499 of 40% to 60%. Mice were provided ad libitum autoclaved rodent diet (NIH31, Harlan

500 Laboratories, Madison, WI) and deionized water treated by reverse osmosis. Mice were

501 negative for mouse hepatitis virus, Sendai virus, pneumonia virus of mice, mouse

502 parvovirus 1 and 2, epizootic diarrhea of infant mice, mouse norovirus, Mycoplasma

503 pulmonis, Helicobacter spp., and endo- and ectoparasites upon receipt and no pathogens

504 were detected in sentinel mice during this study.

505 Mice were randomly assigned to experimental groups after they were allowed to

506 acclimate for at least one week prior to experiments.

507

508 Metabolomic analysis

509 WT and SIRT1 KO mESCs were cultured in the complete M10 medium containing 200

510 µM methionine or methionine restricted M10 medium containing 6 µM methionine for 6

511 hours (n=5 biological replicates). WT and SIRT1 KO mel1 hESCs were cultured in serum-

512 free TeSR-E8 medium containing 116 µM methionine or a methionine restricted medium

513 containing 6 µM methionine for 6 hours on Matrigel (n=4 biological replicates). Cells were

514 then harvested and profiled by metabolomics analysis as previously described (30).

515 Specifically, about 100 μl of packed cell pellet per sample were submitted to Metabolon,

516 Inc. (Durham, NC, USA), where the relative amounts of small molecular metabolites were

517 determined using four platforms of Ultrahigh Performance Liquid Chromatography-

518 Tandem Mass Spectroscopy (UPLC-MS/MS) as previously described (55). All methods

519 utilized a Waters ACQUITY UPLC and a Thermo Scientific Q-Exactive high

22 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

520 resolution/accurate mass spectrometer interfaced with a heated electrospray ionization

521 (HESI-II) source and Orbitrap mass analyzer operated at 35,000 mass resolution. Raw

522 data collected from above four analyses were managed by the Metabolon Laboratory

523 Information Management System (LIMS), extracted, peak-identified and QC processed

524 using Metabolon’s hardware and software. The hardware and software foundations for

525 these informatics components were the LAN backbone, and a database server running

526 Oracle 10.2.0.1 Enterprise Edition.

527

528 Sphingolipid analysis

529 To confirmed the alteration of sphingomyelipids in SIRT1 KO mESCs, WT and SIRT1 KO

530 mESCs cultured in serum-free ESGRO medium or serum-containing M10 medium were

531 incubated with 5 µM BODIPY™ FL C5-Sphingomyelin (N-(4,4-Difluoro-5,7-Dimethyl-4-

532 Bora-3a,4a-Diaza-s-Indacene-3-Pentanoyl)Sphingosyl Phosphocholine) (Invitrogen,

533 D3522) or 5 µM BODIPY™ FL C5-Ceramide (N-(4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-

534 Diaza-s-Indacene-3-Pentanoyl)Sphingosine) (Invitrogen, D3521) together with 5 µM

535 delipidated BSA (as a delivery carrier) in Hanksʼ buffered salt solution containing 10 mM

536 HEPES (HBSS/HEPES buffer pH 7.4) at 4 ºC for 30 min to load SM/ceramide. They were

537 then incubated in medium without BODIPY FL C5-Sphingolipid at 37 ºC for additional 30

538 min. The intensity of cellular BODIPY FL C5-Sphingomyelin/Ceramide were analyzed by

539 Zeiss LSM 780 UV confocal microscope and by Flow cytometry analysis (Abs 505 nm and

540 Em 511 nm).

541 To analyze the degradation of sphingomyelins, WT and SIRT1 KO mESCs were

542 pre-load with BODIPY™ FL C5-Sphingomyelin at 4 ºC for 30 min. They were then

543 incubated in medium without BODIPY FL C5-Sphingomyelin at 37 ºC, and the dynamics

544 of loaded BODIPY FL C5-Sphingomyelins in cells were followed using Zeiss LSM 780 UV

545 confocal microscope for additional 12 hours at 37 °C.

23 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

546 The relative contents of endogenous sphingomyelins in WT and SIRT1 KO mESCs

547 were analyzed using a commercially available Sphingomyelin Assay Kit (Abcam

548 ab133118) per manufacturer’s instruction.

549

550 Quantitative real-time PCR (qPCR)

551 Total RNAs were isolated from mESCs or mice tissues using Qiagen RNeasy mini-kit

552 (74104). The nuclear and cytoplasmic RNA were separated and enriched by Fisher

553 BioReagents™ SurePrep™ Nuclear or Cytoplasmic RNA Purification Kit (Fisher Scientific,

554 BP280550). The cDNA was synthesized with ABI High-Capacity cDNA Reverse

555 Transcription Kits (4374967) and further analyzed with qPCR using SYBR Green

556 Supermix (Applied Biosystems). Three biological replications are performed for each

557 experiment and raw data are normalized to the expression level of Rplp0 mRNA levels.

558 The primers used in RT-PCR are listed in (Table S4).

559

560 Immunofluorescence analysis

561 mESCs grown on 0.1% gelatin coated coverslips were washed with PBS and fixed with

562 4% paraformaldehyde (PFA) in PBS (pH 7.4) solution for 20 minutes at room temperature.

563 They were then incubated with 1% glycine/PBS for 10 minutes, and cell membrane was

564 permeabilized with 0.3% Triton X-100 in 1% glycine/PBS for 10 minutes. Cells were further

565 blocked with 1% BSA and 0.05% Tween 20 in PBS for 30 minutes, incubated with primary

566 antibodies (Table S5) diluted with the blocking solution for overnight at 4°C, then the

567 secondary antibodies Alexa Fluor 488, 594 and 633 (for flow cytometry sorting) (Invitrogen,

568 A-11008, A-11032, A-21052) at 1:1000 in PBS for 1 hour at room temperature. Cells were

569 counterstained for Nuclei with DRAQ5™ Fluorescent Probe Solution (Thermal Fisher,

570 62251) or directly mounted on glass slides with VECTASHIELD® Antifade Mounting

24 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

571 Media (VECTOR LABORATORY) which contains DAPI. The images of stained cells are

572 acquired by Zeiss LSM 780 UV confocal microscope.

573

574 Northern blotting

575 The probe for Northern Blot hybridization is generated by using North2SouthTM Biotin

576 Random Prime Labeling Kit (Thermo, 17075). A 100ng DNA product, which was

577 synthesized from PCR reaction by using primer pair “5’-

578 CACCGCTAGCGCCACCatgacgctgctcgggtggctgata-3’ and 5’-

579 CACCGCGGCCGCtaacacctccagtacgtgcaggct-3’” and the cDNA synthesized from total

580 RNA isolated from mESCs, was used as a template to yield biotin-labelled single strand

581 DNA probe that covers the full length Smpdl3b mRNA sequence. 40 µg of total RNA

582 isolated from mESC were separated with agarose electrophoresis with RNA Gel Loading

583 Dye (2X) (Thermo, R0641) and NorthernMax™ 10X Running Buffer (Ambion, AM8671).

584 The separated total RNA samples were further transblotted to positively charged nylon

585 transfer membrane (Cat. 77016) by using S & S TurboBlotter Rapid Downward Transfer

586 System (DAIGGER, EF77803) and SSC buffer (Thermo, AM9763). The RNA samples

587 transferred to membrane were further crosslinked by using Stratalinker® UV Crosslinker

588 (Model 1800) immediately upon completion of transblotting. The hybridization was

589 performed by using North2South® Chemiluminescent Hybridization and Detection Kit

590 (Thermo,17097) and the signaling of positive hybridization on membrane was detected

591 with Chemiluminescent Nucleic Acid Detection Module (Thermo, 89880). All procedures

592 were performed by strictly following protocols for each kit provided by manufacturers.

593

594 Immunoblotting

595 Cells were washed once with PBS, and were then lysed and scraped with 1 x SDS loading

596 buffer without bromophenol blue. Samples were boiled for 10 minutes, and quantified.

25 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

597 Equal amount of protein lysates was loaded and resolved on SDS-PAGE gel and

598 transferred onto an PVDF membrane (Millipore). Blots were blocked with 5% BSA for 1

599 hour, incubated with primary antibodies at 4oC overnight, incubated with secondary

600 antibodies for 2 hours, and detected by Odyssey (LI-Cor inc.).

601

602 Chromatin Immunoprecipitation (ChIP)

603 To determine the association of RNA polymerase II (Pol II), c-Myc, EZH2, and histone

604 marks H3K9me2, H3K4me3 and H3K27me3 on mouse Smpdl3b locus in WT and SIRT1

605 KO mESCs, cells were fixed, harvested, and sonicated. The resulting sonicated chromatin

606 was processed for immunoprecipitation with respective antibodies (Table S5) as

607 previously described (56) .

608

609 RNA-seq analysis

610 Total RNA was extracted from WT and SIRT1 KO mESCs cultured in ESGRO medium in

611 triplicates. All RNA-seq libraries were prepared with the TruSeq Stranded/Ribo kit (Illumina,

612 San Diego, CA) and sequenced using the pair-end 76bp protocol at about 520 million

613 reads per library using the NovaSeq platform (Illumina) per the manufacturer’s protocol.

614 Adaptor sequences were removed by Trim Galore (v0.4.4). Then reads were aligned to

615 mouse genome version GRCm38/mm10 using STAR (v2.5.3a) with Gencode

616 vM18 annotation. Gene expression values were quantified using RSEM (v1.2.28) and

617 differences in gene expression between experimental conditions were estimated using R

618 package DEseq2 (Fold change > 2 were used as cutoff for downregulated genes).

619 Gene set enrichment analysis (GSEA) (v4.1.0) was implemented against all gene

620 ontology (GO) gene sets in Molecular Signatures database (MsigDB v7.2) with 10000

621 permutations (min size 15, max size 500, FDR q < 0.25).

622

26 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

623 Promoter analysis of Smpdl3b gene

624 Potential transcription factors (TFs) on the promoter of Smpdl3b gene were predicted

625 using “Match” from geneXplain (genexplain.com), in which the association scores,

626 including “Core Motif Similarity” and “Weight Matrix Similarity” were calculated (54). A

627 higher score implies a higher chance of the gene being the target of this TF.

628

629 Inhibition of c-Myc or EZH2 in mESCs

630 To test the possible roles of transcriptional factor c-Myc and EZH2 in regulation of

631 Smpdl3b expression in mESCs, WT and SIRT1 KO mESCS were treated with c-Myc

632 Inhibitor CAS 403811-55-2–Calbiochem (10058-F4) (Millipore Sigma, 475956) at 10 µM

633 or EZh2 inhibitor Tazemetostat (EPZ-6438) (MCE, HY-13803) at indicated concentrations

634 for 48 hours. WT and SIRT1 KO mESCs were also transfected with siRNA against mouse

635 c-Myc (Santa Cruz, sc-29227) or EZH2 (ThermoFisher, 4390771) to knockdown their

636 expression respectively. Cells were collected for 48 hours after transfection for qPCR

637 analysis.

638

639 Site-direct mutagenesis

640 To further determine the influence of the acetylation status of c-Myc on expression of

641 Smpdl3b, mouse c-Myc protein was first cloned into the pPHAGE-EF1α-HA-Puro vector.

642 The major acetylation site of c-Myc protein, K323, was then mutated to either R to mimic

643 deacetylated c-Myc (K323R) or Q to mimic acetylated c-Myc (K323Q) using QuickChange

644 II Site-Directed Mutagenesis Kit (Agilent Technologies, 200522-5) against pPHAGE-

645 EF1α-HA-Puro-c-Myc. pPHAGE-EF1α-HA-Puro vector, WT, K323R, and K323Q c-Myc

646 constructs were transfected into WT and SIRT1 KO mESCs using Lipofectamine 3000

647 Reagent (Invitrogen, L3000001). The overexpression of WT and mutant c-Myc protein in

27 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

648 cells were confirmed by immunofluorescence staining of transfected cells with anti-c-Myc

649 antibody (Abcam). The sequences of cloning primers were listed in Table S4.

650

651 Luciferase assay

652 To directly analyze the transcriptional regulation of Smpdl3b expression by c-Myc/SIRT1,

653 firefly luciferase reporters driven by a 3.1 kb mouse Smpdl3b promoter fragment (amplified

654 by 5’- tcttacgcgtgctagcccgggctcgagACTCATCCAAAGGACCCAGGTT-3’ and 5’-

655 tttatgtttttggcgtcttCCATGGGGCAGCAGGCACACATG-3’) containing either wild type (WT)

656 or a mutant c-Myc binding site (E-box) were cloned into pGL3 basic vector. The E-box

657 mutant was constructed with QuikChange II XL Site-Directed Mutagenesis Kit (Agilent

658 Technologies) using primers 5’-

659 cgcgggttcccaccttgtggccagaagatcttctgggcagaactactcgtttggc-3’ and 5’-

660 gccaaacgagtagttctgcccagaagatcttctggccacaaggtgggaacccgcg-3’. The WT or mutant

661 plasmids were then transfected into WT and SIRT1 KO mESCs together with the control

662 pRL-TK plasmid (Renilla Luciferase, Promega). Cells were cultured for 48 h and the

663 luciferase activity was measured using the Dual-Luciferase Reporter Assay System

664 (Promega). The final firefly luciferase activity was normalized to the co-expressed renilla

665 luciferase activity.

