Integrated omics on the physiology of emerald ash borer (Agrilus planipennis Fairmaire)
DISSERTATION
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University
By
Swapna Priya Rajarapu
Graduate Program in Entomology
The Ohio State University
2013
Dissertation Committee:
Omprakash Mittapalli, Advisor
P. Larry Phelan
Daniel A. Herms
Pierluigi Bonello
Copyrighted by
Swapna Priya Rajarapu
2013
Abstract
Coleoptera comprise one of the most frequently intercepted wood feeders because of their abundance and specialization on live and/or dead trees. Within this order, invasive Buprestids (metallic wood boring beetle) have had devastating effects on the forest ecosystems of North America (NA). Emerald ash borer, Agrilus planipennis
Fairmaire, is a recently discovered exotic wood boring beetle in NA. It is a native of
Northeastern Asia and specializes on ash (Fraxinus spp) trees. Since its discovery in 2002 in Michigan, it has killed millions of ash trees and continues to do so at a rapid pace.
Asian/native ash (e.g. F. mandshurica, Manchurian ash) are resistant to A.planipennis attack unless stressed, perhaps by virtue of their co-evolutionary history. Transcriptomic, proteomic and metabolomic studies on NA and Asian ash species have revealed significant qualitative and quantitative differences. Manchurian ash phloem revealed presence of unique phenolics and significantly higher amounts of defense proteins relative to the NA ashes.
During coexistence with plants, herbivorous insects have developed a suite of counter defense mechanisms including avoidance, sequestration, metabolic resistance
(antioxidation and detoxification), excretion and target site insensitivity. To date little is known about the metabolic resistance mechanisms in A. planipennis during its interaction with ash. Therefore, the overarching goal of this thesis was to understand the
ii physiological responses of A. planipennis on NA ash and its differential survivability on
Asian ash via an integrated omics approach. Chapter 2 deals with standardizing real time quantitative PCR technique to accomplish my further objectives. Chapters 3 &4 of my thesis deals with molecular characterization of antioxidant and detoxification enzymes in tissues and developmental stages of larvae feeding on green ash; chapter 5 deals with the targeted metabolomics of green ash phloem, larval tissues (midgut tissue, midgut content, hindgut-Malpighian tubules) and frass. Lastly, chapter 6 deals with the comparative transcriptomic and metabolomics of A.planipennis larvae feeding on green (NA) and
Manchurian (Asian) ash.
I was able to standardize a technique to measure target gene expression levels in
A.planipennis (chapter 1). Expression patterns of antioxidant and detoxification genes reflect a plausible role of these genes in dealing with direct and indirect effects of green ash allelochemicals in diet. Alternatively these enzymes might also be participating in other physiological processes (chapter 3 &4). Targeted metabolomics of larvae feeding on green ash phloem indicated that A. planipennis larvae have the ability to metabolize a suite of phenolics present in green ash phloem via biotransformation and/or excretion mechanisms (chapter 5). Further, higher expression of peritrophic membrane synthesis genes coupled with general stress response and the higher total phenolic content in frass of larvae feeding on Manchurian ash suggest the prime mechanism of ash resistance is damaging the peritrophic membrane (chapter 6). Larvae feeding on green ash had higher levels of digestion genes reflecting a normal digestion metabolism relative to larvae feeding on Manchurian ash. Lastly, results from this research shed light on the wood
iii boring beetle physiology and also molecular interactions of A.planipennis with its Asian and North American host.
iv
Acknowledgments
I would like to thank my advisor, Omprakash Mittapalli, for giving me an opportunity and believing in my abilities to accomplish the goals of this project. I am grateful to have Larry phelan, Dan Herms and Pierluigi (Enrico) Bonello on my student advisory committee, who guided, supported and encouraged me during the pursuit of this degree. Specially, I am thank Larry Phelan for all his time, patience and helping me to cope with difficult situations during my research. He always encouraged me to see the
“big picture” and communicate my thoughts effectively, especially to non-molecular biologist. I appreciate Enrico for his critical comments during my committee meetings and giving me wise suggestions.
I thank all the members in Mittapalli’s lab for their support and encouragement throughout my research. I thank Loren Rivera vega, Marianne Bautista, Priyanka
Mitapelly and Angie Strock for their friendship, emotional support and wise advice. I especially thank Loren and Angie for helping me with sample collection. I also would like to thank Binny Bhandary for help with this research. I also appreciate Praveen
Mamidala’s help for this research. I thank Kathleen Knight, Kyle Costilow, Andrew
Boose and Brad Philips for helping with sample collections. I thank Dave Shetlar for helping me with tissue staining technique. I thank Babu Sudhamalla for helping me with protein modeling.
v
I am grateful to the Department of Entomology for being a home away from home. Especially, I thank Brenda Franks and Nuris Acosta for all their hugs and support during thick and thin. I want to thank Claudia Kuniyoshi for taking care of me like an elder sister, when I first arrived to the United States. I also thank Priyanka Mittapelly for her friendship and company when my family was away. I thank my fellow grad students for making my life at Wooster fun. Especially, I thank Larry Long and Kayla Perry for taking time to review my presentations. I want to thank my friends Yuting Chen, Harit
Bal, Cordelia Manickam for all their love and support.`
Finally, I feel lucky to have an amazing family who always believed in me and encouraged me to pursue my career goals. I owe a lot to my husband, Naresh Kumar, who sacrificed his career for mine. His unconditional love and support during my degree has helped me overcome the most difficult and stressful situations. I also would like to thank my Mother, Mrs. Rani Karunavathi, for her time to take care of me and my family and helped me to accomplish my goals as scheduled. I especially want to thank my maternal uncle, Mr. Suresh Kumar, for all his support and encouragement throughout my life. His support while I was pursuing this degree was invaluable. I also thank my mother in law, Mrs. Vijay Lakshmi, and father in law, Mr. Yadigiri for supporting and encouraging me to pursue my goals. Not to forget a special person in my life, Vanshika, my daughter, who kept me on toes to achieve my goals earlier than I expected.
vi
Vita
2006 ...... B.S. Biochemistry, Osmania University
2008...... M.S. Biochemistry, Osmania University
2009 - 2010 ...... Graduate Teaching Associate, College of
Life Sciences, The Ohio State University
2010 - 2013 ...... Graduate Research Associate, Department
of Entomology, The Ohio State University
Publications
Rajarapu, S. P., Mittapalli, O., 2013. Glutathione -S-transferase profiles in the emerald ash borer (Agrilus planipennis).Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology.doi.org/10.1016/j.cbpb.2013.02.010
Rajarapu, S. P., Mamidala, P., Mittapalli, O., 2012. Validation of reference genes for gene expression studies in the emerald ash borer (Agrilus planipennis). Insect Science. 19, 41-46.
Rajarapu, S. P., Mamidala, P., Herms, D.A., Bonello, P., Mittapalli, O., 2011 Antioxidant genes of the emerald ash borer (Agrilus planipennis): gene characterization and expression profiles. Journal of Insect Physiology. 57, 819-24.
Mamidala, P., Rajarapu, S. P., Jones, S.C., Mittapalli, O., 2011. Identification and Validation of Reference Genes for Quantitative Real-Time Polymerase Chain Reaction in Cimex lectularius. Journal of Medical Entomology 48, 947-951.
Bai, X., Mamidala, P., Rajarapu, S. P., Jones, S.C., Mittapalli, O., 2011. Transcriptomics of the Bed Bug (Cimex lectularis). PLos ONE 6, e16336.
vii
Bhandary, B., Rajarapu, S. P., Rivera-Vega L, Mittapalli, O., 2010. Analysis of Gene Expression in Emerald Ash Borer (Agrilus planipennis) Using Quantitative Real Time-PCR. Journal of Visualized Experiments. DOI 0.3791/1974.
Mittapalli, O., Bai, X., Mamidala, P., Rajarapu, S. P., Bonello, P., Herms, D.A., 2010. Tissue-specific transcriptomics of the exotic invasive insect pest emerald ash borer PLoS ONE 5, e13708.
Fields of Study
Major Field: Entomology
viii
Table of Contents
Abstract ...... ii Acknowledgments...... v Vita ...... vii Publications ...... vii Fields of Study ...... viii Table of Contents ...... ix List of Tables ...... xi List of Figures ...... xiii Chapter 1: Literature Review ...... 1 Insect - Plant Interactions ...... 1 Plant Secondary Metabolites (PSMs) ...... 2 Insect Counterdefense Mechanisms ...... 5 Era of omics ...... 16 The Agrilus planipennis invasion ...... 18 Biology of Agrilus planipennis ...... 20 Counterdefense mechanisms in wood boring beetles ...... 21 Transcriptomics of Agrilus planipennis ...... 22 Chapter 2: Validation of reference genes for gene expression studies in emerald ash borer (Agrilus planipennis) ...... 37 Abstract ...... 37 Introduction ...... 38 Materials and Methods ...... 39 Results and Discussion: ...... 40 Acknowledgements ...... 43 References ...... 46 Chapter 3: Antioxidant genes of the emerald ash borer (Agrilus planipennis): gene characterization and expression profiles ...... 48 Abstract ...... 48 Introduction ...... 50 Materials and method ...... 52 ix
Results ...... 56 Discussion ...... 60 Acknowledgements ...... 63 References ...... 70 Chapter 4: Detoxification enzyme profiles in the emerald ash borer, Agrilus planipennis Fairmaire ...... 73 Abstract ...... 73 Introduction ...... 75 Materials and method ...... 78 Results ...... 82 Discussion ...... 86 Acknowledgements ...... 91 References ...... 102 Chapter 5: Fate of green ash, Fraxinus pennsylvanica phloem phenolics in larval emerald ash borer, Agrilus planipennis ...... 107 Abstract ...... 107 Introduction ...... 108 Materials and methods ...... 109 Results ...... 110 Discussion ...... 111 Conclusions ...... 113 Acknowledgements ...... 114 References ...... 119 Chapter 6: Comparative transcriptomic and metabolomic analysis of emerald ash borer, Agrilus planipennis larvae feeding on Fraxinus pennsylvanica (green ash) and F. mandshurica (Manchurian ash) ...... 121 Abstract ...... 121 Introduction ...... 123 Materials and Methods: ...... 126 Results ...... 132 Discussion ...... 136 Acknowledgements ...... 145 References ...... 155 Chapter 7 Summary and future directions ...... 160 References ...... 172 x
List of Tables Table 1.1: Occurrences of stress response genes in A.planipennis larval midgut and fatbody ...... 24
Table 2.1: Summarized output of the three softwares used for selecting best reference gene in Agrilus planipennis ...... 44
Table 3.1: Primers used for real time quantitative PCR analysis. Ap in the gene name indicates Agrilus planipennis.EF-1 α-Elongation factor, SOD- Superoxide dismutase, CAT- catalase, GPX-glutathione peroxidase ...... 64
Table 4.1 Real time quantitative PCR primers used for studying the mRNA levels of detoxification genes. a‘Ap’ in the gene name indicates Agrilus planipennis. ApTEF1α – Translation elongation factor, ApGST-E1, ApGST-E2, ApGST-E3 – Epsilon class members, ApGST-S1 – Sigma class members, ApGST-O1 – omega class members and ApGST-µ1 - microsomal class members, CYP6FH1, ApCYP6A, ApCYP6B, ApCYP9 and ApCYP12 are Cytochrome P 450s. ApCE1 – Carboxylesterase. bEfficiency is calculated by E = 10^(-1/slope)-1)*100. Slope is obtained from a standard curve of serially diluted samples ...... 92
Table 4.2: Top 3 blast hits for Agrilus planipennis Cytochrome P450s (ApCYP) aSubfamily – Classification of P450 as described previously (Feyresein 2006).a‘Ap’ in all the gene names denotes Agrilus planipennis. CYP6FH1, ApCYP6A, ApCYP6B, ApCYP9 and ApCYP12 are Cytochrome P 450s belonging to different subfamilies denoted with numbers ...... 93
Table 4.3: Top 3 blast hits of Agrilus planipennis glutathione-S-Transferases (ApGST) class members ...... 96
Table 5.1: Compounds identified in this study and their detection in the samples. Compounds identified in green ash, Fraxinus pennsylvanica, phloem as per Eyels et al 2011 and Whitehill et al 2011 ...... 117
Table 6.1 Summary statistics of Illumina sequencing of Agrilus planipennis larval midgut tissue feeding on Fraxinus pennsylvanica (green ash) and F. mandshurica (Manchurian ash) ...... 147
xi
Table 6.2: Differentially regulated biological process in the midgut of larvae feeding on Fraxinus pennsylvanica (green ash) and F. mandshurica (Manchurian ash) ...... 149
Table 6.3 Identification of compounds found in current study in present in green ash, F. pennsylvanica (Fp) and Manchurian ash, F. mandshurica (Fm) phloem ...... 151
Table 6.4: Calculated Binding energies, Inhibition constant (Ki) and Binding constant (Ka) of compounds from Fraxinus pennsylvanica allelochemicals against CYP6FH1 ranked in ascending order of calculated K ...... 154
xii
List of Figures
Figure 1.1 Mechanisms of toxin metabolism in insects. Green circles represent allelochemical Pink area represent midgut lumen. Red line represents peritrophic membrane ...... 23
Figure 1.2 Life cycle of Agrilus planipennis ...... 23
Figure 2.1 Ranking, stability and determination of optimal number of reference genes for Agrilus planipennis using geNorm. A, C and E represent ranking based on average expression stability value (M) for tissues, developmental stages and treatments; B, D and F display optimal number of genes required for the accurate estimation of the target gene mRNA in tissues, developmental stages and treatments calculated by the pairwise variation (V) of the normalization factors (NFn and NFn+1). Note: ACT (actin), BTUB (β-tubulin), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), RPL7 (ribosomal protein), TEF-1α (translation elongation factor1α), and UBQ (ubiquitin) ...... 44
Figure 3.1 Characterization of a superoxide dismutase (SOD) gene from Agrilus planipennis (ApSOD1). (A) Nucleotide (first line) and deduced amino acid sequences (second line) of ApSOD1. The start codon (ATG) along with its coded amino acid (M) is highlighted in bold and the stop codon is represented as an asterisk (*). Amino acids within the Cu binding site (H46, H48 and H120) are shown with open inverted triangles ( ). Amino acids within the Zn binding site (H63, H80 and D83) are shown with a filled inverted triangles ( ). The two signature motifs are boxed. (B) Predicted secondary structure of ApSOD1. Cylinders and solid black lines represent alpha-helices and coils, respectively. Amino acids underlying the alpha-helices are underlined...... 65
Figure 3.2. Multiple sequence alignment of Agrilus planipennis antioxidant genes: ApCAT1 with Tribolium castaneum (NP001153712.1), Hydra vulgaris (ABC250281), Homo sapiens (AAK2918. 1); ApSOD1with T. castaneum (XP968284.1), Macaca mullata (NP001027976.1) and Taenia solium (AAL66230.1); and ApGPX1 with sequences of T. castaneum (XP969937.2), Loa loa (XP003146189.1) and Hydra sps (ADI56239). Identical residues among all taxa are indicated by “*”, conserved substitutions by “:” and semi-conserved substitutions by “...... 66
Figure 3.3. Neighbour joining phylogenetic tree of Agrilus planipennis superoxide dismutase (ApSOD1) with other insect SODs. Members of Cu-Zn SOD and Mn SOD pertaining to different insect orders were included: (i) Cu-Zn SODs: Drosophila
xiii melanogaster (NP 476735.1), Glossina mositans morsitans (ADD20357.1), Bombyx mori (NP 001037084.1) and Hyphantia cunea (BAF73670.1) (ii) Mn SODs: D. melanogaster (NP 476925.1), G. morsitans morsitans (ADD18846.1), B. mori (NP 001037299.1) and H. cunea (ABL63640.1) . The numbers on the branch represent bootstrap values...... 67
Figure 3.4. Expression patterns of Agrilus planipennis antioxidant genes (ApCAT1, ApSOD1 and ApGPX1) in (A) larval tissues ( midgut (MG), fatbody (FB), Malpighian tubules (MT) and integument (IN) and (B) developmental stages (1st – 2nd larval instars, prepupae (PP) and adult) using real-time quantitative PCR. Relative expression values (REV) were calculated by normalizing the expression with A.planipennis translation elongation factor 1-α (TEF-1α). Error bars represent the pooled standard error for two biological replicates (each with two technical replicates) ...... 68
Figure 3.5: Specificity of Superoxide dismutase (SOD), Catalase (CAT) and glutathione peroxidase (GPX). Activity of SOD is determined as the percentage of inhibition rate per mg of protein. Activity of CAT is determined as the micromoles of H2O2 reduced per minute per mg of protein. Activity of GPX is determined by the amount of NADPH oxidized per mg of protein. Means are representative of 3 biological replicates with their respective standard error mean ...... 69
Table 4.1: Partial alignments of Agrilus planipennis P450 amino acid sequences with respective insect P450 family members: CYP6FH1, ApCYP6A and ApCYP6B with Tribolium castaneum (TcCYP6, gi|189236550|) and Aedes aegypti (AaCYP6, gi|157120794|); ApCYP9 with Drosophila mettleri ( DmCYP9, gi|3493155|) and Nisonia vitripennis (NvCYP9, gi|289177209|); ApCYP12 with T. castaneum (TcCYP12, gi|91093939|) and Anopheles gambiae (AgCYP12, gi|27752853|). Boxed residues are conserved signature motifs EXXRXXP and FXXGXXXCXG. Asterisk (*) indicates highly conserved residues, semicolon (:) and period (.) indicate partially conserved residues ...... 94
Figure 4.2: Phylogenetic analysis of Agrilus planipennis Cytochrome P450 (ApCYP) amino acid sequences with other insect P450 sequences. The topology of the tree was derived by the distance/Neighbour joining criteria with 1000 bootstrap replicates. The numbers on the branch represent bootstrap values. CYP6FH1, ApCYP6A and ApCYP6B with Tribolium castaneum (gi|189236550|) and Aedes aegypti (gi|157120794|); ApCYP9 with Drosophila mettleri (gi|3493155|) and Nisonia vitripennis (gi|289177209|); ApCYP12 with T. castaneum (gi|91093939|) and Anopheles gambiae (gi|27752853|)...... 95
Figure 4.3 : Partial alignments of Agrilus planipennis GST amino acid sequences with other respective insect GST class members: ApGST-E1, ApGST-E2, ApGST-E3 with epsilon GST of Tribolium castaneum (gi|91076572|), Drosophila melanogaster (gi|24654975|) and Helicoverpa assulta (gi|311223146|); ApGST-S1 with T. castaneum
xiv
(gi|91092852|), D. melanogaster (gi|21627085|)and H. armigera (gi|297340788|); ApGST-O1 with T. castaneum (gi|270004515| ), D. melanogaster (gi|268321293|) and Bombyx mori (gi|112983952|); ApGST-µ1 with T. castaneum (gi|91086441|) Aedes aegypti (gi|157114362|). Filled circles above the bolded letters represent conserved residues involved in G-site for ApGST-E1, ApGST-E2, ApGST-E3, ApGST-S1 and ApGST-O1, whereas the underlined 16 amino acid residue of ApGST-µ represents its signature motif ...... 97
Figure 4.4: Phylogenetic analysis of Agrilus planipennis glutathione-S-transferase (ApGST) amino acid sequences with other insect GST sequences. ApGST epsilon members include ApGST-E1, ApGST-E2, ApGST-E3; ApGST-S1 a sigma class member; ApGST-O1, a omega class member and ApGST-µ1, a microsomal GST. The topology of the tree was derived by the distance/Neighbour joining criteria with 1000 bootstrap replicates. The numbers on the branch represent bootstrap values. Accessions of reference sequences used for analysis: Drosophila melanogaster GST-E6 giǀ199225321ǀ; Tribolium castaneum GST-E5 giǀ91076572ǀ; D. melanogaster GST-D1 giǀ7299601ǀ; Helicoverpa armigera GST-D giǀ16555415ǀ; T. castaneum GST-D giǀ91080625ǀ; D. melanogaster GST-S giǀ21627085ǀ; T. castaneum GST-S giǀ91092852ǀ; Bombyx mori GST-O2 (gi|112983952|); T. castaneum GST-O giǀ270004515ǀ; D. melanogaster GST-O giǀ268321293ǀ; T. castaneum GST-µ giǀ91086441ǀ; Aedes aegypti GST- µ (gi|157114362|) ...... 98
Figure 4.5 mRNA levels of Agrilus planipennis detoxification genes in the larval tissues including midgut (MG), fat body (FB), Malpighian tubules (MT) and integument (IN) using real-time quantitative PCR (A) Cytochrome P450 members (CYP6FH1, ApCYP6A, ApCYP6B, ApCYP9 and ApCYP12); (B) glutathione-S-transferase members (ApGST-E1, ApGST-E2, ApGST-E3, ApGST-S1, ApGST-O1 and ApGST-µ1) Transcript levels were normalized with Agrilus planipennis translation elongation factor 1- α. Error bars represent the pooled standard error for three biological replicates (each with two technical replicates) ...... 99
Figure 4.6: Relative fold change in transcript levels of (A) Cytochrome P450s (CYP6FH1, ApCYP6A, ApCYP6B, ApCYP9 and ApCYP12); (B) glutathione-S- transferases (ApGST-E1, ApGST-E2, ApGST-E3, ApGST-S1, ApGST-O1 and ApGST-µ1) and in developmental stages of Agrilus planipennis including neonates, larval instars (1st - 4th), prepupa (PP) and adult using real time quantitative PCR. Transcript levels were normalized with Agrilus planipennis translation elongation factor 1- α. Neonate stage was taken as calibrator (1X). Error bars represent the pooled standard error for three biological replicates (each with two technical replicates) ...... 100
Figure 4.7: Specific activity of P450s and GSTs in different stages including neonates (<1day old), larvae (1st-4th instars) and adults (a) ApCYPs specific activity assayed via P- Nitoanisole-O-Demethylation assay. Means represent picomole of p-nitrophenol per microgram of protein per 5 min (b) Specific activity of ApGST toward 1-chloro-2,4-
xv dinitro benzene (CDNB) represented as the micromole of CDNB converted per milliliter per minute. Means are representative of three biological replicates with their respective standard error of mean ...... 101
Figure 5.1 Overlay of chromatograms showing the phenolic profiles of green ash phloem, larval tissues (midgut content, midgut tissue, hindgut-Malpighian tubules, frass and carcasses. Numbers on the peaks represent retention time of the compound ...... 115
Figure 5.2 Total phenolics measured as total UV peak area in chromatograms (A) phloem, midgut content (MGC) and frass (B) midgut tissue (MGT), hindgut-Malpighian tubule (HG-MT) and carcasses (CC). Means are represented with SEM...... 116
Figure 6.1 Differential transcriptome of A. planipennis midgut (A) Differential expression plot of midgut tissue of Agrilus planipennis larvae feeding on Fraxinus pennsylvanica (Fp-MG) versus F. mandshurica (Fm-MG). Red dots above the red line represent upregulated genes while under the line represent downregulated genes in Fm- MG relative to Fp-MG (B) Proportion of sequences belonging to biological processes digestion, transporter activity and detoxification (C) Fold change of candidate gene mRNA levels in Fm-MG relative to Fp-MG. Error bars represent SEM of three biological replicates : β-glucosidases (Ap β-glc1, Apβ-glc2), glycoside hydrolases (Ap-GH), peritrophic membrane proteins (ApPM1, ApPM2); transport: Sodium dependent and independent amino acid transporters (ApNa-AAT, ApAAT), Sugar transporters (ApSuT), Multidrug resistant transporters (ApMDR); detoxification/response to stress: Cytochrome P450 (CYP6FH1, CYP6FH3), glutathione-s-transferase (ApGST), sulfotransferase (ApST), lactoyglutathione lyase (ApLGSH), carboxylesterase (ApCE), β-amyloid ...... 148
Figure 6.2 Comparison of HPLC-UV chromatographic profiles of (A) green ash Fraxinus pennsylvanica phloem and frass of larvae feeding on it. (B) Manchurian ash Fraxinus mandschurica phloem and frass of larvae feeding on it (C) Total phenolics present in Manchurian ash phloem and its corresponding larval frass; green ash phloem and its corresponding larval frass ...... 150
Figure 6.3: Characterization of CYP6FH1 (A) Nucleotide (first line) and the deduced amino acid sequence (second line) of CYP6FH1.Start codon ATG and its corresponding amino acid are represented in bold and an * in the amino acid sequence represents a stop. Underlined amino acids are the conserved domains forming catalytic and substrate binding sites of P450 ...... 152
Figure 6.4: Molecular modeling and docking of CYP6FH1 with F. pennsylvanica (green ash) allelochemicals. (A) Representation of the homology model of CYP6FH1. The cartoon model of CYP397A1V2 is colored using a blue to red gradient from N-terminus to C-terminus. The model was created with MODELLER 9v8 using human cytochrome P450 CYP3A4 as a template (B-E) green ash allelochemicals docked into the binding site
xvi of CYP6FH1. Images show the orientation of the compounds in catalytic site (red ring structure) and interacting amino acids (B) syringaresinol (C) oleuropein (D) apigenin and (E) syringin ...... 153
Figure 7.1: Ash allelochemical (phenolic) flux inside A.planipennis larvae. Arrows indicate the direction of phenolic flow inside the larvae. Yellow structures indicate potential sites for transformation. P450s – cytochrome P450, GST- Glutathione-S- Transferases...... 165
xvii
Chapter 1: Literature Review
Insect - Plant Interactions
Interaction between plants and insects determines the structure and diversity of ecological communities through evolutionary times. This phenomenon could be better explained by coevoltuion theory proposed by Ehrlich and Raven (1964). According to this theory plants develop/synthesize novel chemical defenses to escape from herbivores and increase in abundance whereas the interacting herbivore develops counter defense mechanisms to adapt to these novel defenses. In this review I focus more on the mechanisms evolved by plants and insects during their course of coevolution.
Plants possess several physical and chemical defenses to protect themselves from insects and pathogens. Thorns, cuticle, wax layer are some of the physical barriers whereas secondary metabolites, defensive proteins and non-protein amino acids constitute the chemicals defenses.
1
Plant Secondary Metabolites (PSMs)
Secondary metabolites in plants are classified in to various chemical classes among which majority of the compounds belong to terpenoids (>30,000), alkaloids
(>12,000) and phenolics (>9,000) (Mithöfer and Boland 2012). Though all these compounds might not have a negative effect on herbivorous insects their mechanism of defense against herbivores would be further discussed in brief.
Terpenoids:
Terpenoids are formed from 5 carbon isoprene units; ubiquitously distributed and diverse compounds. They are important for growth and development in plants
(Langenheim 1994). Along with these functions, terpenoids also have protective role against herbivores. Terpenoids exhibit antifeedant properties towards a wide range of crop pests such as sunflower moth (Gershenzon and others 1985), corn root worm
(Mullin and others 1991) and Colorado potato beetle (Murray and others 1999). At a physiological level, terpenoids impact digestion of herbivores through inhibiting digestive enzymes like α-amylase and proteases (Liu and others 2008; Liu and others
2009). They are also known to increase the levels of factors involved in innate immunity in gypsy moth larvae (Martemyanov and others 2012). Indirect effects of terpenoids include recruiting parasitoids to the infested tree (Buchel and others 2011).
