DOCSLIB.ORG

Meta-Analysis of Genome-Wide Association Studies for Abdominal Aortic Aneurysm Identifies Four New Disease-Specific Risk Loci

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Meta-Analysis of Genome-Wide Association Studies for Abdominal Aortic Aneurysm Identifies Four New Disease-Specific Risk Loci ), 13q12.11 as modifiers of SMYD2 LDLR , and IL6R DOI: 10.1161/CIRCRESAHA.116.308765 genome-wide association study genome-wide , In various database searches, we database searches, In various ■ Bown ). ERG IdentifiesFour ERG AAA risk loci: 1q32.3 ( genetics ■ meta-analysis ■ was 15.7 days. was . License, which permits use, distribution, and reproduction in any medium, in any and reproduction use, distribution, which permits License, ), and 21q22.2 ( 341 MMP9 and ZNF335 / computational biology computational Circulation Research Research Circulation ERG ■ Clinical Track MMP9 / 766 controls, we identified 4 new 766 controls, matrix metalloproteinases Disease-Specific Risk Loci ■ is published on behalf of the American Heart Association, Inc., by Wolters Kluwer Health, Inc. This is Kluwer Health, Inc. Wolters Association, Inc., by American Heart is published on behalf of the Creative Creative Attribution Commons PCIF1 Andre M. van Rij, Nilesh J. Samani, Matthew J. Rij, Nilesh J. Samani, Matthew Andre M. van New Through a meta-analysis of 6 genome-wide association study data sets and a validation of 6 genome-wide association study data sets and a validation a meta-analysis Through 204 cases and 107 Abdominal Aortic Aneurysm Circulation Research Circulation is available at http://circres.ahajournals.org is available aortic aneurysm, abdominal aortic The 4 new risk loci for AAA seem to be specific for AAA compared with other cardiovascular with other cardiovascular AAA compared for AAA seem to be specific The 4 new risk loci for ), 20q13.12 (near for Abdominal aortic aneurysm (AAA) is a complex disease with both genetic and environmental risk environmental genetic and both disease with a complex (AAA) is aortic aneurysm Abdominal . 2017;120:341-353. DOI: 10.1161/CIRCRESAHA.116.308765.) To identify additional AAA risk loci using data from all available genome-wide association studies. all available AAA risk loci using data from identify additional To John R. Thompson, Paul I.W. de Bakker, Panos Deloukas, Robert D. Sayers, Seamus C. Harrison, Panos de Bakker, I.W. Thompson, Paul John R. Johan L.M. Björkegren, Leonard Lipovich, Anne M. Drolet, Eric L. Verhoeven, Clark J. Zeebregts, Clark J. Zeebregts, Verhoeven, Anne M. Drolet, Eric L. Leonard Lipovich, Johan L.M. Björkegren, , with a direct interaction between , with a direct Meta-Analysis of Genome-Wide Association Studies Meta-Analysis of Genome-Wide Unnur Thorsteinsdottir, Jan D. Blankensteijn, Joep A.W. Teijink, Cisca Wijmenga, Jacqueline de Graaf, Wijmenga, Cisca Teijink, A.W. Joep Jan D. Blankensteijn, Thorsteinsdottir, Unnur John D. Eicher, Andrew D. Johnson, Christer Betsholtz, Arno Ruusalepp, Oscar Franzén, Eric E. Schadt, D. Johnson, Christer Betsholtz, Andrew John D. Eicher, Laura J. Rasmussen-Torvik, Kenneth M. Borthwick, Diane T. Smelser, David R. Crosslin, Mariza de Andrade, R. Crosslin, Mariza de David Smelser, T. M. Borthwick, Diane Kenneth Laura J. Rasmussen-Torvik, Glenn S. Gerhard, David P. Franklin, David J. Carey, Victoria L. Phillips, Michael J.A. Williams, Wenhua Wei, Wei, Wenhua Williams, L. Phillips, Michael J.A. Victoria J. Carey, Franklin, David P. Glenn S. Gerhard, David Ana R. Verissimo, Suzannah Bumpstead, Stephen A. Badger, Rachel E. Clough, Gillian Cockerill, Hany Hafez, Hany Rachel E. Clough, Gillian Cockerill, A. Badger, Suzannah Bumpstead, Stephen