DOCSLIB.ORG

Phylogenetic Appraisal of the Drug Bearing Marine Sponge, Callyspongia Subarmigera (Ridley, 1884) from South India

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetic Appraisal of the Drug Bearing Marine Sponge, Callyspongia Subarmigera (Ridley, 1884) from South India Indian Journal of Geo-Marine Sciences Vol. 42(1), February 2013, pp. 139-145 Phylogenetic Appraisal of the Drug Bearing Marine Sponge, Callyspongia subarmigera (Ridley, 1884) from South India M. S. Aishwarya*, A. P. Lipton & A. R. Sarika Centre for Marine Science and Technology, Manonmaniam Sundaranar University, Rajakkamangalam-629 502, India * [E-mail: [email protected]] Received 8 February 2011; revised 20 October 2011 Tropical Callyspongia subarmigera prevalent in the south-east coast of India was studied for evaluating the bioactivity and phylogenetic resemblance with other drug-bearing species. Antibacterial screening of the methanol extract of C. subarmigera against clinical and fish pathogens displayed their broad spectrum against Gram positive and Gram negative pathogenic strains. Fish pathogenic bacteria Vibrio pelagius and Vibrio fischeri and the clinical pathogen Pseudomonas aeruginosa were highly susceptible to the methanol extract. Sponge extract had no antifungal property against the two fungal strains tested viz., Aspergillus niger and Candida albicans. Callyspongia subarmigera extract indicated cytotoxic activity with an LC50 of 0.39% against Artermia nauplii in 24 h. PCR protocol was carried out using a 16S rRNA primer and an 18S rRNA primer and the annealing temperature was standardized at 55°C. BLAST analysis was conducted to detect the resemblance of different species of Callyspongia genera of sponges. A phylogenetic tree was constructed using neighbour joining method and the results revealed that C. subarmigera had the nearest homology to that of Haliclona cinerea, Haliclona oculata (88%) and Callyspongia spp (88%) possessing pharmacological relevance. [Keywords: Callyspongia subarmigera, bioactivity, methanol extract, PCR amplification, DNA sequencing, phylogenetic tree] Introduction characters for demosponge classification6. Marine chemo diversity is one of the targets for A molecular approach towards the analysis of genome deriving natural drug products. Many research organization of marine sponges is essential for the resources are being dedicated to this field to fulfill the elucidation of selected genes7. Use of rDNA gene as a ever growing urgency and demand for new phylogenetic marker has made it possible to antibiotics1. Sponges, the simple sessile filter feeding determine the phylogenetic position of populations in invertebrates in particular prove to be mining the the evolutionary tree and to assess their closest genetic repositories of secondary metabolites2 and relative bearing maximum resemblance of gene harbor uniform yet phylogenetically complex sequences. Present investigation is an attempt for microbial signatures3. Strategies of defense molecular information on Callyspongia subarmigera mechanisms or the so called intense competition of that showcases their closest relative possessing sponges against eukaryotic predators, bacteria and similar bioactivities. viruses results in the production of secondary Materials and Methods metabolites4. New bioactive metabolites are obtained The eco-friendly collection of freshly detached from sponges each year than from any other marine sponges, which get entangled in the traditional taxon5. Cytotoxicity in marine-derived extracts fishing nets were accomplished off Cape Comorin surpasses those of terrestrial origin. Traditionally, = Kanyakumari coast (8º 04' lat., 77º 36' E long.), sponge systematics has been based mostly on skeletal Tamil Nadu. A few specimens of C. subarmigera morphology, spicule geometry and diversity. were also collected by SCUBA diving from the same In particular, the shape and size of the large structural location at depths ranging from 10 to 15 m. Sponges spicules or of the small reinforcing or packing obtained were transferred to sterile plastic bags spicules have been used as important taxonomic containing sea water and immediately transported to —————— the laboratory. Sponges were rinsed thoroughly with *Presently: Central Marine Fisheries Research Institute, sterile sea water for the removal of transient bacteria Vizhinjam-695521, Kerala, India or attached algae if any, present on the surface of the 140 INDIAN J. MAR. SCI., VOL. 42, NO. 1, FEBRUARY 2013 sponge tissue. In the laboratory, the