Indian Journal of Geo-Marine Sciences Vol. 42(1), February 2013, pp. 139-145 Phylogenetic Appraisal of the Drug Bearing Marine Sponge, Callyspongia subarmigera (Ridley, 1884) from South India M. S. Aishwarya*, A. P. Lipton & A. R. Sarika Centre for Marine Science and Technology, Manonmaniam Sundaranar University, Rajakkamangalam-629 502, India * [E-mail: [email protected]] Received 8 February 2011; revised 20 October 2011 Tropical Callyspongia subarmigera prevalent in the south-east coast of India was studied for evaluating the bioactivity and phylogenetic resemblance with other drug-bearing species. Antibacterial screening of the methanol extract of C. subarmigera against clinical and fish pathogens displayed their broad spectrum against Gram positive and Gram negative pathogenic strains. Fish pathogenic bacteria Vibrio pelagius and Vibrio fischeri and the clinical pathogen Pseudomonas aeruginosa were highly susceptible to the methanol extract. Sponge extract had no antifungal property against the two fungal strains tested viz., Aspergillus niger and Candida albicans. Callyspongia subarmigera extract indicated cytotoxic activity with an LC50 of 0.39% against Artermia nauplii in 24 h. PCR protocol was carried out using a 16S rRNA primer and an 18S rRNA primer and the annealing temperature was standardized at 55°C. BLAST analysis was conducted to detect the resemblance of different species of Callyspongia genera of sponges. A phylogenetic tree was constructed using neighbour joining method and the results revealed that C. subarmigera had the nearest homology to that of Haliclona cinerea, Haliclona oculata (88%) and Callyspongia spp (88%) possessing pharmacological relevance. [Keywords: Callyspongia subarmigera, bioactivity, methanol extract, PCR amplification, DNA sequencing, phylogenetic tree] Introduction characters for demosponge classification6. Marine chemo diversity is one of the targets for A molecular approach towards the analysis of genome deriving natural drug products. Many research organization of marine sponges is essential for the resources are being dedicated to this field to fulfill the elucidation of selected genes7. Use of rDNA gene as a ever growing urgency and demand for new phylogenetic marker has made it possible to antibiotics1. Sponges, the simple sessile filter feeding determine the phylogenetic position of populations in invertebrates in particular prove to be mining the the evolutionary tree and to assess their closest genetic repositories of secondary metabolites2 and relative bearing maximum resemblance of gene harbor uniform yet phylogenetically complex sequences. Present investigation is an attempt for microbial signatures3. Strategies of defense molecular information on Callyspongia subarmigera mechanisms or the so called intense competition of that showcases their closest relative possessing sponges against eukaryotic predators, bacteria and similar bioactivities. viruses results in the production of secondary Materials and Methods metabolites4. New bioactive metabolites are obtained The eco-friendly collection of freshly detached from sponges each year than from any other marine sponges, which get entangled in the traditional taxon5. Cytotoxicity in marine-derived extracts fishing nets were accomplished off Cape Comorin surpasses those of terrestrial origin. Traditionally, = Kanyakumari coast (8º 04' lat., 77º 36' E long.), sponge systematics has been based mostly on skeletal Tamil Nadu. A few specimens of C. subarmigera morphology, spicule geometry and diversity. were also collected by SCUBA diving from the same In particular, the shape and size of the large structural location at depths ranging from 10 to 15 m. Sponges spicules or of the small reinforcing or packing obtained were transferred to sterile plastic bags spicules have been used as important taxonomic containing sea water and immediately transported to —————— the laboratory. Sponges were rinsed thoroughly with *Presently: Central Marine Fisheries Research Institute, sterile sea water for the removal of transient bacteria Vizhinjam-695521, Kerala, India or attached algae if any, present on the surface of the 140 INDIAN J. MAR. SCI., VOL. 42, NO. 1, FEBRUARY 2013 sponge tissue. In the laboratory, the sponge was The frozen sponge tissues were cut into thin immediately placed at -80°C (Deep freezer - Voltas) slices and the genomic DNA was extracted using Fast for molecular studies. Sponge tissues required for DNA Spin kit, QIAGEN (Valencia, CA) according to bioactive profile studies were immersed in methanol. the protocol suggested by the manufacturers. Sponge species was identified by Dr. P.A. Thomas, Resulting genomic DNA was used as template to Sponge taxonomist, Thiruvananthapuram (India) by amplify the 18S rRNA gene using two different spicule types, arrangement of spicules and with other primers: the 18S rRNA gene, Forward primer - taxonomic keys. 5' CTGGTGCCAGCAGCCGCGG 3', the Reverse Twenty gram of sponge tissues were immersed for primer - 5' TGGTGCCCTTCCGTCAATTCCT 3.' 