Phylogenetic Appraisal of the Drug Bearing Marine Sponge, Callyspongia Subarmigera (Ridley, 1884) from South India

Indian Journal of Geo-Marine Sciences Vol. 42(1), February 2013, pp. 139-145

Phylogenetic Appraisal of the Drug Bearing Marine Sponge, Callyspongia subarmigera (Ridley, 1884) from South India

M. S. Aishwarya*, A. P. Lipton & A. R. Sarika Centre for Marine Science and Technology, Manonmaniam Sundaranar University, Rajakkamangalam-629 502, India * [E-mail: [email protected]]

Received 8 February 2011; revised 20 October 2011

Tropical Callyspongia subarmigera prevalent in the south-east coast of India was studied for evaluating the bioactivity and phylogenetic resemblance with other drug-bearing species. Antibacterial screening of the methanol extract of C. subarmigera against clinical and fish pathogens displayed their broad spectrum against Gram positive and Gram negative pathogenic strains. Fish pathogenic bacteria Vibrio pelagius and Vibrio fischeri and the clinical pathogen Pseudomonas aeruginosa were highly susceptible to the methanol extract. Sponge extract had no antifungal property against the two fungal strains tested viz., Aspergillus niger and Candida albicans. Callyspongia subarmigera extract indicated cytotoxic activity with an LC50 of 0.39% against Artermia nauplii in 24 h. PCR protocol was carried out using a 16S rRNA primer and an 18S rRNA primer and the annealing temperature was standardized at 55°C. BLAST analysis was conducted to detect the resemblance of different species of Callyspongia genera of sponges. A phylogenetic tree was constructed using neighbour joining method and the results revealed that C. subarmigera had the nearest homology to that of Haliclona cinerea, Haliclona oculata (88%) and Callyspongia spp (88%) possessing pharmacological relevance.

[Keywords: Callyspongia subarmigera, bioactivity, methanol extract, PCR amplification, DNA sequencing, phylogenetic tree]

Introduction characters for demosponge classification6. Marine chemo diversity is one of the targets for A molecular approach towards the analysis of genome deriving natural drug products. Many research organization of marine sponges is essential for the resources are being dedicated to this field to fulfill the elucidation of selected genes7. Use of rDNA gene as a ever growing urgency and demand for new phylogenetic marker has made it possible to antibiotics1. Sponges, the simple sessile filter feeding determine the phylogenetic position of populations in invertebrates in particular prove to be mining the the evolutionary tree and to assess their closest genetic repositories of secondary metabolites2 and relative bearing maximum resemblance of gene harbor uniform yet phylogenetically complex sequences. Present investigation is an attempt for microbial signatures3. Strategies of defense molecular information on Callyspongia subarmigera mechanisms or the so called intense competition of that showcases their closest relative possessing sponges against eukaryotic predators, bacteria and similar bioactivities. viruses results in the production of secondary Materials and Methods metabolites4. New bioactive metabolites are obtained The eco-friendly collection of freshly detached from sponges each year than from any other marine sponges, which get entangled in the traditional taxon5. Cytotoxicity in marine-derived extracts fishing nets were accomplished off Cape Comorin surpasses those of terrestrial origin. Traditionally, = Kanyakumari coast (8º 04' lat., 77º 36' E long.), sponge systematics has been based mostly on skeletal Tamil Nadu. A few specimens of C. subarmigera morphology, spicule geometry and diversity. were also collected by SCUBA diving from the same In particular, the shape and size of the large structural location at depths ranging from 10 to 15 m. Sponges spicules or of the small reinforcing or packing obtained were transferred to sterile plastic bags spicules have been used as important taxonomic containing sea water and immediately transported to —————— the laboratory. Sponges were rinsed thoroughly with *Presently: Central Marine Fisheries Research Institute, sterile sea water for the removal of transient bacteria Vizhinjam-695521, Kerala, India or attached algae if any, present on the surface of the 140 INDIAN J. MAR. SCI., VOL. 42, NO. 1, FEBRUARY 2013