sponge was The frozen sponge tissues were cut into thin immediately placed at -80°C (Deep freezer - Voltas) slices and the genomic DNA was extracted using Fast for molecular studies. Sponge tissues required for DNA Spin kit, QIAGEN (Valencia, CA) according to bioactive profile studies were immersed in methanol. the protocol suggested by the manufacturers. Sponge species was identified by Dr. P.A. Thomas, Resulting genomic DNA was used as template to Sponge taxonomist, Thiruvananthapuram (India) by amplify the 18S rRNA gene using two different spicule types, arrangement of spicules and with other primers: the 18S rRNA gene, Forward primer - taxonomic keys. 5' CTGGTGCCAGCAGCCGCGG 3', the Reverse Twenty gram of sponge tissues were immersed for primer - 5' TGGTGCCCTTCCGTCAATTCCT 3.' 12 7 days in 160 mL of methanol. Sponge tissues were and the universal Eubacterial primer: 519F-5' CAG squeezed and the methanol content was condensed CMG CCG CGG TAA TWC-3'and 1406R - 3' ACG under reduced pressure using rotary vacuum GGC GGT GTG TRC - 5' 13. A high fidelity Taq evaporator (Buchi type) and further filtered using Polymerase (XT05, SIGMA) was used for the Master 0.22 µm bacterial syringe filter (HiMedia, India). mix preparations and the amplification was carried Methanol extract was dried and concentrated to a out using a Gradient PCR (ASTEC, Japan). PCR semi solid extract and stored in refrigerator for cycling conditions using the two primers were further use. The extract diluted with normal saline standardized as follows: Initial denaturation: (5mins, (0.85% NaCl) at different dilutions was screened 94°C), 30 cycles of denaturation (1 min, 94°C), for its antibacterial activity against four clinical primer annealing (1 min, 55°C), elongation (5 mins, pathogens and four fish pathogens viz., 72°C) and the final extension (5 min, 72°C). Staphylococcus aureus, Pseudomonas aeruginosa, Amplicon was viewed on a 1.0% agarose gel along Bacillus subtilis, Proteus mirabilis, Vibrio harveyi, with a DNA ladder (GENEI, India) of 500 bp size. V. alginolyticus, V. Pelagius and V. fischeri Bands of approximately 500 bp were eluted and maintained as axenic stock culture in the laboratory. recovered using a gel extraction kit (QIAGEN) Twenty microlitre of the filtered culture taken at three according to the manufacturer’s protocol. Purified different dilutions (0.1, 1 and 10%) corresponding to DNA was viewed along with a DNA ladder of 100 bp -1 0.02, 0.2 and 2.0 mg disc were dispensed onto the size. PCR product using the former primer sterile discs (Hi-Media) placed on the Mueller Hinton (18S rRNA primer) corresponded to less than 100 bp, 6-7 agar plates seeded with bacteria (10 CFU/mL) in while the product of the latter (16S rRNA) Petri dishes. Discs loaded with normal saline was corresponded to nearly 500 bp. used as the negative control and disc impregnated Sequencing of only the latter sample corresponding with chloramphenicol (30 mcg/disc-Hi-Media) used to 500 bp was performed, using an ABI 3100 as positive control. Triplicates were maintained for automated sequencer. Sequenced result was correlated each bacterial strain. Zone of inhibition was measured to those in databases deposited in GenBank using after 24 h following the standard disc diffusion 8 the Basic Local Alignment Search Tool (BLAST - method . Inhibition zones of the commercial National Centre for Biotechnology Information antibiotic was used as references. A standard agar 9 (http://www.ncbi.nlm.nih.gov) and the sequences with well diffusion method as reported earlier was also high degree of similarity were identified. Multiple carried out using the same dilutions to implicit the alignment of the 18S rRNA gene sequence of antifungal potentiality of the methanol extract of C. subarmigera were compiled manually with related C. subarmigera against Aspergillus niger sequences with high similarity using CLUSTAL W and Candida albicans. Standard drug fluconazole (1.83). Phylogenetic tree was constructed using (30 µg/disc) was used for comparing the results. the neighbour-joining algorithm (Jukes and Cantor The crude methanol extract of Callyspongia distance) and the sequences were estimated based subarmigera at different dilutions ranging from 0.1% on pair-wise genetic distances on the basis of to 1.0% was tested for cytotoxic effect using freshly 10 all substitutions with the least distance pair of hatched nauplii of Artemia salina as described earlier . sequences parameter. LC50 value of the extract was determined using the Probit