An Abstract of the Thesis Of

AN ABSTRACT OF THE THESIS OF

Justin Litwin for the degree of Master of Science in Horticulture presented on May 4, 2020.

Title: Assessment of Grapevine Red Blotch Virus Impacts on Physiology, Productivity, and Fruit Composition of ‘Pinot noir’ Grown in Oregon’s Willamette Valley

Abstract approved: ______Patricia Skinkis

Grapevine red blotch disease (GRBD) is caused by Grapevine Red Blotch Virus, a virus in the Geminiviridae family. Observable symptoms can manifest in red cultivars, such as leaf blades that are partially to fully red, red veins, and different combinations of the two. Previous research has shown evidence of reduced total soluble solids, anthocyanins, and phenolic compounds in GRBD infected vines. In cool regions, such as Oregon’s Willamette Valley, GRBD could have a significant effect on fruit ripeness and wine quality. Most research on this disease to date has been conducted in New York and California. To understand the impacts of vine physiology, productivity, and fruit quality from GRBD in a cool climate, a field study was conducted in Oregon’s Willamette Valley from 2017 to 2019. A commercial

Pinot noir vineyard containing both GRBD+ and GRBD- vines, including GRBD+ vines that were either symptomatic or asymptomatic was selected for this research.

Vines were monitored through each growing season for visual disease symptoms and physiological measures. Visual symptoms began to appear on leaves at véraison in

the basal portion of the shoots and continued acropetally as the season progressed. No consistent differences were observed in the physiological measures of photoassimilation, stomatal conductance, or leaf greenness. Véraison nutrient testing in all three years revealed a consistent magnesium deficiency in petioles of symptomatic GRBD+ vines compared to asymptomatic GRBD+ vines. Yield and berries per cluster did not differ between healthy and GRBD+ vines at harvest in any year, but cluster and berry weight were lower in symptomatic GRBD+ compared to asymptomatic GRBD- in 2017 and 2018. Fruit at harvest did not differ in total soluble solids in any year between healthy and GRBD+ vines. However, during 2018 and 2019 pH was higher and titratable acidity was lower in 2019 in symptomatic

GRBD+ vines compared to asymptomatic GRBD+ vines. No consistent differences in total anthocyanin, total phenolic, or total tannins were measured based on virus or symptom status. This study suggests that there are few impacts of GRBD for Pinot noir grown under the cool climate conditions of Oregon’s Willamette Valley.

Assessment of Grapevine Red Blotch Virus Impacts on Physiology, Productivity, and Fruit Composition of ‘Pinot noir’ Grown in Oregon’s Willamette Valley

by Justin Litwin

A THESIS

submitted to

Oregon State University

in partial fulfillment of the requirements for the degree of

Master of Science

Presented May 4, 2020 Commencement June 2020

Master of Science thesis of Justin Litwin presented on May 4, 2020

APPROVED:

Major Professor, representing Horticulture

Head of the Department of Horticulture

Dean of the Graduate School

I understand that my thesis will become part of the permanent collection of Oregon State University libraries. My signature below authorizes release of my thesis to any reader upon request.

Justin Litwin, Author

ACKNOWLEDGEMENTS

I would like to thank Dr. Patty Skinkis for her continued support and mentorship. I began this journey as an undergraduate with little experience in research and have been allowed to explore curiosities and gain knowledge on my way to this goal.

I would also like to acknowledge the other members of my committee, including Dr. Jay Pscheidt and Dr. Alec Levin for their involvement in my education and helping me pursue answers that moved me forward.

All of the members the Skinkis Lab are also to thank for their comradeship and guidance on issues pertinent to the day to day, as well as always being warm and inviting.

Finally, I would like to thank all of my friends and family for their support over these past years. It was not always easy, but without you I could not have completed this.

CONTRIBUTION OF AUTHORS

Dr. Patrcia Skinkis was the principal investigator and served as major professor.

Dr. Robert Martin assisted with collection of virus samples and performed virus testing.

TABLE OF CONTENTS

Page Chapter 1: Introduction ...... 1 Literature Cited ...... 6 Chapter 2: Assessment of Grapevine Red Blotch Virus Impacts on Physiology, Productivity, and Fruit Composition of ‘Pinot noir’ Grown in Oregon’s Willamette Valley ...... 11 Introduction ...... 11 Materials and Methods ...... 12 Symptom Evaluations ...... 15

Vine growth and production ...... 15

Leaf Gas Exchange...... 16

Vine nutrient status...... 16

Yield parameters and fruit composition ...... 17

Statistical Analysis ...... 18

Results ...... 18 Seasonal climate data ...... 18

Disease symptoms...... 19

Leaf gas exchange and leaf greenness...... 20

Vine nutrient status...... 21

Vine growth and productivity ...... 22

Fruit composition ...... 22

Discussion ...... 23 Conclusion ...... 27 Literature Cited ...... 28 Figures ...... 34 Tables...... 39

TABLE OF CONTENTS (Continued)

Page Chapter 3: Conclusions ...... 45 Literature Cited ...... 47

LIST OF FIGURES

Figure Page

1. Grapevine red blotch disease symptomatic leaves found …..…………………….34 on a ‘Pinot noir’ grapevine that tested positive for the virus in a vineyard in Amity, OR.

2. Progression of ‘Pinot noir’ grapevine red blotch disease ...……………………...35 symptom incidence in the canopy of individual grapevines from the first symptom onset at late véraison to post- harvest for a vineyard in Amity, OR during 2019.

3. Symptomatic grapevine red blotch virus positive ‘Pinot noir’……………………36 vine next to an asymptomatic healthy (grapevine red blotch virus negative) ‘Pinot noir’ vine in a vineyard in Amity, OR.

4. Mean (+SE) single leaf photoassimilation from the upper……………………….37 positions of ‘Pinot noir’ vines in 2017, 2018, and 2019.

5. Mean (+SE) single leaf stomatal conductance from the………………………….38 upper canopy positions of ‘Pinot noir’ vines in 2017, 2018, and 2019.

LIST OF TABLES

Table Page

1. Weather data for the north Willamette Valley of Oregon…………………………39 during three growing seasons (2017-2019) during which grapevine red blotch research was conducted.

2. Mean (+SE) véraison nutrient concentration of ‘Pinot noir’..………………….…40 grapevines in Amity, OR.

3. Mean (+SE) véraison micronutrient concentration of ‘Pinot……..…………….…41 noir’ grapevines in Amity, OR.

4. Mean (+SE) growth and crop load measures of ‘Pinot noir’ ……….……..……..42 grapevines in Amity, OR.

5. Mean (+SE) harvest yield and cluster components of ‘Pinot ………….…………43 noir’ grapevines in Amity, OR.

6. Mean (+SE) berry composition at harvest of ‘Pinot noir’….…………………….44 grapevines in Amity, OR.

Chapter 1: Introduction

Grapevine red blotch disease (GRBD) has become an important concern among the Oregon wine industry, with reports coming from California producers and some local information indicating the potential for reduced fruit and wine quality.

Grapevine red blotch disease is a relatively new disease and the need for more research in Oregon is necessary to gain insight into the disease characteristics and impacts in the local environment and on Oregon’s most economically important cultivar, Pinot noir, on which previous research has not been conducted.

In 2008, vines at a California vineyard were showing symptoms similar to grapevine leafroll disease, including leaves with red blotchy areas. However, the vines tested negative for grapevine leafroll associated virus (Calvi, 2011). During this same period, investigations of similar symptoms were being investigated independently in New York, which led to the identification of a circular single stranded DNA virus temporarily known as grapevine Cabernet Franc associated virus

(Krenz, 2012). These two independent observations were linked, and the disease became known as grapevine red blotch disease (GRBD) and the virus termed grapevine red blotch virus (Yepes, 2019).

Grapevine red blotch disease has continued to be identified across North

America, including British Columbia, Washington, Pennsylvania, New Jersey, Ohio,

Virginia, Maryland, and Oregon (Krenz, 2014; Poojari, 2017; Yao, 2017; Adiputara,

2018). This disease has more recently been identified in Switzerland, Korea, and

India (Reynard, 2018; Lim, 2016; Marwal, 2018). Evidence obtained in California at the Vitis Germplasm repository has led some to suggest that this virus has been

2 around for over 70 years (Thompson, 2017). The fact that this was an unknown disease is one of the potential reasons that it may have continued to spread to vineyards across the globe by way of propagation material. For example, the disease was found in Switzerland for vines imported from the United States (Reynard, 2018).

Grapevine red blotch disease has noticeable visual symptoms during certain phenological stages. The disease symptoms can manifest with different levels of intensity and position within the vine. However, the most common symptoms in red- fruited cultivars are leaves with red blotchy leaf blades and/or red veins. These symptoms typically first occur in basal leaves and are expressed in leaves acropetally as the season progresses (Sudarshana, 2015). Research suggests that symptom development is related to foliar metabolism effects associated with the virus. Wallis and Sudarshana (2016) found that the virus has an effect on primary metabolism resulting in increased levels of reducing sugars in the leaves which thereby cause anthocyanin acculation in the leaf blade, causing red blotches.

The impacts of grapevine red blotch disease on fruit and wine quality are still being explored, but the most recent research comes from California vineyards. One measure of concern for many growers is the reduction of total soluble solids (TSS), a primary metric used to determine fruit ripeness and harvest timing. Several studies show that GRBD reduces TSS by 2-20% compared to healthy vines without the virus

(Sudarshana, 2015; Martínez-Lüscher, 2019; Girardello, 2019a). Impacts on amino acid and phenolic compounds have also been observed in GRBD+ vines (Wallis &

Sudarshana, 2016) with some evidence supporting changes in gene regulation of the both pathways (Blanco-Ulate, 2017). Many of these studies have focused on red

3 grape cultivars, such as Cabernet Sauvignon (Wallis, 2016; Giradello, 2019a;

Martínez-Lüscher, 2019), Merlot (Poojari, 2013; Giradello, 2019a), and Zinfandel

(Blanco-Ulate, 2017). Research on GRBD of white grape cultivars is more challenging because the symptoms are less visible and wine quality is generally of lower economic impact. However, Girardello et al. (2019b) found that GRBD affected TSS, pH, and phenolic compounds in Chardonnay fruit which led to decreases in ethanol, phenolic compounds, and volatile compounds of the wine with an increase in pH.