sponge tissue. In the laboratory, the sponge was The frozen sponge tissues were cut into thin immediately placed at -80°C (Deep freezer - Voltas) slices and the genomic DNA was extracted using Fast for molecular studies. Sponge tissues required for DNA Spin kit, QIAGEN (Valencia, CA) according to bioactive profile studies were immersed in methanol. the protocol suggested by the manufacturers. Sponge species was identified by Dr. P.A. Thomas, Resulting genomic DNA was used as template to Sponge taxonomist, Thiruvananthapuram (India) by amplify the 18S rRNA gene using two different spicule types, arrangement of spicules and with other primers: the 18S rRNA gene, Forward primer - taxonomic keys. 5' CTGGTGCCAGCAGCCGCGG 3', the Reverse Twenty gram of sponge tissues were immersed for primer - 5' TGGTGCCCTTCCGTCAATTCCT 3.' 12 7 days in 160 mL of methanol. Sponge tissues were and the universal Eubacterial primer: 519F-5' CAG squeezed and the methanol content was condensed CMG CCG CGG TAA TWC-3'and 1406R - 3' ACG under reduced pressure using rotary vacuum GGC GGT GTG TRC - 5' 13. A high fidelity Taq evaporator (Buchi type) and further filtered using Polymerase (XT05, SIGMA) was used for the Master 0.22 m bacterial syringe filter (HiMedia, India). mix preparations and the amplification was carried Methanol extract was dried and concentrated to a out using a Gradient PCR (ASTEC, Japan). PCR semi solid extract and stored in refrigerator for cycling conditions using the two primers were further use. The extract diluted with normal saline standardized as follows: Initial denaturation: (5mins, (0.85% NaCl) at different dilutions was screened 94°C), 30 cycles of denaturation (1 min, 94°C), for its antibacterial activity against four clinical primer annealing (1 min, 55°C), elongation (5 mins, pathogens and four fish pathogens viz., 72°C) and the final extension (5 min, 72°C). Staphylococcus aureus, Pseudomonas aeruginosa, Amplicon was viewed on a 1.0% agarose gel along Bacillus subtilis, Proteus mirabilis, Vibrio harveyi, with a DNA ladder (GENEI, India) of 500 bp size. V. alginolyticus, V. Pelagius and V. fischeri Bands of approximately 500 bp were eluted and maintained as axenic stock culture in the laboratory. recovered using a gel extraction kit (QIAGEN) Twenty microlitre of the filtered culture taken at three according to the manufacturer’s protocol. Purified different dilutions (0.1, 1 and 10%) corresponding to DNA was viewed along with a DNA ladder of 100 bp -1 0.02, 0.2 and 2.0 mg disc were dispensed onto the size. PCR product using the former primer sterile discs (Hi-Media) placed on the Mueller Hinton (18S rRNA primer) corresponded to less than 100 bp, 6-7 agar plates seeded with bacteria (10 CFU/mL) in while the product of the latter (16S rRNA) Petri dishes. Discs loaded with normal saline was corresponded to nearly 500 bp. used as the negative control and disc impregnated Sequencing of only the latter sample corresponding with chloramphenicol (30 mcg/disc-Hi-Media) used to 500 bp was performed, using an ABI 3100 as positive control. Triplicates were maintained for automated sequencer. Sequenced result was correlated each bacterial strain. Zone of inhibition was measured to those in databases deposited in GenBank using after 24 h following the standard disc diffusion 8 the Basic Local Alignment Search Tool (BLAST - method . Inhibition zones of the commercial National Centre for Biotechnology Information antibiotic was used as references. A standard agar 9 (http://www.ncbi.nlm.nih.gov) and the sequences with well diffusion method as reported earlier was also high degree of similarity were identified. Multiple carried out using the same dilutions to implicit the alignment of the 18S rRNA gene sequence of antifungal potentiality of the methanol extract of C. subarmigera were compiled manually with related C. subarmigera against Aspergillus niger sequences with high similarity using CLUSTAL W and Candida albicans. Standard drug fluconazole (1.83). Phylogenetic tree was constructed using (30 µg/disc) was used for comparing the results. the neighbour-joining algorithm (Jukes and Cantor The crude methanol extract of Callyspongia distance) and the sequences were estimated based subarmigera at different dilutions ranging from 0.1% on pair-wise genetic distances on the basis of to 1.0% was tested for cytotoxic effect using freshly 10 all substitutions with the least distance pair of hatched nauplii of Artemia salina as described earlier . sequences parameter. LC50 value of the extract was determined using the Probit scale11 based on their percentage of mortality, Results which forms a befitting statistical method for toxicity The sponge of interest was taxonomically data analysis. identified as Callyspongia subarmigera (Plate 1). AISHWARYA et al.: PHYLOGENETIC APPRAISAL OF THE DRUG BEARING MARINE SPONGE 141