scale11 based on their percentage of mortality, Results which forms a befitting statistical method for toxicity The sponge of interest was taxonomically data analysis. identified as Callyspongia subarmigera (Plate 1). AISHWARYA et al.: PHYLOGENETIC APPRAISAL OF THE DRUG BEARING MARINE SPONGE 141 The colour of the sponge ranged from yellow when inhibition for the former and 12 mm for the latter. freshly collected to pale yellow when dry. Surface of Extract inhibited the clinical pathogens such as branches was beset with conical projections Pseudomonas aeruginosa (12 mm) and Stapylococcus and oscules seemed scattered at few places. Siliceous aureus (9 mm) at 10% level. Gram positive B. subtilis spicules degraded with nitric acid had the size ranging had low zone of
Load more

Recommended publications
  • Taxonomy and Diversity of the Sponge Fauna from Walters Shoal, a Shallow Seamount in the Western Indian Ocean Region
    Taxonomy and diversity of the sponge fauna from Walters Shoal, a shallow seamount in the Western Indian Ocean region By Robyn Pauline Payne A thesis submitted in partial fulfilment of the requirements for the degree of Magister Scientiae in the Department of Biodiversity and Conservation Biology, University of the Western Cape. Supervisors: Dr Toufiek Samaai Prof. Mark J. Gibbons Dr Wayne K. Florence The financial assistance of the National Research Foundation (NRF) towards this research is hereby acknowledged. Opinions expressed and conclusions arrived at, are those of the author and are not necessarily to be attributed to the NRF. December 2015 Taxonomy and diversity of the sponge fauna from Walters Shoal, a shallow seamount in the Western Indian Ocean region Robyn Pauline Payne Keywords Indian Ocean Seamount Walters Shoal Sponges Taxonomy Systematics Diversity Biogeography ii Abstract Taxonomy and diversity of the sponge fauna from Walters Shoal, a shallow seamount in the Western Indian Ocean region R. P. Payne MSc Thesis, Department of Biodiversity and Conservation Biology, University of the Western Cape. Seamounts are poorly understood ubiquitous undersea features, with less than 4% sampled for scientific purposes globally. Consequently, the fauna associated with seamounts in the Indian Ocean remains largely unknown, with less than 300 species recorded. One such feature within this region is Walters Shoal, a shallow seamount located on the South Madagascar Ridge, which is situated approximately 400 nautical miles south of Madagascar and 600 nautical miles east of South Africa. Even though it penetrates the euphotic zone (summit is 15 m below the sea surface) and is protected by the Southern Indian Ocean Deep- Sea Fishers Association, there is a paucity of biodiversity and oceanographic data.
    [Show full text]
  • Examples of Sea Sponges
    Examples Of Sea Sponges Startling Amadeus burlesques her snobbishness so fully that Vaughan structured very cognisably. Freddy is ectypal and stenciling unsocially while epithelial Zippy forces and inflict. Monopolistic Porter sailplanes her honeymooners so incorruptibly that Sutton recirculates very thereon. True only on water leaves, sea of these are animals Yellow like Sponge Oceana. Deeper dives into different aspects of these glassy skeletons are ongoing according to. Sponges theoutershores. Cell types epidermal cells form outer covering amoeboid cells wander around make spicules. Check how These Beautiful Pictures of Different Types of. To be optimal for bathing, increasing with examples of brooding forms tan ct et al ratios derived from other microscopic plants from synthetic sponges belong to the university. What is those natural marine sponge? Different types of sponges come under different price points and loss different uses in. Global Diversity of Sponges Porifera NCBI NIH. Sponges EnchantedLearningcom. They publish the outer shape of rubber sponge 1 Some examples of sponges are Sea SpongeTube SpongeVase Sponge or Sponge Painted. Learn facts about the Porifera or Sea Sponges with our this Easy mountain for Kids. What claim a course Sponge Acme Sponge Company. BG Silicon isotopes of this sea sponges new insights into. Sponges come across an incredible summary of colors and an amazing array of shapes. 5 Fascinating Types of what Sponge Leisure Pro. Sea sponges often a tube-like bodies with his tiny pores. Sponges The World's Simplest Multi-Cellular Creatures. Sponges are food of various nudbranchs sea stars and fish. Examples of sponges Answers Answerscom. Sponges info and games Sheppard Software.