2
Alkaloids:
Alkaloids are nitrogen-containing compounds synthesized from amino acids
(Levinson 1976).Detrimental effects of alkaloids on insects include disruption of growth, development and reproduction (Krug and Proksch 1993; Levinson 1976; Sun and others
2012a). These compounds are also known to be neurotoxic and feeding deterrents
(Bentley and others 1984; Mao and Henderson 2007; Matsukura and others 2012).
Camptomectin, an alkaloid is known to be potential synergist of Bt toxin against
Lepidoptera including Trichoplusia ni and Spodoptera exigua (Sun and others 2012b).
Inhibition of α-amylase (digestive enzymes) by alkaloids was observed in Lepidopteran pests (Bouayad and others 2012).
Phenolics:
A phenolic compound bears an aromatic ring with one or more hydroxyl groups.
Phenolics are constitutively produced in plants and accumulate during growth and development. They are derived from aromatic amino acids through the shikimic acid pathway. Plants synthesize an array of phenolic compounds, ranging from simple to complex in structure. Based on the structure, they are grouped into benzoates, hydroxycinnamates, furanocoumarins, coumarins, stilbenes, flavonoids, hydrolysable tannins, condensed tannins and lignin (Rehman and others 2012). Along with protecting the plants from UV radiation, phenolics provide a first line of defense against herbivory
3 wherein they act as feeding deterrents, growth reducers, or toxins (Close and McArthur
2002; Degraeve and others 1980; Dreyer and Jones 1981; Mole and others 1993). The biochemical mode of action of phenolics in herbivores depends on the gut pH and the presence of enzymes that can activate them (Appel 1993). At the alkaline pH level found in herbivore guts, phenolic oxidation leads to the formation of reactive oxygen species that readily oxidize vital biomolecules including lipids, proteins, carbohydrates and nucleic acids (Appel 1993; Felton and Summers 1995). Oxidation of phenolics can also occur by plant polyphenol oxidases forming quinones which react with proteins and result in their precipitation (Felton and others 1992). A few phenolics like tannins can bind and precipitate gut proteins effecting digestion (Butler and Rogler 1992). The insecticidal activity of coumarins was observed against fall army-worm, S. frugiperda, wherein larval growth was significantly reduced and a high percentage of mortality was also observed (Vera and others 2006). Similar effects were observed against lepidopteran forest pests such as Plecoptera reflexa, Clostera cupreata and Crypsiptya coclesalis
(Sharma and others 2006).
Defense proteins:
Along with PSMs, plants also produce a diverse array of defense proteins that potentially inhibit or degrade insect and pathogen proteins. Protease inhibitors are the most studied in defense proteins in insect-plant interaction. Since the discovery of induction of protease inhibitors in herbivore-attacked tomato, the structure and
4 mechanism of action of these proteins has been extensively reviewed (Green and Ryan
1972; Rawlings and others 2004; Ryan 1989; Ryan 1990). Protease inhibitors hinder digestion by binding to digestive enzymes and effecting growth and development (Chen
2008; Ishimoto and others 2012; Ryan 1989).
Impairment of digestion is also caused by degradation of peritrophic membrane by plant proteases e.g., cysteine proteases in corn (Pechan and others 2002). Plant lectins or agglutinins are another group of carbohydrate-binding proteins. Negative effect of lectins on the performance of Lepidopterans, Coleopterans, Dipterans and Hemipterans has been recently reviewed (Vandenborre and others 2011). Biochemical mode of action of lectins in insect gut has not been extensively studied. Although, study in European corn borer larvae feeding on diet containing wheat germ agglutinin (lectin) shows hindrance in peritrophic membrane formation (Harper and others 1998).
Insect Counterdefense Mechanisms
As plants have evolved chemical defenses, herbivores have developed counterstrategies to deploy these chemical defenses via behavioral and physiological responses (Figure 1.1). Mechanisms employed by phytophagous insects are further discussed in detail.
5
Feeding preference/ Behavioral avoidance:
Phytophagous insects use various sensory modes of cues including olfactory, gustatory or contact to choose the right host and avoid the toxins (Chapman 2003;
Despres and others 2007). Adult oviposition plays an important role in choice of proper hosts for offsprings. This relation between adult preference and larval performance was shown to correlate positively in most of the studies (Mayhew 1997). However, there are studies showing a poor host choice by the adult females (Mayhew 2001). While on host plant, insects can alter their feeding behaviour spatially and temporally (Despres and others 2007; Nealis and Nault 2005). Spatial feeding patterns involve avoiding feeding on plant tissues with high concentration of toxins or exuding the toxins from plant tissues e.g. larvae of Trichoplusia ni (Zangerl and Bazzaz 1992), Bucculatrix thurberiella
(Karban and Agrawal 2002), Danaus plexippus (Zalucki and others 2001), Pygarctia roseicapitis (Bernays and others 2004)
Sequestration:
Another interesting mechanisms adopted by insects is the use of secondary chemicals acquired from their host for their own benefit (Brower and others 1967;
DUffey 1980). Monarch butterflies, D. plexippus, are well-studied models for host plant chemical sequestration. Larvae of monarch butterflies sequester cardiac glycosides from milkweed plants rendering the adult butterflies unpalatable to their predators (Brower and
6 others 1967). Pyrrolizidine alkaloids, produced mainly by Asteracae and Leguminaceae are sequestered by Lepidoptera and Coleoptera into non-toxic N-oxide forms in their hemolymph (Morgan 2010). Sequestration of host plant glucosinolates is observed in the sawfly, Athalia rosea (Müller and others 2001) and the harlequin bug, Murgantia histrionica (Aliabadi and others 2002). Other PSMs sequestered by insects include carotenoids, cycasin, aristocholic acid, tropane alkaloids and grayanoid terpenes (Nishida
2002).
Metabolic resistance:
Herbivores are biochemically and physiologically efficient to deploy chemical defenses and acquire nutrients from their hosts. These mechanisms include detoxification, antioxidation, excretion, and target site mutation (Despres and others 2007). Insects can employ multiple counterstrategies to exploit their host plants (Brattsten and others 1977).
For example, larvae of Monarch butterfly, D. plexippus, use trenching behaviour to inhibit the flow of latex containing sap, adult butterflies sequester few cardiac glycosides while detoxifying others by aldehyde reductase (Brower and others 1967; Marty and
Krieger 1984).
There are two major phases of detoxification – phase I and phase II. Enzymes in phase I include Cytochrome P450s (P450s) and phase II enzymes include glutathione-S- transferases (GSTs) and carboxylesterases (CEs). Integration of phase I and phase II is
7 referred to as detoxification pathway and involves the oxidation and conjugation of non- polar lipophilic molecules to polar hydrophilic forms.
Cytochrome P450:
Cytochrome P450s are ubiquitous microsomal enzymes that can oxidatively metabolize a wide array of endogenous and exogenous compounds (Nebert and Gonzalez
1987). Substantial evidence was shown for the involvement of P450s in drug metabolism in mammalian cells (Nebert and Gonzalez 1987). Detoxification of allelochemical in insects was first shown in Lepidoptera larval guts (Krieger and others 1971). Reactions catalyzed by P450s are diverse ranging from hydroxylation to epoxidation, O-, N-, and S- dealkylation, N- and S-oxidations. General reaction stoichiometry of P450 can be represented as
+ + Substrate + NADPH + H + O2 Substrate-O + NADP + H2O
In the instances of a tight enzyme substrate complex efficient conversion of substrate occurs. But, in most cases the reaction uncouples leading to the formation of superoxide and hydrogen peroxide (Feyereisen 1999). A single P450 enzyme can metabolize more than one substrate or can be very specific to single substrate. Induction of one or more P450s is observed in vivo depending on the presence of substrates (Yu
1986). In some instances consumption of diet depends on the induction of P450 enzymes
8
(Snyder and Glendinning 1996; Snyder and others 1994). However, in insecticide resistant strains of house fly constitutive expression of P450s occurs (Carino and others
1994). P450 gene superfamily divergently evolved by duplication (Feyereisen 2011).
Because of growing numbers of these genes they are classified into different families depending on their similarity at amino acid level. In insects P450 gene family is divided into four clans CYP2, CYP3, CYP4 and a mitochondrial clan (Feyereisen 2006). Among these CYP3 clan is the most diverged subfamily shown to be involved in detoxification of allelochemicals and insecticides (Feyereisen 2006). These enzymes play a crucial role in the adaptation of insect in a naïve/ novel niche (Schuler 2011). Role of P450s in adaptive mechanisms through detoxification is well studied in Depressaria platinicella, Manduca sexta, Helicoverpa zea, Bombyx mori (Cianfrogna and others 2002; Li and others 2002;
Stevens and others 2000).
Glutathione-S-transferases (GST):
Detoxification mediated by GST is also an important mechanism in mammals as well as insects. These cytosolic enzymes belong to phase II in detoxification pathway (Yu
1992). They catalyze the conjugation of endogenous and exogenous xenobiotics with glutathione converting them into excretable forms (Habig and others 1974). Reactions performed by GSTs include S-alkylation of aryl halides, O-aryl and O-alkyl conjugation of phosphorothioates and phosphates, replacement of nitro group and addition of
9 glutathione (GSH) to epoxides, α, β - unsaturated compounds. General reaction performed by GSTs is as follows
ROOH + 2GSH ROH + H2O + GSSG (reduced glutathione)
Similar to P450s, GSTs are also known to be induced in presence of their substrates (Yu 1992). Induction of GST was first observed in houseflies exposed to phenobarbital (Ottea and Plapp 1981). Later studies in fall armyworm, S. frugiperda feeding on cowpea, mustard and turnip demonstrated an induction of GSTs in response to host allelochemicals (Yu 1982). Several studies showed induction of GSTs in presence of xenobiotics (insecticides and PSMs) in Lepidoptera (Sintim and others 2012; Sonoda and
Tsumuki 2005; Ugale and others 2011b; Yamamoto and others 2008; Zhang and others
2011b) ,Diptera (Gunasekaran and others 2011; Kristensen 2005; Le Goff and others
2006; Lumjuan and others 2005; Mittapalli and others 2007b; Wang and others 2008), a few Orthoptera (Adewale and Afolayan 2006), Ixodida (Dreher-Lesnick and others
2006), and Hemiptera (Francis and others 2005).
Carboxylesterases:
Similar to GSTs, carboxylesterases (CEs) also belong to phase II of detoxification pathway. These enzymes hydrolyze ester bonds (C-O and C-N) with the addition of water molecule. General reaction stoichiometry of carboxylesterase is
10
R-COOR + H2O R-OOH + R-OH
Hydrolases encompass a wide range of enzymes and are involved in metabolism of pesticides (Ahmad and Forgash 1976). Resistance to malathion in insecticide-resistant strains of houseflies was observed to be provided by the hydrolysis of malathion to its monoacid by CEs (Kao and others 1984). Later there was growing evidence of carboxylesterase-based insecticide resistance in Lepidoptera (Goh and others 1995; Hung and others 1990; Wu and others 2011), Diptera (Whyard and others 1994a; Whyard and others 1994b), Hemiptera (Hung and others 1990) and Coleoptera (Argentine and others
1994). However, there are very few reports on metabolism of PSMs by CEs (Ghumare and others 1989; Lindroth and Weisbrod 1991; Mu and others 2006). Studying the involvement of CEs in allelochemical detoxification is needed.
Antioxidation:
Reactive Oxygen Species (ROS) pose a threat to vital biological molecules including proteins, lipids, carbohydrates and nucleic acids. Insects encounter ROS through endogenous and exogenous mechanisms either directly or indirectly. Endogenous mechanisms include incomplete oxidation of oxygen molecule during respiration, leading to ROS formation such as superoxide radical, peroxide radical and hydrogen peroxide
(Fridovich 1983). Herbivorous insects encounter ROS as a direct defense from plants or a result of phenolic oxidation (Felton and Summers 1995; Lee and Berenbaum 1989; Miles
11 and Oertli 1993). The lipoxygenase pathway is an important source of singlet oxygen in plants (Kanofsky and Axelrod 1986). Another indirect source of ROS in phytophagous insects includes detoxification of PSMs in the tissues (Feyereisen 1999). To overcome the toxic effects of ROS, insects have evolved an array of antioxidant machinery including superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase
(GPX). These enzymes act in concert to neutralize the ROS (Larson 1986). The foremost player in the pathway is superoxide dismutase which converts superoxide (O2-) to hydrogen peroxide. Toxicity of hydrogen peroxide is higher compared to other ROS
(Imlay and others 1988). These highly reactive molecules are readily converted to water molecule by catalase and glutathione peroxidase. The chain of events catalyzed by these enzymes is shown below
SOD CAT 2- O H2O2 H2O GPX
There are studies demonstrating the role of antioxidant enzymes in insect-plant interactions especially in insects feeding on phototoxic plants (Ahmad 1992; Lee and
Berenbaum 1989; Lee and Berenbaum 1990; Mittapalli and others 2007a). Induction of
SOD was observed in D. pastinacella due to slower detoxification of xanthotoxin (Lee and Berenbaum 1990). Gut tissues of cotton leaf worm, (S. littoralis) migratory grasshopper (Melanoplus sanguinipes) and bigheaded grasshopper (Aulocara elliotti) also showed high levels of antioxidant enzymes while feeding on pro-oxidant diet
(Barbehenn 2002; Krishnan and Kodrík 2006). However, induction of antioxidant genes
12 is also observed during other environmental stress such as temperature and radiation
(Church and others 2012; Wang and others 2012; Yang and others 2010).
Excretion:
Herbivores can regulate the absorption of PSMs by rapid excretion of these compounds (Sorensen and Dearing 2006). Important players/molecules involved in regulated absorption of PSMs by herbivore gut tissues are ABC transporters. Function of these transporters has been well studied in mammalian cells. This superfamily of transporters is ubiquitously distributed in all the organisms and has a wide range of substrates encompassing endogenous (lipids) and exogenous compounds (drugs, toxins)
(Higgins 1992a).
A member of ABC transporter, Permeability glycoprotein or P-glycoprotein is a multidrug resistance transporter protein (MDR) that is abundantly expressed in cancer or tumor cells and rapidly eliminate drugs providing resistance (Marie 1992). A similar scenario was observed in insecticide resistant strains of the tobacco budworm, Heliothis virescens which had higher levels of P-glycoprotein (Lanning and others 1996).
Additional evidence of MDRs in providing insecticide resistance was drawn from studies in Lepidoptera and Diptera (Bariami and others 2012; Labbe and others 2011b).
Interestingly, mutations in ABC transporters are proposed to be linked to Bt resistance in several Lepidopteran pests (Heckel 2012; Hernandez-Martinez and others 2012).
Functional assays in Tribolium castaneum has shown the involvement of ABC
13 transporters in lipid, eye pigment and ecdysteroid transportation also (Broehan and others
2013).
Studies on function of MDRs in herbivores feeding on allelochemically rich hosts are very limited. Sorensen and Dearing (2006) propose the presence of abundant amounts of unmetabolized PSMs present in the feaces of herbivores might be due to their active transportation by the MDRs in the gut of insects or intestines of higher animals. Further experimental evidence of transportation of allelochemicals by these transporters would shed light on interesting and vital mechanisms of herbivore adaptation.
Target site mutation:
A cost effective (energy wise), slow and powerful built-in mechanism evolved by insects is target site mutation (Berenbaum 1986). Targets of PSMs or defense proteins are changed at the gene level to escape recognition by plant defense molecule (Berenbaum
1986). Most extensively studied examples are the Lepidoptera adapted on cardenolide rich hosts. Cardenolides are toxic to the herbivores in a dose dependent manner wherein they inhibit the Na+-K+ pump which is important in nerve signal transmission. In response to this insects have developed cardenolide resistant Na+-K+ pumps (Moore and Scudder
1986).
Molecular evidence of amino acid substitution was observed in Na+-K+ pump of
Monarch butterfly, D. plexippus (Holzinger and others 1992; Holzinger and Wink 1996).
Similar adaptation is seen in other Lepidoptera, Coleoptera, Diptera and Heteroptera
14
(Dobler and others 2012). A recent community level study on phylogenetically diverse insects specialized on cardenolide containing plants indicated convergent adaptation of these insects to host plant cardenolide defenses (Dobler and others 2012). Another group of enzymes that are genetically altered by insects include digestive proteins. Plants have a repertoire of defensive protein that can inhibit or degrade insect digestive enzymes as mentioned in previous section. Insects survive these defenses by mutating the target enzymes of plant proteases to sterically insensitive forms (Bown and others 1997;
Jongsma and Beekwilder 2011).
Other defenses:
Plants produce a diverse range of defense proteins for example Bowman-birk inhibitor, trypsin, cystatin, cysteine proteases that inhibit herbivore digestive enzyme or peritrophic membrane formation (Ryan 1989). The strategies of herbivorous insects against these defensive proteins is to produce a different class of digestive proteins, an insensitive target and degradation of protease inhibitors (Jongsma and Beekwilder 2011).
In diamondback moth, T. ni cysteine protease inhibitor are produced to prevent the deleterious effects of cysteine proteases to peritrophic membrane (Li and others 2009).
Another group of detoxification enzymes which are understudied are the β- glucosidases. These enzymes can participate in digestion of cellulose and also in cleaving the glycosidic bonds of PSM glycosides releasing aglycones (Ferreira and others 1997;
Lindroth 1988; Tokuda and others 2009). These toxic aglycones are assumed to be
15 detoxified by the detoxification pathway genes. Apart from biochemical mechanisms, the peritrophic membrane serves as an important physical barrier in insects. The peritrophic membrane is synthesized by midgut epithelial cells and consists of chitin, protein ad proteoglycans (Hegedus and others 2009; Lehane 1997). It prevents mechanical abrasion of midgut tissue, compartmentalizes digestion and also prevents the entry of xenobiotics and pathogen (Barbehenn and Martin 1995). .
Era of omics
Methods of measuring global or specific levels of biomolecules including DNA,
RNA, protein and metabolites are collectively termed as Omic studies (Debnath and others 2010). Discovery of these techniques has led to a tremendous advancement in understanding the systems biology. These high-throughput technologies generate enormous data and aid in simultaneous detection of wide range of molecules. Overtime these techniques have become cost effective and automated systems made it easier to process, sequence and analyze the data at a rapid pace. To date genomes of 13 insects belonging to Diptera, Lepidoptera, Coleoptera and Phthiraptera (Hampton 2010;
Zdobnov and Bork 2007). Genomics data allows the discovery of molecular markers to understand insecticide resistance, virulence etc (Heckel 2003).
While genomics deals with the structural aspects of genes, function of the gene can be deduced by functional genomics encompassing transcriptomics and proteomics.
Each cell or a tissue expresses a specific set of transcripts and proteins influenced by the
16 environmental conditions reflecting their probable function. Microarray is traditionally used to monitor the transcriptome differences between two conditions. The very first use of microarray was done in Arabidopsis (Schena and others 1995). Later on the technique was adapted in biomedical research to understand several disease conditions and effects of drugs in mammals (Brown and Botstein 1999). Microarrays have also gained popularity in studying insect systems. For example it was used to study development, social behaviour and hormone regulation (Blomquist and others 2004; White and others
1999; Whitfield and others 2001). While microarray was used to analyze a group of genes, real time quantitative polymerase chain reaction was extensively used to study individual gene (Heid and others 1996). Validation of microarray data was recommended to be performed by RT-qPCR. Limitations of microarrays include array density (number of spots/chip), poor detection of target mRNAs with lower levels and high background noise (Bier and Kleinjung 2001).
Microarrays are being rapidly replaced by tag based direct sequencing of transcripts. These new generation transcriptomic techniques include serial analysis of gene expression, cap analysis of gene expression and massively parallel sequencing
(Brenner and others 2000; Kodzius and others 2006; Velculescu and others 1995).
Limitations of these techniques is the difficulty of mapping very short reads to references
(Wang and others 2009). The current high-throughput tool overcoming all these limitations is RNA-seq which is based on novel sequencing methods. Advantages of
RNA-seq include identification of isoforms, novel transcripts, expression difference >
9000 fold change can also be detected and much less RNA is required (Wang and others
17
2009). RNA-seq is widely used in studying diverse physiological mechanisms in insects
(Chen and others 2012; Simmons and others 2012). The main limitation of RNA seq is the analysis of massive sequencing data, which requires strong bioinformatic knowledge.
With the increasing transcriptomic information, proteomic is also becoming an important tool to study various biological events. In insects proteomics was used to study the proteins present in peritrophic membrane, salivary glands, hemolymph under various physiological conditions (Celorio-Mancera and others 2012; Hu and others 2012; Li and others 2012; Nicholson and others 2012). Another promising omic technology that is widely used is metabolomics. Metabolites represent a diverse group of compounds including metabolic intermediates, hormones, signaling molecules and secondary metabolites. Qualitative and quantitative changes in cell or tissue metabolites reflect the systemic responses to environmental conditions (Debnath and others 2010).
Metabolomics is a widely used technique in insect-plant interactions to study chemical warfare between these two taxa is substantially studied (Jansen and others 2009).
The Agrilus planipennis invasion
Invasive herbivorous insects have had devastating effects on North American forest ecosystems either directly or indirectly (Gandhi and Herms 2010). The most destructive invasions recorded to date are by gypsy moth, Limantria dispar L, beech scale, Cryptococcus fagisuga, European elm bark beetle, Scolytus multistriatus, hemlock woolly adelgid, Adelges tsugae, and balsam woolly adelgid, Adelges piceae (Gandhi and
18
Herms 2010). The recently discovered emerald ash borer, Agrilus planipennis has also been recorded as a devastating exotic insect of Fraxinus spp (ash) in North America
(NA). This alien insect is a native of Northeastern China and specializes on Fraxinus genus. Initial A. planipennis infestations in China were observed on an introduced NA species, F. pennsylvanica and a native F. mandschurica in early 1960s (Liu 1966). Later
A. planipennis infestations were recorded on F. velutina in 1989 in Tianjin city , China
(Liu and others 2003).
Introduction of A. planipennis to North America might have occurred in early
1990s via infested ash crates or pallets (Cappaert and others 2005; Herms and others
2004). It was first discovered in 2002 in Detroit, Michigan and Windsor, Ontario. Since then it has killed millions of ash trees in Eastern North America, establishing its populations in 17 U.S. states and 2 Canada Provinces. To date A. planipennis is known to infest black, (F. nigra), green, (F. pennsylvanica), white, (F. americana), and blue (F. quadrangulata) ashes. Infestation in NA are observed on young to matured trees irrespective of whether they are healthy or stressed, whereas Asian ashes (e.g.
Manchurian ash) are attacked only under stressed conditions (Rebek and others 2008).
This might be due to the co-evolutionary history shared between Asian ash and
A.planipennis. An infested tree can be diagnosed for the presence of A. planipennis only after the first year of attack by the presence of D- shaped adult exit holes, canopy dieback, epicormic shoots and cracked bark over larval galleries (Cappaert and others
2005).
19
Ash trees are an important source of timber and food for wildlife in forest systems. They also constitute 5-25% landscape trees in urban ecosystems (Haack and others 2002). Significant ecological and economic impacts have been observed since the invasion by A.planipennis began, and might be similar to those caused by chestnut blight or Dutch elm disease (Burns and Honkala). With its current rate of infestations/spread A. planipennis poses a potential threat to all the NA ash trees.
Biology of Agrilus planipennis
A. planipennis is a holometabolous insect with distinct larval, pupal and adult stages (Figure 1.2). Life cycle of A. planipennis can vary between 1-2 years. Adults emergence begins during mid- May or early June and peaks in June- July. Following emergence, adults feed on foliage for 5-7 days prior to mating. An adult A. planipennis female can lay 60-90 eggs in its life time (Cappaert and others 2005). Eggs are usually laid in the crevice of the bark. Initially eggs are cream colored and later turn reddish brown. Neonates (freshly hatched larvae) chew through the bark and feed on the cambium tissues. There are four larval stages in A. planipennis which feed extensively on the phloem and outer xylem from late July through September (Cappaert and others
2005). As they tunnel through the phloem, they form distinctive S-shaped galleries filled with frass. In late September -early October larvae bore through the outer xylem to form a pupal chamber during which they fold themselves into a ‘J’ shaped prepupal larva.
They overwinter as prepupae until April and pupate during late April and May. Larvae
20 that are not fully grown overwinter in the cambial regions and complete their development in the following year (Cappaert and others 2005). Pupation occur in pupal chambers in mid-April and adults emerge in May (Poland and McCullough 2006).
Counterdefense mechanisms in wood boring beetles
Wood-boring beetles belong to families Scotylidae, Cerambycidae, Buprestidae and Curculionidae. Most of these beetles infest weak/stressed, recently cut or dead tresswhile some infest and kill healthy trees. There has been interest among researchers to understand nutrition, pheromone production and microbial/fungal associations of these wood-boring beetles (Aw and others 2010; Burges and others 1979; Calderon and Berkov
2012; Chararas and Courtois 1976; Schloss and others 2006; Serdjukova 1993). But, studies on the counterstrategies employed by the beetle larvae are very limited. Feeding behaviour of wood-boring larvae exposes them to the highly defensive chemical repertoire of the host plant. Given the successful adaptation to the toxic environment of the host, my research thesis is to dissect the physiologically driven molecular strategies employed by wood-boring beetle larvae to counter the plant chemical defenses and successfully adapt on new host. Very little is known about molecular physiology of the counter defense mechanisms in these beetles.
21
Transcriptomics of Agrilus planipennis
Successful adaption of A.planipennis larvae in North America offers a perfect system to study the efficient mechanisms used by wood boring beetles to exploit their host. A transcriptome database for two vital insect tissues including midgut and fatbody was established. Newer-generation Roche-454 pyrosequencing was used to obtain
126,185 reads for the midgut and 240,848 reads for the fat body, which were assembled into 25,173 and 37,661 high quality expressed sequence tags (ESTs) for the midgut and the fat body of A. planipennis larvae, respectively. (Mittapalli et al 2010).
Among these ESTs, 36% of the midgut and 38% of the fat body sequences showed similarity to proteins in the GenBank nr database. A high number of the midgut sequences contained chitin-binding peritrophin (248) and trypsin (98) domains; while the fat body sequences showed high occurrence of cytochrome P450s (75) and protein kinase
(123) domains. Further, the midgut transcriptome of A. planipennis revealed putative microbial transcripts encoding for cell-wall degrading enzymes such as polygalacturonases and endoglucanases. A significant number of SNPs (137 in midgut and 347 in fat body) and microsatellite loci (317 in midgut and 571 in fat body) were predicted in the A. planipennis transcripts. Along with the above mentioned abundant sequences, significant number of genes involved in detoxification and antioxidation were also identified both in midgut and fatbody (Table 1.1).