Grapevine red blotch virus is in the family Geminiviridae and is currently the only known geminivirus to infect grapevines. Recently the virus has been confirmed as the causal agent in GRBD by meeting the three assumptions of Kochs Postulates, including 1) being present in all cases of the disease, 2) the microorganism must be isolated in pure culture or by proxy through engineered clones, and 3) cause the same disease when the pure culture is inoculated into a healthy host (Yepes et al. 2018).

The virus genome is made up of a circular single-stranded DNA sequence of approximately 3,206 nucleotides (Krenz, 2012; Al Rwahnih, 2013; Poojari, 2013).

The genome has many small variations and has been divided into two main clades

(Krenz, 2014). Many grapevine viruses outside of the Geminiviradae family infect grapevines and are responsible for other diseases, including grapevine fanleaf virus, rupestris stem pitting-associated virus, and grapevine leafroll-associated virus. The visual symptoms of grapevine leafroll-associated virus are similar to those GRBV, but a few distinguishing characteristics is the rolling of the leaf blade margins (Pacific

Northwest Plant Disease Management Handbook, 2020). Observations in prior

4 research have shown reductions of anthocyanins and phenolic compounds in ‘Pinot noir’ due to grapevine leafroll-associated virus (Lee, 2019), which are similar to reports of GRBD in other cultivars. A yield decline has been associated with grapevine leafroll-associated virus leading to economic impacts (Atallah, 2012), but currently no yield impacts have been associated with GRBD with potential ecomonic impacts stemming from reductions in fruit quality (Ricketts, 2015)

A concern with any plant virus is the potential for spread within a vineyard or between vineyards. Cieniewicz, et al. (2017) reported an increase in disease incidence from 3.9% to 7.1% in two years at a California vineyard growing Cabernet Franc. In this same vineyard, Perry et al. (2016) identified that the GRBV infected vines occurred near a riparian area bordering the vineyard. This prompted a search for alternative hosts plants in areas near cultivated grapes, and the virus was found in wild grapevines near vineyards (Perry, 2016) and in Himalayan blackberry (Bahder,

2016a).

The transmission of grapevine red blotch virus through propagation of grapevine plant material and grafting of scions and rootstocks has been confirmed.

However in-field transmission by an insect vector is suspected (Poojari, 2013). One greenhouse study reported Virginia creeper leafhopper Erythroneura ziczac as a vector (Poojari, 2013), but this work has not been able to be reproduced to date.

Another suspected vector is the threecornered alfalfa hopper, Spissistilus festinus, and has been shown to transmit the disease in greenhouse studies (Bahder, 2016b).

Vineyards have also been shown to contain habitat for Spissistilus festinus with cover crops and many common weed species, such as purple vetch, crimson clover, and

5 dandelion, being preferred hosts for feeding and reproduction (Preto, 2018a).

However, studies show that Spissistilus festinus can feed on Vitis vinifera, causing girdling around leaf petioles and shoots and is capable of serving as a reproductive host (Preto, 2018b).

Shortly after the virus was identified, researchers developed an economic model of potential price penalties from GRBV-infected vineyards. This study found that the penalties could be large, ranging from $2213/ha to $68,548/ha depending on region (Ricketts, 2015). This study proposed economic scenarios to help the decision- making process for growers who have GRBD infected vineyards. However, this study was completed early in the identification of the disease before an understanding of the broader impacts to the vine and fruit quality was established. The Oregon wine industry is concerned with the impacts that GRBD on vine health and wine quality, particularly under the cool climate conditions of the Willamette Valley where ripening is often a concern, and where premium wine production is the primary focus.

The Oregon wine industry is comprised of 1,165 vineyards covering 35,972 acres (Institute for Policy Research and Engagement, 2019) and is characterized by small vineyards and wineries. Given its small production size, Oregon producers must focus on premium tier wines, and losing wine quality from GRBD could greatly impact each vineyard or winery’s sales and the Oregon wine quality reputation. With an estimated value of Oregon’s grape production in excess of $200 million of farm gate value, the impacts will reach beyond the vineyard and into all aspects of the wine business. To understand more about the virus effects on vine physiology and fruit composition, a three-year trial was conducted in a commercial Pinot noir vineyard to

6 assess the impacts of grapevine red blotch disease on Vitis vinifera L. ‘Pinot noir’ under the cool climate conditions of Oregon’s Willamette Valley.

Literature Cited

Adiputra, J., S.R. Kesoju, and R.A. Naidu. 2018. The relative occurrence of grapevine

leafroll-associated virus and grapevine red blotch virus in Washington state

vineyards. Plant Disease 102:2129-2135.

Al Rwahnih, M., A. Dave, M.M. Anderson, A. Rowhani, J.K. Uyemoto, and M.R.

Sudarshana. 2013. Association of a DNA virus with grapevines affected by

red blotch disease in California. Phytopathology 103:1069–1076.

Al Rwahnih, M., A. Rowhani, and D. Golino. 2015. First Report of Grapevine red

blotch-associated virus in Archival Grapevine Material from Sonoma

County, California. Plant Disease 99:895–895.

Atallah, S.S., M.I. Gómez, M.F. Fuchs, and T.E. Martinson. Economic impact of

grapevine leafroll disease on Vitis vinifera cv. Cabernet franc in Finger Lakes

vineyards of New York. American Journal of Enology and Viticulture 63:73-

79.

Bahder, B.W., F.G. Zalom, and M.R. Sudarshana. 2016a. An Evaluation of the flora

adjacent to wine grape vineyards for the presence of alternative host plants of

grapevine red blotch-associated virus. Plant Disease 100:1571–1574.

Bahder, B.W., FG. Zalom, M.Jayanth, and M.R. Sudarshana, 2016b. Phylogeny of

geminivirus coat protein sequences and digital PCR aid in identifying

Spissistilus festinus as a vector of grapevine red blotch-associated

virus. Phytopathology 106:1223–1230.

Blanco-Ulate, B., H. Hopfer, R. Figueroa-Balderas, Z. Ye, R.M. Rivero, A. Albacete,

F. Pérez-Alfocea, R. Koyama, M.M. Anderson, R.J. Smith, S.E. Ebeler, and

D. Cantu. 2017. Red blotch disease alters grape berry development and

metabolism by interfering with the transcriptional and hormonal regulation of

ripening. Journal of Experimental Botany 68:1225–1238.

Calvi, B.L. 2011. Effects of red-leaf disease on Cabernet Sauvignon at the Oakville

experimental vineyard and mitigation by harvest delay and crop adjustment.

MS thesis. University of California, Davis.

Cieniewicz, E.J., S.J. Pethybridge, A. Gorny, L.V. Madden, H. McLane, K.L. Perry,

and M. Fuchs. 2017. Spatiotemporal spread of grapevine red blotch-

associated virus in a California vineyard. Virus Research 241:156–162.

Girardello, R.C., M.L Cooper, R.J. Smith, L.A. Lerno, R.C. Bruce, S. Eridon, and A.

Oberholster. 2019a. Impact of grapevine red blotch disease on grape

composition of Vitis vinifera Cabernet Sauvignon, Merlot, and Chardonnay.

J Agric Food Chem 67:5496–5511.

Girardello, R.C., V. Rich, R.J. Smith, C. Brenneman, H. Heymann, and A.

Oberholster. 2019b. The impact of grapevine red blotch disease on Vitis

vinifera L. Chardonnay grape and wine composition and sensory attributes

over three seasons. Journal of the Science of Food and Agriculture n/a.

Institute for Policy Research and Engagement. 2019. 2018 Oregon vineyard and

winery report. University of Oregon, Eugene, OR.

Krenz, B., J.R. Thompson, M. Fuchs, and K.L. Perry. 2012. Complete genome

sequence of a new circular DNA virus from grapevine. Journal of Virology

86:7715–7715.

Krenz, B., J.R. Thompson, H.L. McLane, M. Fuchs, and K.L. Perry. 2014. Grapevine

red blotch-associated virus Is widespread in the United States.

Phytopathology 104:1232–1240.

Lim, S., D. Igori, F. Zhao, J.S. Moon, I-S. Cho, and G-S. Choi. 2016. First report of

grapevine red blotch-associated virus on grapevine in Korea. Plant Disease

100:1957–1957.

Martínez-Lüscher, J., C.M. Plank, L. Brillante, M.L. Cooper, R.J. Smith, M. Al-

Rwahnih, R. Yu, A. Oberholster, R. Girardello, and S.K. Kurtural. 2019.

Grapevine red blotch virus may reduce carbon translocaion leading to

impaired grape berry ripening. Journal of Agricultural and Food Chemistry

67:2437-2448.

Marwal, A., R. Kumar, S.M.P. Khurana, and R.K. Gaur. 2019. Complete nucleotide

sequence of a new geminivirus isolated from Vitis vinifera in India: a

symptomless host of grapevine red blotch virus. VirusDisease 30:106-111

Pacific Northwest Disease Management Handbook. 2020. Grape (Vitis spp.)-Virus

Diseases. Oregon State University, Corvallis, OR

Perry, K.L., H. McLane, M.Z. Hyder, G.S. Dangl, J.R. Thompson, and M.F. Fuchs.

2016. Grapevine red blotch-associated virus is present in free-living Vitis

spp. proximal to cultivated grapevines. Phytopathology 106:663–670.

Poojari, S., O.J. Alabi, V.Y. Fofanov, and R.A. Naidu. 2013. A Leafhopper-

transmissible DNA virus with novel evolutionary lineage in the Family

Geminiviridae implicated in grapevine redleaf disease by next-generation

sequencing. PLOS ONE 8:e64194.

Poojari, S., D.T. Lowery, M. Rott, A.M. Schmidt, and J.R. Úrbez-Torres. 2017.

Incidence, distribution and genetic diversity of grapevine red blotch virus in

British Columbia. Canadian Journal of Plant Pathology 39:201–211.

Preto, C.R., M.R. Sudarshana, and F.G. Zalom. 2018a. Feeding and reproductive

hosts of Spissistilus festinus (Say) (Hemiptera: Membracidae) found in

Californian vineyards. Journal of Economic Entomology 111:2531–2535.