    [Show full text]
  • Checklist of Sponges (Porifera) of the South China Sea Region
    Micronesica 35-36:100-120. 2003 Taxonomic inventory of the sponges (Porifera) of the Mariana Islands MICHELLE KELLY National Institute of Water & Atmospheric Research (NIWA) Ltd Private Bag 109-695 Newmarket, Auckland, New Zealand JOHN HOOPER Queensland Museum P.O. Box 3300 South Brisbane, Queensland 4101, Australia VALERIE PAUL1 AND GUSTAV PAULAY2 Marine Laboratory University of Guam Mangilao, Guam 96923 USA ROB VAN SOEST AND WALLIE DE WEERDT Institute for Biodiversity and Ecosystem Dynamics Zoologisch Museum University of Amsterdam P. O. Box 94766, 1090 GT Amsterdam, The Netherlands Abstract—We review the sponge fauna of the Mariana Islands based on new and existing collections, and literature records. 124 species of siliceous sponges (Class Demospongiae) and 4 species of calcareous sponges (Class Calcarea) have been identified to date, representing 73 genera, 44 families, within 16 orders. Several species are adventive. Approximately 30% (40) of the species encountered are undescribed, but not all are endemics, as the authors know them from other locations. Approximately 30% (38) of the species are known from diverse locations within the Indo West Pacific, but several well-known, widespread species are absent. The actual diversity of sponge fauna of the Marianas is considerably higher, as many species, especially cryptic and encrusting taxa, remain to be collected and studied. Introduction Our knowledge of the sponge fauna of the tropical Pacific has increased substantially in recent years, as a result of enhanced collecting effort driven in 1 current address: Smithsonian Marine Station at Fort Pierce, Fort Pierce FL 34949 2 corresponding author; current address: Florida Museum of Natural History, University of Florida, Gainesville FL 32611-7800, USA; email: [email protected] Kelly et al.: Sponges of the Marianas 101 part by pharmaceutical interests, and by the attention of a larger number of systematists working on Pacific sponges than ever before.
    [Show full text]
  • Mesophotic Sponges of the Genus Callyspongia (Demospongiae, Haplosclerida) from Cuba, with the Description of Two New Species
    Zootaxa 4466 (1): 078–094 ISSN 1175-5326 (print edition) http://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2018 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4466.1.9 http://zoobank.org/urn:lsid:zoobank.org:pub:90E00F08-4096-4926-8034-4B8A93048EF3 Mesophotic sponges of the genus Callyspongia (Demospongiae, Haplosclerida) from Cuba, with the description of two new species LINNET BUSUTIL1, MARÍA R. GARCÍA-HERNÁNDEZ2, M. CRISTINA DÍAZ3 & SHIRLEY A. POMPONI3 1Instituto de Ciencias del Mar, Playa, Havana, Cuba. E-mail: [email protected] 2Centro Nacional de Áreas Protegidas, Playa, Havana, Cuba. 3Harbor Branch Oceanographic Institute, Florida Atlantic University, 5600 US 1 North, Fort Pierce, FL 34946, USA. Abstract This study presents the description of two Callyspongia species new to science, and the distribution of all Callyspongia species recorded during the first joint Cuba–U.S. expedition to characterize Cuban mesophotic coral ecosystems (May– June 2017). Additionally, we propose a key to identify thin branching species of the genus in the Greater Caribbean. The observations here presented are the result of underwater explorations with the Mohawk Remotely Operated Vehicle dives at 35 sites around the island, at depths of 25–188 m, recording images and videos, and collecting specimens. The depth range of five species of Callyspongia, reported before in Cuba, has been extended to deeper waters. Two specimens of branching Callyspongia were collected and described: Callyspongia (Callyspongia) pedroi sp. nov. and Callyspongia (Cladochalina) alcoladoi sp. nov. Morphometric comparisons of external and skeletal traits show clear differences with the other Callyspongia species from the Central West Atlantic with a similar thin branching habit.