The colour of the sponge ranged from yellow when inhibition for the former and 12 mm for the latter. freshly collected to pale yellow when dry. Surface of Extract inhibited the clinical pathogens such as branches was beset with conical projections Pseudomonas aeruginosa (12 mm) and Stapylococcus and oscules seemed scattered at few places. Siliceous aureus (9 mm) at 10% level. Gram positive B. subtilis spicules degraded with nitric acid had the size ranging had low zone of inhibition at 10%. No inhibition from 0.07 × 0.003 mm. Present species was towards V. alginolyticus and Proteus mirabilis by the assigned to the Class: Demospongiae, Order: sponge extract were noticed and hence are not Haplosclerina Topsent, Sub-Order: Haplosclerina depicted in Fig. 1. There was comparatively less Topsent, Family: Callyspongiidae de Laurbenfels, variation in the inhibition spectrum of the extract Genus: Callyspongia , Species: subarmigera. when compared to the commercial antibiotic Methanol extract of C. subarmigera displayed broad (chloramphenicol) though all the test pathogens spectrum of activity against Gram negative and Gram were susceptible to chloramphenicol. Similarly, positive bacteria (Fig. 1). Maximum inhibitory no antifungal activity could be noticed in the activity was noted towards the fish pathogens three concentrations of the extract against the tested Vibrio fischeri (11 mm) and Vibrio pelagius (14 mm) fungal isolates. at 10% of the extract while 1% exhibited 9 mm zone of In Artemia cytotoxic test, 100% mortality was noted at 1% extract after 24 h of incubation. The different concentrations tested indicated the LC50 value of C. subarmigera to be 0.39% (Table 1). This fairly high mortality percentage calculated implies the cytotoxic and pharmacological importance of C. subarmigera extract. The isolated DNA of Callyspongia subarmigera obtained was viewed on a 1.0% agarose gel. DNA amplification method using PCR technique was optimized and finally standardized at an annealing temperature of 55°C. Amplification of the target DNA was carried out using two different primers to denote their accuracy level under specific cycling conditions. Considering the lacuna of previous records denoting cross amplification of kingdoms using universal eubacterial primers, an experiment was also conducted to determine the preferential amplification of genes, though the targeted and preferred results were that of the sponge. PCR product of DNA isolated from Callyspongia subarmigera tissue using

Plate 1—Morphological features of Callyspongia subarmigera 16S rRNA specific eubacterial primers yielded a band Table 1—Mortality of brine shrimp exposed for 24 hours to different concentrations of methanol extract from the sponge Callyspongia subarmigera (± represents standard deviation) Percentage of extract Mortality (%) Control 0.0 0.1 20.2 ± 5.3 0.2 38.0 ± 1.0 0.3 43.0 ± 0.58 0.4 58.6 ± 1.24 0.5 65.3 ± 0.24 0.6 78.0 ± 1.26 0.7 86.9 ± 2.3

0.8 98.5 ± 3.12 Fig. 1—Antibacterial activity of methanol extract of Callyspongia 0.9 100 ± 0.0 subarmigera 1.0 100 ± 0.0 142 INDIAN J. MAR. SCI., VOL. 42, NO. 1, FEBRUARY 2013

of expected size of 500 bp on comparison with a Further BLAST analysis and multiple alignment DNA ladder on a 1.0% agarose gel (Plate 2). And the evaluated using Clustal W 1.83 resurged their nearest amplified product using 18S rRNA gene relative and the neighbour joining method contributed corresponded to fewer base pairs (< 100 bp) which to the evolutionary distance matrices of the sequence. were omitted due to the inadequacy in data. The sequence showed a maximum of 88% homology towards Haliclona cinaria, Haliclona oculata and Callyspongia spp (Fig. 2). The partial sequence of C. subarmigera was submitted to GenBank under the accession number FJ705131.1.