666

667 Measurement of membrane fluidity

668 WT and SIRT1 KO mESCs were seeded on glass cover slips and cultured in ESGRO

669 medium overnight. They were then preincubated for 1 hour with or without 2.5 mM MβCD,

670 and stained with 5 μM di-4-ANEPPDHQ for 30 minutes. Coverslips were mounted using

671 ProLong®Gold (Invitrogen), images were acquired on a Zeiss LSM780 confocal

672 microscope. The fluorescent dye was excited at 488 nm and images from 30 individual

673 colonies in each group were acquired at 560 nm for emission from ordered phase and 620

28 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

674 nm for emission from disordered phase. The images were further analyzed ImageJ

675 according to a method described previously (57).

676

677 In vitro neural differentiation of mESCs

678 In vitro neural differentiation of WT and SIRT1 KO mESCs were performed essentially as

679 described (38, 39). Specifically, WT and SIRT1 KO mESCs maintained in ESGRO

680 Complete PLUS Clonal Grade Medium (Millipore SF001-500P) were gently dissociated

681 with 0.05% Trypsin and plated onto 0.1% gelatin coated cell culture dish at a density of

682 1x104cells / cm2 with RHB-A medium (Clontech TaKaba Cellartis, Y40001). Medium was

683 changed every 2 days and cultured for 4 days. Cells were then dissociated with 0.05%

684 Trypsin again and plated into cell culture dish coated with 1 µg/ml Laminin (Sigma, L2020)

685 at a density of 2x104cells/cm2 in RHB-A medium supplemented with 5 ng/ml murine bFGF

686 (Sigma, SRP4038-50UG). Medium was changed again every 2 days for the next 3 weeks.

687 Cell morphology was monitored during the differentiation. The differentiated neural cells

688 were maintained in RHB-A: Neurobasal (ThermoFisher,10888022): B27 Supplement

689 (ThermoFisher,17504044) (1:1:0.02) medium to for a better survival.

690

691 FACS analysis

692 To quantify the factions of differentiated cells at different stages during in vitro neural

693 differentiation, differentiated cells were harvested with trypsin and fixed with 4% PFA. After

694 fixation, cells are washed with PBS and immunofluorescence stained with different neural

695 markers, and analyzed by FACS.

696

697 Alkaline phosphatase staining

29 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

698 The alkaline phosphatase staining assay was performed using the Alkaline Phosphatase

699 staining kit II as per manufacturer's instructions (Stemgent, Cambridge, MA; cat. no. 00-

700 0055).

701

702 Maternal high-fat diet feeding

703 To investigate the effects of maternal high-fat diet feeding on embryonic development of

704 control and SIRT1 KO mice, 6-8 weeks old SIRT1 heterozygous (Sirt1+/-) female mice

705 were fed with either control chow diet (NIH-31 contains 4% fat) or a high-fat diet (D12492

706 contains 36% fat) for 4-8 weeks. They were then bred with age matched Sirt1+/- male mice

707 fed with chow diet. Early next morning, females with the mating plug (E0.5) were separated

708 from the males into a new cage and put back on the high-fat diet. Embryos from E14.5

709 and E18.5 were then collected and analyzed. The total feeding time on the high-fat diet is

710 up to 11 weeks. Embryos were collected from at least 4 dams (pregnant females) for each

711 time point, this sample size was estimated using Chi square based on 100% penetrance

712 of body weight reduction of SIRT1 KO embryos and a 95% power.

713 All animal procedures were reviewed and approved by National Institute of

714 Environmental Health Sciences Animal Care and Use Committee. All animals were

715 housed, cared for, and used in compliance with the Guide for the Care and Use of

716 Laboratory Animals and housed and used in an Association for the Assessment and

717 Accreditation of Laboratory Animal Care, International (AAALAC) Program.

718

719 Quantification and statistical analysis

720 Values are expressed as mean ± standard error of mean (SEM) from at least three

721 independent experiments or biological replicates, unless otherwise indicated in the figure

722 legend. Significant differences between the means were analyzed by the two-tailed,

723 unpaired, Student’s t-test, and differences were considered significant at *p<0.05 using

30 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

724 Microsoft Office Excel (Version 16.16.27). No methods were used to determine whether

725 the data met assumptions of the statistical approach (e.g. test for normal distribution).

726 Bioinformatic analyses of RNA-seq data are detailed in METHOD DETAILS

727 section.

728

729 Data availability

730 The RNA-seq (RNA-seq) data have been deposited to Gene Expression Omnibus under

731 the accession number GSE163920

732 ( https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE163920). The secure token

733 for reviewers is cryvqkekdbufrmb.

734 Additional information on DEGs is available from Table S3.

735 Metabolomics data (lipid alterations) between WT and SIRT1 KO mESCs is available in

736 Table S1.

737 Sphingolipid profiles between WT and SIRT1 KO mESCs and hESCs are available in

738 Table S2.

739 All oligos used in the study are available in Table S4.

740 All antibodies used in the study are available in Table S5.

741

742 List of Supplemental Tables

743 Table S1. Lipid alterations in WT and SIRT1 KO mESCs analyzed by metabolomics.

744 Table S2. Accumulation of sphingomyelin in both SIRT1 KO hESCs and mESCs.

745 Table S3. Significantly differentially expressed genes between SIRT1 KO vs WT mESCs.

746 Table S4. Oligonucleotides used in the study.

747 Table S5. Antibodies used in the study.

748

31 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

749 Acknowledgements

750 We thank Drs. Serena Dudek, Anton Jetten, and members of the Li laboratory for critical

751 reading of the manuscript. We also thank NIEHS Epigenomics Core Facility for performing

752 RNA-seq experiments. This research was supported by the Intramural Research Program

753 of National Institute of Environmental Health Sciences of the NIH Z01 ES102205 (to X. L.).

754 This study was also supported in part by grants from National Nature Science Foundation

755 of China (NSFC) 31730110 and 31661143031 (to Z. W.) and NIH grants R01CA230631

756 and R01DK111430 (to J. X.). J. X. is a Scholar of The Leukemia & Lymphoma Society

757 (LLS). X. F. is supported by a fellowship from China Postdoctoral Science Foundation

758 (2020M681437).

759

760 Author contributions

761 W. F. designed and performed experiments, analyzed data, and wrote the manuscript. S.

762 T. designed and performed experiments and analyzed data. X. F. analyzed RNA-seq data.

763 Y. F. generated SIRT1 KO hESCs and analyzed the metabolic profiles. X. X., J. L., and L.

764 L. analyzed mouse Smpdl3b promoter. J. X. provided dCas9 mESCs. Z. W. guided and

765 coordinated the study and analyzed data. X. L. guided, designed, and coordinated the

766 study, analyzed data, and wrote the manuscript. All authors critically reviewed the

767 manuscript.

768

769 Conflict of interest statement

770 The authors declare no conflict of interest.

32 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

771 References

772 1. Chen Y, Liu Y, Sullards MC, Merrill AH, Jr. An introduction to sphingolipid 773 metabolism and analysis by new technologies. Neuromolecular Med. 2010;12(4):306-19. 774 2. Merrill AH, Jr., Wang MD, Park M, Sullards MC. (Glyco)sphingolipidology: an 775 amazing challenge and opportunity for systems biology. Trends Biochem Sci. 776 2007;32(10):457-68. 777 3. Pralhada Rao R, Vaidyanathan N, Rengasamy M, Mammen Oommen A, Somaiya 778 N, Jagannath MR. Sphingolipid metabolic pathway: an overview of major roles played in 779 human diseases. J Lipids. 2013;2013:178910. 780 4. Hannun YA, Obeid LM. Principles of bioactive lipid signalling: lessons from 781 sphingolipids. Nat Rev Mol Cell Biol. 2008;9(2):139-50. 782 5. van Meer G, Voelker DR, Feigenson GW. Membrane lipids: where they are and 783 how they behave. Nat Rev Mol Cell Biol. 2008;9(2):112-24. 784 6. Brown DA, London E. Structure and origin of ordered lipid domains in biological 785 membranes. J Membr Biol. 1998;164(2):103-14. 786 7. Heinz LX, Baumann CL, Koberlin MS, Snijder B, Gawish R, Shui G, et al. The 787 Lipid-Modifying Enzyme SMPDL3B Negatively Regulates Innate Immunity. Cell Rep. 788 2015;11(12):1919-28. 789 8. Mitrofanova A, Mallela SK, Ducasa GM, Yoo TH, Rosenfeld-Gur E, Zelnik ID, et al. 790 SMPDL3b modulates insulin receptor signaling in diabetic kidney disease. Nat Commun. 791 2019;10(1):2692. 792 9. Choi S, Snider AJ. Sphingolipids in High Fat Diet and Obesity-Related Diseases. 793 Mediators Inflamm. 2015;2015:520618. 794 10. Giusto NM, Roque ME, Ilincheta de Boschero MG. Effects of aging on the content, 795 composition and synthesis of sphingomyelin in the central nervous system. Lipids. 796 1992;27(11):835-9. 797 11. Lightle SA, Oakley JI, Nikolova-Karakashian MN. Activation of sphingolipid 798 turnover and chronic generation of ceramide and sphingosine in liver during aging. Mech 799 Ageing Dev. 2000;120(1-3):111-25. 800 12. Tacconi MT, Lligona L, Salmona M, Pitsikas N, Algeri S. Aging and food restriction: 801 effect on lipids of cerebral cortex. Neurobiol Aging. 1991;12(1):55-9. 802 13. Muthusamy T, Cordes T, Handzlik MK, You L, Lim EW, Gengatharan J, et al. 803 Serine restriction alters sphingolipid diversity to constrain tumour growth. Nature. 804 2020;586(7831):790-5. 805 14. Brice SE, Cowart LA. Sphingolipid metabolism and analysis in metabolic disease. 806 Adv Exp Med Biol. 2011;721:1-17. 807 15. Alvarez-Vasquez F, Sims KJ, Cowart LA, Okamoto Y, Voit EO, Hannun YA. 808 Simulation and validation of modelled sphingolipid metabolism in Saccharomyces 809 cerevisiae. Nature. 2005;433(7024):425-30. 810 16. Houtkooper RH, Pirinen E, Auwerx J. Sirtuins as regulators of metabolism and 811 healthspan. Nat Rev Mol Cell Biol. 2012;13(4):225-38. 812 17. Tang S, Huang G, Fan W, Chen Y, Ward JM, Xu X, et al. SIRT1-Mediated 813 Deacetylation of CRABPII Regulates Cellular Retinoic Acid Signaling and Modulates 814 Embryonic Stem Cell Differentiation. Mol Cell. 2014;55(6):843-55. 815 18. Han MK, Song EK, Guo Y, Ou X, Mantel C, Broxmeyer HE. SIRT1 regulates 816 apoptosis and Nanog expression in mouse embryonic stem cells by controlling p53 817 subcellular localization. Cell Stem Cell. 2008;2(3):241-51. 818 19. McBurney MW, Yang X, Jardine K, Hixon M, Boekelheide K, Webb JR, et al. The 819 mammalian SIR2alpha protein has a role in embryogenesis and gametogenesis. Mol Cell 820 Biol. 2003;23(1):38-54.