    [Show full text]
  • Novel Extracts from Callyspongia Siphonella and Negombata Magnifica Sponges from the Red Sea, Induced Antiproliferative and Proa
    Egyptian Journal of Aquatic Biology & Fisheries Zoology Department, Faculty of Science, Ain Shams University, Cairo, Egypt. ISSN 1110 – 6131 Vol. 24(7): 319 – 347 (2020) www.ejabf.journals.ekb.eg Novel extracts from Callyspongia siphonella and Negombata magnifica sponges from the Red Sea, induced antiproliferative and proapoptotic activity in HepG-2, MCF-7, and Caco-2 cancer cell lines Islam Rady1,2*, Mansour A.E. Bashar1 1. Zoology Department, Faculty of Science, Al-Azhar University, Cairo, Egypt. 2. Masonic Cancer Center, University of Minnesota, Minnesota, Minnesota, USA. * Corresponding Author: [email protected] _______________________________________________________________________________ ARTICLE INFO ABSTRACT Article History: Marine organisms derived extracts have been shown to exert multiple anti- Received: Sept. 21, 2020 cancer activities. Two marine sponge species; finger-sponge ―Negombata Accepted: Oct. 24, 2020 magnifica (Nm)‖ and tube-sponge ―Callyspongia siphonella (Cs)‖ were Online: Nov. 1, 2020 collected during summer 2020 from the Gulf of Aqaba (Red Sea, Egypt). Each _______________ sponge macerated with methylene chloride (CH2Cl2), ethyl acetate (C4H8O2), acetone (C H O), and chloroform (CHCl₃) separately into four different crude Keywords: 3 6 extracts for each sponge species and eight extracts as a total for both marine Sponges; species, where each extract was in vitro assessed for its antiproliferative and Callyspongia siphonella; proapoptotic activity in HepG-2, MCF7, and Caco-2 cancer cell lines. Cs- Negombata magnifica; CH Cl , Cs-C H O , Cs-C H O, Cs-CHCl , Nm-CH Cl , Nm-C H O , Nm- Red Sea; 2 2 4 8 2 3 6 3 2 2 4 8 2 C H O, and Nm-CHCl , each in a dose-dependent manner inhibited the growth Anticancer; 3 6 3 of HepG2 cancer cells within IC values 17.53, 11.18, 9.97, 19.21, 9.14, 10.94, Antiproliferation; 50 8.78, and 7.23 μg/ml, respectively, MCF-7 cancer cells within IC values of Apoptosis.
    [Show full text]
  • Demosponge Distribution in the Eastern Mediterranean: a NW–SE Gradient
    Helgol Mar Res (2005) 59: 237–251 DOI 10.1007/s10152-005-0224-8 ORIGINAL ARTICLE Eleni Voultsiadou Demosponge distribution in the eastern Mediterranean: a NW–SE gradient Received: 25 October 2004 / Accepted: 26 April 2005 / Published online: 22 June 2005 Ó Springer-Verlag and AWI 2005 Abstract The purpose of this paper was to investigate total number of species was an exponential negative patterns of demosponge distribution along gradients of function of depth. environmental conditions in the biogeographical subz- ones of the eastern Mediterranean (Aegean and Levan- Keywords Demosponges Æ Distribution Æ Faunal tine Sea). The Aegean Sea was divided into six major affinities Æ Mediterranean Sea Æ Aegean Sea Æ areas on the basis of its geomorphology and bathymetry. Levantine Sea Two areas of the Levantine Sea were additionally con- sidered. All available data on demosponge species numbers and abundance in each area, as well as their Introduction vertical and general geographical distribution were ta- ken from the literature. Multivariate analysis revealed a It is generally accepted that the Mediterranean Sea is NW–SE faunal gradient, showing an apparent dissimi- one of the world’s most oligotrophic seas. Conspicu- larity among the North Aegean, the South Aegean and ously, it harbors somewhat between 4% and 18% of the the Levantine Sea, which agrees with the differences in known world marine species, while representing only the geographical, physicochemical and biological char- 0.82% in surface area and 0.32% in volume of the world acteristics of the three areas. The majority of demo- ocean (Bianchi and Morri 2000). The eastern Mediter- sponge species has been recorded in the North Aegean, ranean, and especially the Levantine basin, is considered while the South Aegean is closer, in terms of demo- as the most oligotrophic Mediterranean region, having a sponge diversity, to the oligotrophic Levantine Sea.
