DOCSLIB.ORG

Wo 2014/204727 Al 24 December 2014 (24.12.2014) W POIPGT

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Wo 2014/204727 Al 24 December 2014 (24.12.2014) W POIPGT (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization "llllllllllllllllllllllllllllllllllllllllllim International Bureau (10) International Publication Number (43) International Publication Date wo 2014/204727 Al 24 December 2014 (24.12.2014) W_POIPGT (51) International Patent Classification: Ella Nicole [uszus]; 22 Fairbanks Street, Apt. 3, Brook! C12N15/63 (2006.01) C12N15/10 (2006.01) ine, MA 02446 (US). (طC12N9/22 (06.01 (74) Agents: KOWALSKI，Thomas，J. et al.; Vedder Price (21) International Application Number: P.C., 1633 Broadway, New York, NY 10019 (US). PCT/US2O14/O418O6 (81) Designated States (unless otherwise indicated, for every 1١ Mj١ ١لىح ٠national protection available)'. KE١لInternational Filing Date: kind 0 (22) 10 June 2014 (10.06.2014) AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA: CH, CL, CN, CO: CR, cu: cz, DE, DK, DM: (25) Filing Language: English DO, DZ; EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT (26) Publication Language: English HN: HR: HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR: KZ, LA: LC; LK, LR, LS, LT, LU, LY, 1, MD, ME: (30) Priority Data: MG, MK, MN, MW, MX, MY, MZ, NA, NG, N1, NO, NZ: 61/836；123 17 June2013 (17.06.2013) US OM: PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW: SA: :US SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM ؛September2O13 (25.09 2013 25 61/960,777 PCT/US2O13/O748ÓO TN, TR, TT, TZ, UA, UG, US, uz, VC, 1, ZA, ZM: 12 December2013 (12.12.2013) US zw. US ؛2014 04 15ًا April 2014 15 61/995,636 (84) Designated States (unless otherwise indicated, for every ٠I١d١ .'(Applicants: THE BROAD INSTITUTE INC. [US/US]; kind of regional protection available (71) ؛¿Cambridge Center, Cambridge, MA 02142 (US). MA 7 GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, sz, TZ, SACHUSETTS INSTITUTE OF TECHNOLOGY UG, ZM, ZW), Eurasian (AM, AZ, BY, KG: KZ, RU, TJ: :European (AL, AT, BE, BG, CH, CY, cz, DE, DK，US/US]; 77 Massachusetts Ave., Cambridge, MA 02142 TM١] ;FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV ؛EE, ES, FI ٠(US) MC, MK, MT, NL, NO, PL, PT, RO, RS: SE, SI, SK, SM: (72) Inventors; and (71) Applicants : ZHANG，Feng [US/US]; 100 Pacific Street, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW ， Apt. 11, Cambridge, MA 02139 (US). SHALEM, Ophir KM, ML MR, NE，SN，TD, TG). [US/US]; 117 West Concord Street, Boston, MA 02118 Published: ^US). SANJANA，Neville，Espi [US/US]; 2a Union Ter- ((Cambridge, MA 02142 (US). DOENCH, John — with international search report (Art. 21 (3 ؛race [us)us]; c/o Massachusetts bistitute Of Techology，77 the time limit > amending the ٠لbejore the expiration 0 — receipt of ٠لUS). claims and to be republished in the event 0) اMassachusetts Avenue，Cambridge，MA 0242 ROOT，David [US/US]; 94 Longwood Avenue, Apt. 3, amendments (Rule 48.2(h)) Brookline, MA 02446 (US). BIEWENER HARTENIAN, [Continued on next page] (54) Title: FUNCTIONAL GENOMICS USING CRISPR-CAS SYSTEMS, COMPOSITIONS METHODS, SCREENS AND AP- iÜCATIONS THEREOF :.—.一_一 ةياة'أم؛géi٦fe G٠1؛F (57) Abstract: The present invention generally relates to libraries, compositions, methods, applications, kits and screens used in fractional genomics that focus on gene fonction in a cell and that may use vector systems and other aspects related to Clustered Reg - ularly hterspaced Short Palindromic Repeats (CRISPR)-Cas systems and components thereof. Provided are vectors ^d vector sys- toms, some of which encode one or more components of a CRISPR complex, as well as methods for the design ^d use of such vec - tors. Also provided are methods of directing CRISPR complex fomation in eukaryotic cells and methods for utilizing the CRISPR- Cas system. wo 2014/204727 Al lllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllll 11111111 一 with (an) indication(s) in relation to deposited biological material furnished under Rule Bbis separately from the description (Rides 13bis.4(d)(i) and48.2(a)(viii)) wo 2014/204727 PCT/US2O14/O418O6 FUNCTIONAL GENOMICS USING CRISPR CAS SYSTEMS，COMPOSITIONS， METHODS，SCREENS AND APPLICATIONS THEREOF RELATED APPLICATIONS AND INCORPORATION BY REFERENCE [0001] Priority is claimed to US provisional patent applications 61/836,123, 61/960,777 and 61/995,636, filed on June 17, 2013, September 25, 2013 and April 15, 2014 respectively, each incorporated hercin by reference. This application also claims priority to PCT/US13/74800, filed December 12, 2013. For purposes of the United States, his application also can be a continuation-in-part of PCWS13/74800, filed December 12, 2013; and Applicants reserve as permitted under US law to daim in the United States any right or benefit to US provisional application 61/802,174, filed March 15, 2013 and/or 61/736,527, filed December 12, 2012, which arc in the lineage of PCT/US13/74800, filed December 12, 2013. [0002] The foregoing applications, and all documents cited herein or during their prosecution ("appln cited documents") and all documents cited or referenced in the appln cited documents, and all documents cited or referenced herein ("herein cited documents"), and all documents cited or referenced in herein cited documents, together with any manufacturers instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by rcference herein, arc hereby incorporated herein by reference, and may be employed in the practice or the invention. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference. [0003] The foregoing patent applications, from which this application claims priority, expressly refers to a lengthy table section. Copies of the Tables have been submitted in triplicate in compact disc form (i.e., "Copy 1," “Copy 2" and "Copy 3") with the USPTO on April 15, 2014 in connection with the filing of US provisional application 61/995,636 and are hereby incorporated herein by reference in heir entirety, and may be employed in the practice of the invention. Each compact disc (CD), created April 11, 2014, contains the following files: Table l hKO 65Κ SgRNAs with offtarget scores.txt, 3,883,008 bytes ٠ Table 2A_Human GeCKOv2 controls.txt, 53,248 bytes ٠ Table 2B_Human GeCKOv2 controls.txt, 77,824 bytes ٠ Table З Нитап GeCKOv2 exons A.txt, 8,069,120 bytes ٠ Table 4_Human GeCKOv2 exons B.txt, 8,081,408 bytes ٠ 1 wo 2014/204727 PCT/US2O14/O418O6 Table 5_Human GeCKOv2 miRNAs.txt, 331,776 bytes ٠ Table 6_Mouse GeCKOv2 controls.txt, 610,304 bytes ٠ Table 7_Mouse GeCKOv2 exons A.txt, 8,650,752 bytes ٠ Table 8_Mouse GeCKOv2 exons B.txt, 8,671,232 bytes ٠ Table 9_Mouse GeCKOv2 miRNAs.txt, 208,896 bytes ٠ [0004] The disclosure in each of the foregoing US provisional patent applications is particularly incorporated herein by reference and particularly the disclosure of the CDs filed with 61/960,777 and 61/995,636 is particularly incorporated herein by refercnce in their entirety and is also included in his disclosure by way of the Biological Deposit(s) with the ATCC of plasmids / plasmid libraiy(ies) containing nucleic acid molecules encoding selected guide sequences having the information set forth m US provisional patent applications 61/960,777 and 61/995,636, namely. Deposit Nos: , deposited on June 10, 2014, with the American Type Culture Collection on American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20110 USA, under and pursuant to the terms of the Budapest Treaty. Upon issuance of a patent，all restrictions upon the Deposit(s) will be irrevocably removed, and the Deposit(s) is / are intended to meet the requirements of 37 CFR §§ 1.801- 1.809. The Deposit(s) will be maintained in the depository for a period of 30 years, or 5 years after the last request, or for the effective, enforceable life of the patent, whichever is longer，and will be replaced if necessary during that period; and