DOCSLIB.ORG

Full Text (PDF)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Full Text (PDF) Research Article Patched2 Modulates Tumorigenesis in Patched1 Heterozygous Mice Youngsoo Lee,1 Heather L. Miller,1 Helen R. Russell,1 Kelli Boyd,3 Tom Curran,2 and Peter J. McKinnon1 Departments of 1Genetics and Tumor Cell Biology and 2Developmental Neurobiology and 3Animal Resource Center, St Jude Children’s Research Hospital, Memphis, Tennessee Abstract human patients was associated with poor prognosis (15). Many The sonic hedgehog (SHH) receptor Patched 1 (Ptch1) is features of PTCH2 make this a gene of interest and potentially relevant to tumorigenesis. These include the high similarity to critical for embryonic development, and its loss is linked to tumorigenesis. Germ line inactivation of one copy of Ptch1 PTCH1, the sites of expression, and the link to other tumor types predisposes to basal cell carcinoma and medulloblastoma in (17–22). mouse and man. In many cases, medulloblastoma arising PTC2 is located on chromosome 1p33-34, comprises 22 exons, from perturbations of Ptch1 function leads to a concomitant and shares about 73% amino acid similarity to PTC1 although with up-regulation of a highly similar gene, Patched2 (Ptch2). As significant sequence differences in the transmembrane domains 6 increased expression of Ptch2 is associated with medulloblas- and 7. Several alternatively spliced transcripts of the PTC2 gene toma and other tumors, we investigated the role of Ptch2 in have been identified in various human tissues, although the tumor suppression by generating Ptch2-deficient mice. In physiologic roles of PTC2 spliced forms remains to be determined striking contrast to Ptch1À/À mice, Ptch2À/À animals were (18, 22). Notably, PTC2 has been linked to familial/sporadic BCC and medulloblastoma (19, 22), tumors that are also associated with born alive and showed no obvious defects and were not cancer prone. However, loss of Ptch2 markedly affected tumor PTC1 mutation (8, 14). PTC2 was also suggested as a putative formation in combination with Ptch1 haploinsufficiency. tumor suppressor candidate whose loss was observed frequently Ptch1+/ÀPtch2À/À and Ptch1+/ÀPtch2+/À animals showed a in meningioma (20, 21), and decreased PTC2 expression was higher incidence of tumors and a broader spectrum of tumor associated with malignant peripheral nerve sheath tumors (17). types compared with Ptch1+/À animals. Therefore, Ptch2 Like PTCH1, PTCH2 is also a SHH target, although as the modulates tumorigenesis associated with Ptch1 haploinsuffi- expression pattern of PTCH1 and PTCH2 do not fully overlap, it is likely there are also separate functions for each (23–26). PTCH2 ciency. (Cancer Res 2006; 66(14): 6964-71) can bind HH proteins and can form a complex with SMOOTH- ENED (26). Although the physiologic function of PTC2 is still Introduction unclear, based on sequence and biochemical similarity to PTC1 and Signaling pathways that regulate development, such as the SHH aberrant expression in several tumors, it is possible that PTC2 is pathway, have been linked to tumorigenesis (1–3). SHH is a also important in the SHH signaling pathway and can modulate secreted molecule required for cell growth, patterning, and fate development and tumor formation. Therefore, to test if PTCH2 determination in many tissues (4–7). Germ line mutation of has functional overlap with PTCH1, including a role during tumori- PATCHED1 (PTCH1), a receptor for SHH, is responsible for the genesis, we generated Ptch2-deficient mice. In contrast to Ptch1À/À Gorlin syndrome, a familial cancer predisposition syndrome with a mice, which showed early embryonic lethality, Ptch2À/À animals high incidence of medulloblastoma and basal cell carcinoma (BCC; did not show any discernable abnormalities during development refs. 8, 9). Mutation of PTC1 also occurs in sporadic tumors, and or a propensity for tumorigenesis. However, when