    [Show full text]
  • Callyspongia Crassa and C. Siphonella (Porifera, Callyspongiidae) As a Potential Source for Medical Bioactive Substances, Aqaba Gulf, Red Sea, Egypt Hassan A
    Ibrahim et al. The Journal of Basic and Applied Zoology (2017) 78:7 The Journal of Basic DOI 10.1186/s41936-017-0011-5 and Applied Zoology RESEARCH Open Access Callyspongia crassa and C. siphonella (Porifera, Callyspongiidae) as a potential source for medical bioactive substances, Aqaba Gulf, Red Sea, Egypt Hassan A. H. Ibrahim1, Hussein A. El-Naggar2*, Khalied A. El-Damhougy2, Mansour A. E. Bashar2 and Fekry M. Abou Senna2 Abstract Background: Sponges are champion of bioactive producers because of the variety of products that have been found from them. Most bioactive compounds extracted from sponges were classified into antibiotic, antiviral, antitumor, and anti-inflammatory. Tow marine sponge species were collected during winter 2016 from Gulf of Aqaba, Red Sea, Egypt viz., Callyspongia crassa and Callyspongia siphonella. The collected sponge species belong to family Callyspongiidae. The sponge samples were extracted by ethanol and investigated as a promising source of natural products which can be used as antitumor, antiviral, and antimicrobial, antioxidant, and anti-inflammatory agents. Results: Results revealed that the crude extract of C. siphonella showed high antitumor activity with value of 5.57 and 1.39 μg/ml as IC50 against colon cancer (caco-2) and breast cancer (Mcf-7) on cell line, respectively. Also the C. crassa extract showed high cytotoxic effect to Vero cell with HAV (hepatitis A virus), which exhibits that MIC was 9.765 μg/ml, the most effective extract was of C. crassa against Escherichia coli, Pseudomonas aeruginosa,andCandida albicans. Also, ethanolic crude of C. siphonella showed positive antibacterial activity against P. aueroginosa.
    [Show full text]
  • Especies De Esponjas Marinas Conocidas Para La Isla Hispaniola
    Julio, 2012. No. 5 NOVITATES CARIBAEA 5: 81-94, 2012 81 ESPECIES DE ESPONJAS MARINAS CONOCIDAS PARA LA ISLA HISPANIOLA Alejandro Herrera-Moreno1, Liliana Betancourt1 y Pedro M. Alcolado2 1 Programa EcoMar, Inc. Sarasota 121, Bella Vista, Santo Domingo, República Dominicana 2Instituto de Oceanología. Ave. 1ra. 18406, Reparto Flores, Playa, La Habana, Cuba RESUMEN Se ofrece una cronología histórica de las investigaciones sobre las esponjas de la Isla Hispaniola desde 1864 al presente. La información proviene de los resultados de expediciones y proyectos nacionales e internacionales en más de 20 localidades dominicanas y haitianas, colecciones de cinco museos que albergan 41 especies, y más de 40 publicaciones taxonómicas y ecológicas. De este análisis, se conocen ahora 138 especies de esponjas para Hispaniola: 127 para República Dominicana (lo cual añade unas 102 especies al último inventario nacional), 63 especies para Haití y una especie sin especificar el país. Seis especies, Axinella corrugata, Pseudotrachya amaza, Polymastia tenax, Xestospongia dominicana, Prosuberites psammophilus y Ecionemia dominicana, tienen como tipo una localidad dominicana. Las especies compiladas son representativas de los ecosistemas de manglares, sustratos particulados con macrovegetación y/o pastos marinos y arrecifes coralinos desde la orilla hasta aproximadamente 40 m de profundidad. Palabras clave: biodiversidad marina, esponjas marinas, Hispaniola. Tittle: Marine sponges from Hispaniola Island. ABSTRACT A historical chronology of research reports on Hispaniola sponges, since 1864 until now is presented. Information comes from results of national and international expeditions and projects in more than 20 Dominican and Haitian localities, collections of five museums that harbor 41 species, and more than 40 taxonomic and ecological publications.