Discussion Members of Demospongiae are known to be the richest and pre-eminent producers of secondary metabolites including polyketides, alkaloids and terpenoids14. But they in fact remain to be the few group of animals in which ordinal relationships still remain unsettled. Demosponge relationships using mitochondrial genomic data have been preferred due to some of its typical features15. With the increased occurrence of multidrug resistant human pathogens, the thirst for novel antibiotics has gained momentum. Many clinically relevant microbes have developed resistances resulting from the exposure to sub-lethal concentrations of antibiotics in hospital environments. The class of alkylpyridinium compounds is

commonly found in sponges belonging to the order Plate 2—PCR amplification showing consensus 16S rRNA primer Haplosclerida, with interesting therapeutic

Fig 2–Phylogenetic tree of Callyspongia subarmigera calculated with 18S rRNA gene depicting its nearest homology sequence using neighbour joining tree. The scale bar represents 0.01 substitution per nucleotide position. GenBank accession numbers are shown in parentheses. AISHWARYA et al.: PHYLOGENETIC APPRAISAL OF THE DRUG BEARING MARINE SPONGE 143

potentials16,17. A striking example of such macrolides that inferred satisfying results that tributed to the isolated from Halichondrin okadai sponge is recognition of C. subarmigera as a potential drug Halichondrin B having anti-cancerous property18. bearer. The C. subarmigera extract proved to have Ara-C, the compounds derivative being isolated from higher CT ratio (Clotting time) than heparin that was a marine sponge is currently used in the routine used as control. Fewer reports are available discussing treatment of patients with leukemia and lymphoma19. the anticoagulant properties of marine sponges. The present work deals with the assessment of A report discussing the bioactive profile of marine animals and their derived compounds displays no bioactive potentiality of C. subarmigera. Initial reports on the anticoagulant properties of sponges bioactive profile of C. subarmigera when evaluated whereas the other properties like antimicrobial, against certain bacterial pathogens exhibited strong antimalarial, antiprotozoal have been well studied25 . antibacterial efficacies against two Vibrio strains and Molecular approaches show great promise in no activity was exhibited against V. alginolyticus and making the genetic resources of several marine Proteus mirabilis. Whereas, Vibrio pelagius and organisms more accessible26. Compelling evidences Pseudomonas aeruginosa were observed to be more regarding isolation of secondary metabolites from susceptible to the methanolic extract. A relevant sponges provocated the determination of sequence of report by Dobrestov et al.20 revealed the antibacterial the most predominant sponge of South India. A activity of seven different sponge specimens phylogenetic approach was also carried out in this including three Callyspongia sp that exhibited experiment to detect the nearest phylogenetic inhibition towards Vibrio harveyi on comparison with relationships of C. subarmigera and also to strengthen other tested strains. But the present study highlighted the taxonomic classification. Retrenched sequence strong inhibition of the sponge extract towards details on sponges retrospected the most reliable V. pelagius and V. fischeri to a greater extent than approach of faithful amplification and sequencing of against V. harveyi. But the rational argument that genes thereby illuminating evolutionary details of the different specimens of the same species shows varied sponge of interest. antimicrobial activity ascribing to seasonal, Considering the implications of sponges as a good microgeographical and methodological effects21 source of metabolite production, the phylogeny implies influence over the current statement. The guided approach will provide a solution to the rather antifungal activity of C. subarmigera was not intricate problem of isolating a set of natural product promising against the two fungi and showed no zone biosynthesis genes from the sponge genome. The bias of inhibition. Scanty reports are available on the that may occur in amplification due to random mixing antifungal activity of marine sponges. A study22 of rRNA templates and the frequent hypothesis of reporting the absence of antifungal activity on few 27 cross amplifications prompted the usage of the marine sponges, namely Callyspongia fibrosa easily available eubacterial primer apart from the 18S collected off the coast of south east India is in tune rRNA primer. Sponge 18S rRNA was successfully with the present results. amplified using the eubacterial primer except for their The potential anti-cancerous activity could be limitation in nucleotide base pair sequencing. related to simple cytotoxicity evaluation and the Limitation in the amplification of the gene using 18S analogous compounds correlates well with anti tumor rRNA primer could be attributed to the low properties. In sponges, diverse and potent cytotoxic concentration level of target DNA. Partially acquired compounds are reviewed by Lee and Qian23. 24 sequence (406 bp) when aligned with the closest Sonia et al. reported that among different sponge relative obtained from a BLAST query showed extracts the highest cytotoxicity was exhibited by homology towards the Haliclona genera, C. subarmigera with an LC50 value of 0.46%. Xestospongia muta and towards Amphimedon Concurrent with the existing reports was the present queenslandica, all of them belonging to the Order results that indicated the potential cytotoxic activity of Haplosclerida. But contrarily the presently identified C. subarmigera with an LC50 of 0.39% and hence Callyspongia subarmigera showed a higher demand the need to gain more information on the resemblance towards sponges Haliclona spp. than the compounds responsible for the bioactive properties. Callyspongia spp. belonging to the same genera. Anticoagulant and mosquito larvicidal activity of Manzamine A, a potential drug as conferred in the sponge was also carried out (Data not published) reports had been isolated from Xestospongia, 144 INDIAN J. MAR. SCI., VOL. 42, NO. 1, FEBRUARY 2013