combined with germ line and somatic mutations of SUFU (suppressor of fused), a Ptch1 mutations, Ptch2 mutations promoted a dramatic increase in downstream negative regulator of the SHH pathway, were recently the incidence of tumorigenesis, suggesting a cooperative role of linked to medulloblastoma (10). Similar to Gorlin syndrome, Ptch2 with the tumor suppressor function of Ptch1. Thus, to our engineered mutations in Ptch1 in the mouse can lead to knowledge, these data are the first demonstration that whereas medulloblastoma, highlighting the direct relationship between Ptch2 is dispensable for development, it can influence the effect of SHH/PTC1 signaling and medulloblastoma (11–14). Ptch1 attenuation during tumorigenesis. Our previous studies examining the genesis of medulloblastoma identified a common cohort of gene expression changes that occurred in genetically distinct mouse models of medulloblastoma Materials and Methods (15, 16). In these mouse models, tumors occurred because of defects in either DNA repair, SHH signaling, or cell cycle regulation. Generation of Ptch2-deficient mice. A Mouse BAC genomic DNA Library (Invitrogen, Carlsbad, CA) was screened to identify clones One gene that was highly expressed in all mouse medulloblastomas containing the Ptch2 gene. To inactivate Ptch2, we deleted exons 5 to 17 studied was Ptch2. Furthermore, >30% of human medulloblastomas from the full-length 20 exon–containing murine Ptch2 gene. To do this, a showed increased expression of PATCHED2 (PTC2); this group of BclI and HindIII 12-kb genomic fragment was inserted into HindIII and BamHI sites of pBluscript II (Stratagene, La Jolla, CA), in which the SacII restriction site was inactivated. An oligomer containing a LoxP site was inserted in a PacI site present between a BclI site and exon 5 of the Ptch2 Requests for reprints: Peter J. McKinnon, Department of Genetics, St Jude gene. Then a Neo-tk cassette flanked by LoxP sites was inserted into a SacII Children’s Hospital, 332 North Lauderdale, Memphis, TN 38105. Phone: 901-495-2700; site between Ptch2 exons 17 and 18. Finally, W9.5 embryonic stem cells were Fax: 901-526-2907; E-mail: [email protected]. I2006 American Association for Cancer Research. electroporated with a NotI-linearized targeting construct. Embryonic stem doi:10.1158/0008-5472.CAN-06-0505 cells were selected by G418, and targeted integrations were identified using Cancer Res 2006; 66: (14). July 15, 2006 6964 www.aacrjournals.org Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2006 American Association for Cancer Research. Patched2 and Tumorigenesis Southern blot analysis (data not shown). pMC-Cre was then used to excise and antisense in situ hybridization probes were generated from a Ptch2 the floxed Neo-tk, and the embryonic stem cells were grown in gancyclovir IMAGE clone (clone 3972649, nucleotides 1891-3568, and 3¶ untranslated to ensure cre-mediated removal of the Neo-tk cassette. Targeted embryonic region), a Gli1 clone in pSPORT1 (nucleotides 701-1251, Genbank accession stem cells were microinjected into C57BL/6 blastocysts and implanted in no. AB025922), a Gli2 clone in pSPORT1 (nucleotides 1055-1835, Genbank pseudopregnant F1 B/CBA foster mothers and allowed to develop to term. accession no. X136212), and an Sfrp1 clone in pSPORT1 (nucleotides 247- Germ line transmission was confirmed by Southern blot and PCR analysis. 