22
Figure 1.1: Mechanisms of toxin metabolism in insects. Green circles represent allelochemical Pink area represent midgut lumen. Red line represents peritrophic membrane
Figure 1.2 Life cycle of Agrilus planipennis
23
Table 1.1: Occurrences of stress response genes in A.planipennis larval midgut and fatbody Response to stress genes #Occurrence #Occurrence in midgut in fat body Cytochrome P450 CYP2 clade 1 9 CYP2, CYP24,CYP49,CYP303, CYP306
CYP3 clade 37 45 CYP3, CYP6, CYP9, CYP28
CYP4 clade 3 16 CYP4
Mitochondrial CYP clade 4 6 CYP12, CYP301, CYP314, CYP315 GST 30 19 Epsilon, Sigma ,Omega, Theta, Microsomal
Superoxide dismutase 5 7 Catalase 17 5
Carboxylesterases 16 5
24
References:
Adewale IO, Afolayan A. 2006. Studies on Glutathione Transferase from Grasshopper (Zonocerus Variegatus). Pesticide Biochemistry and Physiology 85(1):52-59. Ahmad S. 1992. Biochemical Defence of Pro-Oxidant Plant Allelochemicals by Herbivorous Insects. Biochemical Systematics and Ecology 20(4):269-296. Ahmad S, Forgash AJ. 1976. Nonoxidative Enzymes in Metabolism of Insecticides. Drug Metabolism Reviews 5(1):141-164. Aliabadi A, Renwick JAA, Whitman DW. 2002. Sequestration of Glucosinolates by Harlequin Bug Murgantia Histrionica. Journal of Chemical Ecology 28(9):1749- 1762. Appel HM. 1993. Phenolics in Ecological Interactions: The Importance of Oxidation. Journal of Chemical Ecology 19(7):1521-1552. Argentine JA, Zhu KY, Lee SH, Clark JM. 1994. Biochemical-Mechanisms of Azinphosmethyl Resistance in Isogenic Strains of Colorado Potato Beetle. Pesticide Biochemistry and Physiology 48(1):63-78. Aw T, Schlauch K, Keeling CI, Young S, Bearfield JC, Blomquist GJ, Tittiger C. 2010. Functional Genomics of Mountain Pine Beetle (Dendroctonus Ponderosae) Midguts and Fat Bodies. Bmc Genomics 11(1):215. Barbehenn RV. 2002. Gut-Based Antioxidant Enzymes in a Polyphagous and a Graminivorous Grasshopper. Journal of Chemical Ecology 28(7):1329-1347. Barbehenn RV, Martin MM. 1995. Peritrophic Envelope Permeability in Herbivorous Insects. Journal of Insect Physiology 41(4):303-311. Bariami V, Jones CM, Poupardin R, Vontas J, Ranson H. 2012. Gene Amplification, Abc Transporters and Cytochrome P450s: Unraveling the Molecular Basis of Pyrethroid Resistance in the Dengue Vector, Aedes Aegypti. Plos Neglected Tropical Diseases 6(6). Bentley MD, Leonard DE, Reynolds EK, Leach S, Beck AB, Murakoshi I. 1984. Lupine Alkaloids as Larval Feeding Deterrents for Spruce Budworm, Choristoneura- Fumiferana (Lepidoptera, Tortricidae). Annals of the Entomological Society of America 77(4):398-400. Berenbaum MR. 1986. Target Site Insensitivity in Insect-Plant Interactions. Molecular Aspects of Insect-Plant Associations / Edited by Lena B. Brattsten and Sami Ahmad: New York : Plenum Press, c1986. p 257-272. Bernays E, Singer M, Rodrigues D. 2004. Trenching Behavior by Caterpillars of the Euphorbia Specialist, Pygarctia Roseicapitis: A Field Study. Journal of Insect Behavior 17(1):41-52. Bier FF, Kleinjung F. 2001. Feature-Size Limitations of Microarray Technology - a Critical Review. Fresenius Journal of Analytical Chemistry 371(2):151-156. Blomquist GJ, Keeling CI, Gilg-Young A, Bearfield J, Ginzel MD, Young S, Tittiger C. 2004. Juvenile Hormone Regulation of Bark Beetle Monoterpenoid Pheromone Biosynthesis. Journal of Insect Science (Tucson) 4. Bouayad N, Rharrabe K, Lamhamdi M, Nourouti NG, Sayah F. 2012. Dietary Effects of Harmine, a Beta-Carboline Alkaloid, on Development, Energy Reserves and 25
Alpha-Amylase Activity of Plodia Interpunctella Hubner (Lepidoptera: Pyralidae). Saudi Journal of Biological Sciences 19(1):73-80. Bown DP, Wilkinson HS, Gatehouse JA. 1997. Differentially Regulated Inhibitor- Sensitive and Insensitive Protease Genes from the Phytophagous Insect Pest, Helicoverpa Armigara, Are Members of Complex Multigene Families. Insect Biochemistry and Molecular Biology 27(7):625-638. Brattsten LB, Wilkinson CF, Eisner T. 1977. Herbivore-Plant Interactions - Mixed- Function Oxidases and Secondary Plant Substances. Science 196(4296):1349- 1352. Brenner S, Johnson M, Bridgham J, Golda G, Lloyd DH, Johnson D, Luo S, McCurdy S, Foy M, Ewan M. 2000. Gene Expression Analysis by Massively Parallel Signature Sequencing (Mpss) on Microbead Arrays. Nature Biotechnology 18(6):630-634. Broehan G, Kroeger T, Lorenzen M, Merzendorfer H. 2013. Functional Analysis of the Atp-Binding Cassette (Abc) Transporter Gene Family of Tribolium Castaneum. Bmc Genomics 14:6-6. Brower LP, Brower JV, Corvino JM. 1967. Plant Poisons in a Terrestrial Food Chain. Proceedings of the National Academy of Sciences of the United States of America 57(4):893-&. Brown PO, Botstein D. 1999. Exploring the New World of the Genome with DNA Microarrays. Nature Genetics 21(1 Suppl):33-37. Buchel K, Malskies S, Mayer M, Fenning TM, Gershenzon J, Hilker M, Meiners T. 2011. How Plants Give Early Herbivore Alert: Volatile Terpenoids Attract Parasitoids to Egg-Infested Elms. Basic and Applied Ecology 12(5):403-412. Burges HD, Grove JF, Pople M. 1979. Internal Microbial-Flora of the Elm Bark Beetle, Scolytus Scolytus, at All Stages of Its Development. Journal of Invertebrate Pathology 34(1):21-25. Burns RM, Honkala BH. Tech. Coords.(1990) Silvics of North America: 1. Conifers; 2. Hardwoods. Agriculture Handbook 654:877. Butler LG, Rogler JC. 1992. Biochemical-Mechanisms of the Antinutritional Effects of Tannins. Acs Symposium Series 506:298-304. Calderon O, Berkov A. 2012. Midgut and Fat Body Bacteriocytes in Neotropical Cerambycid Beetles (Coleoptera: Cerambycidae). Environmental Entomology 41(1):108-117. Cappaert D, McCullough DG, Poland TM, Siegert NW. 2005. Emerald Ash Borer in North America: A Research and Regulatory Challenge. American Entomologist 51(3):152-165. Carino F, Koener J, Plapp F, Feyereisen R. 1994. Constitutive Overexpression of the Cytochrome P450 Gene Cyp6a1in a House Fly Strain with Metabolic Resistance to Insecticides. Insect Biochemistry and Molecular Biology 24(4):411-418. Celorio-Mancera MdlP, Sundmalm SM, Vogel H, Rutishauser D, Ytterberg AJ, Zubarev RA, Janz N. 2012. Chemosensory Proteins, Major Salivary Factors in Caterpillar Mandibular Glands. Insect Biochemistry and Molecular Biology 42(10):796-805.
26
Chapman RF. 2003. Contact Chemoreception Infeeding by Phytophagous Insects. Annual Review of Entomology 48:455-484. Chararas C, Courtois JE. 1976. Nutrition and Digestive Enzymes Activity of Dendroctonus Micans Kug. Comptes Rendus Des Seances De La Societe De Biologie Et De Ses Filiales 170(6):1155-1158. Chen MS. 2008. Inducible Direct Plant Defense against Insect Herbivores: A Review. Insect Science 15(2):101-114. Chen Y, Cassone BJ, Bai X, Redinbaugh MG, Michel AP. 2012. Transcriptome of the Plant Virus Vector Graminella Nigrifrons, and the Molecular Interactions of Maize Fine Streak Rhabdovirus Transmission. Plos One 7(7):e40613-e40613. Church A, Legters C, Papa J, Tymochko L, Elnitsky MA. 2012. Antioxidant Capacity and Oxidative Stress in the Freeze-Tolerant Woolly Bear Caterpillar, Pyrrharctia Isabella. Integrative and Comparative Biology 52:E226-E226. Cianfrogna JA, Zangerl AR, Berenbaum MR. 2002. Dietary and Developmental Influences on Induced Detoxification in an Oligophage. Journal of Chemical Ecology 28(7):1349-1364. Close DC, McArthur C. 2002. Rethinking the Role of Many Plant Phenolics–Protection from Photodamage Not Herbivores? Oikos 99(1):166-172. Debnath M, Prasad G, Bisen PS. 2010. Omics Technology. New York: Springer. 11-31 p. Degraeve GM, Geiger DL, Meyer JS, Bergman HL. 1980. Acute and Embryo-Larval Toxicity of Phenolic-Compounds to Aquatic Biota. Archives of Environmental Contamination and Toxicology 9(5):557-568. Despres L, David J-P, Gallet C. 2007. The Evolutionary Ecology of Insect Resistance to Plant Chemicals. Trends in Ecology & Evolution 22(6):298-307. Dobler S, Dalla S, Wagschal V, Agrawal AA. 2012. Community-Wide Convergent Evolution in Insect Adaptation to Toxic Cardenolides by Substitutions in the Na,K-Atpase. Proceedings of the National Academy of Sciences of the United States of America 109(32):13040-13045. Dreher-Lesnick SM, Mulenga A, Simser JA, Azad AF. 2006. Differential Expression of Two Glutathione S-Transferases Identified from the American Dog Tick, Dermacentor Variabilis. Insect Molecular Biology 15(4):445-453. Dreyer DL, Jones KC. 1981. Feeding Deterrency of Flavonoids and Related Phenolics Towards Schizaphis Graminum and Myzus Persicae - Aphid Feeding Deterrents in Wheat. Phytochemistry 20(11):2489-2493. DUffey SS. 1980. Sequestration of Plant Natural Products by Insects. Annual Review of Entomology 25(1):447-477. Felton GW, Donato KK, Broadway RM, Duffey SS. 1992. Impact of Oxidized Plant Phenolics on the Nutritional Quality of Dietary-Protein to a Noctuid Herbivore, Spodoptera Exigua. Journal of Insect Physiology 38(4):277-285. Felton GW, Summers CB. 1995. Antioxidant Systems in Insects. Archives of Insect Biochemistry and Physiology 29(2):187-197.
27
Ferreira C, Parra JRP, Terra WR. 1997. The Effect of Dietary Plant Glycosides on Larval Midgut Beta-Glucosidases from Spodoptera Frugiperda and Diatraea Saccharalis. Insect Biochemistry and Molecular Biology 27(1):55-59. Feyereisen R. 1999. Insect P450 Enzymes. Annual Review of Entomology 44:507-533. Feyereisen R. 2006. Evolution of Insect P450. Biochemical Society Transactions 34:1252-1255. Feyereisen R. 2011. Arthropod Cypomes Illustrate the Tempo and Mode in P450 Evolution. Biochimica Et Biophysica Acta-Proteins and Proteomics 1814(1):19- 28. Francis F, Vanhaelen N, Haubruge E. 2005. Glutathione S-Transferases in the Adaptation to Plant Secondary Metabolites in the Myzus Persicae Aphid. Archives of Insect Biochemistry and Physiology 58(3):166-174. Fridovich I. 1983. Superoxide Radical - an Endogenous Toxicant. Annual Review of Pharmacology and Toxicology 23:239-257. Gandhi KJK, Herms DA. 2010. Direct and Indirect Effects of Alien Insect Herbivores on Ecological Processes and Interactions in Forests of Eastern North America. Biological Invasions 12(2):389-405. Gershenzon J, Rossiter M, Mabry TJ, Rogers CE, Blust MH, Hopkins TL. 1985. Insect Antifeedant Terpenoids in Wild Sunflower - a Possible Source of Resistance to the Sunflower Moth. Acs Symposium Series 276:432-446. Ghumare SS, Mukherjee SN, Sharma RN. 1989. Effect of Rutin on the Neonate Sensitivity, Dietary Utilization and Midgut Carboxylesterase Activity of Spodoptera Litura (Fabricius) (Lepidoptera, Noctuidae). Proceedings of the Indian Academy of Sciences-Animal Sciences 98(6):399-404. Goh DKS, Anspaugh DD, Motoyama N, Rock GC, Roe RM. 1995. Isolation and Characterization of an Insecticide-Resistance-Associated Esterase in the Tobacco Budworm Heliothis Virescens (F). Pesticide Biochemistry and Physiology 51(3):192-204. Green TR, Ryan CA. 1972. Wound-Induced Proteinase Inhibitor in Plant Leaves - Possible Defense Mechanism against Insects. Science 175(4023):776-&. Gunasekaran K, Muthukumaravel S, Sahu SS, Vijayakumar T, Jambulingam P. 2011. Glutathione S Transferase Activity in Indian Vectors of Malaria: A Defense Mechanism against Ddt. Journal of Medical Entomology 48(3):561-569. Haack RA, Jendek E, Liu H, Marchant KR, Petrice TR, Poland TM, Ye H. 2002. The Emerald Ash Borer: A New Exotic Pest in North America. Newsletter of the Michigan Entomological Society 47(3-4):1-5. Habig WH, Pabst MJ, Jakoby WB. 1974. Glutathione S-Transferases - First Enzymatic Step in Mercapturic Acid Formation. Journal of Biological Chemistry 249(22):7130-7139. Hampton T. 2010. Body Louse Genome. JAMA: The Journal of the American Medical Association 304(7):733-733. Harper M, Hopkins T, Czapla T. 1998. Effect of Wheat Germ Agglutinin on Formation and Structure of the Peritrophic Membrane in European Corn Borer (Ostrinia Nubilalis) Larvae. Tissue and Cell 30(2):166-176. 28
Heckel DG. 2003. Genomics in Pure and Applied Entomology. In: Berenbaum MR, Carde RT, Robinson GE, editors. Annual Review of Entomology. Volume 48. p 235-260. Heckel DG. 2012. Learning the Abcs of Bt: Abc Transporters and Insect Resistance to Bacillus Thuringiensis Provide Clues to a Crucial Step in Toxin Mode of Action. Pesticide Biochemistry and Physiology 104(2):103-110. Hegedus D, Erlandson M, Gillott C, Toprak U. 2009. New Insights into Peritrophic Matrix Synthesis, Architecture, and Function. Annual Review of Entomology 54:285-302. Heid CA, Stevens J, Livak KJ, Williams PM. 1996. Real Time Quantitative Pcr. Genome research 6(10):986-994. Herms DA, Stone AK, Chatfield JA. 2004. Emerald Ash Borer: The Beginning of the End of Ash in North America? Special Circular-Ohio Agricultural Research and Development Center:62-71. Hernandez-Martinez P, Sara Hernandez-Rodriguez C, Krishnan V, Crickmore N, Escriche B, Ferre J. 2012. Lack of Cry1fa Binding to the Midgut Brush Border Membrane in a Resistant Colony of Plutella Xylostella Moths with a Mutation in the Abcc2 Locus. Applied and Environmental Microbiology 78(18):6759-6761. Higgins CF. 1992. Abc Transporters - from Microorganisms to Man. Annual review of cell biology 8:67-113. Holzinger F, Frick C, Wink M. 1992. Molecular-Basis for the Insensitivity of the Monarch (Danaus Plexippus) to Cardiac-Glycosides. Febs Letters 314(3):477- 480. Holzinger F, Wink M. 1996. Mediation of Cardiac Glycoside Insensitivity in the Monarch Butterfly (Danaus Plexippus): Role of an Amino Acid Substitution in the Ouabain Binding Site of Na+,K+-Atpase. Journal of Chemical Ecology 22(10):1921-1937. Hu X, Chen L, Xiang X, Yang R, Yu S, Wu X. 2012. Proteomic Analysis of Peritrophic Membrane (Pm) from the Midgut of Fifth-Instar Larvae, Bombyx Mori. Molecular Biology Reports 39(4):3427-3434. Hung CF, Kao CH, Liu CC, Lin JG, Sun CN. 1990. Detoxifying Enzymes of Selected Insect Species with Chewing and Sucking Habits. Journal of Economic Entomology 83(2):361-365. Imlay JA, Chin SM, Linn S. 1988. Toxic DNA Damage by Hydrogen Peroxide through the Fenton Reaction in Vivo and in Vitro. Science (New York, NY) 240(4852):640. Ishimoto M, Kuroda M, Yoza K, Nishizawa K, Teraishi M, Mizutani N, Ito K, Moriya S. 2012. Heterologous Expression of Corn Cystatin in Soybean and Effect on Growth of the Stink Bug. Bioscience Biotechnology and Biochemistry 76(11):2142-2145. Jansen JJ, Allwood JW, Marsden-Edwards E, van der Putten WH, Goodacre R, van Dam NM. 2009. Metabolomic Analysis of the Interaction between Plants and Herbivores. Metabolomics 5(1):150-161.
29
Jongsma MA, Beekwilder J. 2011. Co-Evolution of Insect Proteases and Plant Protease Inhibitors. Current Protein & Peptide Science 12(5):437-447. Kanofsky J, Axelrod B. 1986. Singlet Oxygen Production by Soybean Lipoxygenase Isozymes. Journal of Biological Chemistry 261(3):1099-1104. Kao LR, Motoyama N, Dauterman WC. 1984. Studies on Hydrolases in Various Housefly Strains and Their Role in Malathion Resistance. Pesticide Biochemistry and Physiology 22(1):86-92. Karban R, Agrawal AA. 2002. Herbivore Offense. Annual Review of Ecology and Systematics 33:641-664. Kodzius R, Kojima M, Nishiyori H, Nakamura M, Fukuda S, Tagami M, Sasaki D, Imamura K, Kai C, Harbers M. 2006. Cage: Cap Analysis of Gene Expression. Nature Methods 3(3):211-222. Krieger RI, Feeny PP, Wilkinso.Cf. 1971. Detoxication Enzymes in Guts of Caterpillars - Evolutionary Answer to Plant Defenses. Science 172(3983):579-&. Krishnan N, Kodrík D. 2006. Antioxidant Enzymes in Spodoptera Littoralis (Boisduval): Are They Enhanced to Protect Gut Tissues During Oxidative Stress? Journal of Insect Physiology 52(1):11. Kristensen M. 2005. Glutathione S-Transferase and Insecticide Resistance in Laboratory Strains and Field Populations of Musca Domestica. Journal of Economic Entomology 98(4):1341-1348. Krug E, Proksch P. 1993. Influence of Dietary Alkaloids on Survival and Growth of Spodoptera Littoralis. Biochemical Systematics and Ecology 21(8):749-756. Labbe R, Caveney S, Donly C. 2011. Genetic Analysis of the Xenobiotic Resistance- Associated Abc Gene Subfamilies of the Lepidoptera. Insect Molecular Biology 20(2):243-256. Langenheim JH. 1994. Higher-Plant Terpenoids - a Phytocentric Overview of Their Ecological Roles. Journal of Chemical Ecology 20(6):1223-1280. Lanning CL, Fine RL, Corcoran JJ, Ayad HM, Rose RL, AbouDonia MB. 1996. Tobacco Budworm P-Glycoprotein: Biochemical Characterization and Its Involvement in Pesticide Resistance. Biochimica Et Biophysica Acta-General Subjects 1291(2):155-162. Larson RA. 1986. Insect Defenses against Phototoxic Plant-Chemicals. Journal of Chemical Ecology 12(4):859-870. Le Goff G, Hilliou F, Siegfried BD, Boundy S, Wajnberg E, Sofer L, Audant P, Ffrench- Constant RH, Feyereisen R. 2006. Xenobiotic Response in Drosophila Melanogaster: Sex Dependence of P450 and Gst Gene Induction. Insect Biochemistry and Molecular Biology 36(8):674-682. Lee K, Berenbaum MR. 1989. Action of Antioxidant Enzymes and Cytochrome-P-450 Monooxygenases in the Cabbage-Looper in Response to Plant Phototoxins. Archives of Insect Biochemistry and Physiology 10(2):151-162. Lee KW, Berenbaum MR. 1990. Defense of Parsnip Webworm against Phototoxic Furanocoumarins - Role of Antioxidant Enzymes. Journal of Chemical Ecology 16(8):2451-2460.
30
Lehane M. 1997. Peritrophic Matrix Structure and Function. Annual Review of Entomology 42(1):525-550. Levinson HZ. 1976. Defensive Role of Alkaloids in Insects and Plants. Experientia 32(4):408-411. Li C, Song X, Li G, Wang P. 2009. Midgut Cysteine Protease-Inhibiting Activity in Trichoplusia Ni Protects the Peritrophic Membrane from Degradation by Plant Cysteine Proteases. Insect Biochemistry and Molecular Biology 39(10):726-734. Li J-Y, Li J-S, Zhong B-X. 2012. Proteomic Profiling of the Hemolymph at the Fifth Instar of the Silkworm Bombyx Mori. Insect Science 19(4):441-454. Li XC, Berenbaum MR, Schuler MA. 2002. Plant Allelochemicals Differentially Regulate Helicoverpa Zea Cytochrome P450 Genes. Insect Molecular Biology 11(4):343-351. Lindroth RL. 1988. Hydrolysis of Phenolic Glycosides by Midgut Beta-Glucosidases in Papilio Glaucus Subspecies. Insect Biochemistry 18(8):789-792. Lindroth RL, Weisbrod AV. 1991. Genetic-Variation in Response of the Gypsy-Moth to Aspen Phenolic Glycosides. Biochemical Systematics and Ecology 19(2):97-103. Liu H, Bauer LS, Gao R, Zhao T, Petrice TR, Haack RA. 2003. Exploratory Survey for the Emerald Ash Borer, Agrilus Planipennis (Coleoptera: Buprestidae), and Its Natural Enemies in China. Great Lakes Entomologist 36:191-204. Liu Y. 1966. A Study on the Ash Buprestid Beetle, Agrilus Sp. Shenyang. Annual Report of Shenyang Horticulture Research Institute, Shenyang, Liaoning, China:1-16. Liu ZL, Ho SH, Goh SH. 2008. Effect of Fraxinellone on Growth and Digestive Physiology of Asian Corn Borer, Ostrinia Furnacalis Guenee. Pesticide Biochemistry and Physiology 91(2):122-127. Liu ZL, Ho SH, Goh SH. 2009. Modes of Action of Fraxinellone against the Tobacco Budworm, Heliothis Virescens. Insect Science 16(2):147-155. Lumjuan N, McCarroll L, Prapanthadara LA, Hemingway J, Ranson H. 2005. Elevated Activity of an Epsilon Class Glutathione Transferase Confers Ddt Resistance in the Dengue Vector, Aedes Aegypti. Insect Biochemistry and Molecular Biology 35(8):861-871. Mao LX, Henderson G. 2007. Antifeedant Activity and Acute and Residual Toxicity of Alkaloids from Sophora Flavescens (Leguminosae) against Formosan Subterranean Termites (Isoptera : Rhinotermitidae). Journal of Economic Entomology 100(3):866-870. Marie JP. 1992. Drug-Resistance Genes. Presse Medicale 21(22):1033-1037. Martemyanov VV, Dubovskiy IM, Belousova IA, Pavlushin SV, Domrachev DV, Rantala MJ, Salminen JP, Bakhvalov SA, Glupov VV. 2012. Rapid Induced Resistance of Silver Birch Affects Both Innate Immunity and Performance of Gypsy Moths: The Role of Plant Chemical Defenses. Arthropod-Plant Interactions 6(4):507-518. Marty MA, Krieger RI. 1984. Metabolism of Uscharidin, a Milkweed Cardenolide, by Tissue Homogenates of Monarch Butterfly Larvae, Danaus Plexippus L. Journal of Chemical Ecology 10(6):945-956.
31
Matsukura K, Shiba T, Sasaki T, Matsumura M. 2012. Enhanced Resistance to Four Species of Clypeorrhynchan Pests in Neotyphodium Uncinatum Infected Italian Ryegrass. Journal of Economic Entomology 105(1):129-134. Mayhew PJ. 1997. Adaptive Patterns of Host-Plant Selection by Phytophagous Insects. Oikos:417-428. Mayhew PJ. 2001. Herbivore Host Choice and Optimal Bad Motherhood. Trends in Ecology & Evolution 16(4):165-167. Miles PW, Oertli JJ. 1993. The Significance of Antioxidants in the Aphid-Plant Interaction - the Redox Hypothesis. Entomologia Experimentalis Et Applicata 67(3):275-283. Mithöfer A, Boland W. 2012. Plant Defense against Herbivores: Chemical Aspects. Annual Review of Plant Biology 63:431-450. Mittapalli O, Neal JJ, Shukle RH. 2007a. Antioxidant Defense Response in a Galling Insect. Proceedings of the National Academy of Sciences 104(6):1889-1894. Mittapalli O, Neal JJ, Shukle RH. 2007b. Tissue and Life Stage Specificity of Glutathione S-Transferase Expression in the Hessian Fly, Mayetiola Destructor: Implications for Resistance to Host Allelochemicals. Journal of Insect Science 7. Mole S, Rogler JC, Butler LG. 1993. Growth Reduction by Dietary Tannins - Different Effects Due to Different Tannins. Biochemical Systematics and Ecology 21(6- 7):667-677. Moore LV, Scudder GGE. 1986. Ouabain-Resistant Na,K-Atpases and Cardenolide Tolerance in the Large Milkweed Bug, Oncopeltus Fasciatus. Journal of Insect Physiology 32(1):27-33. Morgan ED. 2010. Plant Substances Altered and Sequestered by Insects. 315-331 p. Mu S-F, Liang P, Gao X-W. 2006. Effects of Quercetin on Specific Activity of Carboxylesterase and Glutathione S-Transferases in Bemisia Tabaci. Chinese Bulletin of Entomology 43(4):491-495. Müller C, Agerbirk N, Olsen CE, Boevé J-L, Schaffner U, Brakefield PM. 2001. Sequestration of Host Plant Glucosinolates in the Defensive Hemolymph of the Sawfly Athalia Rosae. Journal of Chemical Ecology 27(12):2505-2516. Mullin CA, Alfatafta AA, Harman JL, Serino AA, Everett SL. 1991. Corn-Rootworm Feeding on Sunflower and Other Compositae - Influence of Floral Terpenoid and Phenolic Factors. Acs Symposium Series 449:278-292. Murray KD, Hasegawa S, Alford AR. 1999. Antifeedant Activity of Citrus Limonoids against Colorado Potato Beetle: Comparison of Aglycones and Glucosides. Entomologia Experimentalis Et Applicata 92(3):331-334. Nealis VG, Nault JR. 2005. Seasonal Changes in Foliar Terpenes Indicate Suitability of Douglas-Fir Buds for Western Spruce Budworm. Journal of Chemical Ecology 31(4):683-696. Nebert DW, Gonzalez F. 1987. P450 Genes: Structure, Evolution, and Regulation. Annual review of biochemistry 56(1):945-993.