33 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

821 20. Cheng HL, Mostoslavsky R, Saito S, Manis JP, Gu Y, Patel P, et al. Developmental 822 defects and p53 hyperacetylation in Sir2 homolog (SIRT1)-deficient mice. Proc Natl Acad 823 Sci U S A. 2003. 824 21. Wang RH, Sengupta K, Li C, Kim HS, Cao L, Xiao C, et al. Impaired DNA damage 825 response, genome instability, and tumorigenesis in SIRT1 mutant mice. Cancer Cell. 826 2008;14(4):312-23. 827 22. Dietrich MO, Antunes C, Geliang G, Liu ZW, Borok E, Nie Y, et al. Agrp neurons 828 mediate Sirt1's action on the melanocortin system and energy balance: roles for Sirt1 in 829 neuronal firing and synaptic plasticity. J Neurosci. 2010;30(35):11815-25. 830 23. Ramadori G, Fujikawa T, Fukuda M, Anderson J, Morgan DA, Mostoslavsky R, et 831 al. SIRT1 deacetylase in POMC neurons is required for homeostatic defenses against 832 diet-induced obesity. Cell Metab. 2010;12(1):78-87. 833 24. Ramadori G, Fujikawa T, Anderson J, Berglund ED, Frazao R, Michan S, et al. 834 SIRT1 deacetylase in SF1 neurons protects against metabolic imbalance. Cell Metab. 835 2011;14(3):301-12. 836 25. Satoh A, Brace CS, Rensing N, Cliften P, Wozniak DF, Herzog ED, et al. Sirt1 837 extends life span and delays aging in mice through the regulation of Nk2 homeobox 1 in 838 the DMH and LH. Cell Metab. 2013;18(3):416-30. 839 26. Hisahara S, Chiba S, Matsumoto H, Tanno M, Yagi H, Shimohama S, et al. Histone 840 deacetylase SIRT1 modulates neuronal differentiation by its nuclear translocation. Proc 841 Natl Acad Sci U S A. 2008;105(40):15599-604. 842 27. Michan S, Li Y, Chou MM, Parrella E, Ge H, Long JM, et al. SIRT1 is essential for 843 normal cognitive function and synaptic plasticity. J Neurosci. 2010;30(29):9695-707. 844 28. Gao J, Wang WY, Mao YW, Graff J, Guan JS, Pan L, et al. A novel pathway 845 regulates memory and plasticity via SIRT1 and miR-134. Nature. 2010;466(7310):1105-9. 846 29. Herskovits AZ, Guarente L. SIRT1 in neurodevelopment and brain senescence. 847 Neuron. 2014;81(3):471-83. 848 30. Tang S, Fang Y, Huang G, Xu X, Padilla-Banks E, Fan W, et al. Methionine 849 metabolism is essential for SIRT1-regulated mouse embryonic stem cell maintenance and 850 embryonic development. EMBO J. 2017;36(21):3175-93. 851 31. Wakayama T, Rodriguez I, Perry AC, Yanagimachi R, Mombaerts P. Mice cloned 852 from embryonic stem cells. Proc Natl Acad Sci U S A. 1999;96(26):14984-9. 853 32. Menssen A, Hydbring P, Kapelle K, Vervoorts J, Diebold J, Luscher B, et al. The 854 c-MYC oncoprotein, the NAMPT enzyme, the SIRT1-inhibitor DBC1, and the SIRT1 855 deacetylase form a positive feedback loop. Proc Natl Acad Sci U S A. 2012;109(4):E187- 856 96. 857 33. Liu X, Zhang Y, Chen Y, Li M, Zhou F, Li K, et al. In Situ Capture of Chromatin 858 Interactions by Biotinylated dCas9. Cell. 2017;170(5):1028-43 e19. 859 34. Yin X, Giap C, Lazo JS, Prochownik EV. Low molecular weight inhibitors of Myc- 860 Max interaction and function. Oncogene. 2003;22(40):6151-9. 861 35. Wan J, Zhan J, Li S, Ma J, Xu W, Liu C, et al. PCAF-primed EZH2 acetylation 862 regulates its stability and promotes lung adenocarcinoma progression. Nucleic Acids Res. 863 2015;43(7):3591-604. 864 36. Bieberich E. Ceramide signaling in cancer and stem cells. Future Lipidol. 865 2008;3(3):273-300. 866 37. Wang G, Spassieva SD, Bieberich E. Ceramide and S1P Signaling in Embryonic 867 Stem Cell Differentiation. Methods Mol Biol. 2018;1697:153-71. 868 38. Ying QL, Nichols J, Chambers I, Smith A. BMP induction of Id proteins suppresses 869 differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. 870 Cell. 2003;115(3):281-92.

34 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

871 39. Abranches E, Silva M, Pradier L, Schulz H, Hummel O, Henrique D, et al. Neural 872 differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. 873 PLoS One. 2009;4(7):e6286. 874 40. van Echten-Deckert G, Herget T. Sphingolipid metabolism in neural cells. Biochim 875 Biophys Acta. 2006;1758(12):1978-94. 876 41. Olsen ASB, Faergeman NJ. Sphingolipids: membrane microdomains in brain 877 development, function and neurological diseases. Open Biol. 2017;7(5). 878 42. Piccinini M, Scandroglio F, Prioni S, Buccinna B, Loberto N, Aureli M, et al. 879 Deregulated sphingolipid metabolism and membrane organization in neurodegenerative 880 disorders. Mol Neurobiol. 2010;41(2-3):314-40. 881 43. Canto C, Auwerx J. Caloric restriction, SIRT1 and longevity. Trends Endocrinol 882 Metab. 2009;20(7):325-31. 883 44. Imai S. SIRT1 and caloric restriction: an insight into possible trade-offs between 884 robustness and frailty. Curr Opin Clin Nutr Metab Care. 2009;12(4):350-6. 885 45. Prozorovski T, Schulze-Topphoff U, Glumm R, Baumgart J, Schroter F, 886 Ninnemann O, et al. Sirt1 contributes critically to the redox-dependent fate of neural 887 progenitors. Nat Cell Biol. 2008;10(4):385-94. 888 46. Kang MR, Lee SW, Um E, Kang HT, Hwang ES, Kim EJ, et al. Reciprocal roles of 889 SIRT1 and SKIP in the regulation of RAR activity: implication in the retinoic acid-induced 890 neuronal differentiation of P19 cells. Nucleic Acids Res. 2009;38(3):822-31. 891 47. Fusco S, Leone L, Barbati SA, Samengo D, Piacentini R, Maulucci G, et al. A 892 CREB-Sirt1-Hes1 Circuitry Mediates Neural Stem Cell Response to Glucose Availability. 893 Cell Rep. 2016;14(5):1195-205. 894 48. Bernstein BE, Mikkelsen TS, Xie X, Kamal M, Huebert DJ, Cuff J, et al. A bivalent 895 chromatin structure marks key developmental genes in embryonic stem cells. Cell. 896 2006;125(2):315-26. 897 49. Sanz LA, Chamberlain S, Sabourin JC, Henckel A, Magnuson T, Hugnot JP, et al. 898 A mono-allelic bivalent chromatin domain controls tissue-specific imprinting at Grb10. 899 EMBO J. 2008;27(19):2523-32. 900 50. Vastenhouw NL, Schier AF. Bivalent histone modifications in early embryogenesis. 901 Curr Opin Cell Biol. 2012;24(3):374-86. 902 51. Iessa N, Berard A. Update on Prepregnancy Maternal Obesity: Birth Defects and 903 Childhood Outcomes. J Pediatr Genet. 2015;4(2):71-83. 904 52. Helle E, Priest JR. Maternal Obesity and Diabetes Mellitus as Risk Factors for 905 Congenital Heart Disease in the Offspring. J Am Heart Assoc. 2020;9(8):e011541. 906 53. Tong L, Kalish BT. The impact of maternal obesity on childhood neurodevelopment. 907 J Perinatol. 2020. 908 54. Chen X, Xu H, Yuan P, Fang F, Huss M, Vega VB, et al. Integration of external 909 signaling pathways with the core transcriptional network in embryonic stem cells. Cell. 910 2008;133(6):1106-17. 911 55. Evans AM, Bridgewater BR, Miller LAD, Mitchell MW, Robinson RJ, Dai H, et al. 912 High Resolution Mass Spectrometry Improves Data Quantity and Quality as Compared to 913 Unit Mass Resolution Mass Spectrometry in High-Throughput Profiling Metabolomics. 914 Metabolomics. 2014;4(2). 915 56. Shimbo T, Du Y, Grimm SA, Dhasarathy A, Mav D, Shah RR, et al. MBD3 localizes 916 at promoters, gene bodies and enhancers of active genes. PLoS Genet. 917 2013;9(12):e1004028. 918 57. Owen DM, Williamson D, Magenau A, Gaus K. Optical techniques for imaging 919 membrane domains in live cells (live-cell palm of protein clustering). Methods Enzymol. 920 2012;504:221-35. 921

35 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A B C Complete Medium Endoplasmic reticulum

1-palmitoyl-2-gamma-linolenoyl-GPC Sirt1 KO 1-oleoyl-2-linoleoyl-GPC (16:0/18:3n6)* Sirt1 WT (18:1/18:2)* 1,2-dioleoyl-GPI 1-stearoyl-2-oleoyl-GPC Serine + (palmitoyl CoA) (18:1/18:1) (18:0/18:1) 1-palmitoyl-2-oleoyl-GPS 1,2-dipalmitoyl-GPC (16:0/18:1) 1-palmitoyl-2-arachidonoyl-GPC1,2-dioleoyl-GPE 1-palmitoyl-2-oleoyl-GPI 1-stearoyl-2-arachidonoyl-GPC (16:0/16:0) 2 (16:0/20:4) (18:1/18:1) 1-linoleoyl-2-arachidonoyl-GPC(16:0/18:1)* (18:0/20:4) 1-palmitoyl-2-oleoyl-GPG (18:2/20:4n6)* SPT 1-palmitoleoyl-2-oleoyl-GPC 1,2-dilinoleoyl-GPC (16:0/18:1) (18:2/18:2) (16:1/18:1)* glycerophosphorylcholine 1 1,2-dioleoyl-GPG1-oleoyl-2-linoleoyl-GPE 1-stearoyl-2-arachidonoyl-GPE myristoleate glycerophosphoinositol*(GPC) (18:1/18:1) (18:1/18:2)* (18:0/20:4) (14:1n5) palmitoleate 10-heptadecenoate (16:1n7) (17:1n7) 0.5 glycerophosphoethanolamine 1,2-distearoyl-GPCPhospholipid choline phosphate 1,2-distearoyl-GPG (3-Keto dihydrosphingosine) 1-palmitoyl-2-palmitoleoyl-GPC (18:0/18:0) (18:0/18:0) oleate/vaccenate Metabolism (16:0/16:1)* 1-palmitoyl-2-stearoyl-GPC (18:1) 10-nonadecenoatearachidate (20:0) cytidine 0 (16:0/18:0) 1-palmitoyl-2-arachidonoyl-GPE palmitate (16:0) (19:1n9) 5'-diphosphocholine eicosenoate (20:1) Log2 palmitoloelycholine 1-palmitoleoyl-2-linoleoyl-GPC(16:0/20:4)* arachidonate 1-palmitoyl-2-linoleoyl-GPC (20:4n6) docosadienoate 1-stearoyl-2-oleoyl-GPE (16:1/18:2)* (16:0/18:2) (22:2n6) -0.5 KDSR (18:0/18:1)