Verissimo, Ana R. Natzi Sakalihasan, Audrey Courtois, Robert E. Ferrell, Per Eriksson, Lasse Folkersen, Anders Franco-Cereceda, Courtois, Robert E. Ferrell, Per Eriksson, Lasse Folkersen, Audrey Natzi Sakalihasan, Robert H. Geelkerken, Marc R. van Sambeek, Steven M. van Sterkenburg, Jean-Paul de Vries, Kari Stefansson, Vries, Kari Stefansson, de Jean-Paul Sterkenburg, M. van Sambeek, Steven Marc R. van Robert H. Geelkerken, LINC00540 Circ Res Alberto Smith, Matthew M. Thompson, Frank M. van Bockxmeer, Stefan E. Matthiasson, Gudmar Thorleifsson, E. Matthiasson, Gudmar Stefan Bockxmeer, Thompson, Frank M. van M. Alberto Smith, Matthew D. Julian A. Scott, T. Simon Futers, Simon P.R. Romaine, Katherine Bridge, Kathryn J. Griffin, Marc A. Bailey, A. Bailey, Romaine, Katherine Bridge, Kathryn J. Griffin, Marc Simon Futers, Simon P.R. T. A. Scott, D. Julian Key Words: Key Femke N.G. van‘t Hof, Thomas R. Webb, Robert Erdman, Marylyn D. Ritchie, James R. Elmore, Anurag Verma, Verma, Anurag Robert Erdman, Marylyn D. Ritchie, James R. Elmore, Webb, Thomas R. Hof, N.G. van‘t Femke ( observed no new associations between the lead AAA single nucleotide polymorphisms and coronary artery disease, and coronary nucleotide polymorphisms AAA single the lead new associations between no observed analyses identified lipids, or diabetes mellitus. Network blood pressure, MMP9 diseases and related traits suggesting that traditional cardiovascular risk factor management may only have risk factor management may only have traits suggesting that traditional cardiovascular diseases and related of aneurysmal disease. the progression in preventing limited value ( study totaling 10 factors. Together, 6 previously identified risk loci only explain a small proportion of the heritability of AAA. of the heritability of identified risk loci only explain a small proportion 6 previously Together, factors. Lambertus A. Kiemeney, Jes S. Lindholt, Anne Hughes, Declan T. Bradley, Kathleen Stirrups, Jonathan Golledge, Bradley, T. Anne Hughes, Declan Jes S. Lindholt, A. Kiemeney, Lambertus Ross Blair, Andrew A. Hill, Thodor M. Vasudevan, David R. Lewis, Ian A. Thomson, Jo Krysa, Geraldine B. Hill, A. Ian R. Lewis, David Vasudevan, Thodor M. A. Hill, Andrew Ross Blair, Evan J. Ryer, Catherine A. McCarty, Erwin P. Böttinger, Jennifer A. Pacheco, Dana C. Crawford, David S. Carrell, David Dana C. Crawford, A. Pacheco, Jennifer Böttinger, Erwin P. A. McCarty, Catherine J. Ryer, Evan Circulation Research © 2016 The Authors. Original received March 23, 2016; revision received October 28, 2016; accepted November 21, 2016. In October 2016, the average time from submission time from the average October 2016, 21, 2016. In accepted November 28, 2016; October received 2016; revision March 23, Original received Appendix. the author affiliations, please see the For with this article at http://circres.ahajournals.org/lookup/suppl/doi:10.1161/CIRCRESAHA. The online-only Data Supplement is available LE2 7LX, of Leicester Robert Kilpatrick Bldg, Leicester, Sciences, University MBBCh, MD, Cardiovascular J. Bown, Correspondence to Matthew Carlo Pratesi, The Cardiogenics Consortium, The International Consortium for Blood Pressure, Athanasios Saratzis, The International Consortium for Blood Pressure, The Cardiogenics Consortium, Carlo Pratesi, Paul E. Norman, Janet T. Powell, Steve E. Humphries, Stephen E. Hamby, Alison H. Goodall, Christopher P. Nelson, Alison H. Goodall, Christopher P. E. Humphries, Stephen E. Hamby, Steve Powell, T. E. Norman, Janet Paul Justin Roake, Tony R. Merriman, Grzegorz Oszkinis, Silvia Galora, Claudia Saracini, Rosanna Abbate, Raffaele Pulli, Abbate, Raffaele