32
Nicholson SJ, Hartson SD, Puterka GJ. 2012. Proteomic Analysis of Secreted Saliva from Russian Wheat Aphid (Diuraphis Noxia Kurd.) Biotypes That Differ in Virulence to Wheat. Journal of Proteomics 75(7):2252-2268. Nishida R. 2002. Sequestration of Defensive Substances from Plants by Lepidoptera. Annual Review of Entomology 47(1):57-92. Ottea J, Plapp F. 1981. Induction of Glutathione S-Aryl Transferase by Phenobarbital in the House Fly. Pesticide Biochemistry and Physiology 15(1):10-13. Pechan T, Cohen A, Williams WP, Luthe DS. 2002. Insect Feeding Mobilizes a Unique Plant Defense Protease That Disrupts the Peritrophic Matrix of Caterpillars. Proceedings of the National Academy of Sciences 99(20):13319-13323. Poland TM, McCullough DG. 2006. Emerald Ash Borer: Invasion of the Urban Forest and the Threat to North Americas Ash Resource. Journal of Forestry 104(3):118- 124. Rawlings ND, Tolle DP, Barrett AJ. 2004. Evolutionary Families of Peptidase Inhibitors. Biochemical Journal 378:705-716. Rebek EJ, Herms DA, Smitley DR. 2008. Interspecific Variation in Resistance to Emerald Ash Borer (Coleoptera : Buprestidae) among North American and Asian Ash (Fraxinus Spp.). Environmental Entomology 37(1):242-246. Rehman F, Khan FA, Badruddin SMA. 2012. Role of Phenolics in Plant Defense against Insect Herbivory. Khemani LD, Srivastava MM, Srivastava S, editors. 309-313 p. Ryan CA. 1989. Proteinase-Inhibitor Gene Families - Strategies for Transformation to Improve Plant Defenses against Herbivores. Bioessays 10(1):20-24. Ryan CA. 1990. Protease Inhibitors in Plants - Genes for Improving Defenses against Insects and Pathogens. Annual Review of Phytopathology 28:425-449. Schena M, Shalon D, Davis RW, Brown PO. 1995. Quantitative Monitoring of Gene- Expression Patterns with a Complementary-Dna Microarray. Science 270(5235):467-470. Schloss PD, Delalibera Jr I, Handelsman J, Raffa KF. 2006. Bacteria Associated with the Guts of Two Wood-Boring Beetles: Anoplophora Glabripennis and Saperda Vestita (Cerambycidae). Environmental Entomology 35(3):625-629. Schuler MA. 2011. P450s in Plant-Insect Interactions. Biochimica Et Biophysica Acta- Proteins and Proteomics 1814(1):36-45. Serdjukova IR. 1993. Investigation of Digestive Enzymes of Some Wood-Boring Beetles Larvae (Coleoptera, Anobiidae). Zoologichesky Zhurnal 72(6):43-51. Sharma R, Negi DS, Shin WKP, Gibbons S. 2006. Characterization of an Insecticidal Coumarin from Boenninghausenia Albiflora. Phytotherapy Research 20(7):607- 609. Simmons J, D'Souza O, Rheault M, Donly C. 2012. Multidrug Resistance Protein Gene Expression in Trichoplusia Ni Caterpillars. Insect Molecular Biology. Sintim HO, Tashiro T, Motoyama N. 2012. Effect of Sesame Leaf Diet on Detoxification Activities of Insects with Different Feeding Behavior. Archives of Insect Biochemistry and Physiology 81(3):148-159. Snyder M, Glendinning J. 1996. Causal Connection between Detoxification Enzyme Activity and Consumption of a Toxic Plant Compound. Journal of Comparative 33
Physiology A: Neuroethology, Sensory, Neural, and Behavioral Physiology 179(2):255-261. Snyder MJ, Walding JK, Feyereisen R. 1994. Metabolic-Fate of the Allelochemical Nicotine in the Tobacco Hornworm Manduca Sexta. Insect Biochemistry and Molecular Biology 24(8):837-846. Sonoda S, Tsumuki H. 2005. Studies on Glutathione S-Transferase Gene Involved in Chlorfluazuron Resistance of the Diamondback Moth, Plutella Xylostella L. (Lepidoptera : Yponomeutidae). Pesticide Biochemistry and Physiology 82(1):94- 101. Sorensen JS, Dearing MD. 2006. Efflux Transporters as a Novel Herbivore Countermechanism to Plant Chemical Defenses. Journal of Chemical Ecology 32(6):1181-1196. Stevens JL, Snyder MJ, Koener JF, Feyereisen R. 2000. Inducible P450s of the Cyp9 Family from Larval Manduca Sexta Midgut. Insect Biochemistry and Molecular Biology 30(7):559-568. Sun HL, Blanford S, Guo YY, Fu XJ, Shi WP. 2012a. Toxicity and Influences of the Alkaloids from Cynanchum Komarovii Al. Iljinski (Asclepiadaceae) on Growth and Cuticle Components of Spodoptera Litura Fabricius (Noctuidae) Larvae. Natural Product Research 26(10):903-912. Sun SF, Cheng ZS, Fan J, Cheng XH, Pang Y. 2012b. The Utility of Camptothecin as a Synergist of Bacillus Thuringiensis Var. Kurstaki and Nucleopolyhedroviruses against Trichoplusia Ni and Spodoptera Exigua. Journal of Economic Entomology 105(4):1164-1170. Tokuda G, Miyagi M, Makiya H, Watanabe H, Arakawa G. 2009. Digestive Beta- Glucosidases from the Wood-Feeding Higher Termite, Nasutitermes Takasagoensis: Intestinal Distribution, Molecular Characterization, and Alteration in Sites of Expression. Insect Biochemistry and Molecular Biology 39(12):931- 937. Ugale TB, Barkhade UP, Moharil MP, Ghule S. 2011. Induction of Midgut Glutathione S-Transferase in Helicoverpa Armigera (Hubner) by Different Hosts and Its Influence on Insecticide Metabolism. Crop Research (Hisar) 42(1-3):276-283. Vandenborre G, Smagghe G, Van Damme EJM. 2011. Plant Lectins as Defense Proteins against Phytophagous Insects. Phytochemistry 72(13):1538-1550. Velculescu VE, Zhang L, Vogelstein B, Kinzler KW. 1995. Serial Analysis of Gene Expression. Science-AAAS-Weekly Paper Edition 270(5235):484-486. Vera N, Popich S, Luna L, Cravero R, Sierra MG, Bardón A. 2006. Toxicity and Synergism in the Feeding Deterrence of Some Coumarins on Spodoptera Frugiperdasmith (Lepidoptera: Noctuidae). Chemistry & biodiversity 3(1):21-26. Wang Y, Qiu L, Ranson H, Lumjuan N, Hemingway J, Setzer WN, Meehan EJ, Chen L. 2008. Structure of an Insect Epsilon Class Glutathione S-Transferase from the Malaria Vector Anopheles Gambiae Provides an Explanation for the High Ddt- Detoxifying Activity. Journal of Structural Biology 164(2):228-235. Wang Y, Wang L, Zhu Z, Ma W, Lei C. 2012. The Molecular Characterization of Antioxidant Enzyme Genes in Helicoverpa Armigera Adults and Their 34
Involvement in Response to Ultraviolet-a Stress. Journal of Insect Physiology 58(9):1250-1258. Wang Z, Gerstein M, Snyder M. 2009. Rna-Seq: A Revolutionary Tool for Transcriptomics. Nature Reviews Genetics 10(1):57-63. White KP, Rifkin SA, Hurban P, Hogness DS. 1999. Microarray Analysis of Drosophila Development During Metamorphosis. Science 286(5447):2179-2184. Whitfield CW, Cziko A, Band M, Liu L, Pardinas J, Soares B, Robertson H, Robinson GE. 2001. Social Regulation of Behavior in the Honey Bee: Expressed Sequence Tags and Microarray Analysis of Gene Expression in the Brain. Society for Neuroscience Abstracts 27(2):2541-2541. Whyard S, Downe AER, Walker VK. 1994a. Isolation of an Esterase Conferring Insecticide Resistance in the Mosquito Culex Tarsalis. Insect Biochemistry and Molecular Biology 24(8):819-827. Whyard S, Russell RJ, Walker VK. 1994b. Insecticide Resistance and Malathion Carboxylesterase in the Sheep Blowfly, Lucilia-Cuprina. Biochemical Genetics 32(1-2):9-24. Wu S, Peiffer M, Luthe DS, Felton GW. 2012. Atp Hydrolyzing Salivary Enzymes of Caterpillars Suppress Plant Defenses. Plos One 7(7). Wu S, Yang Y, Yuan G, Campbell PM, Teese MG, Russell RJ, Oakeshott JG, Wu Y. 2011. Overexpressed Esterases in a Fenvalerate Resistant Strain of the Cotton Bollworm, Helicoverpa Armigera. Insect Biochemistry and Molecular Biology 41(1):14-21. Yamamoto K, Teshiba S, Aso Y. 2008. Characterization of Glutathione S-Transferase of the Rice Leaffolder Moth, Cnaphalocrocis Medinalis (Lepidoptera: Pyralidae): Comparison of Its Properties of Glutathione S-Transferases from Other Lepidopteran Insects. Pesticide Biochemistry and Physiology 92(3):125-128. Yang LH, Huang H, Wang JJ. 2010. Antioxidant Responses of Citrus Red Mite, Panonychus Citri (Mcgregor)(Acari: Tetranychidae), Exposed to Thermal Stress. Journal of Insect Physiology 56(12):1871-1876. Yu S. 1986. Consequences of Induction of Foreign Compound-Metabolizing Enzymes in Insects. Yu SJ. 1982. Host Plant Induction of Glutathione S-Transferase in the Fall Armyworm. Pesticide Biochemistry and Physiology 18(1):101-106. Yu SJ. 1992. Plant-Allelochemical-Adapted Glutathione Transferases in Lepidoptera. Acs Symposium Series 505:174-190. Zalucki MP, Malcolm SB, Paine TD, Hanlon CC, Brower LP, Clarke AR. 2001. It’s the First Bites That Count: Survival of First-Instar Monarchs on Milkweeds. Austral Ecology 26(5):547-555. Zangerl AR, Bazzaz FA. 1992. Theory and Pattern in Plant Defense Allocation. Plant resistance to herbivores and pathogens: ecology, evolution, and genetics. University of Chicago Press, Chicago, Illinois, USA:363-391. Zdobnov EM, Bork P. 2007. Quantification of Insect Genome Divergence. Trends in Genetics 23(1):16-20.
35
Zhang T, Wei Z-G, Gao R-N, Wang R-X, Zhao G-D, Li B, Shen W-D. 2011. Induction of Expression of Partial Glutathione-S-Transferase Genes in Bombyx Mori by Rutin. Acta Entomologica Sinica 54(1):20-26.
36
Chapter 2: Validation of reference genes for gene expression studies in emerald ash borer (Agrilus planipennis)
Abstract
Emerald ash borer (EAB, Agrilus planipennis Fairmaire) an exotic invasive insect pest has killed millions ash trees (Fraxinus spp.) across North American and threatens billions more. In this study, we validated six A. planipennis reference genes (actin, ACT; beta tubulin β-TUB; glyceraldehyde-3- phosphate dehydrogenase, GAPDH; ribosomal protein, RPL7; translation elongation factor, TEF-1α; and ubiquitin, UBQ) using geNorm, Normfinder and BestKeeper for accurate determination of target mRNA levels in gene expression studies of A.planipennis. The stability of the six reference genes was evaluated in different larval tissues, developmental stages and two treatments of A. planipennis using quantitative real-time PCR (RT-qPCR). Though there was no consistent ranking observed among the reference genes across the samples, the overall analysis revealed TEF-1α as the most stable reference gene. Given the variation found in the stability of genes in A. planipennis, it is essential to validate multiple reference genes prior to performing gene expression analysis of target genes. GAPDH and ACT showed least stability for all the samples studied. Thus, I conclude that TEF1- α is the most appropriate reference gene for gene expression studies in larval tissues, developmental stages and treatments of A. planipennis.
37
Introduction
Quantitative real-time polymerase chain reaction (RT-qPCR) is the most reliable method for detection and quantification of transcript abundance (Bustin 2002). The sensitivity of RT-qPCR to detect subtle changes in gene expression under different conditions makes it an exceptional and trustworthy technique for quantification of mRNA levels even for low abundant transcripts (compared to Northern blotting). The procurement of accurate results from RT-qPCR is negatively correlated to the background errors i.e. lower the background error, greater the accuracy. Background errors constitute several parameters including quality and integrity of RNA samples, amount of starting material, efficiency of complementary DNA (cDNA) synthesis, transcriptional activity in the biological samples, primer design and retrotranscription efficiency (Andersen et al. 2004 ). In order to correct for such errors, normalization is required using a reference gene. Usually reference genes are those that are involved in basic cellular processes and are constitutively expressed across treatments. Reference genes are also known as internal control or housekeeping genes. In RT-qPCR, since the target gene is compared to the reference gene, it is necessary to select at least two or three stable reference genes for accurate quantification of target gene expression
(Vandesompele et al. 2002).
Emerald ash borer (Agrilus planipennis Fairmaire) has become a major invasive insect of North American ash (Fraxinus spp). Since its discovery in 2002, it has killed millions of ash trees and threatens billions more across the United States (Herms et al.
38
2003). With the advent of next generation sequencing methods, tissue-specific transcriptomic database for A. planipennis using 454 pyrosequencing was developed
(Mittapalli et al. 2010). Deciphering gene expression profiles and validation of mRNA levels for candidate genes via RT-qPCR has been crucial to on-going studies; also there is a paucity of knowledge on reference genes in insect systems. Thus far glyceraldehyde-3- phosphate dehydrogenase (GAPDH), actin (ACT), translation elongation factor 1α
(TEF1- α), phospholipase A2 (PLA2), arginine kinase (AK), ribosomal proteins (RP49,
RPS3, RPS18, RPL13a), have been reported to be stable reference genes in insects (Jiang et al. 2010; Van Hiel et al. 2009; Hornakova et al. 2010; Lord et al. 2010; de Boer et al.
2009; Scharlaken et al. 2008). To my knowledge this is the first report on the selection of reference genes for gene expression studies in A. planipennis.
Materials and Methods
In this study, I selected six candidate reference genes including ACT, β-TUB
(beta tubulin), GAPDH, RPL7, TEF-1α and UBQ (ubiquitin). Total RNA was isolated from three larval tissues (midgut, fat body and cuticle of late 3rd-instars) and from six developmental stages (1st, 2nd, 3rd, 4th, prepupal and adults) using Trizol reagent
(Invitrogen). Larvae feeding on green (F. pennsylvanica) and white (F. americana) ash species represented treatments (although both species are susceptible to A. planipennis, they respond differently). Approximately 1-2 µg of total RNA was used as the template for first strand cDNA synthesis using Superscript II cDNA synthesis kit (Invitrogen).
39
Resultant cDNA was diluted to 20 ng/µl concentration and used as template for RT- qPCR.
Primer pairs were designed using the Beacon primer designer 7.0 software
o o (BioRad) with optimal parameters (20-24 bp in length, Tm of 50 C - 60 C and a product size of 90-220 bp). Relative expression value for the genes was calculated using the standard curve method (User Bulletin #2: ABI Prism 7700 Sequence Detection System vide supra (http://www3.appliedbiosystems.com/). Standard curves were constructed with serially diluted pooled cDNA samples. Correlation co-efficient (R2) and PCR efficiency
(E %) was calculated from the standard curve. All the tested primer sets showed an R2 above 0.99 with E values ranging from 89.28 - 102.07 (Table 2.1). Stability analysis for the six reference genes was done using three different softwares (excel add-ins): geNorm
(Vandesompele et al. 2002), Normfinder (Andersen et al. 2004) and Bestkeeper (Pfaffl
2004).
Results and Discussion:
The stability values calculated for six candidate reference genes using geNORM revealed TEF-1α as the best reference gene for A. planipennis irrespective of the samples
(Fig 2.1A, 2.1C, 2.1E). ACT was scored rank #2 in developmental stages; however it was the least stable in tissues and treatments (Table 2.2). The minimum number of genes required for optimal normalization varied across the samples: while 2 genes were suggested for the tissue and treatment samples, 5 genes were suggested for the
40 developmental samples (Fig. 2.1B, 2.1D,2.1F ). geNORM calculates the average expression stability value (M) and gives the two most stable genes out of the set of genes submitted. The lower the M value, the more stable is the gene with the maximum cut off of 1.5. A normalization factor is calculated based on the geometric mean of the most stable gene and a pairwise variation (V) is calculated between the sequential normalization factors to decipher the optimal number of genes required for precise estimation of target mRNA levels (Vandesompele et al. 2002).
In accordance with geNORM, the stability analysis output obtained with
Normfinder revealed TEF-1α as the most stable gene across all samples except for the developmental samples, for which TEF-1α was scored 2nd for stability (Table 2.2B). geNORM and Normfinder operate on the same principle but the latter has an underlying mathematical model which calculates the stability value by combining the inter- and intra- group expression value(s). Variation in expression of the genes is reciprocally related to their stability value, i.e. lower the stability value, lesser is the variation in gene expression among the samples assayed (Andersen et al. 2004).
There was no consistent ranking observed for the reference genes studied across the samples using the BestKeeper software. TEF-1α was observed to be stable only in the treatment samples in contrast to the results obtained with geNORM and Normfinder.
However, individual analyses demonstrated that all the genes were stable in tissues, whereas only RPL7 and TEF-1α were verified to be stable in the development samples
(Table 2.2C). BestKeeper calculates the descriptive statistics of the given set of genes and obtains a BestKeeper index from the most stable expressed gene (Pfaffl et al. 2004).
41
Pairwise comparison of all the genes to BestKeeper index identifies the genes with similar expression patterns. Therefore, this software also enables us to monitor the expression levels of target gene in comparison with reference gene. Assessment of expression stability is done based on the calculated variations including standard deviation and coefficient of variance. Ideally, genes that have a standard deviation less than one are considered to be stable (Table 2.2C).
In summary, stability analysis of reference genes in A. planipennis revealed TEF-
1α as the potential candidate for gene expression studies. TEF-1α is involved in protein synthesis and is widely used in gene expression studies in plants and animals including insects (Jiang et al 2010; Van Hiel et al. 2009; Tong et al. 2009; Wan et al. 2010; Shen et al. 2010). Another candidate reference gene identified in this study was RPL-7, which showed consistent stability across the samples assayed. Ribosomal proteins are involved in translation and protein synthesis and are reported to be best reference genes in many insects (Scharlaken et al. 2008; Hornakova et al. 2010). Irrespective of the software’s used, β-TUB and UBQ exhibited moderate stability across the samples assayed. While β-
TUB plays an important role in cell growth and response to stimuli, UBQ a highly conserved protein is vital for protein degradation and participates in several cellular functions (Hershko & Ciechanover 1998, Nielsen et al. 2010). Among the reference genes analyzed, GAPDH and ACT showed least stability for the samples examined. To conclude: albeit gene expression is highly affected by various physiological conditions such as tissue, age and treatments (Van Hiel 2009; Jiang et al. 2010; Hornakova et al.
2010), expression levels of TEF-1α was found to be most stable across all the samples
42 analyzed and thus would be recommended for normalization in gene expression studies of A. planipennis.
Acknowledgements
I thank Amy Stone, The Ohio State University Extension, for assisting with collection of A. planipennis larvae. I thank Loren Rivera-Vega (Department of Entomology, The
Ohio State University/OARDC).
43
Figure 2.1 Ranking, stability and determination of optimal number of reference genes for Agrilus planipennis using geNorm. A, C and E represent ranking based on average expression stability value (M) for tissues, developmental stages and treatments; B, D and Fdisplay optimal number of genes required for the accurate estimation of the target gene mRNA in tissues, developmental stages and treatments calculated by the pairwise variation (V) of the normalization factors (NFn and NFn+1). Note: ACT (actin), BTUB (β-tubulin), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), RPL7 (ribosomal protein), TEF-1α (translation elongation factor1α), and UBQ (ubiquitin).
44
Table 2. 2: Summarized output of the three softwares used for selecting best reference gene in Agrilus planipennis
a. GENORM
Rank Tissues Development Treatments 1 TEF-1α TEF-1α TEF-1α (0.188) (0.182) (0.205) 2 RPL7 ACT RPL7 (0.189) (0.194) (0.206) 3 β- TUB UBQ UBQ (0.205) (0.194) (0.230) 4 GAPDH GAPDH β- TUB (0.303) (0.227) (0.286) 5 UBQ β- TUB GAPDH (0.312) (0.228) (0.334) 6 ACT RPL7 ACT (0.332) (0.234) (0.414) b. NORMFINDER 1 TEF-1α β- TUB TEF-1α (0.035) (0.096) (0.050) 2 RPL7 TEF-1α RPL7 (0.035) (0.098) (0.056) 3 β- TUB UBQ UBQ (0.062) (0.109) (0.085) 4 UBQ RPL7 β- TUB (0.211) (0.156) (0.185) 5 GAPDH ACT GAPDH (0.261) (0.158) (0.300) 6 ACT GAPDH ACT (0.291) (0.195) (0.354) c. BESTKEEPER 1 RPL7 RPL7 TEF-1α (0.33) (0.92) (0.76) 2 UBQ TEF-1α RPL7 (0.41) (0.99) (0.833) 3 β- TUB UBQ UBQ (0.60) (1.03) (0.845) 4 TEF-1α β- TUB β- TUB (0.65) (1.27) (0.85) 5 ACT ACT GAPDH (0.72) (1.28) (1.0) 6 GAPDH GAPDH ACT (0.74) (1.37) (1.32)
45
References: Bustin SA, Quantification of mRNA using real-time reverse transcription PCR (RT- PCR): trends and problems, J. Mol. Endocrinol. 29: 23-39 (2002). Andersen CL, Jensen JL and Orntoft TF, Normalization of real-time quantitative reverse transcription–PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets, Cancer Res. 64: 5245–5250 (2004). Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A and Speleman F, Accurate normalization of real-time quantitative RT–PCR data by geometric averaging of multiple internal control genes, Genom Biol. 3: Research0034 (2002). Herms DA, Stone AK and Chatfield JA, Emerald ash borer: the beginning of the end of Ash in North America? In: Ornamental Plants: Annual Reports and Research Reviews Chatfield JA, Draper EA, Mathers HM, Dyke DE, Bennett PJ, and Boggs JF, eds. Ohio Agriculture Research and Development Center, Ohio State University Extension Special Circular 193 62-71 (2003). Mittapalli O, Bai X, Mamidala P, Rajarapu SP, Bonello P, and Herms DA, Tissue- specific transcriptomics of the exotic invasive insect pest emerald ash borer PLoS One 5(10): e13708 (2010). Jiang H, Liu Y, Tang P, Zhou A and Wang J, Validation of endogenous reference genes for insecticide-induced and developmental expression profiling of Liposcelis bostsrychophila (Psocoptera: Liposcelididae) Mol Biol Rep. 37: 1019-1029 (2010). Van Hiel MB, Van Wielendaele P, Temmerman L, Van Soest S, Vuerinckx K, Huybrechts R, Broeck JV and Simonet G, Identification and validation of housekeeping genes in brains of the desert locust Schistocerca gregaria under different developmental conditions. BMC Mol Biol. 10:56 (2009). Hornakova D, Matouskova P, Kindl J, Valterova I and Pichova I, Selection of reference genes for real-time polymerase chain reaction analysis in tissues from Bombus terrestris and Bombus lucorum of different ages, Anal Biochem. 397: 118-120 (2010). Lord JC, Hartzer K, Toutges M and Oppert B, Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge Journal of Microb Methods. 80: 219-221 (2010). de Boer M, de Boer T, Marien J, Timmermans M, Nota B, van Straalen N, Ellers J and Roelofs D, Reference genes for QRT-PCR tested under various stress conditions in Folsomia candida and Orchesella cincta (Insecta, Collembola), BMC Mol Biol 10: 54 (2009). Scharlaken B, de Graaf DC, Goossens K, Brunain M, Peelman LJ and Jacobs FJ, Reference gene selection for insect expression studies using quantitative real-time PCR: the head of the honeybee, Apis mellifera, after a bacterial challenge. J Insect Sci 8: 33 (2008).
46
Wan H, Zhao Z, Qian C, Sui Y, Malik AA and Chen J, Selection of appropriate reference genes for gene expression studies by quantitative real-time polymerase chain reaction in cucumber. Anal Biochem 399: 257-261 (2010). Shen Y, Li Y, Ye F, Wang F, Lu W and Xie X, Identification of suitable reference genes for measurement of gene expression in human cervical tissues Anal Biochem 405(2): 224-229 (2010). Pfaffl MW, Tichopad A, Prgomet C and Neuvians TP, Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel based tool using pair-wise correlations. Biotech Lett. 26: 509- 515 (2004). Tong Z, Gao Z, Wang F, Zhou J and Zhang Z, Selection of reliable reference genes for gene expression studies in peach using real-time PCR. BMC Mol Biol 10:71 (2009). Hershko A and Ciechanover A, The ubiquitin system. Ann Rev Biochem 67: 425-479 (1998).
47
Chapter 3: Antioxidant genes of the emerald ash borer (Agrilus planipennis): gene characterization and expression profiles
Abstract
Phytophagous insects frequently encounter reactive oxygen species (ROS) from exogenous and endogenous sources. To overcome the effect of ROS, insects have evolved a suite of antioxidant defense genes such as superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX) and glutathione peroxidase (GPX). Emerald ash borer (Agrilus planipennis Fairmaire), an exotic invasive insect pest from Asia has killed millions of ash trees and continues to invade North America at a rapid pace. From an on-going expressed sequence tag (EST) project of A. planipennis larval tissues, we identified ESTs coding for a Cu-Zn SOD (ApSOD1), a CAT (ApCAT1) and a GPX
(ApGPX1). A multiple sequence alignment of the derived A. planipennis sequences revealed high homology with other insect sequences at the amino acid level. Phylogenetic analysis of ApSOD1 grouped it with Cu-Zn SODs of other insect taxa. Real time quantitative PCR (RT-qPCR) analysis in different larval tissues (midgut, fat body,
Malpighian tubule and integument) revealed higher mRNA levels of ApCAT1 in the midgut. Interestingly, higher mRNA levels for both ApSOD1 and ApGPX1 were observed in the Malpighian tubules. Assay of mRNA levels in developmental stages (larva,
48 prepupa and adults) by RT-qPCR indicated higher transcript levels of ApCAT1 and
ApGPX1 in larval and prepupal stages with a decline in adults. On the other hand, the transcript levels of ApSOD1 were observed to be constitutive in all the developmental stages assayed. However, at the enzyme level activity of CAT, SOD and GPX were similar in all the developmental stages (neonates, larvae and pupae). Results obtained reflect a plausible role of these A. planipennis antioxidant genes in quenching ROS from both diet (ash phloem) as well as endogenous sources.
49
Introduction
Aerobic organisms are continuously exposed to oxidative stress due to the by- products produced during oxygen metabolism and via the metabolism of the encountered toxins including allelochemicals and pesticides (Adamski and others 2003; Barbehenn
− 2002). These by-products include superoxide radical ( O2 ), hydroxyl radical ( OH) and hydrogen peroxide (H2O2) collectively termed as reactive oxygen species (ROS).
Adverse effects of ROS include damage to biologically important macromolecules
(DNA, proteins and lipids) leading to programmed cell death (Felton and Summers 1995;
Halliwell and Gutteridge 1999; Hanham and others 1983; Imlay and others 1988).
However, in insects, ROS are also thought to be involved in innate immunity (Hao and others 2003; Kumar and others 2003).
Phytophagous insects have developed unique defense strategies via detoxification and antioxidant enzymes mainly to combat the deleterious effects of pro-oxidant rich diets obtained from their host plants (Felton and Summers 1995; Krishnan and Kodrík
2006; Mittapalli and others 2007a) . Among the antioxidant enzymes, the most studied group of enzymes are superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase
(APX) and glutathione peroxidase (GPX). SOD catalyzes the dismutation of superoxide radical to stable hydrogen (Krishnan and Kodrík 2006) peroxide and oxygen; CAT catalyzes hydrogen peroxide to water and oxygen(Ahmad 1992; Fridovich 1995). On the other hand, APX also catalyzes the conversion of hydrogen peroxide to water but at low concentrations whereas GPX converts hydroperoxides to less reactive alcohols primarily
50 in cell membranes (Ahmad, 1989). These antioxidant enzymes are collectively involved in scavenging the exogenous and endogenous ROS to prevent oxidative stress in insects
(Krishnan and Kodrík 2006; Mittapalli and others 2007a; Yang and others 2010).