Haliclona and Amphimedon queenslandica. These hence hinges to perform more analytical studies for sponges being the closest relative of the sequenced development of new analogs. sponge Callyspongia subarmigera suggest a possible indication of the sponge bearing similar compounds Acknowledgements supported by its cytotoxic studies. Similarly rare Authors are thankful to Dr. R.T. Sabapathy Mohan, phospholipids fatty acids and HIV protease inhibitors former Vice Chancellor of Manonmaniam Sundaranar 28 had been explored in Xestospongia muta . A University, Tirunelveli and Dr. G. Syda Rao, Xestospongia sp. of sponge has been studied due to its Director, Central Marine Fisheries Research Institute, cytotoxic effect against Human colon tumor HCT 116 Cochin for the encouragement and facilities. and Adociaquinone B, a compound derived from similar sponge was also regarded to possess References 29 30 anticancer activity . Another report by Orhan et al. 1 Li, X., Qin, L., Metagenomics-based drug discovery and assessed the property of fourteen sponge originated marine microbial diversity, Trends. Biotechnol., 23 (2005) compounds isolated from two sponges namely, 539-543. Spongia sp. and Ircinia sp. showing promising in 2 Mohamed, N.M., Enticknap, J. J., Lohr, J. E., McIntosh, 17 S. M., Hill, R.T., Changes in bacterial communities of the vitro anti-protozoal properties. Becking et al has marine sponge Mycale laxissima on transfer into aquaculture, reconfirmed the presence of amphitoxin in Appl. Environ. Microbiol ., 74 (4) (2008) 1209 – 1222. Callyspongia biru that can be utilized as a genuine 3 Schirmer, A., Gadkari, R., Reeves, C.D., Ibrahim, F., chemotaxonomic marker. Another promising report Delong, E. F., Hutchinson, C. R., Metagenomic analysis on the Callyspongia sp. was that of Rao et al. 31 on the reveals diverse polyketide synthase gene clusters in microorganisms associated with the marine sponge isolation of seven compounds including two steroids Discoderma dissoluta, Appl. Environ. Microbiol ., 71 (2005) from C. fibrosa collected off the coast of Gulf of 4840-4849. 32 Mannar. Yu et al. reported the isolation of eight new 4 Schroder, H.C., Ushijima, H., Krasko, A., Gamulin, V., compounds including oculatol, oculatolide and six Thakur, N.L., Diehl-Seifert B., Muller, I.M., Muller, unusual A-nor steroids from Haliclona oculata that is W. E. G., Emergence and disappearance of an immune molecule, an antimicrobial lectin, in basal metazoa : A one of the sponges having nearest homology to that of Tachylectin – related protein in the sponge Suberites C. subarmigera. An 18S rRNA sequencing carried out domuncula, J. Biol. Chem., 278 (35) (2003) 32810 – 32817. 