12 7 days in 160 mL of methanol. Sponge tissues were and the universal Eubacterial primer: 519F-5' CAG squeezed and the methanol content was condensed CMG CCG CGG TAA TWC-3'and 1406R - 3' ACG under reduced pressure using rotary vacuum GGC GGT GTG TRC - 5' 13. A high fidelity Taq evaporator (Buchi type) and further filtered using Polymerase (XT05, SIGMA) was used for the Master 0.22 µm bacterial syringe filter (HiMedia, India). mix preparations and the amplification was carried Methanol extract was dried and concentrated to a out using a Gradient PCR (ASTEC, Japan). PCR semi solid extract and stored in refrigerator for cycling conditions using the two primers were further use. The extract diluted with normal saline standardized as follows: Initial denaturation: (5mins, (0.85% NaCl) at different dilutions was screened 94°C), 30 cycles of denaturation (1 min, 94°C), for its antibacterial activity against four clinical primer annealing (1 min, 55°C), elongation (5 mins, pathogens and four fish pathogens viz., 72°C) and the final extension (5 min, 72°C). Staphylococcus aureus, Pseudomonas aeruginosa, Amplicon was viewed on a 1.0% agarose gel along Bacillus subtilis, Proteus mirabilis, Vibrio harveyi, with a DNA ladder (GENEI, India) of 500 bp size. V. alginolyticus, V. Pelagius and V. fischeri Bands of approximately 500 bp were eluted and maintained as axenic stock culture in the laboratory. recovered using a gel extraction kit (QIAGEN) Twenty microlitre of the filtered culture taken at three according to the manufacturer’s protocol. Purified different dilutions (0.1, 1 and 10%) corresponding to DNA was viewed along with a DNA ladder of 100 bp -1 0.02, 0.2 and 2.0 mg disc were dispensed onto the size. PCR product using the former primer sterile discs (Hi-Media) placed on the Mueller Hinton (18S rRNA primer) corresponded to less than 100 bp, 6-7 agar plates seeded with bacteria (10 CFU/mL) in while the product of the latter (16S rRNA) Petri dishes. Discs loaded with normal saline was corresponded to nearly 500 bp. used as the negative control and disc impregnated Sequencing of only the latter sample corresponding with chloramphenicol (30 mcg/disc-Hi-Media) used to 500 bp was performed, using an ABI 3100 as positive control. Triplicates were maintained for automated sequencer. Sequenced result was correlated each bacterial strain. Zone of inhibition was measured to those in databases deposited in GenBank using after 24 h following the standard disc diffusion 8 the Basic Local Alignment Search Tool (BLAST - method . Inhibition zones of the commercial National Centre for Biotechnology Information antibiotic was used as references. A standard agar 9 (http://www.ncbi.nlm.nih.gov) and the sequences with well diffusion method as reported earlier was also high degree of similarity were identified. Multiple carried out using the same dilutions to implicit the alignment of the 18S rRNA gene sequence of antifungal potentiality of the methanol extract of C. subarmigera were compiled manually with related C. subarmigera against Aspergillus niger sequences with high similarity using CLUSTAL W and Candida albicans. Standard drug fluconazole (1.83). Phylogenetic tree was constructed using (30 µg/disc) was used for comparing the results. the neighbour-joining algorithm (Jukes and Cantor The crude methanol extract of Callyspongia distance) and the sequences were estimated based subarmigera at different dilutions ranging from 0.1% on pair-wise genetic distances on the basis of to 1.0% was tested for cytotoxic effect using freshly 10 all substitutions with the least distance pair of hatched nauplii of Artemia salina as described earlier . sequences parameter. LC50 value of the extract was determined using the Probit scale11 based on their percentage of mortality, Results which forms a befitting statistical method for toxicity The sponge of interest was taxonomically data analysis. identified as Callyspongia subarmigera (Plate 1). AISHWARYA et al.: PHYLOGENETIC APPRAISAL OF THE DRUG BEARING MARINE SPONGE 141 The colour of the sponge ranged from yellow when inhibition for the former and 12 mm for the latter. freshly collected to pale yellow when dry. Surface of Extract inhibited the clinical pathogens such as branches was beset with conical projections Pseudomonas aeruginosa (12 mm) and Stapylococcus and oscules seemed scattered at few places. Siliceous aureus (9 mm) at 10% level. Gram positive B. subtilis spicules degraded with nitric acid had the size ranging had low zone of