Emerald ash borer (Agrilus planipennis Fairmaire), an invasive wood-boring beetle in the family Buprestidae has reached high impact status by killing millions of
North American (NA) ash trees (Fraxinus spp.) since its discovery in southeast Michigan in 2002 (Poland and McCullough 2006). At the current rate of invasion A. planipennis has the potential to decimate NA ash with impacts reminiscent to those of Dutch elm disease and chestnut blight (Herms and others 2004). However, the damage caused by this beetle to its native host (Manchurian ash, F. mandshucrian) is insignificant, perhaps a virtue of their co-evolutionary history (Rebek and others 2008). The unique phloem chemistry of Manchurian ash (phenylethanoids and hydroxycoumarins) may contribute to its resistance to A. planipennis (Eyles and others 2007). The major damage to ash is caused by the larvae as they feed on the phloem forming typical S- shaped galleries.
Adults emerge in late spring or early summer leaving a D-shaped exit hole and feed on foliage (Poland and McCullough 2006). From the A.planipennis larval midgut transcriptomic database, sequences of candidate antioxidant genes including a Cu-Zn
SOD, a CAT and a GPX, were identified and designated as “ApSOD1”, “ApCAT1” and
“ApGPX1”. Further, molecular characterization and expression analysis (via real time quantitative PCR, RT-qPCR) in different tissues (midgut, fat body, Malpighian tubules and integument) and developmental stages (1st- 4th instars, prepupa and adult) of A. planipennis is reported.
51
Materials and method
Sequence retrieval, annotation and alignment
The sequences of antioxidant gene were retrieved from the EST database reported per (Mittapalli and others 2010). From the annotated sequences of A. planipennis EST database a full length EST of a Cu-Zn SOD (ApSOD1) and partial ESTs of a CAT
(ApCAT1) and a GPX (ApGPX1) were recovered. Further identification and annotation of these antioxidant genes was performed by searching against the non-redundant database using the BlastX algorithm at National Center for Biotechnology Information,
(NCBI, Bethesda, MD, USA) (http://www.ncbi.nlm.nih.gov/). Multiple sequence alignment was performed using an online tool MUSCLE provided by a web service, phylogeny.fr. (www.phylogeny.fr). The protein secondary structure of ApSOD1 was predicted using the PSIPRED protein structure prediction server at http://bioinf.cs.ucl.ac.uk /psipred/(Jones 1999). For phylogenetic analyses, an unrooted neighbour joining tree was constructed with 1000 bootstrap replicates and excluding positions with gap using MEGA version 5 (Tamura and others 2007).
Insect Material and Dissections
A. planipennis larvae were collected from two naturally infested sites of green ash trees at Michigan and Ohio, USA. Larvae of different development stages (1st-4th instar
52 larvae, prepupa and adults) were collected and maintained in moist conditions on ice till dissections. For tissues, 3rd and 4th instars (7-8 larvae) were dissected in ice cold 1X phosphate buffer saline as described by (Vasanthakumar and others 2008) with few modifications in the dissection technique. Larvae were pinned on a paraffin wax platform at the head and last abdominal segment to perform dissections more efficiently. Tissues including midgut, fat body, Malpighian tubules and integument were collected separately in 1.5ml centrifuge tubes containing pre-chilled Trizol reagent and stored at -80o C until
RNA isolation.
RNA isolation and cDNA synthesis
Total RNA was isolated from tissues and developmental stages including 1st-4th instars, prepupa and adults using Trizol reagent following the manufacturer’s protocol.
The total RNA obtained was resuspended in 40µl of DEPC-treated water and the concentration was measured using a Nanodrop (Thermo scientific Nanodrop 2000).
About 1-2 µg of total RNA was used for first strand cDNA synthesis using the
Superscript II first strand cDNA synthesis kit (Invitrogen). The resultant cDNA was diluted to 20 ng/µl for further use in gene expression analysis using RT-qPCR.
53
Expression analysis using real-time quantitative PCR (RT-qPCR)
First strand cDNA was used as the template for measuring mRNA levels via RT- qPCR. Reaction mixture consisted of 2 µl cDNA (20ng/µl), 1µl of 5 picomole/µl forward primer, 1µl of 5 picomole/µl of reverse primer, 5 µl of SYBR green (Bio-Rad) and 1µl of nuclease free water making the total reaction volume to 10µl. Concentration of the template and primers were standardized based on the Ct values and melting curves.
Target gene was amplified at the following conditions: 95°C for 3 min and then, 40 cycles of 95°C for 10 s and 60°C for 30 s. Primer pairs were designed using the Beacon primer designer 7.0 software (BioRad) with optimal parameters (Table 3.1). Quantitation of target mRNA levels in all the samples (tissues and developmental stages) was analyzed by relative standard curve method as described in the ABI Prism 7700 user bulletin (User Bulletin #2: ABI Prism 7700 Sequence Detection System
(http://www3.appliedbiosystems.com/). A. planipennis specific TEF-1α was used as the internal control which was found to be consistent among the samples assayed (Rajarapu and others 2012).Fold change of genes was calculated relative to tissue or developmental stage with lowest expression respectively.
54
Enzyme assays:
Activity of CAT, SOD and GPX was measured in neonates, larvae and prepupae.
Tissues were ground in liquid nitrogen and suspended in sodium phosphate buffer (pH7,
66mM).Homogenates were centrifuged for 10 minutes at 10,000g. Supernatant was collected and used for assaying the total protein content followed by the activity assays.
Total protein content in the extracts was measured using Pierce 660nm against standard curve of serially diluted BSA standards (2-0.13mg/ml). Specific activity of CAT and
GPX was measured as described previously with few modifications (Barbehenn 2002).
Absorbance of all the assays were measured using Multiscan plate reader
(Thermoscientific).
For catalase assay reaction mixture consisted of 10µl of enzyme extract and 5 µl of 3% H2O2 and made up to 350µl with phosphate buffer (pH 66mM, pH 7). Change in absorbance was measured at 240nm for 5 minutes. Specific activity of CAT was expressed as micromoles of H2O2 reduced per minute per milligram of protein using an extinction coefficient of 39.4M-1cm-1.
Reaction mixture for GPX assay consisted of 20µl of glutathione reductase (1.67
EU/ml), 100 µl of sodium phosphate buffer (pH 7, 66mM containing 1 MM reduced glutathione and 0.2 mM NADPH) and 50µl of Cumene hydroperoxide (1.4 mM in buffer). The rate of decrease in the absorbance at 340 nm was measured for 4 min.
Total SOD activity was measured using Sigma Superoxide dismutase assay kit.
(Thermoscientific). Briefly, to 200 µl of WST working solution provided in the kit, 20 µl
55 of dilution buffer and 20µl of enzyme extract were added and incubated at 370C for 20 minutes. Following incubation absorbance was measured at 240 nm. Specific activity was calculated as the percentage of inhibition rate of SOD as per the kit protocol. (Sigma
19160 SOD determination kit).
Statistical analysis
Relative expression values (REVs) obtained from standard curve method were analyzed by PROC MIXED Analysis of Variance (ANOVA) with a significance level (α) of 0.05 using SAS (SAS Institute Inc. SAS.STAT User’s Guide, Version 9.1). Mean separation was calculated by Tukey’s method (α = 0.05). For each treatment there were two biological replicates nested with two technical replicates each. Enzyme activities were analyzed using general linear model in Minitab 16 on three biological replicates.
Results
Gene characterization of antioxidant genes
Among the annotated antioxidant genes, a full length sequence for ApSOD1 with an open reading frame consisting of 154 amino acids was retrieved (465 bp; Figure
2.1A). A similarity search of the retrieved ApSOD1 against the non-redundant nucleotide (nr) database at NCBI using BlastX, revealed 81% similarity to a cytoplasmic
56
Cu- Zn SOD of Tribolium castaneum (XP_968284.1, 2e-68), 77% similarity with
Gryllotalpa orientalis Cu- Zn SOD (AAV73809.1, 3e-63) and 76 % identity with
Camponotus floridanus Cu-Zn SOD (EFN70085.1, 5e-62) at the amino acid level. A similar search for ApCAT1 showed 71% identity with catalase of T. castaneum
(NP_001153712.1, 8e -107), 78% similarity with two different catalase isoforms of
Anopheles gambiae (ABL09376.1, 8e-107; AAR90327.1, 8e-107) at the amino acid level.
Similarity search of ApGPX1 showed 62% similarity with Hydra sps. (ADI56239.1, 2e-
07), 56% similarity with GPX of Aedes aegypti (XP_001662240.1, 3e-08) and 52% similarity with T. castaneum GPX (XP_969937.2, 1e-07).
The deduced amino acid sequence of ApSOD1 revealed all the important characteristics of a typical Cu- Zn SOD protein including Cu binding site, Zn binding site and two signature motifs (Figure 3.1A). The Cu binding site has three Histidine residues at H46, H48 and H120. Three amino acid residues including Histidine (H63), Histidine
(H80) and Aspartate (D83) interact with the Zn ion at the zinc binding site. The two signature motifs were present at the N terminal and C terminal end spanning 9 and 12 amino acids respectively (Figure 3.1A). Secondary structure of the deduced amino acid sequence of ApSOD1 showed 9 alpha helices and 10 coils. Two SOD specific signature motifs were located within the alpha helices of the deduced protein structure (Figure
3.1B).
57
Multiple sequence alignment
A partial multiple sequence alignment of the deduced amino acid sequences of
ApSOD1, ApCAT1 and ApGPX1 with other insect sequences revealed a high level of homology among the taxa (Figure 3.2). The percentile of similarity (i.e. identical residues) was 53.3% for ApSOD1, 63.3% for ApCAT1 and 34.7% for ApGPX1 among the sequences compared.
Phylogenetic analysis
In order to reveal the phylogenetic relationship of ApSOD1 with other insect sequences and/or the types of SODs, an unrooted neighbor joining tree was constructed with the amino acid sequences of different types of SODs. The dendrogram clearly grouped the SOD sequences into two major clades (i) Cu-Zn SODs and (ii) Mn SODs.
ApSOD1 was included within the Cu-Zn SOD clade (Figure 3.3). Specifically, ApSOD1 was more closely related to the Diptera Cu-Zn SODs, compared to the Lepidoptera Cu-
Zn SODs.
Transcript levels in larval tissues
The transcript levels of ApSOD1, ApCAT1, and ApGPX1 were determined in different tissues (midgut, fat body, Malpighian tubule and integument) of 3rd and 4th
58 instar larvae using RT-qPCR. All the genes assayed showed a tissue specific expression pattern, wherein ApSOD1 showed higher mRNA levels in the Malpighian tubules with minimal expression levels in fat body and midgut. High mRNA levels of ApCAT1 were observed in the midgut tissue with low levels in all the other tissues assayed. ApGPX1 showed high transcript levels in fat body and Malpighian tubules with comparatively low mRNA levels in the midgut and integument (Figure 3.4A). All the genes analyzed showed the least transcript levels in the integument sample. Therefore, the integument sample was taken as the calibrator (1X) (Pfaffl, 2001) to calculate the relative fold change among the tissues. ApCAT1 showed a fold difference of >10,000X (P< 0.05) in the midgut compared to the integument. A fold change of 55.17X (P< 0.05) was observed for ApSOD1 in the Malpighian tubules compared to the integument. ApGPX1 showed a fold change of 25X (P< 0.05) in the Malpighian tubules compared to the integument.
Transcript and enzyme levels during development
RT-qPCR analysis of ApSOD1, ApCAT1 and ApGPX1 was also performed in the developmental stages including the four larval instars (1st- 4th), prepupa and adults. Both
ApCAT1 and ApGPX1 displayed a differential gene expression pattern among the developmental stages assayed, whereas ApSOD1 had similar mRNA levels throughout the developmental stages assayed (constitutive). High mRNA levels of ApCAT1 were observed in the 1st and 3rd instars, and prepupal stages with a sudden drop in adults.
ApGPX1 transcript levels were found to be high in the 4th instar and prepupal stage
59 compared to other developmental stages (Figure 3.4B). Relative fold change of transcript levels was calculated by taking the adult sample as the calibrator (1X) (Pfaffl, 2001).
Significant (p < 0.05) fold change of >10,000 was observed in all stages for
ApCAT1when compared to the transcript levels in the adult sample. ApGPX1 showed a significant (p < 0.05) fold change in 4th (3.3X) and prepupal (4.85X) instars when compared to the adult stage. ApSOD1 had no significant variation among the developmental stages assayed. There were no significant differences in the total enzyme activity of CAT, SOD and GPX during the developmental stages (Neonates, larvae and adults) (Figure 3.5).
Discussion
Phytophagous insects have developed a suite of antioxidant defense response in order to deal with the dietary allelochemicals biosynthesized by their host plants. This feature has enabled them to exploit even some of the most noxious and/or naïve ecological niches. Agrilus planipennis seems to fit well with the latter, evident from its rampant invasion of NA ash. Resistance of Manchurian ash to A. planipennis may result from its unique phloem chemistry with high constitutive levels of phenolics compared to the NA ash species (Eyles and others 2007). Phenolic compounds have the potential to generate ROS and in turn could create oxidative stress within insect tissues (Krishnan and
Kodrík 2006). With this knowledge I report the molecular characterization and expression profile of antioxidant gene in A.planipennis feeding on green ash.
60
The tissue specific transcriptomic study of A. planipennis revealed a number of antioxidant genes along with other candidate defense genes (Mittapalli and others 2010).
In this study the identified antioxidant genes (ApSOD1, ApCAT1 and ApGPX1) shared homology with similar genes from other insect and non-insect species. Specifically, the derived secondary structure of ApSOD1 revealed several conserved regions of Cu-Zn
SOD and the phylogenetic analysis clearly corroborates with previous studies on insect
SODs (Yamamoto and others 2007). In general, phytophagous insects overcome oxidative stress during feeding with an up regulation of antioxidant enzymes like SOD,
CAT, GPX etc. (Krishnan and Kodrík 2006). Metabolically active tissues like the midgut and fat body provide a platform for major physiological functions which are crucial for insect survival and adaptation (Mittapalli and others 2010; Mittapalli and others 2007a).
Tissue specific transcript levels of antioxidant genes in the midgut, fat body and
Malpighian tubules in this study were in agreement with other studies (Mittapalli and others 2007a; Munks and others 2005).
Among the antioxidant genes assayed, higher mRNA levels of ApCAT1 were observed in the midgut compared to ApSOD1 and ApGPX1. This observation probably suggests H2O2 as one of the primary ROS encountered during A. planipennis-ash interaction. Putative hypothesis supporting these results include: (i) H2O2 might be one of the primary defense responses of the host plant against insect attack as observed in previous studies (Bi and Felton 1995); (ii) H2O2 might be produced due to phenolic oxidation in the midgut of A. planipennis larvae (Felton and others 1989; Kanofsky and
61
Axelrod 1986). However, these hypotheses with relevance to A. planipennis – ash interaction needs to be validated.
A higher level of ApSOD1 transcripts in the Malpighian tubules relative to other issues is intriguing. Recently, it was shown that Malpighian tubules play an important role in detoxification and elimination of toxins (Beyenbach and others 2010b). Although speculative at this point, the function of ApSOD1 within the Malpighian tubules of A. planipennis is to be determined in future studies. Other tissues that revealed higher mRNA levels of ApSOD1 include the midgut, which is a major interface for digestion and detoxification. Oxidation of dietary phenolics within this vital tissue could lead to the formation of superoxide radicals and therefore be the probable source for ApSOD1 in the midgut of A. planipennis as observed in other studies (Krishnan and Kodrík 2006;
Krishnan and others 2007). While the higher transcript levels of ApGPX1 in the
Malpighian tubules of A. planipennis is intriguing but unknown at this time. Higher mRNA levels of ApGPX1 in the fat body suggests their probable role in protecting the tissue from oxidative damage.
Higher mRNA levels of ApCAT1 in larval and prepupal stages relative to other stages further supports its role in quenching H2O2 derived from the diet and endogenous sources. Negligible ApCAT1 mRNA levels in adult beetles might be due to (a) low secondary metabolite concentration in the matured leaves on which they feed (Chen and
Poland, 2009). (b) presence of an adult specific ApCAT gene in dealing with the oxidative toxicity. The sudden decrease of ApCAT1 transcript levels in adults potentially reflects
62 the different sources of ROS encountered during the development stages. This latter explanation could suggest the difference in the chemical composition in the phloem and foliage of ash. The constitutive (similar mRNA levels) expression of ApSOD1 during developmental stages indicates its continuous participation in removal of ROS generated from endogenous sources. Higher levels of ApGPX1 in late instars (4th and prepupa) might suggest the defense against lipid peroxides stemming from tissue differentiation
(Kostaropoulos and others 1996; Mittapalli and others 2007a). Constitutive (similar) enzyme levels of all the antioxidant genes during development might indicate the need for high levels of these enzymes to establish a successful feeding site on green ash.
Further feeding bioassays with the presence and absence of phenolics in diet might shed light on the contribution of these genes in encountering the oxidative stress that might be encountered during feeding.
Acknowledgements
I thank Loren Rivera-Vega (Department of Entomology, The Ohio State
University/OARDC), Kathleen Knight and Kyle Costilow (USDA North Research
Station, Delaware), Andrew Boose (Columbus Metro Park), Amy Stone (Ohio State
University Extension, Toledo) and Brad Philips (Berlin Heights Metroparks) for assisting with collection of A. planipennis larvae. I also appreciate Naresh Kumar and Angela
Strock (The Ohio State University, OARDC) for help with driving and sample collection.
I thank Therese Poland (USDA, Michigan) for timely supply of EAB adults and eggs.
63
Table 3.1: Primers used for real time quantitative PCR analysis. Ap in the gene name indicates Agrilus planipennis.EF-1 α-Elongation factor, SOD- Superoxide dismutase, CAT-catalase, GPX-glutathione peroxidase
Primer Primer Sequence Length Tm Efficiency name (bp) (ºC) ApEF1α - F CATTGAAACCTACGTTGTCGC 21 61.8 97.6 ApEF1α - R ACTGGAGTGCTTAAACCTGG 20 61.8 ApCAT- F GCCCTGTCTCCATCAAAT 18 59.8 96.8 ApCAT- R CGGACAGTTGACAGGAAT 18 59.5 ApSOD - F AAATGGTAGCGAAAGCGG 18 59.9 95.7 ApSOD - R CTTTACGGGTGCTTTGGA 18 59.2 ApGPX - F ACACCCTGTGAAACGTTCCGC 21 60.5 100.8 ApGPX - R CCTGCGTGAGGTTGATCACCAAT 23 59.6
64
A
B
Figure 3.1 Characterization of a superoxide dismutase (SOD) gene from Agrilus planipennis (ApSOD1). (A) Nucleotide (first line) and deduced amino acid sequences (second line) of ApSOD1. The start codon (ATG) along with its coded amino acid (M) is highlighted in bold and the stop codon is represented as an asterisk (*). Amino acids within the Cu binding site (H46, H48 and H120) are shown with open inverted trianlges ( ). Amino acids within the Zn binding site (H63, H80 and D83) are shown with a filled inverted trianlges ( ). The two signature motifs are boxed. (B) Predicted secondary structure of ApSOD1. Cylinders and solid black lines represent alpha-helices and coils, respectively. Amino acids underlying the alpha-helices are underlined
65
Figure 3.2. Multiple sequence alignment of Agrilus planipennis antioxidant genes: ApCAT1 with Tribolium castaneum (NP001153712.1), Hydra vulgaris (ABC250281), Homo sapiens (AAK2918. 1); ApSOD1with T. castaneum (XP968284.1), Macaca mullata (NP001027976.1) and Taenia solium (AAL66230.1); and ApGPX1 with sequences of T. castaneum (XP969937.2), Loa loa (XP003146189.1) and Hydra sps (ADI56239). Identical residues among all taxa are indicated by “*”, conserved substitutions by “:” and semi-conserved substitutions by “.” symbols
66
Figure 3.3 Neighbour joining phylogenetic tree of Agrilus planipennis superoxide dismutase (ApSOD1) with other insect SODs. Members of Cu-Zn SOD and Mn SOD pertaining to different insect orders were included: (i) Cu-Zn SODs: Drosophila melanogaster (NP 476735.1), Glossina mositans morsitans (ADD20357.1), Bombyx mori (NP 001037084.1) and Hyphantia cunea (BAF73670.1) (ii) Mn SODs: D. melanogaster (NP 476925.1), G. morsitans morsitans (ADD18846.1), B. mori (NP 001037299.1) and H. cunea (ABL63640.1) . The numbers on the branch represent bootstrap values.
67
A
IN
B
Figure 3.4. Expression patterns of Agrilus planipennis antioxidant genes (ApCAT1, ApSOD1 and ApGPX1) in (A) larval tissues ( midgut (MG), fatbody (FB), Malpighian tubules (MT) and integument (CU)) and (B) developmental stages (1st – 2nd larval instars, prepupae (PP) and adult) using real-time quantitative PCR. Relative expression values (REV) were calculated by normalizing the expression with a A.planipennis translation elongation factor 1-α (TEF-1α). Error bars represent the pooled standard error for two biological replicates (each with two technical replicates).
68
Figure 3.5: Specificity of Superoxide dismutase (SOD), Catalase (CAT) and glutathione peroxidase (GPX). Activity of SOD is determined as the percentage of inhibition rate of the enzyme per mg of protein. Activity of CAT is determined as the micromoles of H2O2 reduced per minute per mg of protein. Activity of GPX is determined by the amount of NADPH oxidized per mg of protein.
69
References: Adamski, Z, Ziemnicki, K, Fila, K, Zikic, R and Stajn, A (2003) Effects of long-term exposure to fenitrothion on Spodoptera exigua and Tenebrio molitor larval development and antioxidant enzyme activity. Biol. Lett 40: 43-52. Ahmad, S (1992) Biochemical defence of pro-oxidant plant allelochemicals by herbivorous insects. Biochemical Systematics and Ecology 20: 269-296. Barbehenn, RV (2002) Gut-based antioxidant enzymes in a polyphagous and a graminivorous grasshopper. Journal of Chemical Ecology 28: 1329-1347. Beyenbach, KW, Skaer, H and Dow, JAT (2010) The Developmental, Molecular, and Transport Biology of Malpighian Tubules. In: Annual Review of Entomology. Vol. 55, pp. 351-374. Bi, J and Felton, G (1995) Foliar oxidative stress and insect herbivory: primary compounds, secondary metabolites, and reactive oxygen species as components of induced resistance. Journal of Chemical Ecology 21: 1511-1530. Eyles, A, Jones, W, Riedl, K, Cipollini, D, Schwartz, S, Chan, K, Herms, DA and Bonello, P (2007) Comparative phloem chemistry of manchurian (Fraxinus mandshurica) and two north american ash species (Fraxinus americana and Fraxinus pennsylvanica). Journal of Chemical Ecology 33: 1430-1448. Felton, G, Donato, K, Del Vecchio, R and Duffey, S (1989) Activation of plant foliar oxidases by insect feeding reduces nutritive quality of foliage for noctuid herbivores. Journal of Chemical Ecology 15: 2667-2694. Felton, GW and Summers, CB (1995) Antioxidant systems in insects. Archives of Insect Biochemistry and Physiology 29: 187-197. Fridovich, I (1995) Superoxide radical and superoxide dismutases. Annual review of biochemistry 64: 97-112. Halliwell, B and Gutteridge, JMC (1999) Free radicals in biology and medicine. Vol 3. Oxford university press Oxford. Hanham, AF, Dunn, BP and Stich, HF (1983) Clastogenic activity of caffeic acid and its relationship to hydrogen peroxide generated during autooxidation. Mutation Research/Genetic Toxicology 116: 333-339. Hao, Z, Kasumba, I and Aksoy, S (2003) Proventriculus (cardia) plays a crucial role in immunity in tsetse fly (Diptera: Glossinidiae). Insect Biochemistry and Molecular Biology 33: 1155-1164. Herms, DA, Stone, AK and Chatfield, JA (2004) Emerald ash borer: the beginning of the end of Ash in North America? Special Circular-Ohio Agricultural Research and Development Center: 62-71. Imlay, JA, Chin, SM and Linn, S (1988) Toxic DNA damage by hydrogen peroxide through the Fenton reaction in vivo and in vitro. Science (New York, NY) 240: 640. Jones, DT (1999) Protein secondary structure prediction based on position-specific scoring matrices. Journal of molecular biology 292: 195-202. Kanofsky, J and Axelrod, B (1986) Singlet oxygen production by soybean lipoxygenase isozymes. Journal of Biological Chemistry 261: 1099-1104.
70
Kostaropoulos, I, Mantzari, AE and Papadopoulos, AI (1996) Alterations of some glutathione S-transferase characteristics during the development of Tenebrio molitor (Insecta: Coleoptera). Insect Biochemistry and Molecular Biology 26: 963-969. Krishnan, N and Kodrík, D (2006) Antioxidant enzymes in Spodoptera littoralis (Boisduval): are they enhanced to protect gut tissues during oxidative stress? Journal of Insect Physiology 52: 11. Krishnan, N, Kodrík, D, Turanli, F and Sehnal, F (2007) Stage-specific distribution of oxidative radicals and antioxidant enzymes in the midgut of Leptinotarsa decemlineata. Journal of Insect Physiology 53: 67-74. Kumar, S, Christophides, GK, Cantera, R, Charles, B, Han, YS, Meister, S, Dimopoulos, G, Kafatos, FC and Barillas-Mury, C (2003) The role of reactive oxygen species on Plasmodium melanotic encapsulation in Anopheles gambiae. Proceedings of the National Academy of Sciences 100: 14139-14144. Law, J and Wells, M (1989) Insects as biochemical models. J. biol. Chem 264: 16335- 16338. Mittapalli, O, Bai, XD, Mamidala, P, Rajarapu, SP, Bonello, P and Herms, DA (2010) Tissue-Specific Transcriptomics of the Exotic Invasive Insect Pest Emerald Ash Borer (Agrilus planipennis). Plos One 5. Mittapalli, O, Neal, JJ and Shukle, RH (2007) Antioxidant defense response in a galling insect. Proceedings of the National Academy of Sciences 104: 1889-1894. Munks, R, Sant’Anna, M, Grail, W, Gibson, W, Igglesden, T, Yoshiyama, M, Lehane, S and Lehane, M (2005) Antioxidant gene expression in the blood‐feeding fly Glossina morsitans morsitans. Insect Molecular Biology 14: 483-491. Poland, TM and McCullough, DG (2006) Emerald Ash Borer: Invasion of the Urban Forest and the Threat to North Americas Ash Resource. Journal of Forestry 104: 118-124. Rajarapu, SP, Mamidala, P and Mittapalli, O (2012) Validation of reference genes for gene expression studies in the emerald ash borer (Agrilus planipennis). Insect Science 19: 41-46. Rebek, EJ, Herms, DA and Smitley, DR (2008) Interspecific variation in resistance to Emerald ash borer (Coleoptera : Buprestidae) among North American and Asian ash (Fraxinus spp.). Environmental Entomology 37: 242-246. Tamura, K, Dudley, J, Nei, M and Kumar, S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596-1599. Vasanthakumar, A, Handelsman, J, Schloss, PD, Bauer, LS and Raffa, KF (2008) Gut microbiota of an invasive subcortical beetle, Agrilus planipennis Fairmaire, across various life stages. Environmental Entomology 37: 1344-1353. Yamamoto, K, Kimura, M, Aso, Y, Banno, Y and Koga, K (2007) Characterization of superoxide dismutase from the fall webworm, Hyphantria cunea: Comparison of its properties to superoxide dismutase from the silkworm Bombyx mori. Applied Entomology and Zoology 42: 465-472.