    [Show full text]
  • Diversity and Abundance of Intertidal Zone Sponges on Rocky Shores of Southern NSW, Australia: Patterns of Distribution, Environ
    University of Wollongong Research Online University of Wollongong Thesis Collection 2017+ University of Wollongong Thesis Collections 2019 Diversity and abundance of intertidal zone sponges on rocky shores of southern NSW, Australia: patterns of distribution, environmental impacts and ecological interactions Caroline Cordonis Borges da Silva UnivFollowersity this of and Wollongong additional works at: https://ro.uow.edu.au/theses1 University of Wollongong Copyright Warning You may print or download ONE copy of this document for the purpose of your own research or study. The University does not authorise you to copy, communicate or otherwise make available electronically to any other person any copyright material contained on this site. You are reminded of the following: This work is copyright. Apart from any use permitted under the Copyright Act 1968, no part of this work may be reproduced by any process, nor may any other exclusive right be exercised, without the permission of the author. Copyright owners are entitled to take legal action against persons who infringe their copyright. A reproduction of material that is protected by copyright may be a copyright infringement. A court may impose penalties and award damages in relation to offences and infringements relating to copyright material. Higher penalties may apply, and higher damages may be awarded, for offences and infringements involving the conversion of material into digital or electronic form. Unless otherwise indicated, the views expressed in this thesis are those of the author and do not necessarily represent the views of the University of Wollongong. Recommended Citation Borges da Silva, Caroline Cordonis, Diversity and abundance of intertidal zone sponges on rocky shores of southern NSW, Australia: patterns of distribution, environmental impacts and ecological interactions, Doctor of Philosophy thesis, School of Earth, Atmospheric and Life Sciences, University of Wollongong, 2019.
    [Show full text]
  • Global Diversity of Sponges (Porifera)
    OPEN 3 ACCESS Freely available online tlos one Review Global Diversity of Sponges (Porifera) Rob W. M. Van Soest1*, Nicole Boury-Esnault2, Jean Vacelet2, Martin Dohrmann3, Dirk Erpenbeck4, Nicole J. De Voogd1, Nadiezhda Santodomingo5, Bart Vanhoorne6, Michelle Kelly7, John N. 8A. Hooper 1 Netherlands Centre for Biodiversity Naturalis, Leiden, The Netherlands, 2 Aix-Marseille University, Centre d'Océanologie de Marseille, CNRS, DIMAR, UMR 6540, Marseille, France, 3 Department of Invertebrate Zoology, National Museum of Natural History, Smithsonian Institution, Washington, D.C., United States of America, 4 Department of Earth- and Environmental Sciences & GeoBio-Center LMU, Ludwig-Maximilians-University Munich, Munich, Germany, 5 Paleontology Department, Natural History Museum, London, United Kingdom, 6 Flanders Marine Institute - VLIZ, Innovocean Site, Oostende, Belgium, 7 National Centre for Aquatic Biodiversity & Biosecurity, National Institute of Water and Atmospheric Research Ltd, Auckland, New Zealand, 8 Queensland Museum, South Brisbane, Queensland, and Eskitis Institute for Cell & Molecular Therapies, Griffiths University, Queensland, Australia These chambers have a lining of flagella-bearing cells (choano­ Abstract: With the completion of a single unified cytes, Fig. 1C) that generate the water currents necessary for the classification, the Systema Porifera (SP) and subsequent unique filtering activity characteristic to sponges. An exception to development of an online species database, the World this is in the so-called carnivorous sponges, highly adapted deep- Porifera Database (WPD), we are now equipped to provide sea forms, in which the aquiferous system is non-existent, but a first comprehensive picture of the global biodiversity of which have a sticky outer surface with which small prey animals the Porifera.