Oszkinis, Silvia Galora, Claudia Saracini, Rosanna R. Merriman, Grzegorz Tony Justin Roake, Sarah Pendergrass, Iftikhar J. Kullo, Zi Ye, Peggy L. Peissig, Omri Gottesman, Shefali S. Verma, Jennifer Malinowski, Jennifer Malinowski, Verma, S. L. Peissig, Omri Gottesman, Shefali Peggy Ye, Zi Iftikhar J. Kullo, Sarah Pendergrass, Gregory T. Jones, Gerard Tromp, Helena Kuivaniemi, Solveig Gretarsdottir, Annette F. Baas, Betti Giusti, Ewa Strauss, Baas, Betti Giusti, Ewa Annette F. Gretarsdottir, Solveig Helena Kuivaniemi, Tromp, Jones, Gerard T. Gregory provided that the original work is properly cited. that the original work provided an open access article under the terms of the terms of under the access article an open to first decision for all original research papers submitted to 116.308765/-/DC1. Zealand. E-mail of Otago, Dunedin 9054, New Department, University Jones, PhD, Surgery T. or Gregory United Kingdom. E-mail [email protected]; [email protected] Conclusions: Methods and Results: Rationale: Objective: Downloaded from http://circres.ahajournals.org/ by guest on March 23, 2017 342 Circulation Research January 20, 2017 Novelty and Significance What Is Known? identified risk loci explain only a small proportion of this effect. No current effective medical therapies that slow AAA growth • Abdominal aortic aneurysm (AAA) has a prevalence of ≈1.5% in men aged >65 years. exist, highlighting the need to better understand factors influ- • Positive family history of AAA is a strong risk factor for AAA; however, encing pathogenesis and disease progression. This study is only 6 robust and independently validated AAA genetic loci have been the first meta-analysis of genome-wide association studies for identified to date. AAA (10 204 cases). Four novel loci were identified and 5 of the 6 previous AAA genetic associations were confirmed. The new What New Information Does This Article Contribute? loci showed no significant associations with other arterial disease phenotypes, potentially suggesting associations more specific to • Four novel genetic loci associated with AAA were identified. • Pathway analysis highlighted the potential importance of lipoprotein AAA than known loci (such as CDKN2BAS1, SORT1, and LDLR). metabolism, inflammation, and matrix metalloproteinases in AAA Associations were consistent with known AAA pathobiology, im- pathobiology. plicating lipoprotein metabolism, inflammation, and matrix me- • Potentially novel mechanisms, involving genes such as ERG, PLTP, and talloproteinases
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Overexpression of DCLK1-AL Increases Tumor Cell Invasion, Drug Resistance, and KRAS Activation and Can Be Targeted to Inhibit Tumorigenesis in Pancreatic Cancer
    Hindawi Journal of Oncology Volume 2019, Article ID 6402925, 11 pages https://doi.org/10.1155/2019/6402925 Research Article Overexpression of DCLK1-AL Increases Tumor Cell Invasion, Drug Resistance, and KRAS Activation and Can Be Targeted to Inhibit Tumorigenesis in Pancreatic Cancer Dongfeng Qu ,1,2,3 Nathaniel Weygant,1 Jiannan Yao ,4 Parthasarathy Chandrakesan,1,2,3 William L. Berry,5 Randal May ,1,2 Kamille Pitts,1 Sanam Husain,6 Stan Lightfoot,6 Min Li,1 Timothy C. Wang,7 Guangyu An ,4 Cynthia Clendenin,8 Ben Z. Stanger,8 and Courtney W. Houchen 1,2,3 Department of Medicine, University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA Department of Veterans Affairs Medical Center, Oklahoma City, OK, USA Peggy and Charles Stephenson Cancer Center, Oklahoma City, OK, USA Department of Oncology, Beijing Chaoyang Hospital, Capital Medical University, Beijing, China Department of Cell Biology, University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA Department of Pathology, University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA Department of Digestive and Liver Diseases, Columbia University Medical Center, New York, NY, USA Department of Medicine, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA, USA Correspondence should be addressed to Dongfeng Qu; [email protected] and Courtney W. Houchen; [email protected] Received 24 January 2019; Revised 10 May 2019; Accepted 27 May 2019; Published 5 August 2019 Academic Editor: Francesca De Felice Copyright © 2019 Dongfeng Qu et al. Tis is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
    [Show full text]
  • Recombinant MAP2K2 Protein
    Recombinant MAP2K2 protein Catalog No: 81332, 81632 Quantity: 20, 1000 µg Expressed In: Baculovirus Concentration: 0.3 µg/µl Source: Human Buffer Contents: Recombinant MAP2K2 protein is supplied in 25 mM HEPES-NaOH pH 7.5, 300 mM NaCl, 10% glycerol, 0.04% Triton X-100, and 0.5 mM TCEP. Background: MAP2K2 (Mitogen-Activated Protein Kinase Kinase Kinase 2) is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase plays a critical role in mitogen growth factor signal transduction. It phosphorylates and activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, cognitive disability, and distinctive facial features similar to those found in Noonan syndrome. Protein Details: Recombinant MAP2K2 protein was expressed in baculovirus expression system as the full length protein (accession number NP_109587.1) with a N-terminal FLAG Tag. The molecular weight of the protein is 45.7 kDa. Application Notes: This product was manufactured as described in Protein Details. Where possible, Active Motif has developed functional or activity assays for Recombinant MAP2K2 protein gel recombinant proteins. Additional characterization such as enzyme kinetic activity 10% SDS-PAGE with Coomassie blue assays, inhibitor screening or other biological activity assays may not have been staining MW: 45.7 kDa performed for every product. All available data for a given product is shown on the lot- Purity: >90% specific Technical Data Sheet. Storage and Guarantee: Recombinant proteins in solution are temperature sensitive and must be stored at -80°C to prevent degradation.
    [Show full text]
  • Table 2. Functional Classification of Genes Differentially Regulated After HOXB4 Inactivation in HSC/Hpcs
    Table 2. Functional classification of genes differentially regulated after HOXB4 inactivation in HSC/HPCs Symbol Gene description Fold-change (mean ± SD) Signal transduction Adam8 A disintegrin and metalloprotease domain 8 1.91 ± 0.51 Arl4 ADP-ribosylation factor-like 4 - 1.80 ± 0.40 Dusp6 Dual specificity phosphatase 6 (Mkp3) - 2.30 ± 0.46 Ksr1 Kinase suppressor of ras 1 1.92 ± 0.42 Lyst Lysosomal trafficking regulator 1.89 ± 0.34 Mapk1ip1 Mitogen activated protein kinase 1 interacting protein 1 1.84 ± 0.22 Narf* Nuclear prelamin A recognition factor 2.12 ± 0.04 Plekha2 Pleckstrin homology domain-containing. family A. (phosphoinosite 2.15 ± 0.22 binding specific) member 2 Ptp4a2 Protein tyrosine phosphatase 4a2 - 2.04 ± 0.94 Rasa2* RAS p21 activator protein 2 - 2.80 ± 0.13 Rassf4 RAS association (RalGDS/AF-6) domain family 4 3.44 ± 2.56 Rgs18 Regulator of G-protein signaling - 1.93 ± 0.57 Rrad Ras-related associated with diabetes 1.81 ± 0.73 Sh3kbp1 SH3 domain kinase bindings protein 1 - 2.19 ± 0.53 Senp2 SUMO/sentrin specific protease 2 - 1.97 ± 0.49 Socs2 Suppressor of cytokine signaling 2 - 2.82 ± 0.85 Socs5 Suppressor of cytokine signaling 5 2.13 ± 0.08 Socs6 Suppressor of cytokine signaling 6 - 2.18 ± 0.38 Spry1 Sprouty 1 - 2.69 ± 0.19 Sos1 Son of sevenless homolog 1 (Drosophila) 2.16 ± 0.71 Ywhag 3-monooxygenase/tryptophan 5- monooxygenase activation protein. - 2.37 ± 1.42 gamma polypeptide Zfyve21 Zinc finger. FYVE domain containing 21 1.93 ± 0.57 Ligands and receptors Bambi BMP and activin membrane-bound inhibitor - 2.94 ± 0.62