1375, Genbank accession no. U88566). All Ptch2 animals were maintained in a mixed genetic background of Quantitative real-time PCR. Total RNA samples were extracted from 129SvX1/SVJ and C57BL/6. The PCR condition for the genotyping snap-frozen tumor samples and control tissues using Trizol (Invitrogen). was 30 cycles of 95jC for 1 minute, 63jC for 1 minute, and 72jCfor real-time reverse transcriptase-PCR (RT-PCR) was done as described before 1 minute with primers Ptch2-1 (5¶ ACCGGCACAGCAGGCAGG), Ptch2-2 (15). A primer/Taqman probe set for Ptch2 was forward primer Ptch2-SDS-F (5¶ GTGAGCTCAGTGCCGTCTACACAGC), and Ptch2-3 (5¶ AGAGATGTG- (5¶-ATCCTAGCTGGGAGCCTGAAG), reverse primer Ptch2-SDS-R (5¶-TCCC- TCTGGCCACACAGAGC). These conditions gave a 755-bp PCR product for GCATCCCAGAGAGA), and Taqman probe Ptch2-SDS-FAM (5¶-TCCACTCT- a wild-type allele and a 663-bp product for the mutant allele. GGCTTCGTGCTTACTTCCA), which detected a portion of a missing part To examine the targeted Ptch2 allele, total RNA was extracted from P5 in the Ptch2 mutant allele (nucleotides 2366-2447, Genbank accession wild-type (WT) and Ptch2À/À brains using Trizol (Invitrogen), and RNA was no. NM_008958). Two different sets of primer/Taqman probe sets for Ptch1 separated on a 1% agarose gel in a MOPS/formaldehyde–containing buffer. were used: one set to detect mRNA from exon 21 and the other for exon 2 cDNA probes for either Ptch1 or Ptch2 were radiolabeled using a random (the exon disrupted in the mutant allele of Ptch1; ref. 14). To detect Ptch1 primed labeling system (Roche, Indianapolis, IN). exon 21, we used forward primer Ptch1-SDS-F (5¶-CAAGTGTCGTC- Mice. Ptch1 and Ptch2 double mutant animals were obtained by CGGTTTGC), reverse primer Ptch1-SDS-R (5¶-CTGTACTCCGAGTCGGAG- intercrossing of Ptch1+/ÀPtch2À/À or Ptch1+/ÀPtch2+/À. The details of Ptch1 GAA), and Taqman probe Ptch1-SDS-FAM (5¶-CCTCCTGGTCACACGAA- animal model were described before (13, 14). Ptch2À/Àp53À/À mutant CAATGGGTC). The primer set for Ptch1 exon 2 was forward primer animals were generated by intercrossing of either Ptch2+/Àp53+/À or Ptch1ex2-SDS-F (5¶-GGCTACTGGCCGGAAAGC), reverse primer Ptch1ex2- Ptch2À/Àp53+/À mice. All Ptch1-Ptch2 mice used in these studies were F2 SDS-R (5¶-GAATGTAACAACCCAGTTTAAATAAGAGTCT), and Taqman or later-generation littermates on a 129Svj  C57BL/6 genetic background. probe Ptch1ex2-SDS-F (5¶-CCGCTGTGGCTGAGAGCGAAGTTTC). In addi- The presence of a vaginal plug was designated as embryonic day 0.5 (E0.5), tion, we used the following primer/probe sets for other genes: Gli1 forward and the day of birth as postnatal day 0 (P0). Animals were acclimated to (5¶-GCTTGGATGAAGGACCTTGTG), reverse (5¶-GCTGATCCAGCCTAA- controlled temperature and constant light/dark schedule with food and GGTTCTC), and Taqman probe (5¶-CCGGACTCTCCACGCTTCGCC); Sfrp1 water ad libitum. Full necropsy was done by the diagnostic Pathology forward (5¶-TCCTCCATGCGACAACGA), reverse (5¶-TGATTTTCATCCTCA- laboratory at St.
Load more

Recommended publications
  • Multivariate Meta-Analysis of Differential Principal Components Underlying Human Primed and Naive-Like Pluripotent States
    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347666; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. October 20, 2020 To: bioRxiv Multivariate Meta-Analysis of Differential Principal Components underlying Human Primed and Naive-like Pluripotent States Kory R. Johnson1*, Barbara S. Mallon2, Yang C. Fann1, and Kevin G. Chen2*, 1Intramural IT and Bioinformatics Program, 2NIH Stem Cell Unit, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, Maryland 20892, USA Keywords: human pluripotent stem cells; naive pluripotency, meta-analysis, principal component analysis, t-SNE, consensus clustering *Correspondence to: Dr. Kory R. Johnson ([email protected]) Dr. Kevin G. Chen ([email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347666; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. ABSTRACT The ground or naive pluripotent state of human pluripotent stem cells (hPSCs), which was initially established in mouse embryonic stem cells (mESCs), is an emerging and tentative concept. To verify this important concept in hPSCs, we performed a multivariate meta-analysis of major hPSC datasets via the combined analytic powers of percentile normalization, principal component analysis (PCA), t-distributed stochastic neighbor embedding (t-SNE), and SC3 consensus clustering.