1-palmitoyl-2-oleoyl-GPE Long Chain (KO/WT) myristate (14:0)erucate (22:1n9) (16:0/18:1) choline 1-linoleoyl-2-arachidonoyl-GPE docosapentaenoate 1-palmitoyl-2-linoleoyl-GPE linoleate (18:2n6)docosahexaenoate Fatty Acid (18:2/20:4)* (n6 DPA; 22:5n6) (16:0/18:2) (DHA; 22:6n3) -1 1,2-dioleoyl-GPS oleoylcholine linolenate [alpha docosatrienoate cytidine-5'-diphosphoethanolamine (18:1/18:1) 1-palmitoyl-2-oleoyl-GPC 1,2-dioleoyl-GPC or gamma; (22:3n3) dihomo-linoleate (16:0/18:1) (18:1/18:1)* (18:3n3 or 6)] Polyunsaturated stearate (18:0) Dihydrosphingosine (20:2n6) 1-palmitoyl-2-alpha-linolenoyl-GPC 1,2-dilinoleoyl-GPE Fatty Acid adrenate (22:4n6) (16:0/18:3n3)* 1-stearoyl-2-arachidonoyl-GPI(18:2/18:2)* Plasma membrane trimethylamine (18:0/20:4) dihomo-linolenate (n3 and n6) N-oxide (20:3n3 or n6) eicosapentaenoate palmitoleoylcarnitine* CERS (EPA; 20:5n3) myristoylcarnitine oleoylcarnitine mead acid (20:3n9) 3-hydroxybutyrylcarnitine docosapentaenoate Fatty Acid (1) (n3 DPA; 22:5n3) myo-inositol acetylcarnitine 17-methylstearate Metabolism(Acyl 3-hydroxybutyrate Dihydroceramide (BHBA) 1-palmitoyl-3-linoleoyl-glycerolCarnitine) Sphingomyelin (16:0/18:2)* BODIPY FL C5-Sphingomyelin 3-hydroxy-3-methylglutarate Inositol palmitoylcarnitine Fatty Acid, stearoylcarnitine Metabolism DEGS KetoneBranched palmitoylcholine1-palmitoleoyl-3-oleoyl-glycerol Mevalonate Fatty Acid (16:1/18:1)* Bodies 3-hydroxybutyrylcarnitine acetylcholine Metabolism DAPI malonate Metabolism (2) (AcylDiacylglycerol 1-oleoyl-3-linoleoyl-glycerol NeurotransmitterFatty Acid Choline) (18:1/18:2) Ceramide carnitine Carnitine Synthesis glycerophosphoglycerol Metabolism cholesterol 3-hydroxylaurate Fatty Acid, Glycerolipid SMPD deoxycarnitine Monohydroxy D Sphingolipid Sterol Metabolism 3-hydroxymyristate N-monomethylarginine 1-(1-enyl-oleoyl)-2-oleoyl-GPE Lipid glycerol (P-18:1/18:1)* CERT 1-(1-enyl-oleoyl)-GPE Phosphatidylserine BODIPY FL C5- (P-18:1)* Fatty Acid N-delta-acetylornithine Lysoplasmalogen 1-stearoyl-2-arachidonoyl-GPS(PS) 7-hydroxycholesterol 4-hydroxybutyrate metabolism Fatty Acid(18:0/20:4) (GHB) (alpha or beta) sphingomyelin Metabolism behenoyl (d18:1/22:1,sphingomyelin 1-(1-enyl-palmitoyl)-GPE Metabolism glycerol CERK sphingomyelin palmitoyl d18:2/22:0,(d18:1/20:0, (P-16:0)* acetyl CoA 3-phosphate trans-4-hydroxyproline (d18:1/22:0)* (also BCAA Sphingomyelin d16:1/24:1)*d16:1/22:0)* EndocannabinoidFatty ethanolamide Acid, sphingomyelin Metabolism) 1-stearoyl-2-oleoyl-GPS (d18:2/24:1, 1-(1-enyl-palmitoyl)-GPC Dicarboxylate Ceramide (Ceramide-1-P) sphingomyelin N-palmitoyl-sphingosinesphingomyelin (18:0/18:1) 2-palmitoyl-GPC d18:1/24:2)* (d18:1/14:0, (P-16:0)* 1-palmitoyl-GPI (d18:1/16:0)(d18:1/21:0, 1-oleoyl-GPG (16:0)* d16:1/16:0)* (16:0)* tricosanoyl d17:1/22:0, (18:1)* glycosyl-N-palmitoyl-sphingosine 1-(1-enyl-stearoyl)-GPE sphingomyelin d16:1/23:0)* (P-18:0)* sphingomyelin(d18:1/23:0)* 2-hydroxyglutarate 1-arachidonoyl-GPE 1-oleoyl-GPS PPAP2A/B/C myristoyl CoA 1-stearoyl-GPS (d18:2/14:0, Ceramide 1-palmitoyl-GPS (18:1) sphingomyelin Sphingolipid (18:0)* (20:4n6)* d18:1/14:1)* oleoyl (16:0)* lactosyl-N-palmitoyl-sphingosine(d18:1/24:1, Metabolism CDASE 1.6 stearoyl ethanolamide *** butyrylcarnitine 2-hydroxyadipate d18:2/24:0)* ethanolamide 2-palmitoleoyl-GPC sphingomyelin SGMS palmitoyl 1-lignoceroyl-GPC (16:1)* sphingosine 1-linoleoyl-GPC sphingomyelin (d18:2/23:0, maleate (24:0) sphingomyelin propionylcarnitine Lysolipid (18:2) UGCG d18:1/23:1, GBA (d18:1/16:0) (d18:1/20:1, stearoyl d17:1/24:1)* 1-arachidonoyl-GPC d18:2/20:0)* sphingomyelin palmitoyl (20:4n6)* 1-palmitoleoyl-GPC (d18:1/18:0) Plasmalogen1-(1-enyl-palmitoyl)-2-arachidonoyl-GPC 1-stearoyl-GPG (16:1)* dihydrosphingomyelinsphingomyelin (18:0) 1-arachidonoyl-GPI Sphingosine N-palmitoyl-sphinganine 2-linoleoylglycerol (P-16:0/20:4)* phytosphingosine (d18:0/16:0)*(d18:1/18:1, (d18:0/16:0) (18:2) 1-stearoyl-GPI (20:4)* d18:2/18:0) sphingomyelin (18:0) 1-linoleoyl-GPE Glucosyl ceramide (18:2)*1-palmitoyl-GPE (d18:2/16:0, sphinganine Monoacylglycerol1-(1-enyl-palmitoyl)-2-palmitoleoyl-GPC 2-stearoyl-GPE sphingomyelin 1-oleoyl-GPE (16:0) d18:1/16:1)* sphingomyelin 1-arachidonylglycerol (P-16:0/16:1)* (18:0)* (d18:1/17:0, 1-(1-enyl-stearoyl)-2-arachidonoyl-GPE 1-palmitoyl-GPC glycosyl-N-stearoyl-sphingosine (d18:1/15:0, (20:4) 1-(1-enyl-palmitoyl)-2-oleoyl-GPC (18:1) d17:1/18:0, (P-18:0/20:4)* (16:0) 1-oleoyl-GPI d16:1/17:0)* (P-16:0/18:1)* (18:1)* 1-palmitoyl-GPG Sirt1 WT d19:1/16:0) 2-arachidonoylglycerol (16:0)* 1-(1-enyl-palmitoyl)-2-linoleoyl-GPC1-(1-enyl-palmitoyl)-2-oleoyl-GPE 1-stearoyl-GPE SPHK SGPP 1.2 (20:4) 2-palmitoylglycerol (P-16:0/18:2)*(P-16:0/18:1)* (18:0) 1-oleoyl-GPC 1-linoleoylglycerol 1-(1-enyl-palmitoyl)-2-palmitoyl-GPC (16:0) 1-stearoyl-GPC (18:1) Sphingomyelin (18:2) (P-16:0/16:0)* (18:0) 1-dihomo-linolenylglycerol 1-(1-enyl-stearoyl)-2-oleoyl-GPE 2-palmitoleoylglycerol 1-palmitoleoylglycerol1-(1-enyl-palmitoyl)-2-arachidonoyl-GPE (20:3) (P-18:0/18:1) (16:1)* (16:1)* (P-16:0/20:4)* 1-oleoylglycerol (18:1) 1-palmitoylglycerol 2-oleoylglycerol (16:0) Isobar: fructose (Sphingosine-1-P) (18:1) 1,6-diphosphate, Sphingomyelin glucose

1,6-diphosphate, - myo-inositol 1,4 0.8 Complex glycosphingolipids (GSL) FL C5 sphingomyelin behenoyl 0.4 (d18:1/22:1,sphingomyelin 1-(1-enyl-palmitoyl)-GPEGolgi complex sphingomyelin d18:2/22:0,(d18:1/20:0, (d18:1/22:0)* d16:1/24:1)*d16:1/22:0)* sphingomyelin Sirt1 KO BODIPY 0 (d18:2/24:1, sphingomyelin Intensity FL BODIPY Relative N-palmitoyl-sphingosinesphingomyelin d18:1/24:2)* (d18:1/14:0, WT KO (d18:1/16:0)(d18:1/21:0, d16:1/16:0)* FSC tricosanoyl d17:1/22:0, glycosyl-N-palmitoyl-sphingosine E F sphingomyelin d16:1/23:0)* sphingomyelin(d18:1/23:0)* Endogenous A1 A7 A9 B2 B4 B8 GC01-1 -2 -3 BODYPY FL-C5- (d18:2/14:0, Sphingolipid Sphingomyelin H d18:1/14:1)* sphingomyelin Sphingomyelin lactosyl-N-palmitoyl-sphingosine(d18:1/24:1, Metabolism SIRT1 d18:2/24:0)* 2 *** palmitoyl sphingomyelin sphingosine * 1.6 sphingomyelin (d18:2/23:0, 1.8 *** sphingomyelin (d18:1/16:0) d18:1/23:1, GAPDH 1.4 (d18:1/20:1, stearoyl d17:1/24:1)* 1.6 d18:2/20:0)* sphingomyelin palmitoyl 1.2 (d18:1/18:0) 1.4 dihydrosphingomyelinsphingomyelin G N-palmitoyl-sphinganine 1.2 phytosphingosine (d18:0/16:0)*(d18:1/18:1, 1 (d18:0/16:0) GC01 A7 B2 d18:2/18:0) 1 sphingomyelin 0.8 (d18:2/16:0, sphinganine 0.8 sphingomyelin

d18:1/16:1)* sphingomyelin intensity 0.6 (d18:1/17:0, glycosyl-N-stearoyl-sphingosine (d18:1/15:0, 0.6 d17:1/18:0, sphingomyelin d16:1/17:0)* 0.4 0.4 d19:1/16:0) Relative endogenous 0.2 Relative FL BODYPY 0.2 0 0 WT KO BODIPY FL C5-Sphingomyelin GC01 A7 B2

Figure 1. Deletion of SIRT1 in mESCs results in a dramatic accumulation of sphingomyelin.

(A) Metabolomic analysis reveals a massive accumulation of sphingolipids in SIRT1 KO mESCs. WT and SIRT1 KO mESCs were cultured in a complete mESC maintenance medium (M10) and metabolites were analyzed by metabolomics as described in Methods. The networks of significantly changed metabolites in lipid metabolism were analyzed by Cytoscape 2.8.3. Metabolites increased in SIRT1 KO mESCs were labeled red (p<0.05) or pink (0.05

A B WT KO ESGRO Medium Sirt1 WT M10 Medium 2 Sirt1 KO ** 1.8 1.8 SMPDL3B ** 1.6 * 1.6 * 1.4 1.4 ** * ** 1.2 1.2 1 1 SIRT1 0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2 Relative abundance mRNA 0 0 Actin

Sgms1 Sgms2 Samd8 Smpd1 Smpd2 Smpd3 Smpd4 Smpd5 Enpp7 Sgms1 Sgms2 Samd8 Smpd1Smpd2Smpd3Smpd4Smpd5 Enpp7 Smpdl3b Smpdl3b C D Sirt1 WT Sirt1 WT Sirt1 WT 0 30” 60” 90” 120” 150”

Sirt1 KO Sirt1 Sirt1 KO 0 30” 60” 90” 120” 150” KO

SMPDL3B SMPDL3B BODIPY FL C5-Sphingomyelin DAPI

Figure 2. SIRT1 deficient mESCs have reduced expression of SMPDL3B and sphingomyelin degradation.

(A) SIRT1 KO mESCs have reduced mRNA levels of Smpdl3b. WT and SIRT1 KO mESCs were cultured in either ESGRO medium or M10 medium. The mRNA levels of indicated enzymes involved in sphingomyelin synthesis (Sgms) and degradation (Smpd) were analyzed by qPCR (n=3 biological replicates, *p<0.05, **p<0.01). (B-C) SIRT1 KO mESCs have reduced protein levels of SMPDL3B. The protein levels of SMPDL3B were analyzed by (B) immuno-blotting and (C) immuno-fluorescence staining. Scale bars: 20µm. (D) SIRT1 KO mESCs have reduced degradation of sphingomyelin. WT and SIRT1 KO mESCs were preloaded with BODIPY FL-C5 sphingomyelin for 30 min at 4 �C, then incubated with BODIPY FL-C5 sphingomyelin-free medium at 37 �C. The dynamic of BODIPY FL-sphingomyelin was monitored for additional 12 hours at 37 �C. WT and SIRT1 KO mESC clones that have comparable preloaded levels of BODIPY FL-C5 sphingomyelin were shown. Scale bars: 20µm. bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A SMDPL3B Overexpression B M10 Medium C Sirt1 WT V Sirt1 WT SMPDL3B C5-Sphingomyelin in Sirt1 WT Sirt1KO M10 Medium

SMPDL3B + V + V 1.8 *** *** 1.6 n.s. 1.4 SMPDL3B 1.2 Sirt1 KO V Sirt1 KO SMPDL3B 1 0.8 0.6 GAPDH 0.4 0.2

Relative BODIPY FL Intensity FL BODIPY Relative 0 Sirt1 WT Sirt1 KO BODIPY FL C5-Sphingomyelin DRAQ5TM V L3B V L3B D ESGRO Medium Endogenous E C5-Sphingomyelin in F G SMDPL3B Knockdown Sirt1 WT V Sirt1 WT ESGRO Medium Sphingomyelin SMPDL3B 1.8 ** Sirt1 WT Sirt1KO 1.4 ** *** 1.6 shL3B * B11 B12 C1 V B11 B12 C1 V 1.2 *** 1.4 construct 1 1.2 0.8 1 SMPDL3B Sirt1 KO V Sirt1 KO SMPDL3B 0.6 0.8 0.6 0.4 0.4 ACTIN 0.2 0.2 0 0 Relative Endogenous SM Sirt1 WT Sirt1 KO Sirt1 WT Sirt1 KO BODIPY FL C5-Sphingomyelin Intensity FL BODIPY Relative V L3B V L3B V L3B V L3B

H I C5-Shingomyelin J Sirt1 WT V Sirt1 WT shSMPDL3B Endogenous Sphingomyelin n.s. *** p=0.07 n.s. 2.5 3.5 ** *** 2 3 2.5 1.5 2 Sirt1 KO V Sirt1KO shSMPDL3B 1 1.5 1 0.5 0.5 0 0 Relative Endogenous SM

Relative BODIPY FL Intensity FL BODIPY Relative Sirt1 WT Sirt1 KO Sirt1 WT Sirt1 KO BODIPY FL C5-Sphingomyelin V shL3B V shL3B V shL3B V shL3B

Figure 3. SMPDL3B directly controls the sphingomyelin contents in mESCs.