71
Yang, LH, Huang, H and Wang, JJ (2010) Antioxidant responses of citrus red mite, Panonychus citri (McGregor)(Acari: Tetranychidae), exposed to thermal stress. Journal of Insect Physiology 56: 1871-1876.
72
Chapter 4: Detoxification enzyme profiles in the emerald ash borer, Agrilus planipennis Fairmaire
Abstract
Emerald ash borer, Agrilus planipennis Fairmaire is a recently discovered invasive insect of ash, Fraxinus spp. in North America. Detoxification is an important mechanism for metabolic resistance against xenobiotics in insects and consists of two phases, phase I and phase II. Key enzymes involved in this process include cytochrome
P450 (P450s) and glutathione-S-transferases (GST). In this study, I report the molecular characterization and expression patterns of different classes of P450s and GST in different tissues and developmental stages along with their specific activity during development. Multiple sequence alignment of all five A. planipennis P450s (CYP6FH1,
ApCYP6A, ApCYP6B, ApCYP9 and ApCYP12) and six GSTs (ApGST-E1, ApGST-E2,
ApGST-E3, ApGST-O1, ApGST-S1 and ApGST- µ1) revealed conserved features of insect
P450s and GSTs. Phylogenetic analysis grouped the P450s and GSTs within their respective families and classes. Real time quantitative PCR of field collected larval tissues showed higher mRNA levels for CYP6FH1 in Malpighian tubules and ApCYP6A in midgut. Transcript levels of ApCYP6B, ApCYP12 were higher in midgut and
Malpighian tubules. Transcript levels of ApCYP9 were higher in midgut and integument.
Higher mRNA levels of ApGST-E1, ApGST-E3 and ApGST-O1 were observed in the 73 midgut and Malpighian tubules. On the other hand, ApGST-E2 and ApGST-S1 showed high mRNA levels in fat body and ApGST-µ1 was constitutively expressed in all tissues assayed. During development, all P450s assayed, except ApCYP6A and ApCYP12, were constitutively expressed. Transcripts of ApCYP12 were lower in early larval stages (1st,
2nd, 3rd). mRNA levels of ApCYP6A were higher in adult stages. ApGST-E2 was observed to be highest in feeding instars, ApGST-S1 in prepupal instars; while the others were constitutively expressed in all developmental stages examined. At the enzyme level, total
P450 and GST activity was similar in all the developmental stages assayed. These results suggest that A. planipennis is potentially primed with a suite of detoxification genes whose function is to metabolize ash allelochemicals and that also participate in other physiological functions
74
Introduction
Emerald ash borer, Agrilus planipennis Fairmaire, is a recently introduced invasive insect of high impact status in North America (NA). This wood boring buprestid beetle was accidentally introduced from Asia and was first discovered in the year 2002
(Poland and McCullough 2006). Since its discovery it has killed millions of ash trees
(Fraxinus spp.) and has a potential to eliminate all the NA ash trees (Herms and others
2004). At the current rate of infestation, A.planipennis might have an impact reminiscent to those of Chestnut blight and Dutch elm disease (Herms et al., 2004). Larvae (1st-4th instars) are the most destructive life stages of A.planipennis wherein they girdle ash phloem forming S- shaped galleries and thus obstruct the flow of nutrients eventually killing trees in 3-4 years post-infestation (Cappaert and others 2005). The native Asian host (e.g. Manchurian ash, F. mandshurica) is resistant to A. planipennis attack perhaps by virtue of their co-evolutionary history (Rebek and others 2008). However, stressed
Manchurian ash trees are reported to be colonized by this beetle (Haack and others 2002).
Studies on comparative phloem chemistry suggested a unique suite of phenolic compounds present in Manchurian ash that might contribute resistance towards
A.planipennis colonization (Eyles and others 2007; Whitehill and others 2012). Further, transcriptomic and proteomic level comparison also revealed elevated levels of defense genes/proteins in Manchurian ash as compared to NA ash (Bai and others 2011; Whitehill and others 2011).
75
Detoxification provides a crucial line of defense through metabolic resistance against a multitude of chemicals including allelochemicals and synthetic pesticides/insecticides (Terriere 1984). It is a two phase process with key players of phase
I as cytochrome P450s (P450s), and phase II as glutathione-S-transferases (GSTs)
(Terriere, 1984). These genes might also be a key component in the adaptation of phytophagous insects to noxious/ naïve host environments (Feyereisen 1999; Schuler
2011).
Cytochrome P450 (P450s):
Cytochrome p450s (p450s) represent highly diverse superfamily of genes involved in biosynthetic, bioactivation and detoxification reactions (Feyereisen 1999).
These enzymes have a potential to evolve either by selective mutations of catalytic sites altering substrate specificity or by mutations in the promoter sequences to increase their expression (Schuler 2011). Due to the expanding diversification of P450 genes in insects, they have been classified into four clades comprising several families depending on the percentage identity at their amino acid level. These include CYP3 clade; CYP4 clade;
Mitochondrial CYP clade and CYP2 clade (Feyereisen 2006). Among these, CYP3 clade is well studied and known to be involved in detoxification of toxins (Feyereisen, 2006).
However, recent studies have reported the involvement of CYP4 clade and a subset of mitochondrial clade also in neutralizing toxins (David and others 2006; Snyder and others
1995).
Unlike the former three clades CYP2 clade encompasses highly conserved genes involved in essential physiological functions (hormone biosynthesis) (Feyereisen, 2006).
76
Irrespective of the clades, P450 genes share certain universal features at the amino acid level: a heme-binding sequence motif FXXGXXXCXG, a K-helix EXXRXXP, a C-helix
WXXXR and an oxygen binding motif AGXXT. These motifs are highly variable and constitute the substrate recognition sites (SRSs) which participate in substrate binding and recognition (Hlavica 2006).
Glutathione-S-Transferase (GSTs):
GSTs are well known superfamily of enzymes that are involved in detoxifying a wide range of compounds including endogenous and exogenous sources. The mode of action of GSTs is via converting insoluble toxic compounds in to less toxic and soluble compounds by an electrophilic addition of the reduced glutathione molecule to the reacting group of the toxin (Habig and others 1974). GSTs also play an important role in protecting the cell against oxidative stress and also in transportation of endogenous lipophilic compounds (Listowsky and others 1988; Weinhold and others 1990).
Depending on their localization in the cell, GSTs are classified as cytosolic and mitochondrial (Enayati and others 2005). Cytosolic GSTs are further classified into six classes including delta, epsilon, omega, sigma, theta and zeta. Irrespective of the class, each subunit of these dimeric proteins has a conserved N-terminal thioredoxin like domain containing 4 β sheaths and 3 α helices (βαβαββα) and a C- terminal domain with
α helices (Lumjuan and others 2007). The N-terminal domain has a conserved glutathione binding site, the “G” site, whereas the C-terminal domain has a highly variable substrate binding “H” site. Among all the cytosolic GSTs, delta and epsilon seem most predominant in insect genomes and are known to metabolize insecticides and
77 plant allelochemicals, thus providing metabolic resistance to insects (Kostaropoulos and others 2001; Ranson and others 2001; Yu 1982). Alternatively omega, sigma, theta and zeta are ubiquitously distributed across taxa and are involved in other essential physiological functions in addition to detoxification. In contrast to other GSTs, microsomal GSTs are not involved in detoxification (Enayati et al., 2005).
From A.planipennis larval midgut EST databases, a total of 5 P450s and 6 GSTs belonging to different classes were identified. Expression patterns of these genes were determined in different tissues and developmental stages. Specific activity of total P450 and GST was also determined in neonates, larvae and adults.
Materials and method
Insect Material
Different developmental stages of A. planipennis larvae (1st-4th, prepupal and adults) feeding on green ash (F. pennsylvanica) were collected from three naturally infested sites, including Berlin heights, Toledo and Columbus. Newly hatched larvae
(neonates) were collected from eggs of adults feeding on green ash in Michigan. Larvae measuring less than 1cm were identified as first, 1-2 cm as second, 2-3 cm as third, more than 3 cm as fourth instars. Tissues including midgut, fat body, Malpighian tubules and integument were isolated from approximately 10 individuals of 4th instars per replicate in
500 µl Trizol as per (Rajarapu and others 2011). For each developmental stage, 5
78 individuals per replicate were ground with liquid nitrogen and suspended in 500ul Trizol reagent for total RNA isolation.
RNA isolation and cDNA synthesis
Total RNA was isolated from the tissues and developmental stages using 1ml of
Trizol reagent (Invitrogen) following the manufacturer’s protocol and treated with Turbo
DNase from Ambion. Resultant RNA concentration and purity were measured using a
Nanodrop (Thermo scientific Nanodrop 2000). All the samples had A260/A280 of 1.8-2.0.
About 1-2 µg of total RNA was used for first strand cDNA synthesis using the
SuperScriptTM First-strand synthesis system for RT-PCR following the manufacture’s protocol (Invitrogen).
Expression analysis using real-time quantitative PCR (RT-qPCR)
Sequence retrieval, annotation and phylogenetic analysis were done as mentioned in chapter 3. Primer pairs for the ESTs used in this study are given in Table 4.1.
Specificity of the primers was analyzed in silico using BlastN algorithm at NCBI
(National center for Biotechnology Information). Expression analysis was performed using Bio-Rad CFX96 Real time System as mentioned earlier (chapter 3). For each primer a no template control (NTC) and a no reverse transcription control (NRT) were
79 included. Raw data from RT-qPCR was obtained as Ct values determined by single threshold mode.
Levels of mRNA or relative expression values (REV) were calculated by Bio-Rad
CFX software by comparative Ct method (Livak and Schmittgen 2001). Fold change in expression was calculated relative to neonates in developmental stages and relative to integument in tissues. Translation elongation factor 1- α (TEF-1α) of A. planipennis was used as internal control to normalize the expression of the genes across different samples analyzed (Rajarapu and others 2012)
Extraction and estimation of protein:
For measuring the enzyme activity, three biological replicates of 10 individuals per stage including neonates (<1day old), larvae (1st – 4th; > 1day old) and adults from green ash were homogenized in liquid nitrogen. Phosphate buffer (pH 7, 100mM) with
100mM EDTA, 10% glycerol, 50mM SDS was added to ground tissues in the ratio of
1:10 (w/v) and were homogenized on ice. Homogenate was centrifuged at 10,000 g for 10 min at 40C and 10 µl of supernatant was used for activity assay. Protein concentration of the enzyme extract was estimated with Pierce 660 nm reagent over a range of BSA standards (2– 0.13 mg/ml). All the enzyme assays were performed in 96 well plate and the absorbance was measured using MultiScan plate reader (Thermoscientific).
80
Cytochrome P450 activity assay:
Total P450 was measured using P-Nitoanisole-O-Demethylation assay (PNOD) as per Bautista et al. (2009) with small modifications. In brief p-nitroanisole (2mM, 20 µl) and enzyme extract (20µl) were incubated for 10 minutes at room temperature. After incubation, NADPH (4.8mM, 5µl) was added and further incubated for 5min at 300C.
Absorbance of the product formed was measured at 405nm and the concentration was measured using the standard curve generated by serial dilutions of p-nitrophenol (0-
100pmol). The PNOD activity was measured as picomole of p-nitrophenol formed per microgram of protein per 5 min.
Glutathione –S-transferase.l activity assay:
Total GST activity was measured using a GST assay kit from Sigma-Aldrich following the manufacturer’s protocol (Habig et al., 1974). Briefly, for 50 assays- 10ml substrate buffer was prepared with 9.8 ml Dulbecco’s phosphate buffer saline, 0.1ml glutathione (100mM) and 0.1ml 1-chloro-2,4-dinitrobenzene (CDNB, 200mM) was prepared. To 10 µl of enzyme extract 190 µl of substrate buffer was added and absorbance was measured for 5 minutes with 30 second interval. Enzyme blank was treated similar to the samples. Specific activity was calculated as micromole of glutathione conjugate formed per milliliter of protein extract per minute per microgram of protein (µmol/ml/min/µg of protein).
81
2.6 Statistical analysis
Relative expression values and specific activity of enzymes was analyzed using general linear model in Minitab (version 16). Mean separation was done using Tukey’s method (α = 0.05). Transformation of observations was done where necessary. For each treatment (tissues and developmental stages), there were three biological replicates.
Results
Sequence retrieval and phylogenetic analysis:
Full and partial length sequences of P450s and GSTs from existing A.planipennis larval midgut databases were identified. Five different P450s including CYP6FH1,
ApCYP6A, ApCYP6B, ApCYP9 and ApCYP12 were mined from the database. Top Blast results showed high similarity of A. planipennis P450s to Tribolium castaneum P450 sequences (Table 4.2). A multiple sequence alignment of A. planipennis P450s with their respective reference sequences from T. castaneum, Aedes aegypti, Anopheles gambiae and Nassonia vitripennis revealed two conserved motifs including EXXLXXP and a 10 amino acid residue signature motif FXXGXXXCXG at the N terminus (Figure 4.1).
Phylogenetic analysis using an unrooted neighbor joining tree clustered ApCYP6s including CYP6FH1, ApCYP6A and ApCYP6B with T. castaneum and A. aegypti CYP6 with boot strap values of 98 and 82 respectively. Accordingly ApCYP9 and ApCYP12
82 grouped closely with Hymenopteran N. vitripennis CYP9 and Coleopteran T. castaneum
CYP12 with boot strap values of 61 and 54 respectively (Figure 4.2).
Retrieved GSTs belonged to epsilon, omega, sigma and microsomal classes. They have been named as ApGST-E1 (654 bp, 217a.a), ApGST-E2 (657 bp, 218 a.a), ApGST-
E3 (663 bp, 220 a.a), ApGST-S1 (597 bp, 198 a.a), ApGST-O1 (762 bp, 253 a.a) and
ApGST-µ1 (453 bp, 150 a.a). Sequence identity search using BlastX algorithms showed highest similarities to the respective reference sequences in the database (Table 4.3). A multiple sequence alignment revealed a conserved glutathione binding site (G-site) for all the classes (Figure 4.3). Epsilon class GSTs including ApGST-E1, ApGST-E2 and
ApGST-E3 have conserved G-site residues Glu 68, Ser 69 and Arg 111. In sigma class member ApGST-S1, Tyr 25, Trp 40, Gln 51, Gln 64 and Ser 65 constitute the G-site.
ApGST-O1 has highly conserved residues Cys 28, Pro 29 and Tyr 30 at the N-terminal.
Microsomal GST, ApGST-µ has the 16 amino acid signature motif
VERVRRAHLNDVENIL spanning from 63-79 a.a.
An unrooted neighbor joining phylogenetic tree was constructed with the deduced amino acid sequences of A.planipennis along with other insect GSTs including
Coleoptera, Diptera and Lepidoptera (Figure 4.4). Among the different GSTs of
A.planipennis ApGST-E1, ApGST-E2 and ApGST-E3 were grouped with Epsilon GSTs of other insects with bootstrap values of 43-63. ApGST-S1 was closely related to D. melanogaster GST sigma with a bootstrap value of 70. Similarly ApGST-O1 and ApGST-
µ1 were grouped with other insect GST omega and microsomal class members with a bootstrap value of 73 and 60 respectively.
83
Expression patterns of detoxification genes in tissues:
The mRNA levels of ApGSTs and ApCYPs were assessed in different tissues including midgut, fat body, Malpighian tubules and integument using RT-qPCR. Levels of mRNA in tissues were compared to mRNA levels in integument. Among the CYP6 members significantly higher expression of CYP6FH1 was observed in Malpighian tubule (40X), ApCYP6A in midgut (6.6X) and ApCYP6B in midgut (9.4X) and
Malpighian tubules (11X). Higher mRNA levels of ApCYP9 were observed in midgut
(1.1X) and integument (1X). mRNA levels of ApCYP12 was significantly higher in midgut (4.4X) and Malpighian tubules (4X) (Figure 4.5A).
The mRNA levels of ApGST were assessed in different tissues including midgut, fat body, Malpighian tubules and integument using RT-qPCR with integument as the calibrator (1X). Among the epsilon GSTs ApGST-E1 showed peak mRNA levels in midgut (91X) and Malpighian tubules (20X); ApGST-E2 in fat body (6.0X) and ApGST-
E3 in midgut (48X). ApGST-S1 mRNA levels were high in fat body (4X). Levels of
ApGST-O1 were high in midgut (16X) and Malpighian tubules (11X). Transcript levels of ApGST-µ1 were high in Malpighian tubules (Figure 4.5B).
84
Transcript profiles during development:
Transcript levels for all A.planipennis P450s and GSTs were determined in all stages of development including neonates, 1st-4th larval instars, prepupae and adults using
RT-qPCR. Transcripts of CYP6FH1, ApCYP6B and ApCYP9 members showed constitutive (similar) levels throughout the developmental stages including neonates, larvae and adults. mRNA levels of ApCYP6A showed higher levels in adult stages (4X)
(Figure 4.6A).
Among ApGSTs, Epsilon member transcripts varied during development wherein levels of ApGST-E2 were higher in 2nd (2.6X) and 3rd (4.2X) instars; ApGST-E3 were lower in prepupal (0.08X) and adult (0.004X) instars and ApGST-E2 levels were constitutive during development. Interestingly, ApGST-S1 had higher mRNA levels in prepupal stage (4.5X). Further, mRNA levels of ApGST-O1 and ApGST-µ1 were constant during development (Figure 4.6B).
Total enzyme activity:
Specific activity of P450 and GST was determined in neonates, larvae and adults.
There was no significant difference (P > 0.05) in the total enzyme activity among the developmental stages assayed (Figure 4.7).
85
Discussion
Detoxification is a two phase physiological process (phase I and phase II) that occurs in various animal taxa in order to eliminate toxins. These two phases of detoxification either act in co-ordination or independently depending on the type of compound encountered. Phase I enzymes include P450s and among the phase II enzymes,
GSTs are the major players in expulsion of toxins (McMahon and others 1987). There have been several studies showing the importance of detoxification enzymes/genes to insects in developing resistance to xenobiotics including chemical insecticides and plant toxins (Huang and others 2011; Schuler 2011; Scott 1999; Ugale and others 2011a; Yu and Huang 2000). In this study I report the characterization and transcript/enzymatic profiles of A. planipennis P450s and GSTs. From the blast results, it was evident that there is a general paucity of molecular knowledge in wood boring beetles. Further, multiple sequence alignment of P450s and GSTs with other insect sequences revealed conserved residues of these sequences (Feyereisen 2006; Mittapalli and others 2007b;
Wang and others 2008; Yamamoto and others 2011). The dominance of the recovered epsilon class GST and CYP6 members perhaps implies the importance of these genes during the course of evolution/adaptation of this beetle on its host as observed in other insect groups (Enayati and others 2005; Ketterman and others 2011).
A differential expression pattern was observed for all the assayed P450s in different larval tissues. ApCYP6A and ApCYP6B had higher levels of transcripts in midgut tissue. In insects CYP3 clade members (CYP6 and CYP9) are known to be
86 induced in presence of xenobiotics including plant secondary chemicals and insecticides
(Bass and others 2011; Bautista and others 2009; Cifuentes and others 2012; Jones and others 2011; Mao and others 2011; Niu and others 2011; Zhou and others 2010). Higher expression of ApCYP6A and ApCYP6B in midgut tissue of A. planipennis might be responding to the ash allelochemicals. Several studies of plant- insect interaction have shown the midgut tissue as the major interface for several detoxification enzymes (Hakim and others 2010; Mittapalli and others 2010; Pauchet and others 2010; Rajarapu and others 2011). On the other hand CYP6FH1 and ApCYP6B expressed higher transcripts in
Malpighian tubules which is a vital tissue for excretion, but also participates in detoxification (Chahine and O'Donnell 2011). Recent reports demonstrated that
Malpighian tubules are also known to play a role in detoxification of xenobiotics
(Beyenbach and others 2010a; Chahine and O'Donnell 2011; Dow 2009; Dow and Davies
2006). Higher expression of the P450s in midgut and Malpighian tubules suggests the potential involvement of these genes in detoxifying host secondary compounds.
Another CYP3 clade member, ApCYP9 exhibited an interesting pattern of expression wherein it showed higher transcript levels in midgut and integument.
Although many studies have identified CYP6 members as key enzyme in detoxification of xenobiotics, CYP9 members also play a significant role in toxin metabolism (Stevens and others 2000). Higher transcript levels of ApCYP9 in A. planipennis midgut might be induced in presence of ash allelochemicals in diet similar to ApCYP6 members.
Interestingly, higher mRNA levels in integument might suggest their involvement in dealing with either endogenous substrates (e.g. cuticular hydrocarbons) or
87 allelochemicals encountered due to the physical contact of larvae with ash phloem during feeding.
Transcripts of ApCYP12 were higher in midgut and Malpighian tubules which are important tissues of detoxification as mentioned earlier. Members of CYP12 are known to be induced in presence of insecticides and allelochemicals (Bogwitz and others 2005;
Feyereisen 1999; Guzov and others 1998). Higher expression of ApCYP12 in midgut and
Malpighian tubules with a significantly lower expression in integument suggests the role of ApCYP12 in dealing with the allelochemicals obtained via diet or other endogenous metabolites.
Expression analysis of ApGSTs in tissues showed unique profiles for different class members. Epsilon group members, particularly ApGST-E1 and ApGST-E3 showed peak mRNA levels in the midgut tissue wherein they might be participating in metabolizing dietary toxins ingested from the host plant. ApGST-E2 was also higher in
Malpighian tubules, an important tissue studied in dealing with dietary toxins as observed in other insects (Chahine and O'Donnell 2011). On the other hand, ApGST-E2 was highly expressed in fat body which is also an important metabolic tissue for detoxification as demonstrated earlier in A.planipennis (Mittapalli et al., 2010) and in Hessian fly,
Mayetiola destructor (Mittapalli et al., 2007).
Higher mRNA levels of ApGST-µ1 were found in midgut and Malpighian tubules.
Microsomal GSTs are membrane proteins involved in protecting the cell from oxygen toxicity via lipid peroxidation products (Shi and others 2012). Abundant mRNA levels of this gene in vital tissues including midgut, and Malpighian tubules might be due to higher
88 stress levels encountered by these tissues during the metabolism of ash toxins and/or the result of other physiological processes. Transcript levels of ApGST-O1 were higher in midgut and Malpighian tubules. Omega class GST members are known to be induced in the presence of stress factors like bacteria, insecticides and UV light (Yamamoto et al.,
2011). Higher levels of ApGST-O1 in midgut and Malpighian tubules demonstrate that these tissues might encounter some potential toxins via diet. Sigma class member,
ApGST-S1 had higher mRNA levels in fat body as identified in other insects suggesting their possible role in detoxification and other critical physiological functions (Flanagan and Smythe 2011; Huang and others 2011; Kim and others 2011; Yamamoto and others
2006).
Profiling of ApCYPs in A. planipennis developmental stages revealed interesting patterns. Constitutive higher levels of CYP6FH1, ApCYP6B and ApCYP9 was observed in all the instars. Adapted specialist have shown to have a high activity of enzymes involved in detoxifying a compound frequently encountered in its host (Bull and others
1986) . Since A. planipennis is also a specialist well adapted on green ash, higher number of ApCYP6 and ApCYP9 transcripts might be expressed constitutively to the compounds present in green ash phloem. However, there might be other P450s responding to the phloem allelochemicals. Higher levels of ApCYP6A in adults might be induced due to the compounds encountered in foliage.
Intriguingly, the developmental profiles of ApGSTs revealed constitutive patterns in all the developmental stages assayed except for ApGST-E2 and ApGST-S1. mRNA
89 levels of ApGST-E2 was higher in fat body and during feeding stages which might be induced due to the presence of dietary factors. Similar profiles for epsilon GSTs were reported in hoverfly, Episyrphus balteatus and diamondback moth, Plutella xylostella
(Sonoda and others 2006; Vanhaelen and others 2001). On the other hand, mRNA levels for ApGST-S1 were comparatively higher in the prepupal stage which implies its role in dealing with oxidative stress caused by profound physiological changes during metamorphosis as observed in other insects (Feng and others 2001; Hazelton and Lang
1983; Mittapalli and others 2007b). Additionally, an induction in GST activity due to high hemolymph juvenile hormone (JH) titers was observed in common cutworm,
Spodoptera litura (Lu and Wu 2007). Presumably, JH titers increase during the prepupal stages of A. planipennis as well, which could represent a second factor for the induction of ApGST-S1.
I further analyzed the activity of GSTs and P450s in neonates, larvae, and adults.
Though there was a differential transcript pattern at mRNA level during development, specific activity of ApGSTs towards CDNB was the same in all the stages examined. A poor correlation of enzyme mRNA and actual activity levels has been previously observed for genes with expression regulated by post-transcriptional and post- translational parameters, such as splicing, translational and functional inactivation (Maier et al., 2009). In contrast, specific activity of P450s in developmental stages corroborated the mRNA levels/patterns. Given that total enzyme activities were measured, the contribution of individual isoforms remains unclear. Alternatively, different isoenzymes may target different specific artificial substrates.
90
In conclusion, expression patterns of ApCYPs and ApGSTs provide insights into their probable functions in different tissues and development stages. CYP6, CYP9 and
GST epsilon class members of A. planipennis might be among the key tools used in the successful adaptation of this beetle to its naïve host. Overall, results indicate that midgut and Malpighian tubules might play a significant role in A. planipennis ash interactions.
Being a specialist, A. planipennis might be primed for P450 and GST-based detoxification of green ash secondary compounds, in addition to using these enzymes for other fundamental physiological functions.
Acknowledgements
I thank Kathleen Knight and Kyle Costilow (USDA North Research Station,
Delaware), Andrew Boose (Columbus Metro Park), Amy Stone (Ohio State University
Extension, Toledo) and Brad Philips (Berlin Heights Metroparks) for assisting with collection of A. planipennis larvae. I also appreciate Naresh Kumar and Angela Strock
(The Ohio State University, OARDC) for help with driving and sample collection. I also thank Therese Poland (USDA, Michigan) for timely supply of A. planipennis adults and eggs for collecting neonates.