    [Show full text]
  • Targeting Fibrosis in the Duchenne Muscular Dystrophy Mice Model: an Uphill Battle
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.20.427485; this version posted January 21, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Targeting fibrosis in the Duchenne Muscular Dystrophy mice model: an uphill battle 2 Marine Theret1#, Marcela Low1#, Lucas Rempel1, Fang Fang Li1, Lin Wei Tung1, Osvaldo 3 Contreras3,4, Chih-Kai Chang1, Andrew Wu1, Hesham Soliman1,2, Fabio M.V. Rossi1 4 1School of Biomedical Engineering and the Biomedical Research Centre, Department of Medical 5 Genetics, 2222 Health Sciences Mall, Vancouver, BC, V6T 1Z3, Canada 6 2Department of Pharmacology and Toxicology, Faculty of Pharmaceutical Sciences, Minia 7 University, Minia, Egypt 8 3Developmental and Stem Cell Biology Division, Victor Chang Cardiac Research Institute, 9 Darlinghurst, NSW, 2010, Australia 10 4Departamento de Biología Celular y Molecular and Center for Aging and Regeneration (CARE- 11 ChileUC), Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, 8331150 12 Santiago, Chile 13 # Denotes Co-first authorship 14 15 Keywords: drug screening, fibro/adipogenic progenitors, fibrosis, repair, skeletal muscle. 16 Correspondence to: 17 Marine Theret 18 School of Biomedical Engineering and the Biomedical Research Centre 19 University of British Columbia 20 2222 Health Sciences Mall, Vancouver, British Columbia 21 Tel: +1(604) 822 0441 fax: +1(604) 822 7815 22 Email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.01.20.427485; this version posted January 21, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Allosteric Activation of Functionally Asymmetric RAF Kinase Dimers
    Allosteric Activation of Functionally Asymmetric RAF Kinase Dimers Jiancheng Hu,1,2 Edward C. Stites,1 Haiyang Yu,1 Elizabeth A. Germino,1 Hiruy S. Meharena,3,4 Philip J.S. Stork,6 Alexandr P. Kornev,3,4,5 Susan S. Taylor,3,4,5,* and Andrey S. Shaw1,2,* 1Department of Pathology and Immunology 2Howard Hughes Medical Institute Washington University School of Medicine, 660 South Euclid, Box 8118, St. Louis, MO 63110, USA 3Department of Chemistry/Biochemistry 4Department of Pharmacology 5Howard Hughes Medical Institute University of California San Diego, 9500 Gilman Drive, Mail code 0654, La Jolla, CA 92093, USA 6Vollum Institute, Oregon Health & Science University, 3181 SW Sam Jackson Park Road, Portland, OR 97239, USA *Correspondence: [email protected] (S.S.T.), [email protected] (A.S.S.) http://dx.doi.org/10.1016/j.cell.2013.07.046 SUMMARY There are three isoforms of RAF: A-RAF, B-RAF, and C-RAF. Each appears to have a distinct mechanism of activation (Baljuls Although RAF kinases are critical for controlling et al., 2007; Galabova-Kovacs et al., 2006; Wimmer and Baccar- cell growth, their mechanism of activation is incom- ini, 2010). BRAF is considered to be more active and have a pletely understood. Recently, dimerization was simpler mechanism of activation in comparison to CRAF and shown to be important for activation. Here we show ARAF (Chong et al., 2001; Rebocho and Marais, 2013; Zhang that the dimer is functionally asymmetric with one and Guan, 2000). This difference can potentially explain why kinase functioning as an activator to stimulate activ- BRAF mutations are so common in cancer, in contrast to CRAF and ARAF, where mutations are rarely found (Davies ity of the partner, receiver kinase.