Preto, C.R., M.R Sudarshana, M.L. Bollinger, and F.G. Zalom. 2018b. Vitis vinifera

(Vitales: Vitaceae) as a reproductive host of Spissistilus festinus (Heimptera:

Mebracidae). Journal of Insect Science 18:1-7

Reynard, J-S., J. Brodard, N. Dubuis, V. Zufferey, O. Schumpp, S. Schaerer, and P.

Gugerli. 2018. Grapevine red blotch virus : Absence in Swiss vineyards and

analysis of potential detrimental effect on viticultural performance. Plant

Disease 102:651–655.

Ricketts, K.D., M.I. Gómez, M.F. Fuchs, T.E. Martinson, R.J. Smith, M.L. Cooper,

M.M. Moyer, and A. Wise. 2015. Mitigating the economic impact of

grapevine red blotch: Optimizing disease management strategies in U.S.

Vineyards. American Journal of Enology and Viticulture 68:127–135.

Sudarshana, M.R., K.L. Perry, and M.F. Fuchs. 2015. Grapevine red blotch-

associated virus, an emerging threat to the grapevine industry.

Phytopathology 105:1026–1032.

Thompson, T., S. Petersen, J. Londo, and W.P. Qiu. 2017. First Report of grapevine

red blotch virus in seven Vitis Species in a U.S. Vitis germplasm repository.

Plant Disease 102:828–828.

Wallis, C.M. and M.R. Sudarshana. 2016. Effects of grapevine red blotch-associated

virus (GRBaV) infection on foliar metabolism of grapevines. Canadian

Journal of Plant Pathology 38:358–366.

Yao, X-L., J. Han, L.L. Domier, F. Qu, and M.L. Lewis Ivey. 2017. First report of a

grapevine red blotch virus in Ohio vineyards. Plant Disease 102:463–463.

Yepes, L.M., E. Cieniewicz, B. Krenz, H. McLane, J.R. Thompson, K.L. Perry, and

M. Fuchs. 2018. Causative role of grapevine red blotch virus in red blotch

disease. Phytopathology 108:902–909.

Chapter 2: Assessment of Grapevine Red Blotch Virus Impacts on Physiology, Productivity, and Fruit Composition of ‘Pinot noir’ Grown in Oregon’s Willamette Valley

Introduction

Grapevine red blotch disease (GRBD) is caused by a virus in the family

Geminiviridae and has been confirmed to be the causal agent (Yepes, 2018). It is currently the only known member of Geminiviridae to infect grapevines and consists of circular single stranded DNA with approximately 3,206 nucleotides (Krenz, 2012;

Al Rwahnih, 2013; Poojari, 2013). Grapevine red blotch disease was first identified in

2008 (Calvi, 2011) and was subsequently found throughout North America, Europe, and Asia (Krenz, 2014; Lim, 2016; Poojari, 2017; Yao, 2017; Adiputara, 2018;

Marwal, 2018; Reynard, 2018). Additionally, grape cultivar ‘Abouriou’ at the Vitis

Germplasm Repository in California tested positive for the virus, suggesting that grapevine red blotch disease has been present in the US for more than 70 years

(Thompson, 2018).

Red blotchy leaf blades with or without red veins is a common symptom of

GRBD among red fruited cultivars and is noticeable during certain phenological time points. Visual symptoms typically occur in the oldest leaves during véraison and proceed acropetally up the shoot as the season progresses (Sudarshana, 2015).

Previous research suggests a cause of these foliar symptoms may be due to a disruption in primary metabolism leading to increased levels of reducing sugars in leaf blades that result in anthocyanin accumulation (Wallis, 2016).

Grapevine red blotch disease has been shown to affect ripening. Reductions in total soluble solids (TSS) range from 2 to 20% in GRBD+ compared to GRBD- vines

(Sudarshana, 2015; Martínez-Lüscher, 2019; Girardello, 2019a). However, pH increases were observed in GRBD+ vines compared to healthy vines (Girardello,

2019b). Berry chemistry has also been shown to be affected by GRBD with reductions in amino acids, phenolic compounds, and anthocyanins being observed in positive vines compared to negative (Wallis, 2016; Blanco-Ulate, 2017). One study found that these impacts may be a result of changes in gene regulation of pathways responsible for the synthesis of anthocyanins (Blanco-Ulate, 2017)

It is estimated that the economic impacts of GRBD may be substantial. Ricketts et al.

(2015) proposed price penalties for grapes ranged from $2213/ha to $68,548/ha under different production scenarios and regions in the US. However, early economic estimates were conducted prior to a full understanding of the fruit quality and vine health impacts. Further research is needed to understand the economic impacts for

Oregon producers, who were not included in the economic study. A three year trial was designed to assess of the impacts of Grapevine Red Blotch Disease on physiology, productivity, and fruit composition of ‘Pinot noir’ grown in Oregon’s

Willamette Valley. The goal was to ascertain the level of impacts that growers could anticipate and develop future studies to manage the disease, if possible.

Materials and Methods

A commercial vineyard that tested positive for grapevine red blotch virus was used for this study. The vineyard was located east of Amity, Oregon in the Eola-

Amity Hills American Viticultural Area (AVA) at an elevation of 230 m asl. This vineyard was planted in 2007 with Vitis vinifera L. ‘Pinot noir’ clone 828 grafted to

Riparia Gloire rootstock in silty clay loam soils in the Saum-Parrett series. The vines were spaced 1 m in row and 1.75 m between rows with a SE – NW orientation on a southeastern facing hillside. Vines were cane pruned to a bilateral Guyot training system with vertical shoot positioning. The vineyard was managed with commercial standard disease and canopy management practices for the region. Vines were irrigated late season, from lag phase of berry ripening, starting in early August, through ripening, as needed.

The vineyard had both GRBD+ and GRBD- vines in close proximity.

Symptoms of GRBD were first noticed by the vineyard manager in 2014, and the block was sampled and tested by the grower to confirm that positive vines were in the block during 2014. Before staring the study, single vines (n=90) were tested for grapevine red blotch virus within a 3-row section of the vineyard that was known to have both asymptomatic and symptomatic vines. Additional testing was conducted at several time points to confirm virus status during the three-year trial; these additional tests was not intended to observe spread. The initial tissue samples consisted of two basal leaves per vine, with one leaf each collected from a shoot on one cane of bilaterally trained vines. Samples were collected on 14 July 2017 (BB size berries,

BBCH 73) and 8 Aug 2018 (berries touching, BBCH 78). Additional virus testing was conducted on samples collected during dormancy to confirm virus status since it is the best time point for testing based on recent findings (Setiono, 2018) and practical experience with Oregon growers (Skinkis, personal communication).

Dormant tissue samples consisted of basal portions of shoots that grew the previous seasons, one from each bilateral cane per vine. These dormant samples were collected

14 on 3 Jan 2019. All virus assays were conducted using polymerase chain reaction

(PCR) at the USDA-ARS Horticultural Crops Research Unit Corvallis, OR. A general

PCR procedure was used with an annealing temperature of 56°C. Two sets of detection primers were used in duplex. The two primers resulted in two bands, with the GRBV CP primer producing a band of 257 base pairs and the GRBV REP primer producing a band of 318 base pairs.

GRBV CP: F: AGCGGAAGCATGATTGAGACATTGACG

R: AACGTATGTCCACTTGCAGAAGCCGC

GRBV REP: F: CAAGTCGTTGTAGATTGAGGACGTATTGG

R: AGCCACACCTACACGCCTTGCTCATC

At the outset of the field study in 2017, a total of 20 vines were selected for vine growth and physiology measures in the three-row section of the vineyard that was known to have symptoms and virus presence. The selection was based on information from the vineyard manager, who had flagged vines with symptoms the years prior to the study (2014-2016). Since visible symptoms were not present at the outset of the study, we had to rely on this symptom mapping to take advantage of the growing season data collection. A total of 90 vines were tested in the three row area as described above within one month after the study began to confirm virus status.

Therefore, of the 20 vines we initially selected included GRBD+ and GRBD- vines, and we were further able to document GRBD+ vines with and without virus. Each vine was evaluated individually over three years and each served as the experimental unit. Of the 20 vine population, there were 7 vines that were GRBD- (healthy) and 14

15 vines that were GRBD+. Of the infected vines, 6 vines had symptoms, and 7 vines had no symptoms. No healthy vines (GRBD-) had visible symptoms.

Symptom Evaluations. Visual symptoms of the virus, including red leaf blades, red leaf blotches, and red veins, were monitored in the canopy of each vine from bud break to leaf fall each year, with the exception of 2017 when monitoring began in early July. Monitoring consisted of simple observations to determine if symptoms were present or not in 2017 and 2018. Symptom incidence and severity were assessed during 2019, starting once the first symptoms appeared (23 Aug 2019) and continued until leaf fall. Incidence was determined visually using two methods on each date. The observer first designated a percentage of the entire vine canopy that showed symptoms. Then the total number of shoots per vine counted and number of symptomatic leaves and total leaf count per shoot counted on two shoots with symptoms per plant. These numbers were used to calculate a percentage of the vine canopy with symptoms. Symptom severity was determined by assigning a percent of individual leaf area that was solid red or had red blotches on all symptomatic leaves of the two shoots used in the incidence method to estimate severity across the entire plant.

Vine growth and production. Vine phenology stages were observed for bud break, bloom, véraison, and leaf fall using the BBCH scale for grapevines described by Lorenz et al. (1995). To assess canopy growth, whole vine leaf area was determined using a nondestructive template method at 50% véraison as described by

Navarrete (2015). The total number of shoots per vine were counted and two shoots per vine chosen at random for leaf area measures, including shoot length and leaf size

16 determined by matching leaves to a template of known size. Leaf area was measured on 30 Aug 2017, 30 Aug 2018, and 28 Aug 2019. Leaf greenness was measured on two randomly selected fully expanded leaves of primary shoots at apical, middle, and basal canopy positions of each vine using the SPAD meter (SPAD-502, Konica

Minolta, Ramsey, NJ, USA). Apical, middle, and basal canopy positions were assigned as the canopy hedge height (~110 cm) to 80 cm, 80 to 40 cm, and 40 to 0 cm above the fruiting wire, respectively. The measures of leaf greenness were used in an attempt to observe changes in different canopy zones due to GRBD that occur prior to visual symptom onset, as well as relate to leaf gas exchange measures.