    [Show full text]
  • Coincident Two Mutations and One Single Nucleotide Polymorphism of the PTCH1 Gene in a Family with Naevoid Basal Cell Carcinoma Syndrome
    Letters to the Editor 635 Coincident Two Mutations and One Single Nucleotide Polymorphism of the PTCH1 Gene in a Family with Naevoid Basal Cell Carcinoma Syndrome Shoko Abe1, Kenji Kabashima1*, Jun-ichi Sakabe1, Takatoshi Shimauchi1, Zhang Yan2, Tetsuji Okamoto2 and Yoshiki Tokura1 1Department of Dermatology, University of Occupational and Environmental Health, 1-1 Iseigaoka, Yahatanishi-ku, Kitakyushu 807-8555, and 2Department of Molecular Oral Medicine and Maxillofacial Surgery 1, Division of Frontier Medical Science, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima, Japan. E-mail: [email protected] Accepted May 7, 2008. Sir, at nucleotide position 667 within exon 3 and an intervening se- Naevoid basal cell carcinoma syndrome (NBCCS, OMIM quence (IVS)16 -3T > C, and a SNP; IVS10 -8T > C, were detected in all three cases. A deletion of AGAC causes a frameshift and a #109400), also called Gorlin’s syndrome, is an autosomal subsequent stop codon in exon 3, which prematurely truncates dominant disease that affects about 1 in 60,000 indivi- the protein (Fig. 1a). In addition, the IVS16 -3T > C could lead duals (1, 2). NBCCS is associated with various skeletal to an aberrant splicing and truncation of PTCH1 (10–12). and neurocutaneous abnormalities. Major manifestations To detect the expression level of PTCH1 protein in the skin, are multiple basal cell carcinomas (BCCs), odontogenic an immunohistochemical study was performed using goat poly- clonal anti-PTCH1 antibody (G-19; Santa Cruz Biotechnology, keratocysts, palmoplantar dyskeratotic pits and intra- Santa Cruz, CA, USA). Enzyme reactions were developed with cranial calcification (3). In addition, rib and vertebral conventional substrates for diamino-benzidine (Sigma, St Louis, malformations, epidermal cysts, macrocephaly, facial MO, USA) (13).
    [Show full text]
  • Review of the Molecular Genetics of Basal Cell Carcinoma; Inherited Susceptibility, Somatic Mutations, and Targeted Therapeutics
    cancers Review Review of the Molecular Genetics of Basal Cell Carcinoma; Inherited Susceptibility, Somatic Mutations, and Targeted Therapeutics James M. Kilgour , Justin L. Jia and Kavita Y. Sarin * Department of Dermatology, Stanford University School of Medcine, Stanford, CA 94305, USA; [email protected] (J.M.K.); [email protected] (J.L.J.) * Correspondence: [email protected] Simple Summary: Basal cell carcinoma is the most common human cancer worldwide. The molec- ular basis of BCC involves an interplay of inherited genetic susceptibility and somatic mutations, commonly induced by exposure to UV radiation. In this review, we outline the currently known germline and somatic mutations implicated in the pathogenesis of BCC with particular attention paid toward affected molecular pathways. We also discuss polymorphisms and associated phenotypic traits in addition to active areas of BCC research. We finally provide a brief overview of existing non-surgical treatments and emerging targeted therapeutics for BCC such as Hedgehog pathway inhibitors, immune modulators, and histone deacetylase inhibitors. Abstract: Basal cell carcinoma (BCC) is a significant public health concern, with more than 3 million cases occurring each year in the United States, and with an increasing incidence. The molecular basis of BCC is complex, involving an interplay of inherited genetic susceptibility, including single Citation: Kilgour, J.M.; Jia, J.L.; Sarin, nucleotide polymorphisms and genetic syndromes, and sporadic somatic mutations, often induced K.Y. Review of the Molecular Genetics of Basal Cell Carcinoma; by carcinogenic exposure to UV radiation. This review outlines the currently known germline and Inherited Susceptibility, Somatic somatic mutations implicated in the pathogenesis of BCC, including the key molecular pathways Mutations, and Targeted affected by these mutations, which drive oncogenesis.