    [Show full text]
  • Identifying Novel Actionable Targets in Colon Cancer
    biomedicines Review Identifying Novel Actionable Targets in Colon Cancer Maria Grazia Cerrito and Emanuela Grassilli * Department of Medicine and Surgery, University of Milano-Bicocca, Via Cadore 48, 20900 Monza, Italy; [email protected] * Correspondence: [email protected] Abstract: Colorectal cancer is the fourth cause of death from cancer worldwide, mainly due to the high incidence of drug-resistance toward classic chemotherapeutic and newly targeted drugs. In the last decade or so, the development of novel high-throughput approaches, both genome-wide and chemical, allowed the identification of novel actionable targets and the development of the relative specific inhibitors to be used either to re-sensitize drug-resistant tumors (in combination with chemotherapy) or to be synthetic lethal for tumors with specific oncogenic mutations. Finally, high- throughput screening using FDA-approved libraries of “known” drugs uncovered new therapeutic applications of drugs (used alone or in combination) that have been in the clinic for decades for treating non-cancerous diseases (re-positioning or re-purposing approach). Thus, several novel actionable targets have been identified and some of them are already being tested in clinical trials, indicating that high-throughput approaches, especially those involving drug re-positioning, may lead in a near future to significant improvement of the therapy for colon cancer patients, especially in the context of a personalized approach, i.e., in defined subgroups of patients whose tumors carry certain mutations. Keywords: colon cancer; drug resistance; target therapy; high-throughput screen; si/sh-RNA screen; CRISPR/Cas9 knockout screen; drug re-purposing; drug re-positioning Citation: Cerrito, M.G.; Grassilli, E.
    [Show full text]
  • Advancing a Clinically Relevant Perspective of the Clonal Nature of Cancer
    Advancing a clinically relevant perspective of the clonal nature of cancer Christian Ruiza,b, Elizabeth Lenkiewicza, Lisa Eversa, Tara Holleya, Alex Robesona, Jeffrey Kieferc, Michael J. Demeurea,d, Michael A. Hollingsworthe, Michael Shenf, Donna Prunkardf, Peter S. Rabinovitchf, Tobias Zellwegerg, Spyro Moussesc, Jeffrey M. Trenta,h, John D. Carpteni, Lukas Bubendorfb, Daniel Von Hoffa,d, and Michael T. Barretta,1 aClinical Translational Research Division, Translational Genomics Research Institute, Scottsdale, AZ 85259; bInstitute for Pathology, University Hospital Basel, University of Basel, 4031 Basel, Switzerland; cGenetic Basis of Human Disease, Translational Genomics Research Institute, Phoenix, AZ 85004; dVirginia G. Piper Cancer Center, Scottsdale Healthcare, Scottsdale, AZ 85258; eEppley Institute for Research in Cancer and Allied Diseases, Nebraska Medical Center, Omaha, NE 68198; fDepartment of Pathology, University of Washington, Seattle, WA 98105; gDivision of Urology, St. Claraspital and University of Basel, 4058 Basel, Switzerland; hVan Andel Research Institute, Grand Rapids, MI 49503; and iIntegrated Cancer Genomics Division, Translational Genomics Research Institute, Phoenix, AZ 85004 Edited* by George F. Vande Woude, Van Andel Research Institute, Grand Rapids, MI, and approved June 10, 2011 (received for review March 11, 2011) Cancers frequently arise as a result of an acquired genomic insta- on the basis of morphology alone (8). Thus, the application of bility and the subsequent clonal evolution of neoplastic cells with purification methods such as laser capture microdissection does variable patterns of genetic aberrations. Thus, the presence and not resolve the complexities of many samples. A second approach behaviors of distinct clonal populations in each patient’s tumor is to passage tumor biopsies in tissue culture or in xenografts (4, 9– may underlie multiple clinical phenotypes in cancers.