Leaf Gas Exchange. Single leaf photoassmilation and stomatal conductance were monitored from BBCH stage 75 (pea-size berries) to harvest using an infrared gas analyzer (Li-6400XT, LI-COR, Inc., Lincoln, NE, USA). Measures were taken on clear sunny days from 1200 to 1300 hr during 2017 to 2019. A single sun-exposed leaf from a primary shoot in the upper canopy of each vine was used for measures in

2017, and leaves from both basal (0 to 30 cm above fruiting wire) and upper (50 cm to shoot hedge height ~110 cm above fruiting wire) canopy positions were used in

2018 and 2019. The infrared gas analyzer was equipped with a 2 by 3 cm sun/sky head and set to ambient relative humidity and temperature at a flow rate of 400 mol s-1. Each leaf used for gas exchange measures were first measured for leaf greenness using a SPAD meter (SPAD-502, Konica Minolta, Ramsey, NJ, USA) in an attempt to relate greenness to gas exchange rates.

Vine nutrient status. Leaf and petiole samples were collected from each vine at véraison (50% to 80% color change) on 7 Sept 2017, 30 Aug 2018, and 28 Aug

2019. A sample consisted of leaf blades and petioles from five basal leaves taken from the same node as a cluster and five fully-expanded apical leaves collected from the same five shoots. The two tissues were analyzed separately for the macro- and micro-nutrients of nitrogen, phosphorus, potassium, calcium, magnesium, boron, zinc, manganese, iron, copper, and sodium by Fruit Growers Lab, Inc., Santa Paula,

CA.

Yield parameters and fruit composition. Yield data were obtained within 1 to

2 d prior to commercial harvest. Cluster count and whole vine yields were recorded per vine on 5 Oct 2017, 28 Sept 2018, and 2 Oct 2019. Cluster weight was determined by dividing whole vine yield by cluster number per vine. A 10 cluster sample was randomly selected from fruit harvested per vine and transported to the lab for cluster size measures and analysis of basic fruit ripeness. Five clusters were measured for cluster weight, rachis weight (Scout Pro 400g, Ohaus Corp., Parsippany,

NJ, USA), rachis length (30 cm ruler, Greenbier Int. Inc., Chesapeake, VA, USA), berry count, and berry weight. Destemmed berries were pressed to juice using a hydraulic press (Welles Juice Press, Samson Brands, LLC, Danbury, CT) to collect free run juice for one minute. Juice was then measured for total soluble solids using a digital refractometer (300051, SPER Scientific, Scottsdale, AZ, USA) and pH using temperature-compensating pH meter (Accumet Basic AB15, Pittsburgh, PA, USA). A

5 mL aliquot of juice was diluted with distilled water to 50 mL and titrated to an endpoint pH= 8.2 using 0.1 N sodium hydroxide to measure titratable acidity

(Zoecklein, 1999).

The remaining five clusters were stored at -80°C for later analysis of total anthocyanins, total tannins, and total phenolics. A whole berry extraction method was used, where 50 frozen berries were randomly chosen and weighed from each vine sample and homogenized (T25 digital Ultra-Turrax, IKA Works INC., Wilmington,

NC, USA) for 60 s then an ethanol-based extraction method (Austrailian Wine

Research Institute ,2020) was used. The extract was used for of the following assays.

Total anthocyanins were measured using the pH Differential method described by

Lee, Durst, and Wrolstad (2005). The Methyl Cellulose Precipitation method was used to determine total tannins following the AWRI standard methods (Australian

Wine Research Institute, 2020). Total Phenolics were measured using by Folin-

Ciocalteau colorimetry method from Waterhouse (2002). The spectrophotometry measurements for the anthocyanin, tannin, and phenolic assays previously described were taken with a Genesys 10S UV-Vis Spectrophotometer (Thermo Scientific,

Waltham, MA, USA)

Statistical Analysis. Generalized linear model analysis of variance (ANOVA) was used with and Tukey’s Honestly Significant Difference mean separation at p<0.05. Data that were found to be not normal by Shapiro-Wilkes test was analyzed using a Kruskal-Wallis rank sum test. A linear regression was used to analyze potential correlations between photoassimilation and leaf greenness. All statistical analyses were conducted using SAS 9.4 (SAS Institute Inc., Cary, NC, USA).

Results

Seasonal climate data. Weather conditions varied across the three growing seasons with 2017 having the greatest heat units (GDD10) and 2019 having the lowest

(Table 1). All years were above the long-term average of 1171 GDD10 (Table 1).

Total precipitation through the growing seasons was similar each year, but the timing of rainfall varied with greater late season precipitation (during ripening and harvest) in 2019 compared to 2017 and 2018.

Disease symptoms. Symptom development throughout the growing season did not begin until early to mid véraison in each year. In all years, six of the twenty experimental vines displayed symptoms and all other remained asymptomatic throughout the growing season. The primary symptom observed in symptomatic vines were leaves that ranged from red blotches to fully red leaves with or without red veins

(Figures 1 and 3). Some leaves showed only red veins as symptoms and others had very small red spots covering a large percentage of the leaf. Symptoms began in the leaves proximal to the cane or trunk and progressed acropetally through the entire canopy by leaf fall. In 2017 symptoms first began to appear on one vine at early véraison (less than 5% berries colored), by mid-veraison (50-60% berries colored), a total of three vines were symptomatic, and by harvest, six vines were showing symptoms . Symptoms in 2018 appeared in one vine at late véraison (70-80% berries colored) and all six vines had symptoms at harvest. The more detailed assessments of symptomatic vines in 2019 showed variable symptom onset and different incidence and severity between vines. Five of six vines had initial symptoms emerge during late véraison (60% to 100% berries colored) in 2019, and one of the six symptomatic vines first began showing symptoms post-harvest and quickly had symptoms throughout the entire vine canopy (Figure 2). Through visual observations, there were no discernable differences in phenological development for GRBD+ and GRBD-

20 vines from bud break to harvest, including no differences in the onset of berry ripening or véraison advancement. However, a noticeable delay in leaf senescence occurred in the six GRBD+ symptomatic vines (Figure 3).

Leaf gas exchange and leaf greenness. Photoassimilation, stomatal conductance, and leaf greenness were measured across five dates in 2017, seven dates in 2018, and three dates in 2019. The number of measurements varied by year due to the availability of suitable conditions for measurements and accessibility between pesticide sprays. As the season progressed in each year, photoassimilation and stomatal conductance decreased as expected due to drier and warmer conditions and the potential for increasing plant water stress. Leaf gas exchange of upper canopy leaves measured in 2017, 2018 and 2019 had minimal, inconsistent differences through the growing season (Figures 4 and 5). Basal leaves which were measured in each year also showed inconsistent differences of leaf gas exchange measures in 2018 and 2019 (data not shown). Leaf gas exchange measures were generally lower in basal leaves compared to upper canopy leaves, but followed similar trends. Across the three years, leaf greenness measures taken in conjunction with leaf gas exchange did not show differences except on basal leaves one date, 23 Jul 2018, with GRBV positive asymptomatic vines having a 9% lower SPAD values compared to GRBV negative asymptomatic vines (data not shown). Regression analysis of photoassimilation against SPAD showed no correlation with the exception of one date in 2018 (6 Sept 2018, BBCH 85) with a p-value of 0.0044, r2 of 0.3697 and equation of photoassimilation = -25.155 + 0.988 SPAD. Leaf greenness measures taken in

2019 had no differences based on virus or symptom status (data not shown). Mean

21 leaf greenness measures associated with leaf gas exchange measures were 42.7, 41.6, and 39.9 in 2017, 2018, and 2019 respectively.

Additional measures of leaf greenness taken during the season across three canopy zones, including upper, mid, and lower canopy leaves, lacked consistent differences across dates or zones for the three vine populations. In general, the leaves within varied canopy zones did not differ by virus or symptom status. Mean SPAD readings for all zones were 44.1, 40.5, and 41.0 in 2017, 2018, and 2019 respectively, indicating very green, healthy canopy leaves.

Vine nutrient status. There were no differences in véraison leaf blade and petiole nitrogen for any vines population during all three years. Leaf blade potassium was lowest in GRBD+ symptomatic vines in all three years (Table 2). Leaf blade phosphorus was lower in GRBD+ symptomatic vines compared to healthy vines in

2017 and 2019 (Table 2). Interestingly, asymptomatic GRBD+ vines had similar nutrient status for the three macronutrients as the healthy vines. The GRBD+ symptomatic vines had lower petiole magnesium levels and higher leaf blade magnesium levels compared to asymptomatic vines, whether healthy or GRBD+ in two of three years (Table 2). However, when comparing only the GRBD+ population, symptomatic vines had higher leaf blade magnesium concentrations and lower petiole magnesium in all three years. Petiole calcium levels were consistently lower in

GRBD+ symptomatic vines over asymptomatic vines in all three years, but there were no differences in leaf blade calcium. Leaf blade and petiole boron were not different in any year. Zinc, manganese, iron, copper, and sodium did not differ by virus or

22 symptom status, and they were not found to be at deficiency levels in this vineyard

(Table 3).

Vine growth and productivity. Measures of growth, such as leaf area and pruning weights had no differences based on virus or symptom status in any year

(Table 4). Whole vine leaf areas measured at véraison did not differ due to virus or symptom status; however, variation occurred year to year and may be due to differences in mean leaf size, with 2017 having the largest leaf area and mean leaf size of the three years (data not shown). Pruning weights were only different by year with 2018 having 10% higher dormant pruning weights and 30% dormant cane weights compared to 2019. The yield to pruning weight ratio was not different between treatments in any year.

Yield varied between years with 2017 producing the highest yields, although yields were managed to a target crop level by the vineyard management. Harvest data collected on yield components revealed no differences based on virus or symptom status (Table 5). Across years cluster weight and berry weight showed similar trends with 2017 producing the largest clusters and berries compared to 2018 and 2019

(Table 5). Cluster weight and berry weight were lower in positive symptomatic vines compared to negative asymptomatic vines in 2017 and 2018 (Table 5).

Fruit composition. There were no differences in harvest fruit TSS by virus or symptom status in any year. In 2018 and 2019 pH was ~5% higher in GRBD+ symptomatic vines compared to asymptomatic vines, whether GRBD+ or healthy

(Table 6). Titratable acidity was not different in 2017 or 2018 based on symptom

23 status but was 14% lower in GRBD+ symptomatic vines in 2019 compared to healthy asymptomatic vines (Table 6).