the rcquirements of 37 CFR §§ 1.801- 1.809 are are met. FIELD OF THE INVENTION [0005] The present invention generally rdates to libraries, compositions, methods, applications, kits and screens used in functional genomics that focus on gene function in a cell and that may use vector systems and other aspects related to Clustered Regularly Interspaced Short Palindramic Repeats (CRISPR)-Cas systems and components hereof. STATEMENT AS TO FEDERALLY SPONSORED RESEARCH [0006] This invention was made with government support under the NIH Pioneer Award (1DP1MH100706) awarded by the National Institutes of Health. The government has certain rights in the invention. 2 wo 2014/204727 PCT/US2O14/O418O6 BACKGROUND OF THE INVENTION [0007] Recent advances in genome sequencing techniques and analysis methods have significantly accelerated the ability to catalog and map genetic foctors associated with a diverse range or biological fonctions and diseases. Functional genomics is a field of molecular biology that may be considered to utilize the vast wealth of data produced by genomic projects (such as genome sequencing projects) to describe gene (and protein) fonctions and interactions. Cont ary to dassical genomics, functional genomics focuses on the dynamic aspects such as gene t anscription, translation, and protein-protein interactions, as opposed to the static aspects of the genomic information such as DNA sequence or structures, though these static aspects are very important and supplement one's understanding of cellular and molecular mechanisms. Functional genomics attempts to answer questions about the function of DNA at the levels of genes, RNA transcripts, and protein products. A key characteristic of functional genomics studies is a genome-wide approach to these questions, generally involving high-throughput methods rather than a more t aditional "gene-by-gene" approach.
Load more

Recommended publications
  • Homozygous Deletion of Six Olfactory Receptor Genes in a Subset of Individuals with Beta-Thalassemia
    Homozygous Deletion of Six Olfactory Receptor Genes in a Subset of Individuals with Beta-Thalassemia Jessica Van Ziffle, Wendy Yang, Farid F. Chehab* Department of Laboratory Medicine, University of California San Francisco, San Francisco, California, United States of America Abstract Progress in the functional studies of human olfactory receptors has been largely hampered by the lack of a reliable experimental model system. Although transgenic approaches in mice could characterize the function of individual olfactory receptors, the presence of over 300 functional genes in the human genome becomes a daunting task. Thus, the characterization of individuals with a genetic susceptibility to altered olfaction coupled with the absence of particular olfactory receptor genes will allow phenotype/genotype correlations and vindicate the function of specific olfactory receptors with their cognate ligands. We characterized a 118 kb b-globin deletion and found that its 39 end breakpoint extends to the neighboring olfactory receptor region downstream of the b-globin gene cluster. This deletion encompasses six contiguous olfactory receptor genes (OR51V1, OR52Z1, OR51A1P, OR52A1, OR52A5, and OR52A4) all of which are expressed in the brain. Topology analysis of the encoded proteins from these olfactory receptor genes revealed that OR52Z1, OR52A1, OR52A5, and OR52A4 are predicted to be functional receptors as they display integral characteristics of G- proteins coupled receptors. Individuals homozygous for the 118 kb b-globin deletion are afflicted with b-thalassemia due to a homozygous deletion of the b-globin gene and have no alleles for the above mentioned olfactory receptors genes. This is the first example of a homozygous deletion of olfactory receptor genes in human.
    [Show full text]
  • Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
    bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity.