(A) Overexpression of SMPDL3B in mESCs. WT and SIRT1 KO mESCs were infected with lentiviral particles containing empty vector (V) or expressing SMPDL3B. The expression of SMPDL3B was analyzed by immuno-blotting. (B-C) Overexpression of SMPDL3B reduces sphingomyelin levels in mESCs cultured in M10 medium. The cellular levels of sphingomyelin in WT and SIRT1 KO mESCs with or without overexpression of SMPFL3B were analyzed by (B) BODIPY FL-sphingomyelin confocal imaging, and (C) FACS assay (n=3 biological replicates, *p<0.05, **p<0.01). Scale bars in (B): 20µm. L3B in (C): SMPDL3B. (D-F) Overexpression of SMPDL3B reduces sphingomyelin levels in mESCs cultured in ESGRO medium. The cellular levels of sphingomyelin in WT and SIRT1 KO mESCs with or without overexpression of SMPDL3B were analyzed by (D) BODIPY FL-sphingomyelin staining, (E) BODIPY FL-sphingomyelin FACS assay, or (F) an enzyme-coupled colorimetric assay for endogenous sphingomyelin. (n=3 biological replicates, *p<0.05, **p<0.01, ***p<0.001). Scale bars: 20µm. (G) Stable knockdown of the expression of SMPDL3B in mESCs. WT and SIRT1 KO mESCs were infected with lentiviral particles containing empty vector (V) or shRNA constructs for SMPDL3B (B11, B12, C1). The expression of SMPDL3B were analyzed by immuno- blotting. shL3B: shRNAs against SMPDL3B. (H-J) Knocking down SMPDL3B increases sphingomyelin levels in WT mESCs but not significantly further in SIRT1 KO mESCs in ESGRO medium. The cellular levels of sphingomyelin in WT and SIRT1 KO mESCs with or without stable knockdown of SMPDL3B were analyzed by (H) BODIPY FL-sphingomyelin confocal imaging, (I) BODIPY FL-sphingomyelin FACS assay, or (J) an enzyme-coupled colorimetric assay for endogenous sphingomyelin (n=3 biological replicates, **p<0.01, ***p<0.001). Scale bars: 20µm. bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A B Sirt1 Sirt1 C SIRT1 overexpression WT KO Smpdl3b mRNA Sirt1 WT Sirt1 KO V 1.2 *** SIRT1 V WT HY V WT HY 1 0.8 SIRT1 WT 0.6 *** *** 0.4 ACTIN 0.2 0 Relative abundance mRNA HY SIRT1 V WT HY V WT HY

Sirt1 WT Sirt1 KO SIRT1DAPI

D E F Sirt1 WT V Sirt1 WT-WT Sirt1 WT-HY C5-Shingomyelin SMPDL3B protein 1.4 *** *** *** 1.2 SIRT1 V WT HY V WT HY *** *** 1 0.8 SMPDL3B 0.6 Sirt1 KO V Sirt1 KO-WT Sirt1 KO-HY 0.4 ACTIN 0.2 0 SIRT1 V WT HY V WT HY Relative BODIPY FL Intensity FL BODIPY Relative

Sirt1 WT Sirt1 KO BODIPY FL C5-Sphingomyelin

Figure 4. Expression of WT but not catalytically inactive SIRT1 partially rescues the sphingomyelin defect in SIRT1 KO mESCs.

(A-B) SIRT1 protein levels in indicated mESCs. WT and SIRT1 KO mESCs were infected with lentiviral particles containing empty vector (Plentill-EF1 ) or constructs expressing WT or a catalytically inactive mutant SIRT1 (HY). The expression of SIRT1 was analyzed by either (A) immunoblotting or (B) immunofluorescence staining. Bars in B: 20µm. (C-D) Expression of the HY mutant SIRT1 represses the expression of⍺ Smpdl3b in WT mESCs, whereas expression of WT but not the HY mutant SIRT1 increases the expression of Smpdl3b in SIRT1 KO mESCs. The expression of SMPDL3B was analyzed by either (C) qPCR or (D) immunoblotting. (n=3 biological replicates, ***p<0.001). (E-F) Expression of WT but not HY mutant SIRT1 significantly reduces the sphingomyelin levels in both WT and SIRT1 KO mESCs. Indicated WT and SIRT1 KO mESCs cultured in ESGRO medium were labeled with BODIPY FL-labeled sphingomyelin for 30 min at 4 then incubated at 37 for 30 min. The intensity of BODIPY FL-labeled sphingomyelin in cells were analyzed by (E) confocal fluorescence imaging and by (F) quantitative FACS (n=3 biological replicates, ***p<0.001). Bars in E: 20µm. ℃ ℃ bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A Pol II B C 3 Potential TFs near Smpdl3b TSS Smpdl3b in dCas9 mESCs * *** n.s. 2 * ** * * * * 1 * * 1.2 * 1 0.8 1

0 0.6 0.8 0.4 0.6 0.8 H3K4me3 * 0.2 0.4

0.6 Association score * 0.2 0 0.4 * Relative abundance mRNA * 0 Zfx

* Klf4 Tcfc… E2f1 sgRNAs Gal4 -327 -426 517 528

0.2 Sox2 4- Oct Es rrb CTCF c-Myc n-Myc Suz12 Nanog STAT3 Smad1 Sirt1WT WT Sirt1KO KO 0 D E 0.1 H3K27me3 Smpdl3b c-Myc Smpdl3b * 0.08 * ** * * ** 0.06 1.2 1.2 ** 1.2 * ** 0.04 1 1 1 * 0.8 0.8 0.8 * 0.02 n.s. 0 0.6 0.6 0.6 0.4 0.4 0.4 0.1 Occupancy (% of Input) c-Myc 0.08 0.2 0.2 0.2 0 Relative abundance mRNA 0 0 0.06 * Relative abundance mRNA * DMSO 10058-F4 siNeg siMyc siNeg siMyc 0.04 WT KO WT KO WT KO WT KO WT KO WT KO 0.02 0 F G Smpdl3b Smpdl3b promoter Luc reporters 0.07 EZH2 * 1.2 4 *** 0.06 *** *** 0.05 1 ** 0.04 ** ** 3 0.03 0.8 0.02 0.6 2 0.01 *** 0 0.4 1 n.s. 516 649 385 206 139 373 0.2 ------Relative activityLUC

Exon Exon 1 0 0 Relative abundance mRNA 30 - V V 336 495 218

566 392 WT KO WT KO WT KO KR KQ WT - - - - - Distance to TSS (bp) pGL3- pGL3- pGL3- Myc Myc Myc - - - basic Smpdl3b Smpdl3b c c Sirt1 WT Sirt1 KO c WT E-box Mut WT KO

Figure 5. SIRT1 promotes the transcription of Smpdl3b through c-Myc in mESCs.

(A) SIRT1 KO mESCs have reduced transcription of Smpdl3b. WT and SIRT1 KO mESCs cultured in ESGRO medium were crosslinked and subjected for ChIP-qPCR profiling of PolII, c-Myc, EZH2, and indicated chromatin activation or repression marks near the TSS region of Smpdl3b gene (n=3 biological replicates, *p<0.05). (B) Association scores of potential transcription factors (TFs) near the TSS of Smpdl3b gene. The association scores of indicated TFs were obtained from a published dataset (54). A higher score is suggestive of a higher chance of Smpdl3b gene being targeted by the potential TF. (C) A guide RNA (gRNA) targeting the +528 locus at the TSS region of Smpdl3b gene rescues the expression of this gene. gRNAs targeting indicated loci near the TSS region of Smpdl3b gene were transfected into WT and SIRT1 KO mESCs stably expressing a dox-inducible dCas9 and BirA-V5 (dCas9 mESCs). The mRNA levels of Smpdl3b were analyzed by qPCR (n=3 biological replicates, *p<0.05, **p<0.01, ***p<0.001). (D) Inhibition of c-Myc activity reduces the expression of Smpdl3b gene in mESCs. WT and SIRT1 KO mESCs were treated with DMSO or 10 �M 10058-F4 for 48 hours. The mRNA levels of Smpdl3b were analyzed by qPCR (n=3 biological replicates, *p<0.05, **p<0.01, ***p<0.001). (E) Knocking down c-Myc significantly reduces the expression of Smpdl3b gene in mESCs. WT and SIRT1 KO mESCs were transfected with siRNAs against c-Myc for 48 hours. The mRNA levels of c-Myc and Smpdl3b were analyzed by qPCR (n=3 biological replicates, *p<0.05, **p<0.01). (F) Overexpression of the KR mutant of c-Myc partially reduces the expression of Smpdl3b gene in SIRT1 KO mESCs. The mRNA levels of Smpdl3b in indicated mESCs were analyzed by qPCR (n=6 biological replicates, **p<0.01, ***p<0.001). (G) Mutation of the c-Myc binding E-box element on the promoter of Smpdl3b gene abolishes the expression of Smpdl3b luciferase reporter in mESCs. Luciferase reporters containing the basic vector (pGL3-basic), the WT promoter of Smpdl3b gene, or a promoter of Smpdl3b gene with a mutant E-box were transfected into WT and SIRT1 KO mESCs, and the luciferase activities were measured as described in Methods (n=3 biological replicates, ***p<0.001). bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A Membrane fluidity **** WT vehicle KO vehicle WT MβCD KO MβCD 1.5 **** ** * 1.0

0.5

0.0

Relative ordered fraction-0.5 vehicle MβCD di-4-ANEPPDHQ 560nm (ordered) 620nm (disordered) WT KO WT KO B SM (µM) 0 20 40 60 80 100

Sirt1 WT

Sirt1 KO

C Sirt1 WT Sirt1KO SM (µM) 0 20 40 60 80 100 0 20 40 60 80 100

OCT3/4

Nanog

Nestin

SIRT1

GAPDH

Figure 6. Sphingomyelin accumulation increases membrane fluidity and induces expression of Nestin in SIRT1 KO mESCs.

(A) SIRT1 KO mESCs have an increased membrane fluidity. WT and SIRT1 KO mESCs cultured in ESGRO medium were preincubated with or without 2.5 mM MβCD for 1 hour, then stained with 5 μM di-4-ANEPPDHQ for at least 30 minutes. The relative ordered fraction in each group was analyzed as described in Methods (n=30 clones/group, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). Bars: 10µm. (B-C) Exogeneous sphingomyelin treatment increases Nestin but not pluripotency markers in mESCs. WT and SIRT1 KO mESCs were treated with indicated concentrations of sphingomyelin (SM) in ESGRO medium for 48 hours. (B) The intensity of AP was analyzed as described in Methods. (C) The protein abundance of pluripotency marker OCT3/4, Nanog and neuroepithelial stem cell marker Nestin in WT and Sirt1 KO mESCs were determined by immunoblotting. bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A B Pluripotent factors Neural marker Sirt1 Nanog Oct4 Tau ES cells 1.2 ** 1.5 1.5 40 * ** E14 WT (Nanog, OCT4) 1 E14 KO ** * * 30 0.8 1 1 0.6 ** 20 0.4 0.5 * 0.5 * 10 RHB-A medium 0.2 gelatin coated plates 0 0 0 0 4-7 days 0 1 2 4 0 1 2 4 0 1 2 4 0 1 2 4

D Sirt1 WT Neural progenitor and stem cell markers

Sox3 Nestin Notch3 Relative abundance mRNA 60 40 400 * * Neural Progenitors 50 * (Sox1, Sox3, Notch3) 30 300 40 Neuroectodermal Sirt1 KO stem cells 30 20 200 (Nestin) 20 10 100 10 0 0 0 0 1 2 4 0 1 2 4 0 1 2 4 5 ng/ml bFGF Time after differentiation (weeks) TUBB3 DAPI in RHB-A medium C laminin coated plates E14 Sirt1 WT E14 Sirt1 WT E14 Sirt1 WT 15-20 days

E14 Sirt1 KO E14 Sirt1 KO E14 Sirt1 KO

Neurons (Tau, βIII tubulin (TUBB3), Tyrosine hydroxylase (TH))

SOX1 DAPI TUBB3 DAPI TH DAPI

Figure 7. SIRT1 KO mESCs have an impaired neural differentiation in vitro.