91
Table 4.1: Primers used to amplify Agrilus planipennis P450s and GSTs
Primer name Primer Sequence Length (bp) Tm (ºC) Efficiency
ApEF1α-F CATTGAAACCTACGTTGTCGC 21 61.8 97.6 ApEF1α-R ACTGGAGTGCTTAAACCTGG 20 61.8 ApGST-6A-F TGCCTGGATTAAGAGAATGA 20 50.9 107.5 ApGST-6A-R ACGAGTGCTTGAAGTATCT 19 50.7 ApGST-E2-F GATGATGACGGATTTGTTATTTC 23 50.1 99.6 ApGST-E2-R TTTGCCATACCTTTCCATTAG 21 50.5 ApGST-E7-F TGATAGCGGCACATTAGT 18 50.8 105.6 ApGST-E7-R TTAGTCTTACCAGCAACCA 19 50.7 ApGST-S-F CTTAACAATTCCGCAGAT 18 47.2 99 ApGST-S-R CGAAATGGATAGGCAAAT 18 47.3 ApGST-O-F GCTTATGGTTGATACATC 18 44.8 102.5 ApGST-O-R AACATATAATCTAGCATTCC 20 44.4 ApGST-µ-F ATATACCGCAGCAAGATTTG 20 50.6 98.7 ApGST-µ-R GTTATTGTCCTAAACGCCATA 21 50.2 CYP6FH1-F CGCGTTTGGGATAGACTGTA 20 53.5 99.9 CYP6FH1-R GCTTTGGACTGGCAACAT 18 54.4 ApCYP6A-F CTTTCGGAGAAGGTCCTAGA 20 53.1 101.5 ApCYP6A-R ACTCCAAGACCAAAGTGC 18 52.5 ApCYP6B-F GCCCTATCAAGGATGTGTAC 20 52.8 94.3 ApCYP6B-R TTCTGTATACGGGATCCACC 20 53 ApCYP9-F GGCATAAGACTGGAAAAGGG 20 53.4 101.4 ApCYP9-R GAAAAGTTCGATCCTGACAGAT 22 52.5 ApCYP12-F CCTTTTACAAAATCCGCGC 19 52.6 108.6 ApCYP12-R CCACATATTTCCCAGGAGTG 20 53.1
92
Table 4.2: Top 3 blast hits for Agrilus planipennis Cytochrome P450s (ApCYP)
Subfamilya Gene Length Reference organism with Similarity E value nameb (amino NCBI accession number (%) acids) CYP6 CYP6FH1 515 Tribolium castaneum 47 6e-177 EFA02821.1 T. castaneum 49 4e-175 XP_969633.1 T. castaneum 48 2e-173 XP_975572.1 CYP6 ApCYP6A 204 T. castaneum 51 2e-61 XP_975563.1 T. castaneum 52 1e-60 NP_001164249 T. castaneum 51 9e-57 EFA02821.1 CYP6 ApCYP6B 517 T. castaneum 53 0.0 XP_975569.1 T. castaneum 53 0.0 EFA02821.1 T. castaneum 52 0.0 XP_975568.2 CYP9 ApCYP9 497 T. castaneum 34 7e-93 EFA09151.1 T. castaneum 32 3e-90 XP_972794.2 T. castaneum 34 9e-89 XP_975390.2 CYP12 ApCYP12 369 T. castaneum 44 5e-107 XP_966937.1 Nasonia vitripennis 45 2e-104 XP_001604810.1 Harpegnathos saltator 41 4e-101 EFN89967.1 aSubfamily – Classification of P450 as described previously (Feyresein 2006).a‘Ap’ in all the gene names denotes Agrilus planipennis. CYP6FH1, ApCYP6A, ApCYP6B, ApCYP9 and ApCYP12 are Cytochrome P 450s belonging to different subfamilies denoted with numbers
93
Figure 4.1: Partial alignments of Agrilus planipennis P450 amino acid sequences with respective insect P450 family members: CYP6FH1, ApCYP6A and ApCYP6B with Tribolium castaneum (TcCYP6, gi|189236550|) and Aedes aegypti (AaCYP6, gi|157120794|); ApCYP9 with Drosophila mettleri ( DmCYP9, gi|3493155|) and Nisonia vitripennis (NvCYP9, gi|289177209|); ApCYP12 with T. castaneum (TcCYP12, gi|91093939|) and Anopheles gambiae (AgCYP12, gi|27752853|). Boxed residues encompass conserved signature motifs EXXRXXP and FXXGXXXCXG. Asterisk (*) indicates highly conserved residues, semicolon (:) and period (.) indicate partially conserved residues.
94
Figure 4.2: Phylogenetic analysis of Agrilus planipennis Cytochrome P450 (ApCYP) amino acid sequences with other insect P450 sequences. The topology of the tree was derived by the distance/Neighbour joining criteria with 1000 bootstrap replicates. The numbers on the branch represent bootstrap values. CYP6FH1, ApCYP6A and ApCYP6B with Tribolium castaneum (gi|189236550|) and Aedes aegypti (gi|157120794|); ApCYP9 with Drosophila mettleri (gi|3493155|) and Nisonia vitripennis (gi|289177209|); ApCYP12 with T. castaneum (gi|91093939|) and Anopheles gambiae (gi|27752853|).
95
Table 4.3: Top 3 blast hits of Agrilus planipennis glutathione –S-Transferases (ApGST) class members
Gene name Putative identification Reference organism Similarity E value (%) ApGST-E1 glutathione S- Musca domestica 50 3e-60 transferase ‘epsilon AAD54937.1 Stomoxys calcitrans 49 3e-64 AC083224.1 Tribolium castaneum 47 9e-63 XP_967313.1 ApGST-E2 glutathione S- Anopheles carcens 49 3e-63 transferase’ epsilon ACY95463.1 A. plumbeus 49 8e-67 AEJ87243.1 Drosophila melanogaster 47 1e-66 NP611323.2 ApGST-E3 glutathione S T. castaneum 53 9e-66 transferase’ epsilon XP_971136 S. calcitrans 50 2e-33 AC083224 D. melanogaster 49 7e-33 NP_611329.1 ApGST-S1 glutathione S- Chironomus riparius 57 5e-72 transferase’ gb|ADK66962.1| sigma Lutzomyia longipalpis 53 2e-72 ABV60329.1 Locusta migratoria 52 5e-72 AEB91974.1 ApGST-O1 glutathione S- Bombus terristris 48 2e-70 transferase XP_003396907.1 omega Apis florae 46 8e-67 XP00369501.1 Acromyrmex echinatior 45 5e-64 EGI63557.1 ApGST-µ1 microsomal Tribolium castaneum 59 5e-44 glutathione s- XP_968617.1 transferase Aedes aegypti 59 3e-52 XP_001658060.1 Culex quinquefasciatus 56 3e-49 XP_001863047.1
96
Figure 4.3 : Partial alignments of Agrilus planipennis GST amino acid sequences with other respective insect GST class members: ApGST-E1, ApGST-E2, ApGST-E3 with epsilon GST of Tribolium castaneum (gi|91076572|), Drosophila melanogaster (gi|24654975|) and Helicoverpa assulta (gi|311223146|); ApGST-S1 with T. castaneum (gi|91092852|), D. melanogaster (gi|21627085|)and H. armigera (gi|297340788|); ApGST- O1 with T. castaneum (gi|270004515| ), D. melanogaster (gi|268321293|) and Bombyx mori (gi|112983952|); ApGST-µ1 with T. castaneum (gi|91086441|) Aedes aegypti (gi|157114362|). Filled circles above the bolded letters represent conserved residues involved in G-site for ApGST-E1, ApGST-E2, ApGST-E3, ApGST-S1 and ApGST-O1, whereas the underlined 16 amino acid residue of ApGST-µ represents its signature motif.
97
Figure 4.4: Phylogenetic analysis of Agrilus planipennis glutathione-S-transferase (ApGST) amino acid sequences with other insect GST sequences. ApGST epsilon members include ApGST-E1, ApGST-E2, ApGST-E3; ApGST-S1 a sigma class member; ApGST-O1, a omega class member and ApGST-µ1, a microsomal GST. The topology of the tree was derived by the distance/Neighbour joining criteria with 1000 bootstrap replicates. The numbers on the branch represent bootstrap values. Accessions of reference sequences used for analysis: Drosophila melanogaster GST-E6 giǀ199225321ǀ; Tribolium castaneum GST-E5 giǀ91076572ǀ; D. melanogaster GST-D1 giǀ7299601ǀ; Helicoverpa armigera GST-D giǀ16555415ǀ; T. castaneum GST-D giǀ91080625ǀ; D. melanogaster GST-S giǀ21627085ǀ; T. castaneum GST-S giǀ91092852ǀ; Bombyx mori GST-O2 (gi|112983952|); T. castaneum GST-O giǀ270004515ǀ; D. melanogaster GST-O giǀ268321293ǀ; T. castaneum GST-u giǀ91086441ǀ; Aedes aegypti GST-u (gi|157114362|).
98
A
B
Figure 4.5 mRNA levels of Agrilus planipennis detoxification genes in the larval tissues including midgut (MG), fat body (FB), Malpighian tubules (MT) and integument (IN) using real-time quantitative PCR (A) Cytochrome P450 members (CYP6FH1, ApCYP6A, ApCYP6B, ApCYP9 and ApCYP12); (B) glutathione-S-transferase members (ApGST-E1, ApGST-E2, ApGST-E3, ApGST-S1, ApGST-O1 and ApGST-µ1) Transcript levels were normalized with Agrilus planipennis translation elongation factor 1- α. Error bars represent the pooled standard error for three biological replicates (each with two technical replicates).
99
A
B
st nd rd th 1 2 3 4 PP Adult Figure 4.6: Relative fold change in transcript levels of (a) Cytochrome P450s (CYP6FH1, ApCYP6A, ApCYP6B, ApCYP9 and ApCYP12); (b) glutathione-S-transferases (ApGST- E1, ApGST-E2, ApGST-E3, ApGST-S1, ApGST-O1 and ApGST-µ1) and in developmental stages of Agrilus planipennis including larval instars (1st - 4th), prepupa (PP) and adult using real time quantitative PCR. Transcript levels were normalized with Agrilus planipennis translation elongation factor 1- α. Neonate stage was taken as calibrator (1X). Error bars represent the pooled standard error for three biological replicates (each with two technical replicates).
100
A
B
Figure 4.7: Specific activity of (A) P450s and (B) GSTs in different stages including neonates (< 1 day old), larvae (1st-4th instars), and adults. (A) Values represent picomole of p-nitrophenol per microgram of protein per 5 min. (B) Values represent micromole of 1-chloro-2,4-dinitro benzene converted per milliliter per minute. Means are representative of three biological replicates with their respective standard error of the mean.
101
References:
Bai, X, Rivera-Vega, L, Mamidala, P, Bonello, P, Herms, DA and Mittapalli, O (2011) Transcriptomic Signatures of Ash (Fraxinus spp.) Phloem. Plos One 6. Bass, C, Carvalho, RA, Oliphant, L, Puinean, AM, Field, LM, Nauen, R, Williamson, MS, Moores, G and Gorman, K (2011) Overexpression of a cytochrome P450 monooxygenase, CYP6ER1, is associated with resistance to imidacloprid in the brown planthopper, Nilaparvata lugens. Insect Molecular Biology 20: 763-773. Bautista, MAM, Miyata, T, Miura, K and Tanaka, T (2009) RNA interference-mediated knockdown of a cytochrome P450, CYP6BG1, from the diamondback moth, Plutella xylostella, reduces larval resistance to permethrin. Insect Biochemistry and Molecular Biology 39: 38-46. Beyenbach, KW, Skaer, H and Dow, JAT (2010) The developmental, molecular, and transport biology of Malpighian tubules. Annual Review of Entomology 55: 351- 374. Bogwitz, MR, Chung, H, Magoc, L, Rigby, S, Wong, W, O'Keefe, M, McKenzie, JA, Batterham, P and Daborn, PJ (2005) Cyp12a4 confers lufenuron resistance in a natural population of Drosophila melanogaster. Proceedings of the National Academy of Sciences of the United States of America 102: 12807-12812. Bull, DL, Ivie, GW, Beier, RC and Pryor, NW (1986) Invitro metabolism of a linear furanocoumarin (8-methoxypsoralen, xanthotoxin) by mixed-function oxidases of larvae of black swallowtail butterfly and fall armyworm. Journal of Chemical Ecology 12: 885-892. Cappaert, D, McCullough, DG, Poland, TM and Siegert, NW (2005) Emerald ash borer in North America: A research and regulatory challenge. American Entomologist 51: 152-165. Chahine, S and O'Donnell, MJ (2011) Interactions between detoxification mechanisms and excretion in Malpighian tubules of Drosophila melanogaster. Journal of Experimental Biology 214: 462-468. Cifuentes, D, Chynoweth, R, Guillen, J, De La Rua, P and Bielza, P (2012) Novel Cytochrome P450 Genes, CYP6EB1 and CYP6EC1, Are Over-Expressed in Acrinathrin-Resistant Frankliniella occidentalis (Thysanoptera: Thripidae). Journal of Economic Entomology 105: 1006-1018. Cohen, MB, Schuler, MA and Berenbaum, MR (1992) A host-inducible Cytochrome P450 from a host-specific caterpillar- Molecular cloning and evolution. Proceedings the National Academy of Sciences of the United States of America 89: 10920-10924. David, J, Boyer, S, Mesneau, A, Ball, A, Ranson, H and Dauphin-Villemant, C (2006) Involvement of cytochrome P450 monooxygenases in the response of mosquito larvae to dietary plant xenobiotics. Insect Biochemistry and Molecular Biology 36: 410-420. Dow, JAT (2009) Insights into the Malpighian tubule from functional genomics. Journal of Experimental Biology 212: 435-445.
102
Dow, JAT and Davies, SA (2006) The Malpighian tubule: Rapid insights from post- genomic biology. Journal of Insect Physiology 52: 365-378. Enayati, AA, Ranson, H and Hemingway, J (2005) Insect glutathione transferases and insecticide resistance. Insect Molecular Biology 14: 3-8. Eyles, A, Jones, W, Riedl, K, Cipollini, D, Schwartz, S, Chan, K, Herms, DA and Bonello, P (2007) Comparative phloem chemistry of manchurian (Fraxinus mandshurica) and two north american ash species (Fraxinus americana and Fraxinus pennsylvanica). Journal of Chemical Ecology 33: 1430-1448. Feng, QL, Davey, KG, Pang, ASD, Ladd, TR, Retnakaran, A, Tomkins, BL, Zheng, SC and Palli, SR (2001) Developmental expression and stress induction of glutathione S-transferase in the spruce budworm, Choristoneura fumiferana. Journal of Insect Physiology 47: 1-10. Feyereisen, R (1999) Insect P450 enzymes. Annual Review of Entomology 44: 507-533. Feyereisen, R (2006) Evolution of insect P450. Biochemical Society Transactions 34: 1252-1255. Flanagan, JU and Smythe, ML (2011) Sigma-class glutathione transferases. Drug Metabolism Reviews 43: 194-214. Guzov, VM, Unnithan, GC, Chernogolov, AA and Feyereisen, R (1998) CYP12A1, a mitochondrial cytochrome P450 from the house fly. Archives of Biochemistry and Biophysics 359: 231-240. Haack, RA, Jendek, E, Liu, H, Marchant, KR, Petrice, TR, Poland, TM and Ye, H (2002) The emerald ash borer: a new exotic pest in North America. Newsletter of the Michigan Entomological Society 47: 1-5. Habig, WH, Pabst, MJ and Jakoby, WB (1974) Glutathione s-transferases - first enzymatic step in mercapturic acid formation. Journal of Biological Chemistry 249: 7130-7139. Hakim, RS, Baldwin, K and Smagghe, G (2010) Regulation of Midgut Growth, Development, and Metamorphosis. In: Annual Review of Entomology. Vol. 55, pp. 593-608. Hazelton, GA and Lang, CA (1983) Glutathione biosynthesis in the aging adult yellow- fever mosquito Aedes aegypti (Louisville). Biochemical Journal 210: 289-295. Herms, DA, Stone, AK and Chatfield, JA (2004) Emerald ash borer: the beginning of the end of Ash in North America? Special Circular-Ohio Agricultural Research and Development Center: 62-71. Hlavica, P (2006) Functional interaction of nitrogenous organic bases with cytochrome P450: A critical assessment and update of substrate features and predicted key active-site elements steering the access, binding, and orientation of amines. Biochimica Et Biophysica Acta-Proteins and Proteomics 1764: 645-670. Huang, J, Wu, S and Ye, G (2011) Molecular Characterization of the Sigma Class Gutathione S-Transferase From Chilo suppressalis and Expression Analysis Upon Bacterial and Insecticidal Challenge. Journal of Economic Entomology 104: 2046-2053. Jones, CM, Daniels, M, Andrews, M, Slater, R, Lind, RJ, Gorman, K, Williamson, MS and Denholm, I (2011) Age-specific expression of a P450 monooxygenase 103
(CYP6CM1) correlates with neonicotinoid resistance in Bemisia tabaci. Pesticide Biochemistry and Physiology 101: 53-58. Ketterman, AJ, Saisawang, C and Wongsantichon, J (2011) Insect glutathione transferases. Drug Metabolism Reviews 43: 253-265. Kim, BY, Hui, WL, Lee, KS, Wan, H, Yoon, HJ, Gui, ZZ, Chen, S and Jin, BR (2011) Molecular cloning and oxidative stress response of a sigma-class glutathione S- transferase of the bumblebee Bombus ignitus. Comparative Biochemistry and Physiology B-Biochemistry & Molecular Biology 158: 83-89. Kostaropoulos, I, Papadopoulos, AI, Metaxakis, A, Boukouvala, E and Papadopoulou- Mourkidou, E (2001) Glutathione S-transferase in the defence against pyrethroids in insects. Insect Biochemistry and Molecular Biology 31: 313-319. Listowsky, I, Abramovitz, M, Homma, H and Niitsu, Y (1988) Intracellular binding and transport of hormones and xenobiotics by glutathione-s-transferases. Drug Metabolism Reviews 19: 305-318. Livak, KJ and Schmittgen, TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25: 402-408. Lu, K-H and Wu, M-C (2007) Juvenile hormone induction of glutathione s-transferase activity in larval fat body of the common cutworm, Spodoptera litura (Lepidoptera : Noctuidae). Entomological Research 37: A107. Lumjuan, N, Stevenson, BJ, Prapanthadara, L-a, Somboon, P, Brophy, PM, Loftus, BJ, Severson, DW and Ranson, H (2007) The Aedes aegypti glutathione transferase family. Insect Biochemistry and Molecular Biology 37: 1026-1035. Mao, W, Schuler, MA and Berenbaum, MR (2011) CYP9Q-mediated detoxification of acaricides in the honey bee (Apis mellifera). Proceedings of the National Academy of Sciences of the United States of America 108: 12657-12662. McMahon, TF, Beierschmitt, WP and Weiner, M (1987) Changes in phase-i and phase-ii biotransformation with age in male fischer-344 rat colon - relationship to colon carcinogenesis. Cancer Letters 36: 273-282. Mittapalli, O, Bai, XD, Mamidala, P, Rajarapu, SP, Bonello, P and Herms, DA (2010) Tissue-Specific Transcriptomics of the Exotic Invasive Insect Pest Emerald Ash Borer (Agrilus planipennis). Plos One 5. Mittapalli, O, Neal, JJ and Shukle, RH (2007) Tissue and life stage specificity of glutathione S-transferase expression in the Hessian fly, Mayetiola destructor: implications for resistance to host allelochemicals. Journal of Insect Science 7. Niu, G, Rupasinghe, SG, Zangerl, AR, Siegel, JP, Schuler, MA and Berenbaum, MR (2011) A substrate-specific cytochrome P450 monooxygenase, CYP6AB11, from the polyphagous navel orangeworm (Amyelois transitella). Insect Biochemistry and Molecular Biology 41: 244-253. Pauchet, Y, Wilkinson, P, Vogel, H, Nelson, DR, Reynolds, SE, Heckel, DG and Ffrench-Constant, RH (2010) Pyrosequencing the Manduca sexta larval midgut transcriptome: messages for digestion, detoxification and defence. Insect Molecular Biology 19: 61-75.
104
Poland, TM and McCullough, DG (2006) Emerald Ash Borer: Invasion of the Urban Forest and the Threat to North Americas Ash Resource. Journal of Forestry 104: 118-124. Rajarapu, SP, Mamidala, P, Herms, DA, Bonello, P and Mittapalli, O (2011) Antioxidant genes of the emerald ash borer (Agrilus planipennis): Gene characterization and expression profiles. Journal of Insect Physiology 57: 819-824. Rajarapu, SP, Mamidala, P and Mittapalli, O (2012) Validation of reference genes for gene expression studies in the emerald ash borer (Agrilus planipennis). Insect Science 19: 41-46. Ranson, H, Rossiter, L, Ortelli, F, Jensen, B, Wang, XL, Roth, CW, Collins, FH and Hemingway, J (2001) Identification of a novel class of insect glutathione S- transferases involved in resistance to DDT in the malaria vector Anopheles gambiae. Biochemical Journal 359: 295-304. Rebek, EJ, Herms, DA and Smitley, DR (2008) Interspecific variation in resistance to Emerald ash borer (Coleoptera : Buprestidae) among North American and Asian ash (Fraxinus spp.). Environmental Entomology 37: 242-246. Schuler, MA (2011) P450s in plant-insect interactions. Biochimica Et Biophysica Acta- Proteins and Proteomics 1814: 36-45. Scott, JG (1999) Cytochromes P450 and insecticide resistance. Insect Biochemistry and Molecular Biology 29: 757-777. Shi, J, Karlsson, HL, Johansson, K, Gogvadze, V, Xiao, L, Li, J, Burks, T, Garcia- Bennett, A, Uheida, A, Muhammed, M, Mathur, S, Morgenstern, R, Kagan, VE and Fadeel, B (2012) Microsomal Glutathione Transferase 1 Protects Against Toxicity Induced by Silica Nanoparticles but Not by Zinc Oxide Nanoparticles. Acs Nano 6: 1925-1938. Snyder, MJ, Stevens, JL, Andersen, JF and Feyereisen, R (1995) Expression of cytochrome P450 genes of the CYP4 family in midgut and fat body of the tobacco hornworm, Manduca sexta. Archives of Biochemistry and Biophysics 321: 13-20. Sonoda, S, Ashfaq, M and Tsumuki, H (2006) Genomic organization and developmental expression of glutathione S-transferase genes of the diamondback moth, Plutella xylostella. Journal of Insect Science 6. Stevens, JL, Snyder, MJ, Koener, JF and Feyereisen, R (2000) Inducible P450s of the CYP9 family from larval Manduca sexta midgut. Insect Biochemistry and Molecular Biology 30: 559-568. Tamura, K, Peterson, D, Peterson, N, Stecher, G, Nei, M and Kumar, S (2011) MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28: 2731-2739. Terriere, LC (1984) Induction of detoxification enzymes in insects Annual Review of Entomology 29: 71-88. Ugale, TB, Barkhade, UP, Moharil, MP and Ghule, S (2011) Induction of midgut carboxylesterase and cytochrome p-450 in Helicoverpa armigera (Hubner) by different hosts. Crop Research (Hisar) 42: 269-275.
105
Vanhaelen, N, Haubruge, E, Lognay, G and Francis, F (2001) Hoverfly glutathione S- transferases and effect of Brassicaceae secondary metabolites. Pesticide Biochemistry and Physiology 71: 170-177. Wang, Y, Qiu, L, Ranson, H, Lumjuan, N, Hemingway, J, Setzer, WN, Meehan, EJ and Chen, L (2008) Structure of an insect epsilon class glutathione S-transferase from the malaria vector Anopheles gambiae provides an explanation for the high DDT- detoxifying activity. Journal of Structural Biology 164: 228-235. Weinhold, LC, Ahmad, S and Pardini, RS (1990) Insect glutathione-s-transferase - a predictor of allelochemical and oxidative stress. Comparative Biochemistry and Physiology B-Biochemistry & Molecular Biology 95: 355-363. Wheelock, CE, Shan, G and Ottea, J (2005) Overview of carboxylesterases and their role in the metabolism of insecticides. Journal of Pesticide Science 30: 75-83. Whitehill, JGA, Opiyo, SO, Koch, JL, Herms, DA, Cipollini, DF and Bonello, P (2012) Interspecific Comparison of Constitutive Ash Phloem Phenolic Chemistry Reveals Compounds Unique to Manchurian Ash, a Species Resistant to Emerald Ash Borer. Journal of Chemical Ecology 38: 499-511. Whitehill, JGA, Popova-Butler, A, Green-Church, KB, Koch, JL, Herms, DA and Bonello, P (2011) Interspecific Proteomic Comparisons Reveal Ash Phloem Genes Potentially Involved in Constitutive Resistance to the Emerald Ash Borer. Plos One 6. Yamamoto, K, Teshiba, S, Shigeoka, Y, Aso, Y, Banno, Y, Fujiki, T and Katakura, Y (2011) Characterization of an omega-class glutathione S-transferase in the stress response of the silkmoth. Insect Molecular Biology 20: 379-386. Yamamoto, K, Zhang, PB, Banno, Y and Fujii, H (2006) Identification of a sigma-class glutathione-S-transferase from the silkworm, Bombyx mori. Journal of Applied Entomology 130: 515-522. Yan, SG, Cui, F and Qiao, CL (2009) Structure, Function and Applications of Carboxylesterases from Insects for Insecticide Resistance. Protein and Peptide Letters 16: 1181-1188. Yu, SJ (1982) Host plant induction of glutathione s-transferase in the fall armyworm. Pesticide Biochemistry and Physiology 18: 101-106. Yu, SJ and Huang, SW (2000) Purification and characterization of glutathione S- transferases from the German cockroach, Blattella germanica (L.). Pesticide Biochemistry and Physiology 67: 36-45. Zhang, YE, Ma, HJ, Feng, DD, Lai, XF, Chen, ZM, Xu, MY, Yu, QY and Zhang, Z (2012) Induction of Detoxification Enzymes by Quercetin in the Silkworm. Journal of Economic Entomology 105: 1034-1042. Zhou, XJ, Sheng, CF, Li, M, Wan, H, Liu, D and Qiu, XH (2010) Expression responses of nine cytochrome P450 genes to xenobiotics in the cotton bollworm Helicoverpa armigera. Pesticide Biochemistry and Physiology 97: 209-213.
106
Chapter 5: Fate of green ash, Fraxinus pennsylvanica phloem phenolics in larval emerald ash borer, Agrilus planipennis
Abstract
Phenolics are a diverse group of compounds widely distributed in terrestrial plants. They are known to have deleterious effects on herbivores wherein they act as antifeedants/ feeding deterrents, pro-oxidants, antidigestants and/or toxins. Emerald ash borer, Agrilus planipennis Fairmaire is an invasive wood boring beetle in North America and a specialist on ash trees (Fraxinus spp.). The secondary chemistry of Fraxinus spp. is enriched with phenolics. Larvae of A. planipennis are well adapted to feed on phenolic- rich phloem tissues and cause extensive damage to the tree. In this study, targeted metabolomics of F. pennsylvanica phloem, larval tissues (midgut tissue, hindgut-
Malpighian tubules, carcasses), midgut content, and frass revealed differences in phenolic profiles. Presence of new compounds was observed in larval tissues and midgut content indicating participation of these tissues in transforming host phloem phenolics. A few compounds, including syringin, oleuropein hexoside, verbascoside, oleuropein-related compounds, and other unknown peaks were found to be excreted without modification.
Results show that A. planipennis larvae are metabolically capable to process ash phenolic compounds.
107
Introduction
Plants synthesize a repertoire of secondary compounds in defense of pathogens and herbivores (Swain 1977). Herbivores have evolved to exploit these chemical defenses via multiple mechanisms such as behavioral avoidance, excretion, metabolic resistance, sequestration and target site mutation (Despres and others 2007). Insects can either use a single mechanism or combination of mechanisms to overcome the host defense barrier.
Also, these offense mechanisms differ between specialists and generalists. Specialists tend to have specific mechanisms to deal with allelochemicals as opposed to generalists
(Ahmad and others 1986). With the advances in omic techniques countermeasures employed by insects to deploy host defenses are being studied to greater details.
Metabolomics is a well-established technique providing advantage to study the interaction of an organism with its environment at molecular level (Bundy and others
2009). In the chemical warfare between insects and plants, metabolomics is an important tool to identify the chemical phenotype of both the plant and its interacting herbivore.