33 by Lopez-Legentil et al. denoted the close 5 Taylor, M.W., Radax, R., Steger, D., Wagner, M., Sponge - similarities of Callyspongia vaginalis and associated microorganisms : Ecology and biotechnology Callyspongia falax towards Haliclona cinerea having potential, Microbiology and molecular biology., (2007) 295-347. 0.29% and 0.59% divergence. 6 Lavrov, D. V., Wang, X., Kelly, M., Reconstructing the ordinal relationships in the Demospongiae using Hence it could be considered that since the closest mitochondrial genomic data, Mol. Phylogenet.Evol., relative of the sponge Callyspongia subarmigera are 49(2008) 111-124. potential drug bearers, the probability of the 7 Thakur, N.L., and Muller, W. E. G., Biotechnological potential aforementioned sponge of interest contributing to the of marine sponges, Curr. Sci., 86(11) (2004) 1506-1512. 8 Bauer, A.W., Kirby, W. M. M., Sherris, J. C., Turck, M., astounding arsenal of secondary metabolites are more. Antibiotic susceptibility testing by a standardized single disk Many reports revealing the isolation of alkaloids, method, Am. J. Clin. Pathol., 45 (1966) 493-496. cyclic peptides etc and other valuable findings from 9 Perez, C., Pauli, M., Bazerque, P., An antibiotic assay by Callyspongia sp. provokes the speculation about the agar-well diffusion method, Acta Biologiae et Medecine potentiality of C. subarmigera bearing efficient Experimentaalis., 15 (1990) 113-115. 10 Meyer, B. N., Ferrigni, N. R., Putnam, J. E., Jacobsen, L. B., compounds. And further the simple yet most effective Nichols, D. E., Mc Laughlin, J. L., Brine shrimp: A brine shrimp cytotoxicity assay further adds credit to convenient general bioassay for active plant constituents, their suspected untapped array of secondary Journal of medicinal plant research., 45 (1982) 31-34. metabolites. 11 Finny, D., Probit Analysis. Cambridge University Press, Cambridge. 1971. Considering the immense bioactive potentialities 12 Kelly-Borges, M and Pomponi, S. A., Phylogeny and contributed by newly sequenced sponge, classification of lithistid sponges (Porifera : Demospongiae): a Callyspongia subarmigera, it could be concluded that preliminary assessment using ribosomal DNA sequence attempts should be made to reap out the maximum comparisons, Mol. Mar. Biol. Biotechnol., 3 (2)(1994) 87-103. efficacies of the same. With regard to this, future 13 Webster, N.S., Wilson, K.J., Blackall, L.L., Hill, R.T., Phylogenetic diversity of bacteria associated with the marine work in progress is designed regarding whole genome sponge Rhopaloeides odorabile, Appl. Environ. Microbiol., sequencing and compound isolation, that are vital and 67 (2001b) 434-444. AISHWARYA et al.: PHYLOGENETIC APPRAISAL OF THE DRUG BEARING MARINE SPONGE 145