Berry concentrations of total anthocyanin, phenolics, or tannin was not different based on virus status in any year (Table 5). Observations based on symptom status showed impacts in total phenolics in 2017, which were 13% lower in symptomatic vines.

Discussion

Observable leaf symptoms were expressed similarly to those previously described, with red blotched to fully red coloration of leaves, as well as the presence or absence of red veins (Sudarshana, 2015). Our observations of grapevine symptom development and timing were similar to those observed in previous research, with symptom onset occurring during early to mid véraison (Sudarshana, 2015). However, of the six vines that expressed symptoms in each year, the timing of onset varied by year, and some vines did not express visible symptoms until harvest. Our vine observations went beyond previous publications by following symptom expression through to leaf fall each year. For the 2019 season, we were able to assign values of leaf incidence to document symptom development throughout the canopy over time.

Through these observations we saw that symptoms began in the basal portion of the canopy and continued acropetally as the season progressed. We also noted that the symptoms may occur later and more suddenly. An example of this was the presence of one vine in the study that did not show any symptoms until post-harvest, at which time the symptoms were found throughout the entire canopy. Similar observations of

24 post-véraison symptom onset occurred in 2017 and 2018. Late season observations may provide valuable information for diagnostic purposes due to the difference observed in leaf color change and senescence, which were both observed to be delayed in GRBD+ symptomatic vines compared to GRBD+ asymptomatic vines each year.

Leaf gas exchange measures did not show any consistent differences by virus or symptom status throughout the study. Over the three years, two of the fifteen dates

GRBD+ symptomatic showed lower levels of photoassimilation in the upper canopy compared to GRBD- asymptomatic, these both occurred in 2018 with one prior to véraison on 5 Jul 2018 (BB-size berries, 72 BBCH) and the other occurring at early stages of véraison (10 to 15% berry color change) on 22 Aug 2018 (82 BBCH). This inconsistency makes it difficult to understand the potential relationships between visual symptom changes and leaf gas exchange measures. A previous study utilizing

‘Cabernet Sauvingnon’ observed reductions in leaf gas exchange measures in

GRBV+ vines compared to GRBV- vines that were also not consistent across dates

(Martínez-Lüscher,. 2019). These observed reductions of photoassimilation and stomatal conductance in GRBV+ vines from this study and previous work while not consistent may still be having an impact on vine health and production. When considering grapevine leaf-roll associated virus (GLRaV), which has similar symptoms as GRBV, studies show reductions in photoassimilation and stomatal conductance with reductions in chlorophyll content in GLRaV+ vines compared to healthy vines (Bertamini, 2005). In our study, photoassimilation and stomatal conductance measures decreased during late summer, as expected due to increasing

25 heat and soil dryness that may lead to more vine stress; however, at no point did the vines reach a state in stomatal conductance that would be considered high water stress

-2 -1 (< 100 mmol H2O·m ·s ).

In this study leaf greenness (SPAD data) was also included at the same time points as the leaf gas exchange measures utilizing the same leaf in order to understand potential changes in chlorophyll to changes in photoassimlation and stomatal conductance. Previous GRBD studies did not quantified leaf greenness. Our study revealed only one date amongst fifteen dates measured across the three growing seasons where GRBD+ asymptomatic vines had lower leaf greenness than GRBD- asymptomatic vines. The lack of relationship on the majority of sampled dates is due to lack of differences in leaf greenness in the vine population we used. Furthermore, we focused on measuring gas exchange of fully sun-exposed leaves in the canopy rather than selecting for symptomatic leaves that may have had an impact on leaf photoassimilation. However, even leaves that showed red symptoms had high SPAD values. The virus manifests its symptoms in non-uniform patterns, not only throughout the canopy, but also across the leaf surface (Setiono, 2018). These inconsistences in symptom development along with our random sampling may have led minimal measures of actual symptomatic leaves among our symptomatic populations.

This is the first study, to our knowledge. to report a comparison of vine nutrient status of GRBD infected and healthy vines. Nitrogen status was not affected by the virus, but phosphorus and potassium were lower in GRBD+ symptomatic vines in two years, 2017 and 2019, for phosphorus and all three years for potassium.

Magnesium levels showed interesting differences with GRBD+ symptomatic having higher levels in leaf blades and lower levels in petioles compared to positive and negative asymptomatic vines. Magnesium was not deficient in the GRBD+ asymptomatic and GRBD- populations in any year, but GRBD+ symptomatic vines had deficient concentrations of petiole magnesium of 0.37% for all three years

(Schreiner, 2019). This difference between leaf blade and petiole magnesium may be indicative of changes in movement of and storage due to GRBV, but further research would necessary to understand the impacts from these relationships on visual symptoms and physiological processes. Boron was the only nutrient to show deficiency in leaf and petiole analysis for all three years (Schreiner, 2019).

Impacts on yield and vine growth were not observed in this study between populations, but did vary based on year. In 2017 yield was ~28% higher than 2018 or

2019. Cluster weight showed a decrease from 2017 to 2019 of 25%. Yield reductions have been observed due grapevine leafroll-associated virus, but has not been documented in GRBD vines (Atallah, 2012). Measures of growth such as vine leaf area and pruning weights did not differ based on virus and symptom status. However, vine leaf area, mean leaf size, and dormant cane weight did vary between years. Cane weight was 25% lower in 2019 than 2018.

A measure of ripeness that has been reported to be impacted by grapevine red blotch disease is fruit TSS. In previous research, a reduction of TSS by 2 to 20% has been reported in ‘Cabernet Sauvignon’ and ‘Merlot’ in California (Sudarshana, 2015;

Martínez-Lüscher, 2019; Girardello, 2019a), but our study shows no differences in

TSS for ‘Pinot noir’ in any of the year. Furthermore, the vines were able to achieve

27 ripeness for desired commercial wine production from this vineyard. The TSS at harvest for the vineyard used for our study were generally lower than other vineyards in the region, due to the winery’s earlier harvest of the vineyard for rosé wine production and the fact that the vineyard is at a higher elevation than most vineyards in the region. Between years, climate characteristics impacted ripeness level as well, with 2019 being significantly impacted by rainfall and cool weather during ripening and harvest. Small differences were observed in acid measures, including increased pH and decreased titratable acidity of symptomatic vines compared to asymptomatic vines. These results are similar to previous research on ‘Chardonnay’ by Giradello et al. (2019b) where pH was increased in GRBD+ vines over GRBD-. In our study the change in pH, while statistically significant, may not be of practical importance.

Anthocyanin concentrations observed in berries from this study did not differ, but others found reductions in ‘Zinfandel’ GRBV+ vines compared to healthy vines

(Blanco-Ulate, 2017). Grapevine leaf-roll associated virus has also showed reductions in anthocyanin concentrations (Lee, 2009; Vega, 2011). There were minimal and inconsistent impacts on total phenolics or total tannins in our study, unlike previous research by Wallis and Sudarshana (2016) that observed reductions in phenolic compounds of ‘Cabernet Franc’ and ‘Cabernet Sauvignon’ in California. The lack of differences that we observed in ‘Pinot noir’ phenolic compounds suggest that wine made from GRBD+ fruit may not have reduced quality as compared to healthy vines.

Conclusion

The overall impacts of grapevine red blotch we observed in ‘Pinot noir’ over three growing seasons in the Willamette Valley of Oregon were minimal. While visual symptoms were present, they were not easy to find and only occurred very late int eh growing season. In fact, nearly half of our GRBD+ vines were asymptomatic during the study. With no consistent or noticeable effects of the virus on growth, physiological measures, or fruit ripeness, our data suggests that the virus may have limited impacts on ‘Pinot noir’ under the conditions of an irrigated cool-climate vineyard. The vines were considered to be of high vegetative vigor, given leaf area, leaf greenness, and dormant pruning weight measures.

This study sought to define the symptoms and basic impacts on vine growth and productivity as a first step to understanding this virus for Oregon producers. Due to the observational nature of this study it is hard to identify the cause of the differences or lack thereof because we made observations in a cool climate production region where vines are produced with little to no water or nutrient stress and were irrigated. Many of the California studies were conducted with irrigated vineyards in a warmer, drier climate. The ability for vines in our study to reach the desired ripeness and maintain similar phenolic chemistries suggest that under certain conditions grapevine red blotch disease may cause negligible if any negative impacts to fruit or wine quality. What is unknown is the longer term impacts of the virus on vine health, especially under biotic or abiotic stressors that may be able to be addressed in future research.

Literature Cited

Adiputra, J., S.R. Kesoju, and R.A. Naidu. 2018. The relative occurrence of grapevine

leafroll-associated virus and grapevine red blotch virus in Washington state

vineyards. Plant Disease 102:2129-2135.

Al Rwahnih, M., A. Dave, M.M. Anderson, A. Rowhani, J.K. Uyemoto, and M.R.

Sudarshana. 2013. Association of a DNA virus with grapevines affected by

red blotch disease in California. Phytopathology 103:1069–1076.

Al Rwahnih, M., A. Rowhani, and D. Golino. 2015. First Report of Grapevine red

blotch-associated virus in Archival Grapevine Material from Sonoma

County, California. Plant Disease 99:895–895.

Atallah, S.S., M.I. Gómez, M.F. Fuchs, and T.E. Martinson. Economic impact of

grapevine leafroll disease on Vitis vinifera cv. Cabernet franc in Finger Lakes

vineyards of New York. American Journal of Enology and Viticulture 63:73-

79.

Australian Wine Research Institute.2020. Laboratory establishment and methods.

Australian Wine Research Institute

ry_establishment/>

Bertamini M., U. Malossini, K. Muthuchelian, and N. Nedunchezhian. 2005.

Physiological response of field grown grapevine (Vitis vinifera L. cv.

Marzemino) to grapevine leafroll-associated virus (GLRaV-1).

Phytopathologia Mediterranea. 44:256-265.

Blanco-Ulate, B., H. Hopfer, R. Figueroa-Balderas, Z. Ye, R.M. Rivero, A. Albacete,

F. Pérez-Alfocea, R. Koyama, M.M. Anderson, R.J. Smith, S.E. Ebeler, and

D. Cantu. 2017. Red blotch disease alters grape berry development and

metabolism by interfering with the transcriptional and hormonal regulation of

ripening. Journal of Experimental Botany 68:1225–1238.