(A) A diagram of the in vitro neural differentiation system. (B) SIRT1 KO E14 mESCs are less responsive to in vitro neural differentiation than WT mESCs. The expression of indicated genes were analyzed by qPCR during 4 weeks of in vitro neural differentiation. Please note that deletion of SIRT1 resulted in reduction in both repression of pluripotent factors and induction of markers for neural progenitors/stem cells and neurons (n=3 biological replicates, * p<0.05, **p<0.01). (C) SIRT1 KO E14 mESCs have reduced expression of neural differentiation markers and disordered neuronal morphology. WT and SIRT1 KO E14 mESCs after 4 weeks of in vitro neural differentiation were stained for a neural progenitor marker SOX1 (left panels) and neuronal markers �III tubulin (TUBB3, middle panels) and TH (right panels). Scale bars: 20µm. (D) SIRT1 KO mESCs have reduced expression of TUBB3 and mature neuronal morphology. WT and SIRT1 KO mESCs after 4 weeks of in vitro neural differentiation were stained for TUBB3. Scale bars: 20µm. bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A C D + Sirt1 WT V Sirt1 WT SMPDL3B Sox2 Sox3 TUBB3 cells ** 1.4 1.6 ** *** 1.2 * 1.4 p=0.09 100% 1.2 *** 1 80% 0.8 1 0.8 60% 0.6 0.6 Sirt1 KO SMPDL3B 40% Sirt1 KO V abundance 0.4 0.4 Relative mRNA 0.2 0.2 20% 0 0 Sirt1 WT Sirt1 KO Sirt1 WT Sirt1 KO 0%

+ V L3B V L3B V L3B V L3B CNPase cells *** 60% B E Sirt1 WT Sirt1 WT ** Sirt1 WT V Sirt1 WT SMPDL3B Sirt1 WT V Sirt1 WT SMPDL3B shV shSMPDL3B 50% 40% 30% 20% 10% 0% Sirt1 KO Sirt1 KO Sirt1 KO V Sirt1 KO SMPDL3B Sirt1 KO V Sirt1 KO SMPDL3B shV shSMPDL3B TUBB3+ & CNPase+ cells % of cells total % 100% ***

80% ** 60% Tau NEFH DAPI Bar=50µm TUBB3 DAPI TUBB3 DAPI (6 weeks induction) 40% F Sirt1 WT V Sirt1 WT SMPDL3B Sirt1 WT V Sirt1 WT SMPDL3B Sirt1 WT-V Sirt1 KO-V 20% 0%

GABA+ Cells

100% ** *** 80% Sirt1 KO V Sirt1 KO SMPDL3B Sirt1 KO V Sirt1 KO SMPDL3B Sirt1 KO-WT Sirt1 KO-HY 60% 40% 20% 0% Sirt1 WT Sirt1 KO Nestin DAPI GABA DAPI SOX1 Nestin DAPI Bar=50µm V L3B V L3B

Figure 8. Reduced expression of SMPDL3B is partially responsible for impaired in vitro neural differentiation in SIRT1 KO mESCs.

(A) Overexpression of SMPDL3B partially rescues gross neuronal morphology in in vitro differentiated SIRT1 KO mESCs. WT and SIRT1 KO mESCs stably infected with lentiviral particles containing empty vector (V) or constructs expressing SMPDL3B protein were subjected to 4 weeks of in vitro neural differentiation. The cell morphology was analyzed using regular light microscopy fixed with ZEISS AxioCamHR camera. Scale bars: 20µm. (B) Overexpression of SMPDL3B partially rescues neuronal morphology in in vitro differentiated SIRT1 KO cells. WT and SIRT1 KO mESCs expressing vector (V) or SMPDL3B were differentiated as in (A). The expression of indicated markers and neuronal morphology were analyzed by immunofluorescence staining. Scale bars: 20µm. (C) Overexpression of SMPDL3B partially rescues the expression of neural progenitor markers in in vitro differentiated SIRT1 KO cells. WT and SIRT1 KO mESCs expressing vector (V) or SMPDL3B were differentiated as in (A). The expression of SOX2 and SOX3 were analyzed by qPCR (n=3 biological replicates, *p<0.05, **p<0.01). (D) Overexpression of SMPDL3B partially increased the fraction of differentiated cells in in vitro differentiated SIRT1 KO cells. WT and SIRT1 KO mESCs expressing vector (V) or SMPDL3B were differentiated as in (A). The fraction of differentiated cells positive of indicated neural markers were quantified by FACS (n=3 biological replicates, **p<0.01, ***p<0.001). (E) Knocking down SMPDL3B in WT mESCs impairs neural differentiation in vitro. WT and SIRT1 KO mESCs with or without stable knockdown of SMPDL3B were in vitro differentiated into neurons for 4 weeks. The expression of neural markers Tau and NEFH were analyzed by immunofluorescence staining. Scale bars: 50µm. (F) WT but not a catalytic inactive SIRT1 rescues neural differentiation in vitro. WT and SIRT1 KO mESCs expressing vector (V), WT SIRT1, or a mutant SIRT1 lacking catalytic activity (HY) were in vitro differentiated into neurons for 4 weeks. The expression of neural markers SOX1 and Nestin were analyzed by immunofluorescence staining. Scale bars: 50µm. bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A E14.5 E18.5 B Smpdl3b E ns

P=0.068 ✱ ✱✱ ✱✱✱ 2.0 0.3 ✱✱✱ 1.2 ** WT mESCs KO mESCs ✱✱✱ ✱ 1 1.5 * 0.2 0.8 SIRT1 Ac -Myc 1.0 0.6 Ac c Ac c-Myc c-Myc 0.1 0.4 EZH2

Body Body weight (g) 0.5 0.2 Pol II 0.0 0.0 0 Smpdl3b Smpdl3b Relative abundance mRNA Chow HFD Chow HFD Chow HFD WT KO WT KO WT KO WT KO WT KO WT KO Sphingomyelin Sphingomyelin C Cerebrum Cerebellum Brain stem degradation accumulation 0.4 * 0.5 0.3 p=0.06 * 0.4 0.3 Proper membrane Increased membrane 0.2 0.3 fluidity fluidity 0.2 0.2 0.1 0.1 0.1 Normal Impaired SM (µg/mgSM tissue) neural differentiation neural differentiation 0 0 0 Chow HFD Chow HFD Chow HFD WT KO WT KO WT KO WT KO WT KO WT KO

D Map2 Mash1 Tau *** NeuN 8 *** 16 *** 2.5 3.5 *** 3 12 6 2 abundance 2.5 8 4 1.5 2 1 1.5

mRNA 4 2 1 0.5 0.5 0 0 0 0 Chow HFD Chow HFD Chow HFD Chow HFD Relative WT KO WT KO WT KO WT KO WT KO WT KO WT KO WT KO

Figure 9. Maternal high-fat diet feeding impairs neural development in SIRT1 deficient embryos.

(A) Maternal high-fat diet feeding reduces body weight of embryos. Maternal high-fat diet (HFD) feeding was performed 3-4 weeks before pregnancy (pre-feeding) as described in Methods. Body weight of E14.5 and E18.5 embryos were measured (*p<0.05, **p<0.01, ***p<0.001). (B) SIRT1 KO embryos have reduced expression of Smpdl3b in brains. The mRNA levels of Smpdl3b in brain of E18.5 embryos from chow fed dams or HFD fed dams were analyzed by qPCR (n=6 embryos, *p<0.05, **p<0.01). (C) Maternal high-fat diet feeding induces sphingomyelin accumulation in brains of SIRT1 KO embryos. Maternal high-fat diet (HFD) feeding was performed 3-4 weeks before pregnancy (pre-feeding) as described in Methods. Brains from E18.5 embryos were dissected into three parts and the endogenous sphingomyelins were extracted and measured (n=6 embryos, *p<0.05). (D) Maternal high-fat diet feeding induces defective expression of neural markers in brains of SIRT1 KO embryos. The mRNA levels of indicated neural markers in brain of E18.5 embryos from chow fed dams or HFD fed dams were analyzed by qPCR (n=6 embryos, *p<0.05, **p<0.01, ***p<0.001). (E) SIRT1 regulates sphingomyelin degradation and neural differentiation of mESCs through c-Myc and EZH2. SIRT1 is highly expressed in mESCs cells, where it functions to promote association of c-Myc and recruitment of Pol II to activate transcription of Smpdl3b gene and subsequent sphingomyelin degradation. This action of SIRT1 is important for maintenance of a proper membrane fluidity for normal neural differentiation in response to nutritional/developmental cues. Deletion of SIRT1 causes hyperacetylation and instability of c-Myc, leading to Pol II depletion and transcriptional repression of Smpdl3b. SIRT1 deficiency induced hyperacetylation and stabilization of EZH2 likely enforce this transcriptional suppression by adding H3K27me3 mark. This transcriptional repression of Smpdl3b is associated with accumulation of sphingomyelin, which increases membrane fluidity and impairs neural differentiation. Light blue triangles: H3K4me3; Light green circles: H3K27me3; Ac: acetylation. bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A B Endoplasmic reticulum Methionine Restricted Medium