    [Show full text]
  • View of HER2: Human Epidermal Growth Factor Receptor 2; TNBC: Triple-Negative Breast Resistance to Systemic Therapy in Patients with Breast Cancer
    Wen et al. Cancer Cell Int (2018) 18:128 https://doi.org/10.1186/s12935-018-0625-9 Cancer Cell International PRIMARY RESEARCH Open Access Sulbactam‑enhanced cytotoxicity of doxorubicin in breast cancer cells Shao‑hsuan Wen1†, Shey‑chiang Su2†, Bo‑huang Liou3, Cheng‑hao Lin1 and Kuan‑rong Lee1* Abstract Background: Multidrug resistance (MDR) is a major obstacle in breast cancer treatment. The predominant mecha‑ nism underlying MDR is an increase in the activity of adenosine triphosphate (ATP)-dependent drug efux trans‑ porters. Sulbactam, a β-lactamase inhibitor, is generally combined with β-lactam antibiotics for treating bacterial infections. However, sulbactam alone can be used to treat Acinetobacter baumannii infections because it inhibits the expression of ATP-binding cassette (ABC) transporter proteins. This is the frst study to report the efects of sulbactam on mammalian cells. Methods: We used the breast cancer cell lines as a model system to determine whether sulbactam afects cancer cells. The cell viabilities in the present of doxorubicin with or without sulbactam were measured by MTT assay. Protein identities and the changes in protein expression levels in the cells after sulbactam and doxorubicin treatment were determined using LC–MS/MS. Real-time reverse transcription polymerase chain reaction (real-time RT-PCR) was used to analyze the change in mRNA expression levels of ABC transporters after treatment of doxorubicin with or without sulbactam. The efux of doxorubicin was measures by the doxorubicin efux assay. Results: MTT assay revealed that sulbactam enhanced the cytotoxicity of doxorubicin in breast cancer cells. The results of proteomics showed that ABC transporter proteins and proteins associated with the process of transcription and initiation of translation were reduced.
    [Show full text]
  • Crystal Structure of Human Gadd45 Reveals an Active Dimer
    Protein Cell 2011, 2(10): 814–826 Protein & Cell DOI 10.1007/s13238-011-1090-6 RESEARCH ARTICLE Crystal structure of human Gadd45 reveals an active dimer 1,2,3* 1* 4 4 1 1 3 Wenzheng Zhang , Sheng Fu , Xuefeng Liu , Xuelian Zhao✉ , Wenchi Zhang✉ , Wei Peng , Congying Wu , Yuanyuan Li3, Xuemei Li1, Mark Bartlam1,2, Zong-Hao Zeng1 , Qimin Zhan4 , Zihe Rao1,2,3 1 National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China 2 Tianjin Key Laboratory of Protein Science, College of Life Sciences, Nankai University, Tianjin 300071, China 3 Laboratory of Structural Biology, Tsinghua University, Beijing 100084, China 4 State Key Laboratory of Molecular Oncology, Cancer Institute, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100021, China ✉ Correspondence: [email protected] (Z.-H. Zeng), [email protected] (Q. Zhan) Received August 23, 2011 Accepted September 19, 2011 ABSTRACT INTRODUCTION The human Gadd45 protein family plays critical roles in The human Gadd45 family of growth arrest and DNA DNA repair, negative growth control, genomic stability, damage-inducible proteins has three members, Gadd45α, cell cycle checkpoints and apoptosis. Here we report the -β, and -γ, grouped together on the basis of their amino acid crystal structure of human Gadd45, revealing a unique sequences and functional similarities (Vairapandi et al., 1996; dimer formed via a bundle of four parallel helices, Takekawa and Saito, 1998; Nakayama et al., 1999). The involving the most conserved residues among the genes encoding the α, β and γ isoforms of Gadd45 are Gadd45 isoforms.