Calvi, B.L. 2011. Effects of red-leaf disease on Cabernet Sauvignon at the Oakville

experimental vineyard and mitigation by harvest delay and crop adjustment.

MS thesis. University of California, Davis.

Girardello, R.C., M.L Cooper, R.J. Smith, L.A. Lerno, R.C. Bruce, S. Eridon, and A.

Oberholster. 2019a. Impact of grapevine red blotch disease on grape

composition of Vitis vinifera Cabernet Sauvignon, Merlot, and Chardonnay.

J Agric Food Chem 67:5496–5511.

Girardello, R.C., V. Rich, R.J. Smith, C. Brenneman, H. Heymann, and A.

Oberholster. 2019b. The impact of grapevine red blotch disease on Vitis

vinifera L. Chardonnay grape and wine composition and sensory attributes

over three seasons. Journal of the Science of Food and Agriculture n/a.

Krenz, B., J.R. Thompson, M. Fuchs, and K.L. Perry. 2012. Complete genome

sequence of a new circular DNA virus from grapevine. Journal of Virology

86:7715–7715.

Krenz, B., J.R. Thompson, H.L. McLane, M. Fuchs, and K.L. Perry. 2014. Grapevine

red blotch-associated virus Is widespread in the United States.

Phytopathology 104:1232–1240.

Lee, J., R.W. Durst, and R.E. Wrolstad. 2005. Determination of total monomeric

anthocyanin pigment content of fruit Juices, beverages, natural colorants, and

wines by the pH differential method: Collaborative study. J. of AOAC Int.

88:1269-1278.

Lee, J. and R.R. Martin. 2009. Influence of grapevine leafroll associated viurses

(GLRaV-2 and -3) on the fruit composition of Oregon Vitis vinifera L. cv.

Pinot noir: Phenolics. Food Chemistry 122:889-896

Lim, S., D. Igori, F. Zhao, J.S. Moon, I-S. Cho, and G-S. Choi. 2016. First report of

grapevine red blotch-associated virus on grapevine in Korea. Plant Disease

100:1957–1957.

Lorenz, D.H. et al., 1995. Growth Stages of the Grapevine: Phenological growth

stages of the grapevine (Vitis vinifera L. ssp. vinifera)—Codes and

descriptions according to the extended BBCH scale†. Australian Journal of

Grape and Wine Research, 1(2), pp.100–103.

Martínez-Lüscher, J., C.M. Plank, L. Brillante, M.L. Cooper, R.J. Smith, M. Al-

Rwahnih, R. Yu, A. Oberholster, R. Girardello, and S.K. Kurtural. 2019.

Grapevine red blotch virus may reduce carbon translocaion leading to

impaired grape berry ripening. Journal of Agricultural and Food Chemistry

67:2437-2448.

Marwal, A., R. Kumar, S.M.P. Khurana, and R.K. Gaur. 2019. Complete nucleotide

sequence of a new geminivirus isolated from Vitis vinifera in India: a

symptomless host of grapevine red blotch virus. VirusDisease 30:106-111

Navarrete, A. 2015. Characterizing Grapevine Canopy Architecture. MS Thesis,

Oregon State University.

Poojari, S., O.J. Alabi, V.Y. Fofanov, and R.A. Naidu. 2013. A Leafhopper-

transmissible DNA Virus with tovel evolutionary lineage in the Family

Geminiviridae implicated in grapevine redleaf disease by next-generation

sequencing. PLOS ONE 8:e64194.

Poojari, S., D.T. Lowery, M. Rott, A.M. Schmidt, and J.R. Úrbez-Torres. 2017.

Incidence, distribution and genetic diversity of grapevine red blotch virus in

British Columbia. Canadian Journal of Plant Pathology 39:201–211.

Reynard, J-S., J. Brodard, N. Dubuis, V. Zufferey, O. Schumpp, S. Schaerer, and P.

Gugerli. 2018. Grapevine red blotch virus : Absence in Swiss vineyards and

analysis of potential detrimental effect on viticultural performance. Plant

Disease 102:651–655.

Ricketts, K.D., M.I. Gómez, M.F. Fuchs, T.E. Martinson, R.J. Smith, M.L. Cooper,

M.M. Moyer, and A. Wise. 2015. Mitigating the economic impact of

grapevine red blotch: Optimizing disease management strategies in U.S.

Vineyards. American Journal of Enology and Viticulture 68:127–135.

Schreiner, P. 2019. Wine grape tissue nutrient analysis guidelines for Oregon. Oregon

State University Extension Service, Corvallis, OR.

Setiono, F.J., D. Chatterjee, M. Fuchs, K.L. Perry, and J.R. Thompson. The

distribution and detection of grapevine red blotch virus in its host depend on

time of sampling and tissue type. Plant Disease 102:2187-2193.

Sudarshana, M.R., K.L. Perry, and M.F. Fuchs. 2015. Grapevine red blotch-

associated virus, an emerging threat to the grapevine industry.

Phytopathology 105:1026–1032.

Thompson, T., S. Petersen, J. Londo, and W.P. Qiu. 2017. First Report of grapevine

red blotch virus in seven Vitis Species in a U.S. Vitis germplasm repository.

Plant Disease 102:828–828.

United States Bureau of Reclamation. 2016. Agrimet. United States Bureau of

Reclamation. 19 April 2020.

Vega, A., R.A. Gutiérrez, A. Peña-Neira, G.R. Cramer, and P. Arce-Johnson. 2011.

Compatible GLRaV-3 viral infections affect berry ripening decreasing sugar

accumulation and anthocyanin biosynthesis in Vitis vinifera. Plant Molecular

Biology 77:261-274.

Wallis, C.M. and M.R. Sudarshana. 2016. Effects of grapevine red blotch-associated

virus (GRBaV) infection on foliar metabolism of grapevines. Canadian

Journal of Plant Pathology 38:358–366.

Waterhouse, A.L. 2002. Determination of Total Phenolics, supplement 6. In: R.E.

Wroldstad. 2002. Current protocols in food analytical chemistry. Wiley, NY.

Western Regional Climate Center. 2020. Oregon Climate Summaries. Western

Regional Climate Center. 19 April 2020.

Yao, X-L., J. Han, L.L. Domier, F. Qu, and M.L. Lewis Ivey. 2017. First report of a

grapevine red blotch virus in Ohio vineyards. Plant Disease 102:463–463.

Yepes, L.M., E. Cieniewicz, B. Krenz, H. McLane, J.R. Thompson, K.L. Perry, and

M. Fuchs. 2018. Causative role of grapevine red blotch virus in red blotch

disease. Phytopathology 108:902–909.

Zoecklein, B.W., K.C. Fugelsang, B.H. Gump, and F.S. Nury. 1999. Wine analysis

and production. Kluwer Academic/Plenum Publishers, New York, NY.

Figures

Figure 1. Grapevine red blotch disease symptomatic leaves found on a ‘Pinot noir’ grapevine that tested positive for the virus in a vineyard in Amity, OR. These symptoms were observed at harvest (5 Oct 2017).

120

Vine 1 Vine 2 100 Vine 3 Vine 4 Vine 5 Vine 6

Whole Vine Incidence (%)

0 08/01/19 09/01/19 10/01/19 11/01/19 12/01/19

Figure 2. Progression of ‘Pinot noir’ grapevine red blotch disease symptom incidence in the canopy of individual grapevines from the first symptom onset at late véraison to post-harvest for a vineyard in Amity, OR during 2019. Each point represents data from single vines.

Figure 3. Symptomatic grapevine red blotch virus positive ‘Pinot noir’ vine (left) next to an asymptomatic healthy (grapevine red blotch virus negative ) ‘Pinot noir’ vine (right) in a vineyard in Amity, OR. These symptoms were observed post-harvest (2 Nov 2017) and displayed delayed yellowing of symptomatic leaves.

30 30 30 ) A B C

-1

·s Negative-No -2 25 25 25 Positive-No ·m * 2 Positive-Yes 20 20 20 * 15 15 15

10 10 10

5 5 5

Photoassimilation (mmol CO 0 0 0 7/3/17 7/17/17 7/31/17 8/14/17 8/28/17 9/11/17 9/25/17 7/2/18 7/16/18 7/30/18 8/13/18 8/27/18 9/10/18 9/24/18 7/1/19 7/15/19 7/29/19 8/12/19 8/26/19 9/9/19 9/23/19

Figure 4. Mean (+SE) single leaf photoassimilation from the upper canopy positions of ‘Pinot noir’ vines in 2017 (A), 2018 (B), and 2019 (6). Negative-No (n=7) are grapevine red blotch virus (GRBV) negative without symptoms, Positive-No (n=7) are GRBV positive without symptoms, and Positive-Yes (n=6) are GRBV positive vines with symptoms. Arrow (↑) indicates 50 - 80% véraison, which occurred on 11 Sept 2017, 30 Aug 2018, and 28 Aug 2019. *statistical significance at p<0.05.