Serine + palmitoyl CoA 1-palmitoyl-2-gamma-linolenoyl-GPC1-oleoyl-2-linoleoyl-GPC N-methyl-GABAgamma-aminobutyrate (16:0/18:3n6)* (18:1/18:2)* N-acetyl-aspartyl-glutamate 1,2-dioleoyl-GPI 1-stearoyl-2-oleoyl-GPC (NAAG) (GABA) (18:1/18:1) (18:0/18:1) SPT 1-palmitoyl-2-oleoyl-GPS N-acetylthreonine 1,2-dipalmitoyl-GPC (16:0/18:1) sarcosine 1-palmitoyl-2-arachidonoyl-GPC1,2-dioleoyl-GPE 1-palmitoyl-2-oleoyl-GPI 1-stearoyl-2-arachidonoyl-GPC glutamate (16:0/16:0) N-acetylserine pyroglutamine* glutamine (16:0/20:4) (18:1/18:1) 1-linoleoyl-2-arachidonoyl-GPC(16:0/18:1)* (18:0/20:4) glutamate, 1-palmitoyl-2-oleoyl-GPG (18:2/20:4n6)* 3-Keto dihydrosphingosine 1,2-dilinoleoyl-GPC 1-palmitoleoyl-2-oleoyl-GPC carboxyethyl-GABA gamma-methyl (16:0/18:1) betaine N-acetylglycine N-acetylglutamate (18:2/18:2) (16:1/18:1)* glycerophosphorylcholine Glycine, ester 1,2-dioleoyl-GPG1-oleoyl-2-linoleoyl-GPE 1-stearoyl-2-arachidonoyl-GPE myristoleate glycine Glutamate glycerophosphoinositol*(GPC) threonine (18:1/18:1) (18:1/18:2)* (18:0/20:4) palmitoleate (14:1n5)10-heptadecenoate Serine and Metabolism (16:1n7) (17:1n7) KDSR 1,2-distearoyl-GPC Threonine glycerophosphoethanolamine Phospholipid 1,2-distearoyl-GPG dimethylglycine N-acetylglutamine choline phosphate(18:0/18:0) 1-palmitoyl-2-palmitoleoyl-GPC(18:0/18:0) oleate/vaccenate Metabolism Metabolism (16:0/16:1)* 1-palmitoyl-2-stearoyl-GPC (18:1) 10-nonadecenoatearachidate (20:0) cytidine (16:0/18:0) 1-palmitoyl-2-arachidonoyl-GPE (19:1n9) Dihydrosphingosine arachidonate palmitate (16:0) serine 5'-diphosphocholine (16:0/20:4)* eicosenoate (20:1) palmitoloelycholine 1-palmitoleoyl-2-linoleoyl-GPC (20:4n6) Plasma membrane 1-palmitoyl-2-linoleoyl-GPC docosadienoate tryptophan 1-stearoyl-2-oleoyl-GPE (16:1/18:2)* asparagine (16:0/18:2) (22:2n6) C-glycosyltryptophan 1-palmitoyl-2-oleoyl-GPE(18:0/18:1) Long Chain myristate (14:0) N-acetylasparagine 5-hydroxyindoleacetate glutarate CERS (16:0/18:1) 1-linoleoyl-2-arachidonoyl-GPE linoleate (18:2n6) docosapentaenoate erucate (22:1n9) N-acetylalanine 2-aminoadipateN2-acetyllysine/N6-acetyllysine choline (pentanedioate) 1-palmitoyl-2-linoleoyl-GPE (18:2/20:4)* docosahexaenoate (n6 DPA; 22:5n6) Fatty Acid Alanine kynurenine (16:0/18:2) linolenate [alpha (DHA; 22:6n3) 1,2-dioleoyl-GPS oleoylcholine docosatrienoate cytidine-5'-diphosphoethanolamine1,2-dioleoyl-GPC or gamma; (22:3n3) and (18:1/18:1) 1-palmitoyl-2-oleoyl-GPC dihomo-linoleate 3-sulfo-L-alanine indolelactate Tryptophan 5-aminovalerate (18:1/18:1)* (18:3n3 or 6)] alanine guanidinoacetate Dihydroceramide (16:0/18:1) (20:2n6)Polyunsaturated stearate (18:0) Aspartate Metabolism Lysine Sphingomyelin 1-palmitoyl-2-alpha-linolenoyl-GPC 1,2-dilinoleoyl-GPE adrenate (22:4n6) lysine Fatty Acid Metabolism thioproline (16:0/18:3n3)* 1-stearoyl-2-arachidonoyl-GPI (18:2/18:2)* dihomo-linolenate creatine pipecolate Metabolism trimethylamine(18:0/20:4) (n3 and n6) DEGS N-oxide (20:3n3 or n6) aspartate N6,N6,N6-trimethyllysine eicosapentaenoate Creatine palmitoleoylcarnitine*myristoylcarnitine (EPA; 20:5n3) N-acetylaspartate Metabolism 5-hydroxylysine oleoylcarnitine (NAA) mead acid cysteine-glutathione creatinine (20:3n9) disulfide Ceramide docosapentaenoate 3-hydroxybutyrylcarnitine acetylcarnitine (n3 DPA; 22:5n3) Fatty Acid (1) N(4)-acetylspermidine O-methyltyrosine myo-inositol 17-methylstearate spermine 3-(4-hydroxyphenyl)lactatePhenylalanine SMPD 3-hydroxybutyrate Metabolism(Acyl S-methylglutathione 1-palmitoyl-3-linoleoyl-glycerol (BHBA) (16:0/18:2)* Carnitine) and phenyllactateN-acetylphenylalanine 4-acetamidobutanoate 3-hydroxy-3-methylglutarate palmitoylcarnitine Glutathione Polyamine (PLA) CERT stearoylcarnitine Tyrosine Inositol Metabolism Metabolism acetylcholine Fatty Acid, 1-palmitoleoyl-3-oleoyl-glycerol ophthalmatecysteinylglycine Metabolism Metabolism Amino putrescine KetoneBranched palmitoylcholine (16:1/18:1)* Mevalonate Fatty Acid Guanidino CERK Bodies Metabolism 3-hydroxybutyrylcarnitine Acid and phenol sulfate malonate Metabolism (2) N-acetylputrescine (AcylDiacylglycerol 5-methylthioadenosineAcetamido Ceramide 1-oleoyl-3-linoleoyl-glycerol 5-oxoproline phenylacetylglycine Ceramide-1-P (MTA) Metabolism NeurotransmitterFatty Acid Choline) (18:1/18:2) glutathione, carnitine Synthesis oxidized (GSSG)glutathione, phenylalanine Carnitine spermidine 3-methyl-2-oxobutyrate PPAP2A/B/C glycerophosphoglycerol N-methylproline proline reduced (GSH) p-cresol sulfate beta-hydroxyisovaleroylcarnitine Ceramide cholesterol Urea cycle; 4-imidazoleacetate Metabolism 3-hydroxylaurate CDASE Fatty Acid, tyrosine valine Sphingolipid Glycerolipid Arginine Histidine Leucine, SGMS deoxycarnitine isovalerylcarnitine Sterol Monohydroxy and Proline Metabolism Metabolism N-monomethylarginineN-acetylarginine Isoleucine leucine UGCG GBA 3-hydroxymyristate 1-methylimidazoleacetate 1-(1-enyl-oleoyl)-2-oleoyl-GPE Metabolism and Valine Lipid imidazole 4-guanidinobutanoate (P-18:1/18:1)* tiglylcarnitine Phosphatidylserine glycerol propionate Metabolism alpha-hydroxyisocaproate Sphingosine metabolism 1-(1-enyl-oleoyl)-GPE beta-hydroxyisovalerate (P-18:1)* Fatty Acid N-delta-acetylornithine Glucosyl ceramide Lysoplasmalogen 1-stearoyl-2-arachidonoyl-GPS(PS) 7-hydroxycholesterol 4-hydroxybutyrate N-acetylhistidine sphingomyelin Fatty Acid(18:0/20:4) (alpha or beta) (GHB) Metabolism pro-hydroxy-pro (d18:1/22:1, behenoyl alpha-hydroxyisovalerate d18:2/22:0,sphingomyelin 1-(1-enyl-palmitoyl)-GPE Metabolism glycerol sphingomyelin palmitoyl trans-4-hydroxyproline citrulline 2-methylbutyrylglycine (d18:1/20:0, (P-16:0)* histidine d16:1/24:1)* (d18:1/22:0)* (also BCAA 3-phosphate methylsuccinate d16:1/22:0)* Endocannabinoid ethanolamide 3-methylhistidine SPHK SGPP sphingomyelin Fatty Acid, homocitrulline 1-methylhistidine imidazole lactate (d18:2/24:1, 1-(1-enyl-palmitoyl)-GPC Metabolism) 1-stearoyl-2-oleoyl-GPS 2-hydroxy-3-methylvalerateethylmalonate Sphingomyelin sphingomyelin Dicarboxylate isoleucine d18:1/24:2)* N-palmitoyl-sphingosine (P-16:0)* acetyl CoA (18:0/18:1) 2-palmitoyl-GPC arginine ornithine (d18:1/14:0, 1-palmitoyl-GPI (d18:1/16:0)sphingomyelin 1-oleoyl-GPG (16:0)* N-acetylvaline tricosanoyl d16:1/16:0)* (16:0)* dimethylarginine (d18:1/21:0, (18:1)* sphingomyelinglycosyl-N-palmitoyl-sphingosine (SDMA + ADMA)argininosuccinate isobutyrylcarnitine d17:1/22:0, 1-(1-enyl-stearoyl)-GPE 2-methylbutyrylcarnitine sphingomyelin(d18:1/23:0)* (P-18:0)* 2-hydroxyglutarate 1-oleoyl-GPS 3-hydroxyisobutyrate d16:1/23:0)* 1-stearoyl-GPS (C5) Sphingosine-1-P myristoyl CoA 1-arachidonoyl-GPE (18:1) Methionine, 3-methylglutaconate (d18:2/14:0, 1-palmitoyl-GPS sphingomyelin Sphingolipid butyrylcarnitine (18:0)* (20:4n6)* cysteine sulfinic taurine lactosyl-N-palmitoyl-sphingosined18:1/14:1)* oleoyl (16:0)* Cysteine, (d18:1/24:1, Metabolism stearoyl acid ethanolamide 2-palmitoleoyl-GPC d18:2/24:0)* ethanolamide 2-hydroxyadipate SAM and homocysteine palmitoyl sphingomyelin 1-lignoceroyl-GPC 1-linoleoyl-GPC(16:1)* sphingosine propionylcarnitine Taurine S-adenosylmethionine sphingomyelinsphingomyelin (d18:2/23:0, maleate (24:0) Lysolipid (18:2) 2-hydroxybutyrate/2-hydroxyisobutyrate cystine (SAM) Complex (d18:1/16:0)(d18:1/20:1, stearoyl d18:1/23:1, Metabolism d18:2/20:0)* d17:1/24:1)* 1-arachidonoyl-GPC sphingomyelin 1-palmitoleoyl-GPC N-acetylmethionine palmitoyl (20:4n6)* sulfoxide methionine sphingomyelin(d18:1/18:0) 1-stearoyl-GPG 1-arachidonoyl-GPI(16:1)* dihydrosphingomyelin Plasmalogen1-(1-enyl-palmitoyl)-2-arachidonoyl-GPC sulfoxide glycosphingolipids (GSL) (d18:1/18:1, (18:0) (20:4)* N-palmitoyl-sphinganine(d18:0/16:0)* 2-linoleoylglycerol (P-16:0/20:4)* phytosphingosine d18:2/18:0) 1-stearoyl-GPI (d18:0/16:0) (18:2) S-adenosylhomocysteine sphingomyelin (18:0) 1-linoleoyl-GPE N-acetylcysteine (SAH) (d18:2/16:0, Monoacylglycerol (18:2)*1-palmitoyl-GPE sphinganine 1-(1-enyl-palmitoyl)-2-palmitoleoyl-GPC 2-stearoyl-GPE N-acetylmethionine d18:1/16:1)*sphingomyelin 1-oleoyl-GPE (16:0) 2-aminobutyrate sphingomyelin 1-arachidonylglycerol (P-16:0/16:1)* 1-palmitoyl-GPC (18:0)* glycosyl-N-stearoyl-sphingosine(d18:1/17:0, 1-(1-enyl-stearoyl)-2-arachidonoyl-GPE (18:1) cysteine (d18:1/15:0, (20:4) 1-(1-enyl-palmitoyl)-2-oleoyl-GPC (16:0) 1-oleoyl-GPI d17:1/18:0, (P-18:0/20:4)* N-acetyltaurine d16:1/17:0)* (P-16:0/18:1)* (18:1)* 1-palmitoyl-GPG N-formylmethionine d19:1/16:0) cystathionine 1-(1-enyl-palmitoyl)-2-linoleoyl-GPC 2-arachidonoylglycerol 1-(1-enyl-palmitoyl)-2-oleoyl-GPE 1-stearoyl-GPE (16:0)* (P-16:0/18:2)* hypotaurine Golgi complex 2-palmitoylglycerol (20:4) (P-16:0/18:1)* (18:0) 1-oleoyl-GPC 1-linoleoylglycerol 1-(1-enyl-palmitoyl)-2-palmitoyl-GPC 1-stearoyl-GPC methionine (16:0) (18:1) (18:2) (P-16:0/16:0)* (18:0) sulfone methionine 1-dihomo-linolenylglycerol 1-(1-enyl-stearoyl)-2-oleoyl-GPE 2-palmitoleoylglycerol 1-palmitoleoylglycerol1-(1-enyl-palmitoyl)-2-arachidonoyl-GPE (20:3) (P-18:0/18:1) (16:1)* (16:1)* (P-16:0/20:4)* 1-oleoylglycerol Isobar: fructose (18:1) 1-palmitoylglycerol 1,6-diphosphate, 2-oleoylglycerol (16:0) glucose (18:1) 1,6-diphosphate, myo-inositol 1,4 or 1,3-diphosphate flavin adenine dinucleotide cytosine N4-acetylcytidine (FAD) glucose threonate riboflavin (Vitamin 5-methylcytidine phosphoenolpyruvate 6-phosphate glucose gulonic acid* B2) cytidine cytidine glycerate (PEP)Glycolysis, 5'-monophosphate3'-monophosphate Ascorbate Pyrimidine(5'-CMP) (3'-CMP) Gluconeogenesis, flavin 3-methylcytidine and 5-methyltetrahydrofolate Metabolism, and (5MeTHF) Riboflavin mononucleotide 2'-deoxycytidine Aldarate (FMN) C D Cytidine cytidine E dihydroxyacetonelactate Pyruvate Metabolism diphosphate phosphate Metabolism pyruvate containing (DHAP) Metabolism Mel1 hESCs 2'-deoxycytidine fructose retinol (Vitamin A) 5'-monophosphate adenosine trigonelline nicotinamide Folate (N'-methylnicotinate) cytidine 3',5'-cyclic Metabolism folate 2'-deoxyadenosine Nicotinate monophosphate adenosine Vitamin A (cAMP) and WT mESCs KO mESCsadenosine Sirt1 WT mESCsFructose, 5'-diphosphoribose Metabolism pyridoxamine 3'-monophosphateN6-carbamoylthreonyladenosine (ADP-ribose) Nicotinamide (3'-AMP) Mannose galactonate N6,N6-dimethyladenosine 3-phosphoglycerate lactose Metabolism orotate Purine Disaccharides and pseudouridine sedoheptulose-7-phosphate Vitamin B6 Pyrimidine Metabolism, 2'-deoxyadenosine pyridoxine WT A7 B6 B7 beta-alanine 2'-deoxyuridine and Galactose nicotinamide 5'-monophosphate ribose Metabolism Pyrimidine Metabolism, Adenine adenylosuccinate Pentose Oligosaccharides riboside Cofactors (Vitamin B6) 1-phosphate Metabolism nicotinamide Orotate adenosine containing Phosphate mannitol/sorbitol Tocopherol Metabolism, orotidine 5'-monophosphate adenine adenosine nicotinamide and N-acetyl-beta-alanine (AMP) Pathway dinucleotide Metabolism pyridoxal uridine Uracil containing 2'-monophosphate ribonucleotide ribulose/xylulose (NAD+) phosphate (2'-AMP) (NMN) Vitamins pyridoxate containing adenine 5-phosphate pyridoxamine SIRT1 uridine adenosine pyridoxal phosphate uracil N1-methyladenosine ribonate 5'-diphosphate Purine and 5'-diphosphate mannose Thiamine (ADP) ribose alpha-tocopherol Pantothenate (UDP) glucosamine-6-phosphate Pyrimidine adenosine Metabolism methylphosphate N6-succinyladenosine Carbohydrate and CoA Metabolism erythronate* Pentose uridine Metabolism 5-methyluridine Metabolism 3’-dephospho-acetyl-coenzyme 5'-monophosphate Nucleotide Pyrimidine (ribothymidine) AminosugarN-acetylglucosaminylasparagine arabitol/xylitol A (UMP) Metabolism, ACTIN Metabolism thiamin (Vitamin Thymine B1) phosphopantetheine 3'-dephosphocoenzyme A containing thymidine glucuronate sedoheptulose AICA thiamin thiamin 7-methylguanine ribonucleotide N-acetylglucosamine ribitol diphosphatemonophosphate Purine thymidine ribulose/xylulose Purine 6-phosphate Nucleotide guanosine Metabolism, 5'-monophosphate N-acetylglucosamine/N-acetylgalactosamine coenzyme A 2'-deoxyinosineMetabolism, 3'-monophosphate Sugar arabonate/xylonate pantothenate Guanine UDP-glucose (Hypo)Xanthine/Inosine (3'-GMP) N-acetyl-glucosamine WT A7 B6 B7 containing 1-phosphate thymine N-acetylneuraminate hypoxanthine containing WT mEFs KO mEFs3-aminoisobutyrate Sirt1 KO mESCs UDP-N-acetylglucosamine guanine