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Gene Expression Studies: from Case-Control to Multiple-Population-Based Studies
    From the Institute of Human Genetics, Helmholtz Zentrum Munchen,¨ Deutsches Forschungszentrum fur¨ Gesundheit und Umwelt (GmbH) Head: Prof. Dr. Thomas Meitinger Gene expression studies: From case-control to multiple-population-based studies Thesis Submitted for a Doctoral Degree in Natural Sciences at the Faculty of Medicine, Ludwig-Maximilians-Universitat¨ Munchen¨ Katharina Schramm Dachau, Germany 2016 With approval of the Faculty of Medicine Ludwig-Maximilians-Universit¨atM ¨unchen Supervisor/Examiner: Prof. Dr. Thomas Illig Co-Examiners: Prof. Dr. Roland Kappler Dean: Prof. Dr. med. dent. Reinhard Hickel Date of oral examination: 22.12.2016 II Dedicated to my family. III Abstract Recent technological developments allow genome-wide scans of gene expression levels. The reduction of costs and increasing parallelization of processing enable the quantification of 47,000 transcripts in up to twelve samples on a single microarray. Thereby the data collec- tion of large population-based studies was improved. During my PhD, I first developed a workflow for the statistical analyses of case-control stu- dies of up to 50 samples. With large population-based data sets generated I established a pipeline for quality control, data preprocessing and correction for confounders, which re- sulted in substantially improved data. In total, I processed more than 3,000 genome-wide expression profiles using the generated pipeline. With 993 whole blood samples from the population-based KORA (Cooperative Health Research in the Region of Augsburg) study we established one of the largest population-based resource. Using this data set we contributed to a number of transcriptome-wide association studies within national (MetaXpress) and international (CHARGE) consortia.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • TTDN1 (MPLKIP) (NM 138701) Human 3' UTR Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC204348 TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: MPLKIP Synonyms: ABHS; C7orf11; ORF20; TTD4 ACCN: NM_138701 Insert Size: 2000 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone – SC204348 Insert Sequence: >SC204348 3’UTR clone of NM_138701 The sequence shown below is from the reference sequence of NM_138701. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC ACAGGCAAAAAAGGAAGATACTTTTGTTAACATTTCTGAAATTCAACTGGAAGCTTCATGTGTCAGGAA CATCTTGGACAAAACTTTAAGTTGTGTTGATATAAATTTACCCAAAGATGATGACTTTGATTGGATAAT TAGTAAGGTCTTTTTGTTATTTTTCATCGTATCAGGTATTGTTGATATTAGAGAAAAAAGTAGGATAAC TTGCAACATTTAGCTCTGGAAGTACCTACCACATTTTAGAGATTTACCGTTTCCATATATTTAACATTC CTGGTTACATAATGGACATTTGTCTTTTAATGTTTTTTCAATGTTTTAAAATAAAACATTTTGTCTTCT AGCTATTGTGGTTTTGTGGTATGATAAAGAAGTAGACTTACTACAGTAATGCTTTGTAGTCACTTAGAG TTCATAGGTAAATGTTTTGCAAATTATTTTTGAAAATGAAATAGGTAAACCATCCTTTGAGCTGTAGAC
    [Show full text]
  • Cell Type Specificity of Chromatin Organization Mediated by CTCF
    Cell type specificity of chromatin organization mediated by CTCF and cohesin Chunhui Hou, Ryan Dale, and Ann Dean1 Laboratory of Cellular and Developmental Biology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892 Edited* by Gary Felsenfeld, National Institutes of Health, Bethesda, MD, and approved January 7, 2010 (received for review October 20, 2009) CTCF sites are abundant in the genomes of diverse species but their be required for normal globin gene regulation in erythroid pro- function is enigmatic. We used chromosome conformation capture genitor cells (10). These functions of CTCF all involve CTCF- to determine long-range interactions among CTCF/cohesin sites mediated long-range chromatin organization, which can be man- over 2 Mb on human chromosome 11 encompassing the β-globin ifest intra- or interchromosomally (11, 12). locus and flanking olfactory receptor genes. Although CTCF occu- In a β-globin transgenic mouse model, we showed that CTCF- pies these sites in both erythroid K562 cells and fibroblast 293T cells, binding HS5 has intrinsic, portable enhancer blocking activity (13). the long-range interaction frequencies among the sites are highly When an extra copy of HS5 was placed between the locus control cell type specific, revealing a more densely clustered organization in region (LCR) and downstream genes, it formed a new insulator the absence of globin gene activity. Both CTCF and cohesins are loop with endogenous HS5 that topologically isolated the LCR required for the cell-type-specific chromatin conformation. Further- and nullified its activity. Here we show that CTCF/cohesin sites more, loss of the organizational loops in K562 cells through reduc- over a 2-Mb region of human chromosome 11, primarily among tion of CTCF with shRNA results in acquisition of repressive histone silent odorant receptor genes up- and downstream of the β-globin marks in the globin locus and reduces globin gene expression locus, participate in numerous interactions that form loops.