    [Show full text]
  • Phenotypic Plasticity in the Caribbean Sponge Callyspongia Vaginalis (Porifera: Haplosclerida)
    SCIENTIA MARINA 74(3) September 2010, 445-453, Barcelona (Spain) ISSN: 0214-8358 doi: 10.3989/scimar.2010.74n3445 Phenotypic plasticity in the Caribbean sponge Callyspongia vaginalis (Porifera: Haplosclerida) SUSANNA LÓPEZ-LEGENTIL 1,2, PATRICK M. ERWIN 1, TIMOTHY P. HENKEL 1, TSE-LYNN LOH 1 and JOSEPH R. PAWLIK 1 1 Center for Marine Science, University of North Carolina Wilmington. 5600 Marvin K. Moss Lane, Wilmington NC 28409, USA. E-mail: [email protected] 2 Current Address: Department of Animal Biology (Invertebrates), Faculty of Biology, University of Barcelona, 645 Diagonal Avenue, 08028 Barcelona, Spain. SUMMARY: Sponge morphological plasticity has been a long-standing source of taxonomic difficulty. In the Caribbean, several morphotypes of the sponge Callyspongia vaginalis have been observed. To determine the taxonomic status of three of these morphotypes and their relationship with the congeneric species C. plicifera and C. fallax, we compared the spicule composition, spongin fiber skeleton and sequenced fragments of the mitochondrial genes 16S and COI and nuclear genes 28S and 18S ribosomal RNA. Phylogenetic analyses with ribosomal markers 18S and 28S rRNA confirmed the position of our sequences within the Callyspongiidae. None of the genetic markers provided evidence for consistent differentiation among the three morphotypes of C. vaginalis and C. fallax, and only C. plicifera stood as a distinct species. The 16S mtDNA gene was the most variable molecular marker for this group, presenting a nucleotide variability (/ = 0.024) higher than that reported for COI. Unlike recent studies for other sponge genera, our results indicate that species in the genus Callyspongia maintain a high degree of phenotypic plasticity, and that morphological characteristics may not reflect reproductive boundaries in C.
    [Show full text]
  • Phylum Porifera
    www.nature.com/scientificreports OPEN Development of a multilocus- based approach for sponge (phylum Porifera) identification: refinement Received: 01 September 2016 Accepted: 19 December 2016 and limitations Published: 02 February 2017 Qi Yang1,2, Christopher M. M. Franco1,2, Shirley J. Sorokin1,2,3 & Wei Zhang1,2,4 For sponges (phylum Porifera), there is no reliable molecular protocol available for species identification. To address this gap, we developed a multilocus-based Sponge Identification Protocol (SIP) validated by a sample of 37 sponge species belonging to 10 orders from South Australia. The universal barcode COI mtDNA, 28S rRNA gene (D3–D5), and the nuclear ITS1-5.8S-ITS2 region were evaluated for their suitability and capacity for sponge identification. The highest Bit Score was applied to infer the identity. The reliability of SIP was validated by phylogenetic analysis. The 28S rRNA gene and COI mtDNA performed better than the ITS region in classifying sponges at various taxonomic levels. A major limitation is that the databases are not well populated and possess low diversity, making it difficult to conduct the molecular identification protocol. The identification is also impacted by the accuracy of the morphological classification of the sponges whose sequences have been submitted to the database. Re-examination of the morphological identification further demonstrated and improved the reliability of sponge identification by SIP. Integrated with morphological identification, the multilocus-based SIP offers an improved protocol for more reliable and effective sponge identification, by coupling the accuracy of different DNA markers. Sponges (phylum Porifera), the evolutionary oldest multicellular animals, are sessile, benthic filter-feeders1.
    [Show full text]