inosine cytidine UDP-glucuronate xanthosine xanthine 5'-monophospho-N-acetylneuraminic 5'-monophosphate guanosine 5'- acid monophosphate UDP-galactose (xmp) guanosine UDP-N-acetylgalactosamine (5'-GMP) allantoin inosine N2,N2-dimethylguanosine 5'-monophosphateurate SIRT1 (IMP) 2'-deoxyguanosine xanthosine

isoleucylglycine valylglycine 2-dimethylaminoethanol acetylphosphate benzoate valylglutamine glycylisoleucine penicillin G glycylvaline catechol sulfate tyrosylglycine Oxidative leucylglutamine* Benzoate Drug Phosphorylation valylleucine Metabolism Dipeptide histidylalanine DAPI glutaminylleucine prolylglycine hippurate

phenylalanylglycine 2-methylcitrate/homocitrate leucylglycine BODIPYsulfate* FL N6-Ceramide alanylleucine Energy BODIPY FL C5-Sphingomyelin citrate leucylalanine Xenobiotics glycylleucinephenylalanylalanine Chemical DAPI TCA Cycle N-glycolylneuraminate Food O-sulfo-L-tyrosine alpha-ketoglutarate Component/Plant succinate beta-guanidinopropanoate Peptide homostachydrine* Dipeptide trizma acetate succinylcarnitine malate gamma-glutamylmethionine phenol red Derivative gamma-glutamylthreonine* gamma-glutamylalanine fumarate stachydrine Figure S1. Deletion of SIRT1 in ESCs results in a dramatic accumulation of sphingomyelin. gluconate gamma-glutamylphenylalanine gamma-glutamylcysteine Gamma-glutamyl erythritol

carnosine Amino Acidgamma-glutamylisoleucine* gamma-glutamylleucine 1 gamma-glutamylglycine (A) Key sphingolipid metabolic pathways (modified from ). SPT: serine palmitoyl transferasegamma-glutamylglutamine ; KDSR: 3-keto dihydrosphingosine gamma-glutamylglutamate

gamma-glutamyl-epsilon-lysine gamma-glutamyltryptophan gamma-glutamyltyrosine reductase; CERS, ceramide synthase; DEGS: dihydroceramide desaturase; CERTgamma-glutamylhistidine: ceramide transfer protein; UGCG: UDP-glucose ceramide glucosyltransferase; GBA: glucosyl ceramidase; SGMS: sphingomyelin synthasegamma-glutamylvaline ; SMPD: sphingomyelin phosphodiesterase; CERK: ceramide kinase; PPAP2A/B/C: phosphatidic acid phosphatase 2A/B/C; CDASE: ceramidase; SPHK: sphingosine kinase; SGPP: sphingosine-1-phosphate phosphatase. (B) Metabolomic analysis reveals a massive accumulation of sphingolipids in SIRT1 KO mESCs cultured in methionine restricted medium. WT and SIRT1 KO mESCs were cultured in a methionine restricted M10 medium containing 6 µM of methionine for 6 hours and metabolites were analyzed by metabolomics as described in Methods. The networks of significantly changed metabolites in lipid metabolism were analyzed by Cytoscape 2.8.3. Metabolites increased in SIRT1 KO mESCs were labeled red (p<0.05) or pink (0.05

A Relative mRNA Abundance of SMPD Enzymes 6 5 4 3 2 1 0 Relative abundance mRNA

Smpd1 Smpd2 Smpd3 Smpd4 Smpd5 Enpp7 Smpdl3b B Sirt1 WT Sirt1 WT

SGMS1 DAPI OV SMPD2 DAPI OV Sirt1 KO Sirt1 KO

SGMS1 DAPI OV SMPD2 DAPI OV Sirt1Sirt1 WT Sirt1 WT WT

SGMS2 DAPI OV SMPD4 DAPI OV Sirt1 KO Sirt1 KO

SGMS2 DAPI OV SMPD4 DAPI OV

Figure S2. Expression of sphingolipid synthesis and degrading enzymes in WT and SIRT1 KO mESCs.

(A) Smpdl3b is one of the major Smpds in mESCs. The relative mRNA levels of indicated Smpds were measured by qPCR and normalized with standard curves using cDNA of each gene. Their relative abundance was then quantified and compared (n=3 biological replicates). (B) The expression of SGMS1, SGMS2, SMPD2, and SMPD4 in WT and SIRT1 KO mESCs were analyzed by immunofluorescence staining. Bars: 20µm. bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A Full length of Smpdl3b gene

3_For 3_Rev

1,2_For 1,2_Rev 3_For 4_Rev 5’ 10293bp 1292bp 3556bp 15863bp 1211bp 84bp 4259bp 3’ Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 Exon 7 Exon 8

B Sirt1 WT C mESCs Sirt1 KO MEFs Smpdl3b 1.2 1.4 3.5 *** 1 1.2 3 1 2.5 0.8 0.8 2 0.6 *** 0.6 1.5 * 0.4 *** *** Relative Smpdl3b *** 0.4 1 mRNA abundance mRNA 0.2 0.2 0.5 0 0 0 Nuclear cytosol Relative abundance mRNA Sirt1 WT KO WT KO

Smpdl3b_1Smpdl3b_2Smpdl3b_3Smpdl3b_4 Smpdl3b_1Smpdl3b_2Smpdl3b_3Smpdl3b_4

D Northern Blot E Total RNA-seq Smpdl3b Sirt1 WT KO Exons Introns 700 50 WT-1 700 50 WT-2 700 50 WT-3 700 50 Smpdl3b KO-1 Full Length 700 50 KO-2 mRNA 700 KO-3 50

Gapdh 50000 800

WT-1 50000 800 WT-2 50000 800 WT-3 50000 800 KO-1 28s RNA 50000 800 KO-2 50000 800 18s RNA KO-3

Figure S3. Deletion of SIRT1 reduces transcription of Smpdl3b gene.

(A) Diagram of mouse Smpdl3b gene structure. The locations of indicated qPCR primers were denoted. (B) SIRT1 KO mESCs but not MEFs have reduced mature Smpdl3b mRNA. The relative mature mRNA levels of Smpdl3b were analyzed by qPCR by four different pairs of primers as indicated in (A) (n=3 biological replicates, ***p<0.001). (C) SIRT1 KO mESCs have reduced Smpdl3b mRNA in both nuclear and cytosol. The nuclear and cytosol fraction of WT and SIRT1 KO mESCs were separated as described in Methods and mRNA levels of Smpdl3b were analyzed by qPCR (n=3 biological replicates, *p<0.05, ***p<0.001). (D) SIRT1 KO mESCs have reduced levels of full length Smpdl3b mRNA. Total RNA from WT and SIRT1 KO mESCs were probed for full length Smpdl3b mRNA by Northern blotting as described in Methods. (E) SIRT1 KO mESCs have reduced abundance of transcripts of Smpdl3b gene at both intronic and exonic regions. Ribo-minus total RNA from WT and SIRT1 KO mESCs were sequenced by Nova-seq. The total reads mapped to the whole mouse Smpdl3b gene were shown. The transcript abundance of Gapdh gene at both exonic and intronic regions was shown as control. bioRxiv preprint doi: https://doi.org/10.1101/2021.02.24.432815; this version posted February 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A Position of sgRNA sequences for Smpdl3b gene B dCas9 induction with doxycycline -327bp TSS +517 bp 5’

3’ sgRNA Gal4 Gal4 -327 +517 +528 -426bp WT KO WT KO WT KO WT KO WT KO +528bp Dox (1 µg/ml) - - + + + + + + + +

Mapped EZH2 binding region CAS9

c-Myc “E-Box” binding SIRT1 Sequence CACGTGG 132756282132756477 132757687 132757739 ACTIN gRNA 528 sequence 132756623- 132756643

D Smpdl3b

Mapped c-Myc binding region 1.6 Sit1 WT C 1.4 Sirt1 KO WT V KO V KO c-Myc-WT KO c-Myc-KR KO c-Myc-KQ 1.2 1 0.8 0.6

abundance 0.4 Relative mRNA 0.2 0 0 0.3 0.7 1.1 SIRT1 c-Myc DAPI EPZ 6438 (µM)

Smpdl3b E 1.2 Ezh2 F siNeg siEZH2 G 1.2 1 1 Sirt1 WT KO WT KO 0.8 0.8 0.6 EZH2 0.6 0.4 0.4 abundance abundance 0.2 Relative mRNA 0.2

relative mRNA ACTIN 0 0 siNeg siEZH2 siNeg siEZH2 Sirt1 WT KO WT KO Sirt1 WT KO WT KO

Figure S4. SIRT1 promotes the transcription of Smpdl3b through c-Myc but not EZH2 in mESCs.

(A) The positions of gRNA targeting sequences on the Smpdl3b gene. The targeting sequence of gRNA +528 is located in a region containing both mapped c-Myc binding site and EZH2 binding site. (B) The expression of dCas9 and SIRT1 in WT and SIRT1 KO dCas9 mESCs. WT and SIRT1 KO dCas9 mESCs transfected with indicated sgRNA were treated with 1 µg/ml Dox for 48 hours. (C) Overexpression of WT, K323R, and K323Q mutant of c-Myc in SIRT1 KO mESCs. WT and SIRT1 KO mESCs were infected with lentiviral particles containing empty vector (V) or constructs expressing WT, K323R (KR), or K323Q (KQ) mutant of c-Myc. Bars: 20µm. (D) Inhibition of EZH2 have limited effect on the expression of Smpdl3b gene in mESCs. WT and SIRT1 KO mESCs were treated with EPZ6438 at indicated concentrations for 48 hours (n=3 biological replicates). (E-F) Knocking down EZH2 in mESCs. WT and SIRT1 KO mESCs were transfected with control siRNA (siNeg) or siRNAs against EZH2 (siEZH2) for 48 hours. The expression of Smpdl3b was analyzed by (E) qPCR (n=3 biological replicates) and (F) immunoblotting. (G) Knocking down EZH2 have minimal effect on the expression of Smpdl3b gene in mESCs (n=3 biological replicates). (which wasnotcertifiedbypeerreview)istheauthor/funder,whohasgrantedbioRxivalicensetodisplaypreprintinperpetuity.Itmade bioRxiv preprint transcriptomes downregulated KO (A) Figure membrane B A Genes doi: mESCs S https://doi.org/10.1101/2021.02.24.432815 proteinaceous extracel lular matrix lular extracel proteinaceous 5 . involved SIRT . signaling (B) Cacna1i Scnn1b Scnn1a membrane from Trpm4 Scn9a Scn3a Scn1b Scn2b Scn3b Scn4a Scn8a Scn5a 1 Two Grik4 Grik3 Grik5 deficiency in endoplasmic reticulum WT . major membrane and Functional annotation of 2839 down 2839 of annotation Functional pathways WT 1 impaired SIRT in WT 2 available undera mESCs cell surface membrane function

1 WT 3 were KO KO 1 genes in SIRT1 KO membrane mESCs significantly KO 2 shown are KO 3 CC-BY 4.0Internationallicense significantly ; 0 this versionpostedFebruary25,2021. was (n= pathways - 3 log10(p performed biological reduces 5 enriched mESCs in - value) SIRT the replicates) as 10 expression described

in WT 1 1 - regulated regulated KO genes WT 2 . mESCs WT 3 . 15

downregulated KO 1 in of

Methods KO 2 . genes The copyrightholderforthispreprint GSEA KO 3 . involved analysis Two in SIRT major in of 1