    [Show full text]
  • Supplementary Methods
    Heterogeneous Contribution of Microdeletions in the Development of Common Generalized and Focal epilepsies. SUPPLEMENTARY METHODS Epilepsy subtype extended description. Genetic Gereralized Epilepsy (GGE): Features unprovoked tonic and/or clonic seizures, originated inconsistently at some focal point within the brain that rapidly generalizes engaging bilateral distributed spikes and waves discharges on the electroencephalogram. This generalization can include cortical and sub cortical structures but not necessarily the entire cortex[1]. GGE is the most common group of epilepsies accounting for 20% of all cases[2]. It is characterized by an age-related onset and a strong familial aggregation and heritability which allows the assumption of a genetic cause. Although genetic associations have been identified, a broad spectrum of causes is acknowledged and remains largely unsolved [3]. Rolandic Epilepsy (RE): Commonly known also as Benign Epilepsy with Centrotemporal Spikes (BECTS), hallmarks early onset diagnosis (mean onset = 7 years old) with brief, focal hemifacial or oropharyngeal sensorimotor seizures alongside speech arrest and secondarily generalized tonic– clonic seizures, which mainly occur during sleep[4]. Rolandic epilepsy features a broad spectrum of less benign related syndromes called atypical Rolandic epilepsy (ARE), including benign partial epilepsy (ABPE), Landau–Kleffner syndrome(LKS) and epileptic encephalopathy with continuous spike-and-waves during sleep (CSWSS)[5]. Together they are the most common childhood epilepsy with a prevalence of 0.2–0.73/1000 (i.e. _1/2500)[6]. Adult Focal Epilepsy (AFE). Focal epilepsy is characterized by sporadic events of seizures originated within a specific brain region and restricted to one hemisphere. Although they can exhibit more than one network of wave discharges on the electroencephalogram, and different degrees of spreading, they feature a consistent site of origin.
    [Show full text]
  • Genetic Mechanisms of Pitx1 Action in Murine Hindlimb Development
    1 Genetic mechanisms of Pitx1 action in murine hindlimb development Stephen Nemec, Division of Experimental Medicine, McGill University, Montreal August 2017 A thesis submitted to McGill University in partial fulfillment of the degree of PhD © Stephen Nemec 2017 2 Table of Contents Contents Page Abstract 4 Acknowledgements 8 Abbreviations 9 Preface – Contribution to knowledge 10 Contribution of authors 11 Introduction 13 Figures 1 and 2: Basics of limb anatomy and development 13 Evolutionary origins of the limb 14 Chick embryology and the early study of the limb 16 Molecular limb development 21 Hox genes – Engines of limb development 25 The genetics of forelimb vs. hindlimb development 30 Pitx1: major regulator of HL-specific pattern 30 Tbx4 and Tbx5 – limb-type-specific Tbox paralogs 35 Tbx4, Tbx5 and developmental anomalies in humans 41 Pitx1 Tbx4 42 Purpose and Aims 45 Pitx1 directly modulates the core limb development 46 program to implement hindlimb identity Contributions 47 Abstract 48 Introduction 49 Results 51 Discussion 60 Materials and Methods 65 Figure Legends 69 Figures 74 Interlude A – From Sox9 to signaling 89 Shh signaling influences the 91 phenotype of Pitx1-/- hindlimbs Contributions 92 Abstract 93 Introduction 94 Results 96 Discussion 98 Materials and Methods 100 Figure Legends 102 Figures 104 Interlude B – Regulatory complexity and developmental constraints 110 3 Table of Contents (continued) Contents Page Regulatory integration of Hox factor action with 111 Tbox factors in limb development Contributions 112 Abstract 113 Introduction 114 Results 116 Discussion 124 Materials and Methods 128 Figure Legends 134 Figures 141 Discussion 152 Evolutionary constraints determine the 152 developmental roles of limb-type-specific genes Future Directions 156 References 159 4 Abstract In tetrapods, the forelimbs (FL) and hindlimbs (HL) emerge from the flank of the developing embryo as buds of mesenchyme sheathed in ectoderm.
    [Show full text]