    [Show full text]
  • Coupling of Autism Genes to Tissue-Wide Expression and Dysfunction of Synapse, Calcium Signalling and Transcriptional Regulation
    PLOS ONE RESEARCH ARTICLE Coupling of autism genes to tissue-wide expression and dysfunction of synapse, calcium signalling and transcriptional regulation 1 2,3 4 1,5 Jamie ReillyID *, Louise Gallagher , Geraldine Leader , Sanbing Shen * 1 Regenerative Medicine Institute, School of Medicine, Biomedical Science Building, National University of a1111111111 Ireland (NUI) Galway, Galway, Ireland, 2 Discipline of Psychiatry, School of Medicine, Trinity College Dublin, Dublin, Ireland, 3 Trinity Translational Medicine Institute, Trinity Centre for Health SciencesÐTrinity College a1111111111 Dublin, St. James's Hospital, Dublin, Ireland, 4 Irish Centre for Autism and Neurodevelopmental Research a1111111111 (ICAN), Department of Psychology, National University of Ireland (NUI) Galway, Galway, Ireland, a1111111111 5 FutureNeuro Research Centre, Royal College of Surgeons in Ireland (RCSI), Dublin, Ireland a1111111111 * [email protected] (JR); [email protected] (SS) Abstract OPEN ACCESS Citation: Reilly J, Gallagher L, Leader G, Shen S Autism Spectrum Disorder (ASD) is a heterogeneous disorder that is often accompanied (2020) Coupling of autism genes to tissue-wide with many co-morbidities. Recent genetic studies have identified various pathways from expression and dysfunction of synapse, calcium hundreds of candidate risk genes with varying levels of association to ASD. However, it is signalling and transcriptional regulation. PLoS ONE unknown which pathways are specific to the core symptoms or which are shared by the co- 15(12): e0242773. https://doi.org/10.1371/journal. pone.0242773 morbidities. We hypothesised that critical ASD candidates should appear widely across dif- ferent scoring systems, and that comorbidity pathways should be constituted by genes Editor: Nirakar Sahoo, The University of Texas Rio Grande Valley, UNITED STATES expressed in the relevant tissues.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Chromosome Abnormalities in Neonates with Congenital Heart Defects
    CHROMOSOME ABNORMALITIES IN NEONATES WITH CONGENITAL HEART DEFECTS by Kristine Kay Bachman B.A. Biology and Spanish, Bucknell University, 2010 Submitted to the Graduate Faculty of Human Genetics, Genetic Counseling Graduate School of Public Health in partial fulfillment of the requirements for the degree of Master of Science University of Pittsburgh 2012 UNIVERSITY OF PITTSBURGH Graduate School of Public Health This thesis was presented by Kristine Kay Bachman It was defended on April 11, 2012 and approved by Thesis Advisor: Suneeta Madan-Khetarpal, MD Associate Professor of Pediatrics Division of Medical Genetics School of Medicine University of Pittsburgh Committee Member: Robin Grubs, MS, PhD, CGC Assistant Professor of Human Genetics Co-Director, Genetic Counseling Program Department of Human Genetics Graduate School of Public Health University of Pittsburgh Committee Member: Susanne Gollin, PhD Professor of Human Genetics Department of Human Genetics Graduate School of Public Health University of Pittsburgh Committee Member: Stephanie DeWard, MS, CGC Division of Medical Genetics School of Medicine University of Pittsburgh ii Kristine Kay Bachman 2012 iii Thesis Advisor: Suneeta Madan-Khetarpal, MD CHROMOSOME ABNORMALITIES IN NEONATES WITH CONGENITAL HEART DEFECTS Kristine Kay Bachman, M.S. University of Pittsburgh, 2012 Congenital heart disease (CHD) contributes to the rate of birth defects in the population with an incidence of nearly 1% of all live births (1). CHD has significant Public Health importance due to its high incidence, clinical severity, and complexity of medical management. In some cases, efficiently diagnosing the underlying cause of CHD is essential to providing optimal clinical care. The etiology of CHD is hypothesized to be largely multifactorial in nature, but chromosome abnormalities account for 8-13% of all CHD (2, 3).
    [Show full text]