) 800 800 800

-1

·s A B C

2 - Negative-No Positive-No

O·m 2 600 600 600 Positive-Yes

400 400 400

* 200 200 200

Stomatal Conductance (mmol H 0 0 0 7/3/17 7/17/17 7/31/17 8/14/17 8/28/17 9/11/17 9/25/17 7/2/18 7/16/18 7/30/18 8/13/18 8/27/18 9/10/18 9/24/18 7/1/19 7/15/19 7/29/19 8/12/19 8/26/19 9/9/19 9/23/19

Figure 5. Mean (+SE) single leaf stomatal conductance from the upper canopy positions of ‘Pinot noir’ vines in 2017 (A), 2018 (B), and 2019 (6). Negative-No (n=7) are grapevine red blotch virus (GRBV) negative without symptoms, Positive-No (n=7) are GRBV positive without symptoms, and Positive-Yes (n=6) are GRBV positive vines with symptoms. Arrow (↑) indicates 50 - 80%véraison, which occurred on 11 Sept 2017, 30 Aug 2018, and 28 Aug 2019. *statistical significance at p<0.05

Tables

Table 1. Weather data for the north Willamette Valley of Oregon during three growing seasons (2017-2019) during which grapevine red blotch disease research was conducted. Mean daily Precipitation a Year Phenology Date GDD10 temp (°C) (mm) bb size to véraison 14 July - 11 Sep 730 21.9 3 2017 véraison to harvest 11 Sep - 8 Oct 148 15.0 18 full season 1 Apr - 31 Oct 1506 16.7 318 bud break to bloom 24 Apr - 20 Jun 358 15.8 43 bloom to véraison 20 Jun - 30 Aug 788 20.9 0 2018 véraison to harvest 30 Aug - 28 Sep 195 16.5 14 full season 1 Apr - 31 Oct 1480 16.5 246 bud break to bloom 24 Apr - 18 Jun 375 15.9 40 bloom to véraison 18 Jun - 28 Aug 679 19.6 22 2019 véraison to harvest 28 Aug - 2 Oct 249 16.4 97 full season 1 Apr - 31 Oct 1348 15.9 328 Historical full season 1 Apr - 31 Oct 1171 15.2 284 a Growing degree day base 10 calculated as ((Tmax + Tmin)/2 -10). All yearly weather data obtained from Agrimet, Aurora, OR (United States Bureau of Reclamation, 2016). Long-term data were obtained from McMinnville, OR from 1928 to 2006 (Western Regional Climate Summary, 2020)

Table 2. Mean (± SE) véraison nutrient concentration of ‘Pinot noir’ grapevines in Amity, OR. Negative-No (n=7) are grapevine red blotch virus (GRBV) negative without symptoms, Positive-No (n=7) are GRBV positive without symptoms, and Positive-Yes (n=6) are GRBV positive vines with symptoms. Leaf Blade Year Virus-Symptom N% P% K% Ca% Mg% B (ppm) NegativeClass-No 2.53 (± 0.05) 0.13 (± 0.003) ac 0.96 (± 0.03) a 2.74 (± 0.10) 0.27 (± 0.01) b 14.33 (± 0.48) Positive-No 2.48 (± 0.05) 0.13 (± 0.003) ab 0.89 (± 0.03) a 3.02 (± 0.10) 0.28 (± 0.01) b 14.21 (± 0.48) 2017 Positive-Yes 2.49 (± 0.05) 0.12 (± 0.003) b 0.71 (± 0.03) b 3.01 (± 0.11) 0.38 (± 0.01) a 14.57 (± 0.52) p nsa 0.0163 0.0002 ns <.0001 ns Negative-No 2.53 (± 0.08) 0.14 (± 0.004) 0.98 (± 0.04) a 2.47 (± 0.08) 0.25 (± 0.01) ab 15.00 (± 0.63) Positive-No 2.40 (± 0.08) 0.13 (± 0.004) 1.01 (± 0.04) a 2.50 (± 0.08) 0.23 (± 0.01) b 16.60 (± 0.63) 2018 Positive-Yes 2.44 (± 0.08) 0.13 (± 0.004) 0.78 (± 0.04) b 2.42 (± 0.09) 0.29 (± 0.01) a 15.10 (± 0.68) p ns ns 0.0022 ns 0.03 ns Negative-No 2.62 (± 0.06) 0.16 (± 0.004) a 1.15 (± 0.04) a 2.33 (± 0.05) 0.20 (± 0.01) b 17.83 (± 0.52) Positive-No 2.61 (± 0.06) 0.15 (± 0.004) ab 1.13 (± 0.04) a 2.32 (± 0.05) 0.20 (± 0.01) b 18.64 (± 0.52) 2019 Positive-Yes 2.56 (± 0.06) 0.14 (± 0.004) b 0.97 (± 0.04) b 2.43 (± 0.06) 0.25 (± 0.01) a 16.92 (± 0.57) p ns 0.0306 0.0123 ns 0.005 ns year 0.0316 <.0001 <.0001 <.0001 <.0001 <.0001 p class ns 0.0007 <.0001 ns <.0001 ns year *class ns ns ns ns ns ns Petiole Year Virus-Symptom N% P% K% Ca% Mg% B (ppm) Negative-No 0.48 (± 0.03) 0.05 (± 0.001) 2.44 (± 0.17) b 2.00 (± 0.09) a 0.60 (± 0.03) a 16.90 (± 0.61) Positive-No 0.43 (± 0.03) 0.05 (± 0.001) 2.49 (± 0.17) b 2.14 (± 0.09) a 0.61 (± 0.03) a 17.47 (± 0.61) 2017 Positive-Yes 0.51 (± 0.03) 0.05 (± 0.001) 3.71 (± 0.19) a 1.56 (± 0.09) b 0.38 (± 0.03) b 16.42 (± 0.66) p ns ns 0.0042 kwb 0.0008 0.0001 ns Negative-No 0.52 (± 0.02) 0.06 (± 0.003) 2.47 (± 0.26) 1.98 (± 0.09) 0.59 (± 0.04) a 16.27 (± 0.53) Positive-No 0.50 (± 0.02) 0.06 (± 0.003) 2.55 (± 0.26) 1.95 (± 0.09) 0.58 (± 0.04) a 17.63 (± 0.53) 2018 Positive-Yes 0.54 (± 0.02) 0.06 (± 0.003) 3.28 (± 0.28) 1.49 (± 0.09) 0.38 (± 0.04) b 16.52 (± 0.58) p ns ns ns 0.0018 0.0015 ns Negative-No 0.54 (± 0.02) 0.08 (± 0.009) 2.27 (± 0.35) 1.84 (± 0.14) 0.48 (± 0.04) ab 18.20 (± 1.73) Positive-No 0.51 (± 0.02) 0.07 (± 0.009) 2.75 (± 0.35) 2.03 (± 0.14) 0.53 (± 0.04) a 21.44 (± 1.73) 2019 Positive-Yes 0.53 (± 0.02) 0.06 (± 0.009) 3.19 (± 0.37) 1.50 (± 0.15) 0.33 (± 0.04) b 17.28 (± 1.87) p ns ns ns 0.0031 kw 0.0121 ns year 0.0323 <.0001 kw ns ns 0.0163 0.0111 kw p class ns ns 0.0001 kw <.0001 kw <.0001 0.0385 kw year * class ns ns ns ns ns ns ans = not significant, p> 0.05. bdata were not normal and Kruskal-Wallis test used. cdifferent letters following the SE indicate difference for p<0.05 with mean separation by Tukey’s Honestly Significant Different Test

Table 3. Mean (± SE) véraison micronutrient concentration of ‘Pinot noir’ grapevines in Amity, OR. Negative-No (n=7) are grapevine red blotch virus (GRBV) negative without symptoms, Positive-No (n=7) are GRBV positive without symptoms, and Positive-Yes (n=6) are GRBV positive vines with symptoms. Leaf Year Virus-Symptom Zn (ppm) Mn (ppm) Fe (ppm) Cu (ppm) Na% Negative-No 17.04 (± 0.67) 131.86 (± 8.17) 96.14 (± 4.87) 6.14 (± 0.28) 0.014 (± 0.001) Positive-No 17.04 (± 0.67) 135.71 (± 8.17) 104.14 (± 4.87) 6.29 (± 0.28) 0.014 (± 0.001) 2017 Positive-Yes 18.48 (± 0.73) 140.33 (± 8.83) 90.17 (± 5.26) 5.67 (± 0.31) 0.020 (± 0.002) p nsa ns ns ns ns Negative-No 17.04 (± 1.06) 128.57 (± 6.98) 88.00 (± 3.10) 7.00 (± 0.36) 0.014 (± 0.001) Positive-No 19.76 (± 1.06) 122.14 (± 6.98) 98.43 (± 3.10) 7.43 (± 0.36) 0.018 (± 0.001) 2018 Positive-Yes 17.60 (± 1.14) 117.83 (± 7.94) 88.50 (± 3.35) 6.33 (± 0.38) 0.018 (± 0.001) p ns ns ns ns ns Negative-No 15.50 (± 1.11) 123.14 (± 6.37) 111.29 (± 6.16) 6.86 (± 0.47) 0.019 (± 0.001) bb Positive-No 16.47 (± 1.11) 120.14 (± 6.37) 112.86 (± 6.16) 6.43 (± 0.47) 0.019 (± 0.001) b 2019 Positive-Yes 16.18 (± 1.20) 122.00 (± 6.88) 98.17 (± 6.65) 6.67 (± 0.50) 0.025 (± 0.001) a p ns ns ns ns 0.0007 year 0.0379 0.0405 0.0011 0.0211 <.0001 p class ns ns 0.0118 ns <.0001 year*class ns ns ns ns ns Petiole Year Virus-Symptom Zn (ppm) Mn (ppm) Fe (ppm) Cu (ppm) Na% Negative-No 64.29 (± 4.09) b 226.00 (± 24.27) 22.14(± 1.03) 5.43 (± 0.63) 0.047 (± 0.003) Positive-No 68.99 (± 4.09) ab 204.00 (± 24.47) 20.14 (± 1.03) 4.00 (± 0.63) 0.045 (± 0.003) 2017 Positive-Yes 82.28 (± 4.41) a 151.33 (± 26.43) 20.68 (± 1.11) 4.54 (± 0.68) 0.053 (± 0.003) p 0.0233 ns ns ns ns Negative-No 79.43 (± 14.18) 198.71 (± 18.84) 20.61 (± 5.28) 5.84 (± 0.69) 0.033 (± 0.002) Positive-No 109.67 (± 14.18) 182.57 (± 18.84) 23.91 (± 5.28) 7.39 (± 0.69) 0.035 (± 0.002) 2018 Positive-Yes 72.50 (± 15.31) 131.45 (± 20.35) 40.90 (± 5.71) 6.28 (± 0.75) 0.035 (± 0.002) p ns ns ns ns ns Negative-No 63.73 (± 6.36) 148.71 (± 22.28) 28.43 (± 2.13) 5.79 (± 0.71) 0.052 (± 0.006) Positive-No 69.89 (± 6.36) 174.43 (± 22.28) 32.44 (± 2.13) 7.14 (± 0.71) 0.066 (± 0.006) 2019 Positive-Yes 74.35 (± 6.87) 116.08 (± 24.06) 27.45 (± 2.30) 6.57 (± 0.76) 0.055 (± 0.007) p ns ns ns ns ns year ns ns <.0001 kwc 0.002 <.0001 kw p class ns 0.0031 ns ns ns year*class ns ns 0.0068 ns ns ans = not significant, p> 0.05. bdifferent letters following the SE indicate difference for p<0.05 with mean separation by Tukey’s Honestly Significant Different Test cdata were not normal and Kruskal-Wallis test used.