    [Show full text]
  • View a Copy of This Licence, Visit
    Jägers and Roelink BMC Molecular and Cell Biology (2021) 22:22 BMC Molecular and https://doi.org/10.1186/s12860-021-00359-5 Cell Biology RESEARCH ARTICLE Open Access Association of Sonic Hedgehog with the extracellular matrix requires its zinc- coordination center Carina Jägers and Henk Roelink* Abstract Background: Sonic Hedgehog (Shh) has a catalytic cleft characteristic for zinc metallopeptidases and has significant sequence similarities with some bacterial peptidoglycan metallopeptidases defining a subgroup within the M15A family that, besides having the characteristic zinc coordination motif, can bind two calcium ions. Extracellular matrix (ECM) components in animals include heparan-sulfate proteoglycans, which are analogs of bacterial peptidoglycan and are involved in the extracellular distribution of Shh. Results: We found that the zinc-coordination center of Shh is required for its association to the ECM as well as for non-cell autonomous signaling. Association with the ECM requires the presence of at least 0.1 μM zinc and is prevented by mutations affecting critical conserved catalytical residues. Consistent with the presence of a conserved calcium binding domain, we find that extracellular calcium inhibits ECM association of Shh. Conclusions: Our results indicate that the putative intrinsic peptidase activity of Shh is required for non-cell autonomous signaling, possibly by enzymatically altering ECM characteristics. Keywords: Shh signaling, Zinc metallopeptidases, Extracellular matrix, BacHh Background rejected by demonstrating that mutation of a critical The Hedgehog (Hh) gene was first identified in the residue involved in catalysis (E177) did not impair the Drosophila melanogaster screen performed by Christiane ability of Shh to activate the Hh response [4], and conse- Nüsslein-Volhard and Eric Wieshaus in the late 1970s quently the zinc coordination center of Shh is often re- [1].
    [Show full text]
  • The Cell Adhesion Molecule CHL1 Interacts with Patched-1 to Regulate
    © 2017. Published by The Company of Biologists Ltd | Journal of Cell Science (2017) 130, 2606-2619 doi:10.1242/jcs.194563 RESEARCH ARTICLE The cell adhesion molecule CHL1 interacts with patched-1 to regulate apoptosis during postnatal cerebellar development Jelena Katic1, Gabriele Loers1, Jelena Tosic1, Melitta Schachner2,3,4,* and Ralf Kleene1 ABSTRACT differentiated neural cells (Holm et al., 1996; Chen et al., 1999; The immunoglobulin superfamily adhesion molecule close homolog of Hillenbrand et al., 1999; Buhusi et al., 2003; Jakovcevski et al., L1 (CHL1) plays important roles during nervous system development. 2007, 2009; Katic et al., 2014). Moreover, CHL1 regulates Here, we identified the hedgehog receptor patched-1 (PTCH1) as a neuritogenesis through different mechanisms (Chen et al., 1999; novel CHL1-binding protein and showed that CHL1 interacts with Hillenbrand et al., 1999; Jakovcevski et al., 2007, 2009; Katic et al., the first extracellular loop of PTCH1 via its extracellular domain. 2014). In search for novel binding partners for CHL1, we found that trans Colocalization and co-immunoprecipitation of CHL1 with PTCH1 PTCH1 and CHL1 associate in a heterophilic -interaction. The suggest an association of CHL1 with this major component of the 12-pass transmembrane protein PTCH1 is a cognate receptor for the hedgehog signaling pathway. The trans-interaction of CHL1 with PTCH1 three mammalian hedgehog family members sonic hedgehog promotes neuronal survival in cultures of dissociated cerebellar granule (SHH), desert hedgehog (DHH) and indian hedgehog (IHH), cells and of organotypic cerebellar slices. An inhibitor of the PTCH1- which act as morphogens and function as signaling molecules by regulated hedgehog signal transducer, smoothened (SMO), and binding to PTCH1 (for reviews and references therein, see Jenkins, inhibitors of RhoA and Rho-associated kinase (ROCK) 1 and 2 2009; Robbins et al., 2012; Briscoe and Thérond, 2013).