14 Faulkner, D.J., Marine Natural Products. Natural Product antituberculosis and antiviral activities; affecting the Reports., 19 (2002) 1- 48. cardiovascular, immune and nervous systems and other 15 Lavrov, D.V., Wang, X., Kelly, M., Reconstructing the miscellaneous mechanisms of action, Biochim Biophys Acta ordinal relationships in the Demospongiae using 1790 (5) (2009) 283-308. mitochondrial genomic data, Mol. Phylogenet. Evol., 26 Thakur, N.L., Jain, R., Natalio, F., Hamer, B., Thakur, A.N., 49 (2008) 111-124. Muller, W.E.G., Marine molecular biology: An emerging 16 Sepčić, K., Bioactive alkylpyridinium compounds from field of biological sciences, Biotechnol. Adv., 26 (3) (2008) marine sponges, J. Toxicol Toxin. Rev.,19 (2000) 139–160. 233-245. 17 Becking, L.E., Nakao, Y., de Voogd, N.J., Van soest, R.W. 27 Galkiewicz, J.P., and Kellogg, C.A., Cross kingdom M., Fusetani, N., Matsunaga, S., Perplexing distribution of 3- amplification using bacteria-specific primers : Complications Alkylpyridines in Haplosclerid sponges, Porifera Research: for studies of coral microbial ecology, Appl Environ Biodiversity, Innovation and Sustainability., (2007) 173-178 Microbiol .,74 (24) (2008) 7828-7831. 18 Simmons, L., Andrianasolo, E., Mcphail, K., Flatt, P., 28 Patil, A.D., Kokke, W.C., Cochran, S., Francis, Gerwick, W.H., Marine natural products as anticancer drugs, T.A., Tomszek, J., Westley, J.W., Brominated polyacetylenic Mol. Cancer Ther., 4 (2005) 333 – 342. acids from the marine sponge Xestospongia muta: 19 Laport, M.S., Santos, O.C.S., Muricy, G., Marine sponges: Inhibitors of HIV protease, J. Nat. Prod., 55 (9) (1992) Potential sources of new antimicrobial drugs, Current 1170-1177. Pharmaceutical Biotechnology., 10 (2009) 86-105. 20 Dobrestov., Damhs, H-U., Qian, P.Y., Antibacterial and 29 Concepcion, G.P., Foderaro, T.A., Eldredge, G.S., antidiatom activity of Hong Kong sponges, Aquat. Microb. Lobkovsky, E., Clardy, J., Bar rows, L.R., Ireland, C.M., Ecol., 38 (2005) 191-201. Topoisomerase II- Mediated DNA cleavage by Adocia and 21 Muricy, G., Hajdu, E., Araujo, F. V., Hagler, A.N., xestoquinones from the Philippine sponge Xestospongia sp, Antimicrobial screening of southwestern Atlantic shallow- J. Med..Chem., 38 (22) (1995) 4503-4507. water marine sponges (Porifera), SCI.MAR., 57(4) (1993) 30 Orhan, I., ener, B., Kaiser, M., Brun, R., Tasdemir, D., 427-432. Inhibitory Activity of Marine Sponge-Derived Natural 22 Ely, R., Supriya, T., Naik, C. G., Antimicrobial activity of Products against Parasitic Protozoa, Mar. Drugs., 8(1) (2010) marine organisms collected off the coast of South east India, 47–58. Journal of Experimental Marine Biology and Ecology., 309 31 Rao, T.S.P., Sarma, N.S., Murthy, Y.L.N., Kantamreddi, (2004) 121-127. V.S.S.N., Wright, C.W., Parameswaran, P.S., New 23 Lee, O.O., Qian, P.Y., Chemical control of bacterial epibiosis polyhydroxy sterols from the marine sponge Callyspongia and larval settlement of Hydroides elegans in the red sponge fibrosa ( Ridley & Dendy), Tetrahedron Letters 51 (27) Mycale adherens, Biofouling., 19 (2003) 171-180. (2010) 3583 – 3586. 24 Sonia, G.A., Lipton, A.P., Raj, R.P., Lethal concentration of 32 Yu, S., Deng, Z., Proksh, P., Lin, W., Oculatol, oculatolide methanol extract of sponges to the Brine shrimp Artemia and A-norsterols from the sponge Haliclona oculata., J. Nat salina , J. Mar. Biol. Ass. India., 51(1) (2009) 122-125. Prod., 69(9) (2006) 1330-1334. 25 Mayer, A.M.S., Rodriguez, A.D., Berlinck, R.G.S., Hamann, 33 Lopez-Legentil., Erwin, P.M., Henkel, T.P., Loh, T.L., M.T., Marine pharmacology in 2005-2006 : Marine Pawlik, J.R., Phenotypic plasticity in the Carribean sponge compounds with anthelmintic, antibacterial, anticoagulant, Callyspongia vaginalis (Porifera : Haplosclerida), Scientia antifungal, anti-inflammatory, antimalarial, antiprotozoal, Marina., 74 (3) (2010) 445-453.