Table 4. Mean (±SE) growth and crop load measures of ‘Pinot noir’ grapevines in Amity, OR. Negative-No (n=7) are grapevine red blotch virus (GRBV) negative without symptoms, Positive-No (n=7) are GRBV positive without symptoms, and Positive-Yes (n=6) are GRBV positive vines with symptoms.

Virus-Symptom Vine Leaf Area Leaf Area/ Pruning Wt./ Dormant Cane Yield:Pruning Year Class (m2) Yield Vine (kg) Wt. (g) Wt.

Negative-No 2.81 (± 0.25) 1.08 (± 0.21) ndb nd nd Positive-No 2.56 (± 0.25) 0.94 (± 0.21) nd nd nd 2017 Positive-Yes 2.55 (± 0.27) 1.48 (± 0.22) nd nd nd p nsa ns Negative-No 1.50 (± 0.21) 0.83 (± 0.22) 0.92 (± 0.10) 114.72 (± 17.53) 2.20 (± 0.39) Positive-No 1.87 (± 0.21) 1.09 (± 0.22) 0.68 (± 0.10) 85.09 (± 17.53) 3.08 (± 0.39) 2018 Positive-Yes 1.67 (± 0.23) 1.17 (± 0.23) 0.86 (± 0.11) 119.41 (± 18.93) 2.31 (± 0.42) p ns ns ns ns ns Negative-No 2.34 (± 0.17) 1.13 (± 0.26) 0.78 (± 0.08) 69.82 (± 6.19) 2.92 (± 0.34) Positive-No 2.26 (± 0.17) 1.35 (± 0.26) 0.65 (± 0.08) 72.42 (± 6.19) 2.99 (± 0.34) 2019 Positive-Yes 2.13 (± 0.18) 1.81 (± 0.28) 0.79 (± 0.09) 83.95 (± 6.69) 1.88 (± 0.37) p ns ns ns ns ns year <.0001 ns ns 0.0081 ns p class ns ns ns ns ns year * class ns ns ns ns ns ans = not significant, p>0.05. b nd = no data

Table 5. Mean (± SE) harvest yield and cluster components of ‘Pinot noir’ grapevines in Amity, OR. Negative-No (n=7) are grapevine red blotch virus (GRBV) negative without symptoms, Positive-No (n=7) are GRBV positive without symptoms, and Positive-Yes (n=6) are GRBV positive vines with symptoms. Virus-Symptom Cluster Yield /Vine Berry count/ Year Cluster Wt. (g) Berry Wt. (g) Class count/vine (kg) cluster Negative-No 19 (± 1.4) 3.4 (± 0.3) 173.4 (± 15.7) 148 (± 9.1) 1.2 (± 0.1) Positive-No 17 (± 1.4) 2.4 (± 0.3) 145.5 (± 15.7) 147 (± 9.1) 1.0 (± 0.1) 2017 Positive-Yes 19 (± 1.5) 2.1 (± 0.4) 107.9 (± 16.9) 122 (± 9.9) 0.8 (± 0.1) p nsa ns ns ns ns Negative-No 14 ± 1.6 2.0 (± 0.2) 147.1 (± 11.9) ab 127 (± 9.2) 1.2 (± 0.1 ) a Positive-No 16 (± 1.6) 1.8 (± 0.2) 120.1 (± 11.9) ab 116 (± 9.2) 1.0 (± 0.1) ab 2018 Positive-Yes 20 (± 1.7) 1.8 (± 0.3) 91.5 (± 12.8) b 108 (± 10.0) 0.9 (± 0.1) b p ns ns 0.019 ns 0.0286 Negative-No 19 (± 2.0) 2.3 (± 0.3) 118.7 (± 10.4) 145 (± 9.6) 0.8 (± 0.1) Positive-No 17 (± 2.0) 1.8 (± 0.3) 107.7 (± 10.4) 134 (± 9.6) 0.9 (± 0.1) 2019 Positive-Yes 15 (± 2.1) 1.4 (± 0.3) 96.5 (± 11.2) 126 (± 10.3) 0.7 (± 0.1) p ns ns ns ns ns year ns 0.0033 0.0079 0.0178 0.001 p class ns 0.0074 0.0003 0.0298 0.0005 year * class 0.0456 ns ns ns ns a ns = not significant, p > 0.05. b different letters indicate difference for p<0.05 with mean separation by Tukey’s Honestly Significant Different Test

Table 6. Mean (± SE) berry composition at harvest of ‘Pinot noir’ grapevines in Amity, OR. Negative-No (n=7) are grapevine red blotch virus (GRBV) negative without symptoms, Positive-No (n=7) are GRBV positive without symptoms, and Positive-Yes (n=6) are GRBV positive vines with symptoms. Total Total Virus-Symptom TSS Total Phenolics Year pH TA (g*L-1) Anthocyanin Tannins Class (°Brix) (mg*g-1 FW) (mg*g-1 FWa) (mg*g-1 FW) Negative-No 21.9 (± 1.0) 2.97 (± 0.04) 10.1 (± 0.4) 0.46 (± 0.06) 5.67 (± 0.21) a 7.8 (± 0.6) Positive-No 21.0 (± 1.0) 2.88 (± 0.04) 10.3 (± 0.4) 0.43 (± 0.06) 5.48 (± 0.21) ab 8.4 (± 0.6) 2017 Positive-Yes 20.5 (± 1.1) 2.97 (± 0.05) 9.9 (± 0.4) 0.44 (± 0.06) 4.77 (± 0.23) b 6.6 (± 0.7) p nsb ns ns ns 0.0259 ns Negative-No 23.1 (± 0.6) 3.32 (± 0.02) bc 10.2 (± 0.03) 0.59 (± 0.05) 8.79 (± 0.35) 9.4 (± 0.3) Positive-No 24.9 (± 0.6) 3.30 (± 0.02) b 9.5 (± 0.03) 0.63 (± 0.05) 8.90 (± 0.35) 9.8 (± 0.3) 2018 Positive-Yes 23.4 (± 0.7) 3.43 (± 0.02) a 9.0 (± 0.03) 0.57 (± 0.05) 8.46 (± 0.38) 8.6 (± 0.4) p ns 0.0019 ns ns ns ns Negative-No 22.8 (± 0.7) 3.15 (± 0.03) b 10.4 (± 0.03) a 0.47 (± 0.03) 6.00 (± 0.28) 9.1 (± 0.8) Positive-No 23.5 (± 0.7) 3.17 (± 0.03) b 9.7 (± 0.03) a 0.5 (± 0.03) 6.04 (± 0.28) 9.2 (± 0.8) 2019 Positive-Yes 23.2 (± 0.7) 3.34 (± 0.03) a 8.4 (± 0.03) b 0.5 (± 0.03) 5.67 (± 0.30) 9.0 (± 0.8) p ns 0.0002 0.0017 ns ns ns year 0.0004 <.0001 ns 0.0006 <.0001 0.0041 p class ns <.0001 0.0008 ns ns ns year * class ns ns ns ns ns ns aFW = fresh weight bns = not significant, p>0.05. cdifferent letters indicate difference for p<0.05 with mean separation by Tukey’s Honestly Significant Different Test

Chapter 3: Conclusions Through this study we observed minimal to no impacts caused by grapevine red blotch disease to measures of physiology (photoassimilation, stomatal conductance), productivity (yield and pruning weight), vine nutrition, and fruit quality (basic ripeness, color, and phenolics). This suggest that under some circumstances, such as low plant stress, the virus may have lower impact. The negative impacts that some researchers and growers are observing in other regions of the state and region (California), may be due to site and cultivar differences, suggesting that future management of the disease will have to be assessed on a site by site basis. This study only looked at the GRBV effects over three seasons, and while we observed minimal differences, it is hard to say what impacts will develop from long-term virus progression, increase in vine age, or changes in vine stress.

Minimal to no effects on measures of ripeness and berry phenolics suggests that grapevine red blotch disease may not result in lower fruit and wine quality for wineries and vineyards in cool climate areas compared to the warmer, drier regions where previous research has been conducted. With Oregon’s focus mostly on small wineries producing high tier wines, the economic impacts from a loss of quality could be detrimental; however, the ability for vines to maintain berries of similar phenolic concentrations and still attain adequate ripeness suggests that impacts could be avoided as long as vines are not unduly stressed.

This study aimed to describe the impacts of grapevine red blotch disease, and while most impacts were minimal in our study, it may ease worries of the Oregon wine industry. This study provided the first local observations of disease impacts

46 under the cool climate conditions of Oregon’s Willamette Valley that compare with research conducted in warmer, drier locations of the state and West Coast.

Literature Cited Adiputra, J., S.R. Kesoju, and R.A. Naidu. 2018. The relative occurrence of grapevine

leafroll-associated virus and grapevine red blotch virus in Washington state

vineyards. Plant Disease 102:2129-2135.

Al Rwahnih, M., A. Dave, M.M. Anderson, A. Rowhani, J.K. Uyemoto, and M.R.

Sudarshana. 2013. Association of a DNA virus with grapevines affected by

red blotch disease in California. Phytopathology 103:1069–1076.

Al Rwahnih, M., A. Rowhani, and D. Golino. 2015. First Report of Grapevine red

blotch-associated virus in Archival Grapevine Material from Sonoma

County, California. Plant Disease 99:895–895.

Atallah, S.S., M.I. Gómez, M.F. Fuchs, and T.E. Martinson. Economic impact of

grapevine leafroll disease on Vitis vinifera cv. Cabernet franc in Finger Lakes

vineyards of New York. American Journal of Enology and Viticulture 63:73-

79.

Australian Wine Research Institute.2020. Laboratory establishment and methods.

Australian Wine Research Institute

ry_establishment/>

Bahder, B.W., F.G. Zalom, and M.R. Sudarshana. 2016a. An Evaluation of the flora

adjacent to wine grape vineyards for the presence of alternative host plants of

grapevine red blotch-associated virus. Plant Disease 100:1571–1574.

Bahder, B.W., FG. Zalom, M.Jayanth, and M.R. Sudarshana, 2016b. Phylogeny of

geminivirus Coat Protein Sequences and digital PCR aid in identifying