    [Show full text]
  • A New Trick for an Old Lipid Cholesterol Can Regulate the Hedgehog Signalling Pathway by Directly Binding to a Receptor on the Cell Surface
    INSIGHT SIGNALLING A new trick for an old lipid Cholesterol can regulate the Hedgehog signalling pathway by directly binding to a receptor on the cell surface. HAYLEY SHARPE Hedgehog, a transmembrane protein called Related research article Luchetti G, Sircar Patched, and a transmembrane receptor protein R, Kong JH, Nachtergaele S, Sagner A, called Smoothened. In the absence of Hedge- Byrne EFX, Covey DF, Siebold C, Rohatgi R. hog, Patched inhibits Smoothened. However, when Hedgehog binds to Patched, this inhibi- 2016. Cholesterol activates the G-protein tion is blocked and Smoothened is able to acti- coupled receptor Smoothened to promote vate other Hedgehog pathway components morphogenetic signaling. eLife 5:e20304. inside the cell. It is thought that Patched and doi: 10.7554/eLife.20304 Smoothened communicate using a small mole- cule rather than by direct contact (Taipale et al., 2002), but it is not clear exactly how this works. Smoothened possesses two sites at which holesterol is a lipid molecule that is a small molecules are able to bind: one is in its vital component of all animal cell mem- transmembrane domain region and the other is C branes. It provides structural integrity, in its cysteine-rich domain on the external sur- which is needed for the membrane to be an face of the cell. A similar cysteine-rich domain is effective barrier, and is also required for the pro- found in several other proteins, where it is duction of hormones and vitamin D. These roles known to be able to bind to lipids (Bazan et al., mean the production and transport of choles- 2009).
    [Show full text]
  • Atlas Journal
    Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Solid Tumours Cancer-Prone Deep Insight Portal Teaching X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Atlas Journal Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book. TABLE OF CONTENTS Volume 12, Number 6, Nov-Dec 2008 Previous Issue / Next Issue Genes BCL8 (B-cell CLL/lymphoma 8) (15q11). Silvia Rasi, Gianluca Gaidano. Atlas Genet Cytogenet Oncol Haematol 2008; 12 (6): 781-784. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/BCL8ID781ch15q11.html CDC25A (Cell division cycle 25A) (3p21). Dipankar Ray, Hiroaki Kiyokawa. Atlas Genet Cytogenet Oncol Haematol 2008; 12 (6): 785-791. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/CDC25AID40004ch3p21.html CDC73 (cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)) (1q31.2). Leslie Farber, Bin Tean Teh. Atlas Genet Cytogenet Oncol Haematol 2008; 12 (6): 792-797. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/CDC73D181ch1q31.html EIF3C (eukaryotic translation initiation factor 3, subunit C) (16p11.2). Daniel R Scoles. Atlas Genet Cytogenet Oncol Haematol 2008; 12 (6): 798-802. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/EIF3CID44187ch16p11.html ELAC2 (elaC homolog 2 (E. coli)) (17p11.2). Yang Chen, Sean Tavtigian, Donna Shattuck. Atlas Genet Cytogenet Oncol Haematol 2008; 12 (6): 803-806. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/ELAC2ID40437ch17p11.html FOXM1 (forkhead box M1) (12p13). Jamila Laoukili, Monica Alvarez Fernandez, René H Medema.
    [Show full text]
  • Underestimated PTCH1 Mutation Rate in Sporadic Keratocystic Odontogenic Tumors Q
    Oral Oncology 51 (2015) 40–45 Contents lists available at ScienceDirect Oral Oncology journal homepage: www.elsevier.com/locate/oraloncology Underestimated PTCH1 mutation rate in sporadic keratocystic odontogenic tumors q Jiafei Qu a, Feiyan Yu a, Yingying Hong a, Yanyan Guo a, Lisha Sun b, Xuefen Li b, Jianyun Zhang a, ⇑ ⇑ Heyu Zhang b, Ruirui Shi b, Feng Chen b, , Tiejun Li a, a Department of Oral Pathology, Peking University School and Hospital of Stomatology, Beijing, China b Central Laboratory, Peking University School and Hospital of Stomatology, Beijing, China article info summary Article history: Objectives: Keratocystic odontogenic tumors (KCOTs) are benign cystic lesions of the jaws that occur spo- Received 11 July 2014 radically in isolation or in association with nevoid basal cell carcinoma syndrome (NBCCS). The protein Received in revised form 29 August 2014 patched homolog 1 gene (PTCH1) is associated with NBCCS development and tumor genesis associated Accepted 26 September 2014 with this syndrome. However, previous studies have revealed that more than 85% of syndromic KCOTs Available online 18 November 2014 and less than 30% of sporadic KCOTs harbor PTCH1 mutations. The significantly lower PTCH1 mutation rates observed in sporadic KCOTs suggest that they serve a minor role in pathogenesis. We aimed to Keywords: discern the importance of PTCH1 mutations in sporadic KCOTs. PTCH1 Materials and methods: PTCH1 mutational analysis was performed with 19 new sporadic KCOT cases by Mutation Keratocystic odontogenic tumors direct sequencing of epithelial lining samples separated from fibrous capsules. Using this approach, we further reexamined 9 sporadic KCOTs that were previously reported to lack PTCH1 mutations by our group.
    [Show full text]
  • Nevoid Basal Cell Carcinoma Syndrome and Non-Hodgkin's
    Nevoid Basal Cell Carcinoma Syndrome and Non-Hodgkin’s Lymphoma CPT Beth A. Schulz-Butulis, MC, USAR, Fort Sam Houston, Texas MAJ Robert Gilson, MC, USAF, Fort Sam Houston, Texas MAJ Mary Farley, MC, USAR, Fort Sam Houston, Texas COL James H. Keeling, MC, USA, Fort Sam Houston, Texas Nevoid basal cell carcinoma syndrome (NBCCS) is a hereditary disorder with a predilection for nu- merous basal cell carcinomas in addition to odon- togenic keratocysts, palmoplantar pitting, and skeletal malformations. NBCCS has been associ- ated with a number of benign and malignant neo- plasms. We report the first case of NBCCS in as- sociation with non-Hodgkin’s lymphoma. evoid basal cell carcinoma syndrome (NBCCS), also known as basal cell nevus syn- drome, Gorlin syndrome, Gorlin-Goltz syn- N 1,2 drome, or fifth phacomatosis, is an autosomal dom- inant disease linked to chromosome 9q22.3-q31.3-5 It is a progressive degenerative multisystem disease FIGURE 1. The back of a patient shows multiple basal characterized by a predisposition to develop basal cell cell carcinomas. (Photograph courtesy of MAJ Thomas carcinomas (BCCs) of the skin, palmoplantar pitting, Hirota, MC, USA.) odontogenic keratocysts, bifid ribs, kyphoscoliosis, short fourth metacarpals, ocular abnormalities, calci- the first known report of non-Hodgkin’s lymphoma fied dural folds, endocrine abnormalities, and various associated with NBCCS. internal neoplasms.1,2 Internal neoplasms that have been reported in asso- Case Report ciation with NBCCS include medulloblastoma,6 cran- A 54-year-old white man presented with numerous iopharyngioma,7 meningioma,2 astrocytoma,8 oligo- basal cell cancers.
    [Show full text]
  • Characterization of Two Patched Receptors for the Vertebrate Hedgehog Protein Family
    Proc. Natl. Acad. Sci. USA Vol. 95, pp. 13630–13634, November 1998 Cell Biology Characterization of two patched receptors for the vertebrate hedgehog protein family DAVID CARPENTER*, DONNA M. STONE†,JENNIFER BRUSH‡,ANNE RYAN§,MARK ARMANINI†,GRETCHEN FRANTZ§, ARNON ROSENTHAL†, AND FREDERIC J. DE SAUVAGE*¶ Departments of *Molecular Oncology, ‡Molecular Biology, §Pathology, and †Neuroscience, Genentech Inc., 1 DNA Way, South San Francisco, CA 94080 Communicated by David V. Goeddel, Tularik, Inc., South San Francisco, CA, September 24, 1998 (received for review June 12, 1998) ABSTRACT The multitransmembrane protein Patched mammalian hedgehogs or whether ligand-specific components (PTCH) is the receptor for Sonic Hedgehog (Shh), a secreted exist. Interestingly, a second murine PTCH gene, PTCH2, was molecule implicated in the formation of embryonic structures isolated recently (25) but its function as a hedgehog receptor and in tumorigenesis. Current models suggest that binding of has not been established. To characterize PTCH2 and com- Shh to PTCH prevents the normal inhibition of the seven- pare it with PTCH with respect to the biological function of the transmembrane-protein Smoothened (SMO) by PTCH. Ac- various hedgehog family members, we isolated the human cording to this model, the inhibition of SMO signaling is PTCH2 gene. Binding analysis shows that both PTCH and relieved after mutational inactivation of PTCH in the basal PTCH2 bind to all three hedgehog ligands with similar affinity. cell nevus syndrome. Recently, PTCH2, a molecule with Furthermore PTCH2 interacts with SMO, suggesting that it sequence homology to PTCH, has been identified. To charac- can form a functional multicomponent hedgehog receptor terize both PTCH molecules with respect to the various complex similar to PTCH-SMO.
    [Show full text]
  • Genetic Analysis of Gorlin Syndrome Using a Multiplex PCR Gene Panel, and Its Potential Clinical Utility for Liquid Biopsy
    Genetic Analysis of Gorlin Syndrome Using a Multiplex PCR Gene Panel, and Its Potential Clinical Utility for Liquid Biopsy Yuriko Nakamura Tokyo Dental College: Tokyo Shika Daigaku Shoko Onodera Tokyo Dental College: Tokyo Shika Daigaku Kazuhiko Hashimoto Tokyo Dental College Ichikawa General Hospital: Tokyo Shika Daigaku Ichikawa Sogo Byoin Masayuki Takano Tokyo Dental College: Tokyo Shika Daigaku Akira Katakura Tokyo Dental College: Tokyo Shika Daigaku Takeshi Nomura Tokyo Dental College: Tokyo Shika Daigaku Toshifumi Azuma ( [email protected] ) Tokyo Dental College https://orcid.org/0000-0003-0673-3400 Research Keywords: Genetic testing, NGS panel, Genetic diagnosis, Pathogenic gene prediction, Liquid biopsy, Next- generation sequencing (NGS) Posted Date: July 13th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-676760/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/19 Abstract Background: Gorlin syndrome is an autosomal dominant, rare disease caused by mutations in PTCH1, PTCH2, and SUFU with various symptoms in multiple organs making early diagnosis challenging. In this study, we generated a Gorlin syndrome gene panel that could help to overcome the diculties in diagnosing Gorlin syndrome using a single test. Results: This gene panel is time- and cost-ecient and highly reliable with a high-quality score of 30, on- target ratio, and coverage depth, and could detect more mutations than whole-exome sequencing of the same patient. Although the current in silico prediction tools have a limited genetic database of gene mutations in rare hereditary diseases, ve prediction tools were used to identify pathological mutations.
    [Show full text]
  • Interaction of the Primordial Germ Cell-Specific Protein C2EIP With
    Zuo et al. Cell Death and Disease (2018) 9:497 DOI 10.1038/s41419-018-0557-2 Cell Death & Disease ARTICLE Open Access Interaction of the primordial germ cell- specific protein C2EIP with PTCH2 directs differentiation of embryonic stem cells via HH signaling activation Qisheng Zuo1,KaiJin1, Jiuzhou Song2, Yani Zhang1, Guohong Chen1 and Bichun Li1 Abstract Although many marker genes for germ cell differentiation have been identified, genes that specifically regulate primordial germ cell (PGC) generation are more difficult to determine. In the current study, we confirmed that C2EIP is a PGC marker gene that regulates differentiation by influencing the expression of pluripotency-associated genes such as Oct4 and Sox2. Knockout of C2EIP during embryonic development reduced PGC generation efficiency 1.5-fold, whereas C2EIP overexpression nearly doubled the generation efficiency both in vitro and in vivo. C2EIP encodes a cytoplasmic protein that interacted with PTCH2 at the intracellular membrane, promoted PTCH2 ubiquitination, activated the Hedgehog (HH) signaling pathway via competitive inhibition of the GPCR-like protein SMO, and positively regulated PGC generation. Activation and expression of C2EIP are regulated by the transcription factor STAT1, histone acetylation, and promoter methylation. Our data suggest that C2EIP is a novel, specific indicator of PGC generation whose gene product regulates embryonic stem cell differentiation by activating the HH signaling pathway fi 1234567890():,; 1234567890():,; via PTCH2 modi cation. Introduction re-programming them to differentiate into spermatogo- – Primordial germ cells (PGC) can be used for therapeutic nial stem cells (SSC)7 10. Moreover, RNAi-mediated purposes and genetic modification as an alternative to knockout of LIN28 downregulates expression of multi- + embryonic stem cells1,2.
    [Show full text]