However, they are limited studies conducted in insect-plant interaction to understand the fate of secondary compounds in insects (Glauser and others 2011; Jansen and others
2009; Vihakas and others 2010).
Emerald ash borer, Agrilus planipennis Fairmaire is an invasive wood boring beetle specialized on Fraxinus spp (ash trees). Larval stages of A.planipennis feed on ash phloem forming S-shaped frass filled galleries which obstruct the flow of nutrients leading to the death of tree. Secondary chemistry of ash phloem is dominant with
108 phenolic compounds including hydroxycoumarins, a monolignol, lignans, phenylethanoids, and secoiridoids (Eyles and others 2007). Phenolics may have direct or indirect impacts on herbivores depending on the physiological conditions of the organism
(Appel 1993). Effect of phenolics on herbivores has been well studied in Lepidoptera
(Felton and others 1992; Isman and Duffey 1982; Roth and others 1994). Coleoptera, specifically wood boring beetles which have been notorious invasive insects of North
America are not well studied for the countermeasures employed against host defenses.
Thus, my objective was to study the fate of ash phloem phenolics in A. planipennis larvae. Analysis of green ash phloem, A. planipennis larval midgut tissue, midgut content and frass revealed distinct and intriguing phenolic patterns. Compounds present in phloem indicated potential mechanisms employed by A. planipennis larvae to metabolize the ingested phenolics.
Materials and methods
Insects:
Late fourth instar larvae of A. planipennis feeding on green ash (Fraxinus pennsylvanica) were collected from three trees naturally infested sites in Berlin heights,
Toledo and Columbus (N=9). Along with larvae, phloem and frass were also collected from the trees.Approximately10 larvae per tree were dissected to isolate midgut tissue, midgut content, hindgut and Malpighian tubules. Remaining tissue (carcasses) of the
109 larvae consisting head, fat body, integument were pooled. Midgut tissue, midgut content, hindgut tissue-Malpighian tubules and carcasses were freeze dried for 24 hrs before extractions.
Data Analysis and statistics:
Total phenolics were measured from UV peak areas and were analyzed using general linear model. Means were compared using Tukey comparisons (α=0.05) in
Minitab (v.16).
'
Results
Chromatograms of all the samples including phloem, midgut content (MGC), midgut tissue (MGT), hindgut-Malpighian tubules (HG/MT), carcasses (CC) and frass showed qualitative differences (Figure 5.1). Comparison of total phenolics among phloem, MGC and frass showed significantly higher levels in phloem. There was no significant differences in total phenolics present in tissues (Figure 5.2A; 5.2B).
. Further, qualitative analysis of the samples revealed interesting patterns.
Syringin, unknown peak 5, 15, 17 and 31 were present in phloem, MGT, MGC and frass. oleuropein hexoside, verbascoside, oleuropein related compound, unknown peak 29 were present in phloem, MGT, MGC, HG-MT and frass. Syringaresinol was present in all the samples analyzed. elenolic acid derivative, nuzhenide, unknown peaks 10, 41, 43
110 compounds were present only in phloem, MGT and MGC. New compounds formed present in midgut content and frass include peaks 8, 20 and 52. There were several new compounds found only in frass, these include peaks 12, 24, 25, 28, 30, 35, 39, 45, 47 and
50. Phenolic profiles of CC showed an interesting pattern wherein five compounds unique to this tissue were observed including peaks 48, 53, 54, 55, and 1 (Table 5.1).
Discussion
Plants synthesize a wide array of compounds to protect against biotic and abiotic stressors. To date there have been approximately 200,000 chemicals known to be produced by plants (Mithöfer and Boland 2012). They are broadly classified into different groups based on their chemical structure. Terpenoids, alkaloids and phenolics are the largest class of compounds encompassing more than fifty thousand compounds
(Mithöfer and Boland 2012). These compounds hinder several physiological processes of herbivores effecting their growth and development. Secondary chemical profiles of ash phloem showed presence of phenolics as constitutive defenses (Cipollini and others 2011;
Eyles and others 2007; Whitehill and others 2012).
Presence of higher amounts of total phenolics in phloem compared to midgut content and frass indicates the disruption of phenolic structure by the larvae. It also suggests the potential role of foregut tissue in metabolizing the phenolics. Comparison of phenolic profiles of phloem with larval tissues including MGT, MGC, HG-MT, CC and larval frass showed an overall change in the profiles. Presence of syringin, unknown
111 peaks 5, 15, 17, and 31 in phloem, MGT, MGC and frass indicates that larvae excrete these compounds unmodified. Similarly, oleuropein hexoside, oleuropein related compound, verbascocide, unknown peaks 29 and 32 were also excreted unmodified.
However, the quantities excreted are relatively less compared to the amounts present in phloem. Rapid excretion is an efficient mechanisms adapted by specialist insects
(Rosenthal and Janzen 1979). Similar observations were also identified in other phytophagous insects feeding on flavonoid and terpene containing hosts (Ferreres and others 2008; Gomez and others 1999; Murray and others 1994). In addition to this,
Sorensen and Dearing (2006) has proposed “regulated absorption model” as an important counter mechanisms along with detoxification in specialists herbivores. According to the model, herbivores decrease the amount of plant secondary metabolites circulating the body by limiting the absorption through rapid excretion facilitated by Multidrug resistance transporters (MDR). In mammals, these transporters are found in drug resistant tumor cells (Higgins 1992b). In insects presence of these transporters has been characterized in midgut and Malpighian tubule transporting xenobiotics (Chahine and
O'Donnell 2011; Labbe and others 2011a; Labbe and others 2011b). Midgut transcriptome of larval A. planipennis also showed the presence of MDRs. Nevertheless, involvement of A. planipennis MDRs in transportation of syringin, oleuropien hexoside, oleuropein related compound, verbascocide, and others needs to be further evaluated.
Presence of elenoic acid derivative, nuzhenide, unknown peaks 10, 41 and 43 in
MGT indicates their uptake and by this tissue. Midgut tissue is the primary interface of the insect-plant interactions involved in vital physiological mechanisms like
112 detoxification and digestion (Dow 1986). A. planipennis MGT has higher mRNA levels of Cytochrome P450s (P450) and glutathione-s-transferase (GSTs) (chapter 3). These enzymes can be induced in presence of plant secondary metabolites (Terriere 1984).
Formation of new compounds in MGT might indicate the involvement of these enzymes in transforming ash allelochemicals that this tissue might have encountered.
Presence of new compounds in MGC and frass indicates that these compounds might be intermediates and/or end products of few metabolized phenolics in the gut lumen. Oxidation of phenolics depending on the insect gut physiochemical conditions leads to the formation of toxic intermediates like reactive oxygen species and quinones
(Barbehenn 2002). Many studies have shown the involvement of antioxidant enzymes in dealing with the active oxygen species in gut lumen, but the fate of quinones is least known (Appel 1993). Presence of new compounds in MGC suggests potential involvement of foregut in metabolizing phenolics. Interestingly, presence of new compounds in CC shows the participation of other tissues also in dealing with the phenolic. Presence of new compounds in frass indicates the metabolism of phenolic compounds by A. planipennis larvae and corroborates with the expression of detoxification genes in vital larval tissues as mentioned in previous chapters.
Conclusions
Specialist herbivores use multiple resistance mechanism to overcome the detrimental effects of host plant secondary metabolites (PSMs) (Despres et al., 2007).
113
One of the most efficient counter defense mechanisms is to limit the absorption of PSMs from the diet (Sorensen and Dearing, 2006). In A. planipennis larvae, these efflux mechanisms seems to play an important role in excreting the ingested PSMs. Larvae were also able to efficiently metabolize the phenolics present in the diet. In addition, the presence of new compounds in carcasses potentially indicates the role of other tissues in dealing with ash phenolics. From these results it is evident that A. planipennis larvae have the ability to metabolize at least part of the suite of phenolics present in ash phloem via various enzyme-based detoxification and/or excretion mechanisms.
Acknowledgements
I thank Larry Phelan for helping with HPLC-UV-DAD and data analysis. I thank
Kathleen Knight and Kyle Costilow (USDA North Research Station, Delaware), Andrew
Boose (Columbus Metro Park) and Brad Philips (Berlin Heights Metroparks) for assisting with collection of A. planipennis larvae. I also appreciate Naresh Kumar and Angela
Strock (The Ohio State University, OARDC) for help with driving and sample collection.
114
Figure 5.1 Overlay of chromatograms showing the phenolic profiles of Fraxinus pennsylvanica, green ash phloem, larval tissues (midgut content, midgut tissue, hindgut- Malpighian tubules, frass and carcasses. Numbers on the peaks represent retention time of the compound
115
A
B
Figure 5.2: Total phenolics measured as total UV peak area in chromatograms in (A) phloem, midgut content (MGC), and frass (B) midgut tissue (MGT), hindgut-Malpighian tubule (HG-MT) , carcasses (CC). Means are represented with SEM. Letters indicates means that are significantly different
116
Table 5.2: Compounds found in Fraxinus pennsylvanica (green ash) phloem, midgut tissue (MGT), midgut content (MGC), hindgut-Malpighian tubule (HG-MT), carcasses (CC) and frass .All the compounds were not identified Peak Putative # Identification RT Sample present Major Ions 1 8.73 CC 203 elenolic acid 2 dericative 12.16 Phloem, MGT, MGC 565 3 Syringin 13.01 Alla 417 4 Unknown 13.21 Phloem, MGT, MGC 389, 209 5 Unknown 13.8 Phloem, MGT, MGC 479 6 Unknown 13.9 MGT, MGC 385, 223 elenolic acid 7 derivative 14.06 Phloem, MGC, HG-MT 403 8 Unknown 14.42 MGC, frass 565 9 Unknown 14.6 MGT, MGC 541, 417 10 Unknown 14.8 Phloem, HG-MT, CC 583, 375 11 Unknown 15.1 Phloem, MGT 537, 207 12 Unknown 15.41 frass 449 13 Unknown 15.98 frass 595 14 Unknown 16.1 frass 399 15 Unknown 16.15 Phloem, MGT, MGC, frass 711 16 Unknown 16.23 MGT 674, 381 17 Unknown 16.4 Phloem, MGT, MGC, frass 639 oleuropein related 18 compound 16.6 Phloem, MGT, MGC, HG-MT, frass 525 19 Unknown 16.9 MGT, HG-MT, frass 375 20 Unknown 17.04 MGC, frass 401, 147 Hydroxyl pinoresinol 21 dihexoside 17.2 Phloem, MGT, HG-MT 535, 373 22 Unknown 17.3 Phloem, MGT 742 23 Pinoresinol glucoside 17.6 Phloem, MGT, MGC, HG-MT 579, 405, 389 24 Unknown 17.8 frass 678 25 Unknown 18.09 frass 415 & 193 26 Unknown 18.2 Phloem, MGT, MGC, HG-MT 463 27 Unknown 18.46 Phloem, MGC 585 28 Unknown 18.57 frass 389, 223, 491 29 verbascoside 18.6 Phloem, MGT, MGC, HG-MT, frass 653 30 Unknown 18.78 frass 521 31 Unknown 18.9 Phloem, MGT, MGC, frass 555 32 verbascoside 18.98 Phloem, MGT, MGC, HG-MT, frass 623, 369 33 Unknown 19.8 Phloem, MGC 583 34 Unknown 19.83 MGC 569, 513 35 Unknown 20 frass 373 36 Unknown 20.1 MGC, frass 193, 705 37 Unknown 20.17 MGT, cc 623
117
Table 6.1 continued Putative Peak Identification RT Sample present Major Ions 38 nuzhenide 20.25 Phloem, MGT, MGC 509 39 Unknown 20.46 frass 701 40 Unknown 20.49 HG-MT, frass 377, 403, 623 41 Unknown 20.5 Phloem, MGT, MGC 623 42 Oleuropein hexoside 20.8 Phloem, MGT, MGC, HG-MT, frass 539, 377 43 Unknown 21.48 Phloem, MGT, MGC 951 44 Unknown 21.77 Phloem, frass 569 45 Unknown 21.95 frass 329 46 Unknown 22.2 Phloem, MGC, HG-MT 539 47 Unknown 23.4 frass 415, 337, 599 48 Unknown 23.54 CC 475, 517 49 Unknown 23.77 Phloem, MGT, MGC, HG-MT, frass 583 50 Unknown 24.1 frass 269, 585 51 ligustroside 24.23 All 523 52 Unknown 25 MGC, frass 583 53 Unknown 25.5 CC 531 54 Unknown 28.13 CC 693, 457 55 Unknown 29.86 CC 707, 677 a indicates compounds present in all the samples analyzed.
118
References: Ahmad S, Yu SJ, Mullin CA, Brattsten LB. 1986. Enzymes Involved in the Metabolism of Plant Allelochemicals. Molecular Aspects of Insect-Plant Associations / Edited by Lena B. Brattsten and Sami Ahmad: New York : Plenum Press, c1986. p 73- 151. Appel HM. 1993. Phenolics in Ecological Interactions: The Importance of Oxidation. Journal of Chemical Ecology 19(7):1521-1552. Barbehenn RV. 2002. Gut-Based Antioxidant Enzymes in a Polyphagous and a Graminivorous Grasshopper. Journal of Chemical Ecology 28(7):1329-1347. Bundy JG, Davey MP, Viant MR. 2009. Environmental Metabolomics: A Critical Review and Future Perspectives. Metabolomics 5(1):3-21. Chahine S, O'Donnell MJ. 2011. Interactions between Detoxification Mechanisms and Excretion in Malpighian Tubules of Drosophila Melanogaster. Journal of Experimental Biology 214(3):462-468. Cipollini D, Wang Q, Whitehill JGA, Powell JR, Bonello P, Herms DA. 2011. Distinguishing Defensive Characteristics in the Phloem of Ash Species Resistant and Susceptible to Emerald Ash Borer. Journal of Chemical Ecology 37(5):450- 459. Despres L, David J-P, Gallet C. 2007. The Evolutionary Ecology of Insect Resistance to Plant Chemicals. Trends in Ecology & Evolution 22(6):298-307. Dow JAT. 1986. Insect Midgut Function. Advances in Insect Physiology 19:187-328. Eyles A, Jones W, Riedl K, Cipollini D, Schwartz S, Chan K, Herms DA, Bonello P. 2007. Comparative Phloem Chemistry of Manchurian (Fraxinus Mandshurica) and Two North American Ash Species (Fraxinus Americana and Fraxinus Pennsylvanica). Journal of Chemical Ecology 33(7):1430-1448. Felton GW, Donato KK, Broadway RM, Duffey SS. 1992. Impact of Oxidized Plant Phenolics on the Nutritional Quality of Dietary-Protein to a Noctuid Herbivore, Spodoptera-Exigua. Journal of Insect Physiology 38(4):277-285. Ferreres F, Valentão P, Pereira JA, Bento A, Noites A, Seabra RM, Andrade PB. 2008. Hplc-Dad-Ms/Ms-Esi Screening of Phenolic Compounds in Pieris Brassicae L. Reared on Brassica Rapa Var. Rapa L. Journal of Agricultural and Food Chemistry 56(3):844-853. Glauser G, Marti G, Villard N, Doyen GA, Wolfender JL, Turlings TCJ, Erb M. 2011. Induction and Detoxification of Maize 1,4-Benzoxazin-3-Ones by Insect Herbivores. Plant Journal 68(5):901-911. Gomez NE, Witte L, Hartmann T. 1999. Chemical Defense in Larval Tortoise Beetles: Essential Oil Composition of Fecal Shields of Eurypedus Nigrosignata and Foliage of Its Host Plant, Cordia Curassavica. Journal of Chemical Ecology 25(5):1007-1027. Higgins CF. 1992. Abc Transporters: From Microorganisms to Man. Annual review of cell biology 8(1):67-113. Isman MB, Duffey SS. 1982. Toxicity of Tomato Phenolic-Compounds to the Fruitworm, Heliothis-Zea. Entomologia Experimentalis Et Applicata 31(4):370-376.
119
Jansen JJ, Allwood JW, Marsden-Edwards E, van der Putten WH, Goodacre R, van Dam NM. 2009. Metabolomic Analysis of the Interaction between Plants and Herbivores. Metabolomics 5(1):150-161. Labbe R, Caveney S, Donly C. 2011a. Expression of Multidrug Resistance Proteins Is Localized Principally to the Malpighian Tubules in Larvae of the Cabbage Looper Moth, Trichoplusia Ni. Journal of Experimental Biology 214(6):937-944. Labbe R, Caveney S, Donly C. 2011b. Genetic Analysis of the Xenobiotic Resistance- Associated Abc Gene Subfamilies of the Lepidoptera. Insect Molecular Biology 20(2):243-256. Mithöfer A, Boland W. 2012. Plant Defense against Herbivores: Chemical Aspects. Annual Review of Plant Biology 63:431-450. Murray CL, Quaglia M, Arnason JT, Morris CE. 1994. A Putative Nicotine Pump at the Metabolic Blood-Brain-Barrier of the Tobacco Hornworm. Journal of Neurobiology 25(1):23-34. Roth SK, Lindroth RL, Montgomery ME. 1994. Effects of Foliar Phenolics and Ascorbic Acid on Performance of the Gypsy Moth (< I> Lymantria Dispar). Biochemical Systematics and Ecology 22(4):341-351. Sorensen JS, Dearing MD. 2006. Efflux Transporters as a Novel Herbivore Countermechanism to Plant Chemical Defenses. Journal of Chemical Ecology 32(6):1181-1196. Swain T. 1977. Secondary Compounds as Protective Agents. Annual Review of Plant Physiology 28(1):479-501. Terriere LC. 1984. Induction of Detoxication Enzymes in Insects. Annual Review of Entomology 29:71-88. Vihakas MA, Kapari L, Salminen J-P. 2010. New Types of Flavonol Oligoglycosides Accumulate in the Hemolymph of Birch-Feeding Sawfly Larvae. Journal of Chemical Ecology 36(8):864-872. Whitehill JGA, Opiyo SO, Koch JL, Herms DA, Cipollini DF, Bonello P. 2012. Interspecific Comparison of Constitutive Ash Phloem Phenolic Chemistry Reveals Compounds Unique to Manchurian Ash, a Species Resistant to Emerald Ash Borer. Journal of Chemical Ecology 38(5):499-511.
120
Chapter 6: Comparative transcriptomic and metabolomic analysis of emerald ash borer, Agrilus planipennis larvae feeding on Fraxinus pennsylvanica (green ash) and F. mandshurica (Manchurian ash)
Abstract
Emerald ash borer, Agrilus planipennis is a recently introduced invasive insect pest of ash (Fraxinus spp.) in North America (NA). Its invasion has had significant economic and ecological impacts on urban, natural, and managed forest ecosystems and continues to do so. All NA ash species are susceptible to colonization by this beetle whereas Asian species are resistant and colonized significantly only when stressed.
Larvae of A. planipennis feed on phloem and can kill the trees in 3-4 years post infestation. In this study an integrated approach including transcriptomics, metabolomics, and protein modeling was used to dissect the physiological responses of A. planipennis larvae feeding on susceptible North American green ash (F. pennsylvanica) and resistant
Manchurian ash (F. mandschurica). A total of 58,871 high quality expressed sequence tags (ESTs) were obtained from the pooled transcriptome of midgut tissue of larvae feeding on green ash and Manchurian ash. RNA-Seq analysis showed that 380 genes were differentially expressed, with 266 transcripts more highly expressed in Fm-MG and
114 transcripts more highly expressed in Fp-MG. Validation of candidate genes via real time quantitative PCR corroborated the RNA-seq profiles. Transcripts coding for
121 digestive enzymes, amino acid transporters, and detoxification genes were present at higher levels in Fp-MG whereas transcripts coding for peritrophic membrane synthesis and sugar transporters were present at higher levels in Fm-MG. Furthermore, metabolomic studies indicated that A. planipennis larvae were capable of modifying both green and Manchurian ash phloem were metabolized to similar extent. Lastly, modeling and docking of a candidate P450 highly expressed in larvae feeding on green ash revealed its efficacy to detoxify an array of phenolic compounds.
.
122
Introduction:
Emerald ash borer, Agrilus planipennis Fairmaire, is an exotic wood-boring beetle threatening the survival of Fraxinus spp (ash) trees in both natural and urban ecosystems in eastern North America (Cappaert and others 2005). A.planipennis was discovered in
Michigan in 2002 and has rapidly established populations in 17 U.S. states and 2
Canadian provinces, resulting in the loss of millions of ash trees
(www.emeraldashborer.info). This Buprestid beetle requires 1- 2 years to complete its life cycle (Cappaert and others 2005). Larval feeding creates galleries that girdle the phloem and obstructs the flow of nutrients eventually killing the tree in about 3-4 years.
All North American (NA) Fraxinus spp. including black (F. nigra), green, (F. pennsylvanica), white, (F. Americana), and blue (F. quadrangulata) ashes are susceptible to EAB larval colonization (Herms et al 2004). In contrast, Asian ash (e.g. F. mandshurica) are much more resistant by virtue of their co-evolutionary history, and colonization is confined to stressed trees (Rebek and others 2008).
Several studies have aimed to understand the molecular traits underpinning interspecific variation in host resistance. Comparative transcriptomics between the phloem of NA ash spp. and Asian ash (F. mandshurica Ruprecht, Manchurian ash) indicated higher transcript levels of biotic and abiotic stress genes in Manchurian ash
(Bai et al 2010). Further, chemical and proteomic analyses revealed presence of unique phenolic metabolites and elevated protein levels in Manchurian ash, which is hypothesized to provide defense against A.planipennis (Cipollini and others 2011; Eyles
123 and others 2007; Whitehill and others 2012; Whitehill and others 2011). In contrast to the progress that has been made in understanding ash defenses to A.planipennis larvae, relatively little is known about A.planipennis defenses and physiological responses that enable larvae to detoxify ash metabolites. An initial transcriptomic study conducted by
Mittapalli et al. (2010) and the subsequent gene characterization studies (chapter 3 and
4)(Rajarapu and others 2011) suggested potential involvement of the midgut and fat body tissues in detoxification/antioxidation and immune responses. Midgut is the primary interface between the insect and its environment and performs vital physiological functions including digestion and detoxification.
At the genomic and transcriptomic level, next generation sequencing (NGS) techniques have widely replaced traditionally used methods like Sanger sequencing
(Schuster 2008). In the recent past plethora of studies in insects using next generation techniques to study various biological processes such as immunity (Chen and others
2012; Choi and others 2012; Pascual and others 2012), toxin resistance (Liu and others
2011; Mamidala and others 2012), and overwintering physiology (Poelchau and others
2011). Among these NGS techniques, RNA-seq is widely used for comparative global gene expression analysis. Advantages of RNA-seq over traditionally used microarrays include identification of splice junctions, alternate splice variants, and novel transcripts
(Wang and others 2009). On the other hand metabolomics is a promising approach to integrate with other omic studies for a more holistic understanding of an organism or process (Nadella and others 2012). Targeted metabolomics has been effectively used to
124 study host plant utilization by Lepidoptera (Ferreres and others 2007; Jansen and others
2009; Lahtinen and others 2006) and Hymenoptera (Salminen and others 2004).
Although enormous data is generated using a single omic technique, discrete functions of genes and proteins are elusive (Fridman and Pichersky 2005; Ge and others
2003). Thus, it is crucial to combine different omic approaches in order to understand the network of events occurring in a cell, tissue or organism in response to internal and external stimuli and to formulate hypotheses (Ge and others 2001). Although to my knowledge no studies exist that have utilized the different omic approaches to study insect-plant interactions, other systems have utilized these approaches. For e.g. Two or more omic approaches were used to identify clusters of co-regulated genes in yeast (e.g.,
Saccharomyces cervisea) and nematodes (e.g. Caenorhabditis elegans), to study drug toxicology in mammals ; and to understand the phenotypic response to prolonged environmental stresses in plants (Zea mays, Arabidopsis thaliana) (Amiour and others
2012; Ge and others 2001; Hirai and others 2005; Lou 2012; Walhout and others 2002).
In the current study, my objective was to understand the adaptation criteria required by A. planipennis larvae to survive on two contrasting hosts, i.e. susceptible green ash and resistant Manchurian ash. RNA-seq revealed higher transcript levels coding for digestive enzymes, amino acid transporters, and detoxification genes in larvae feeding on green ash whereas genes coding for peritrophic membrane synthesis and sugar transporters were more highly expressed in larvae feeding on Manchurian ash. Targeted metabolomics of host phloem and frass phenolics revealed differential utilization of the hosts by A. planipennis larvae. A protein model derived for a differentially expressed
125 cytochrome P450 gene (CYP6FH1) revealed a high level of efficiency to detoxify an array of green ash allelochemicals.
Materials and Methods:
Ash common garden
A common garden plantation consisting of white (F. americana L.), green, and
Manchurian ash was established at Michigan State University’s Tollgate Research and
Education Farm in Novi, MI in April 2004. Each species was replicated 80 times for a total of 240 trees. Trees were arranged in four blocks of 60, with each block consisting of four rows of 15 trees spaced 3 m apart. Each of the three species was replicated 20 times
(located randomly) within each block. For this experiment, two trees of green and
Manchurian ash per block were randomly selected to be included in the experiment
(N=12 trees). Because A.planipennis pressure was high around the plantation during its establishment, all trees were protected from A.planipennis colonization with two applications of bifenthrin (Onyx™) sprays per year from 2004-2006 and drip-irrigated to facilitate establishment. At the time of this experiment, green and Manchurian ash were
10.49 0.40 and 7.36 0.22 cm in diameter at 50 cm above ground level, respectively.
126
A.planipennis inoculation
Twenty A.planipennis eggs were applied to the stems of previously selected green and Manchurian ash. Small pieces of filter paper bearing A.planipennis eggs from oviposition in the lab were cut out and secured to the tree bark using cheesecloth. Eggs were applied on 7 July 2011 to coincide with the natural phenology of A.planipennis oviposition.
Tree harvest, larval samples, and tissue collection
Trees were harvested on 22 August 2011. Three main stem sections were returned to the lab and stored at 30 C. Stems were debarked using drawknives and early 3rd instar larvae were removed using chisels and forceps. Larvae were maintained on ice until dissections were performed. Phloem tissue encompassing larval feeding sites and frass samples were also collected and stored at -800C until extractions.
RNA isolation, RNA-seq library preparation, and Illumina sequencing:
Midgut tissue was isolated from 4-5 larvae collected from two trees per species per replicate, as described earlier in chapter 3. Gut contents were removed and tissue was washed thoroughly in phosphate buffer (0.1M, pH 7.00) to remove phloem contaminants.
Rinsed tissue was suspended in 1ml Trizol (Invitrogen) for total RNA isolation. Isolated
127 total RNA was treated with Turbo DNase (Ambion) to remove genomic DNA contamination. Quality of total RNA was measured using Nanodrop and bioanalyzer to assure highest quality for sequencing. Paired-end cDNA libraries for biological replicates per treatment were synthesized using TruSeq RNA prep kit (Illumina) with a small modification in the protocol. Fragmentation of RNA was done for 4 min to obtain longer pair of reads. Libraries were prepared and sequenced by Illumina HiScan SQ at Purdue
Genomics Center (http://www.genomics.purdue.edu/~core/).
Denovo sequence assembly and differential expression analysis:
Sequence assembly and preliminary data analysis was performed at Purdue
Genomics Center. Low quality sequences and adapters were trimmed using Trimmomatic software (Bolger and Giorgi) with default parameters. Trimmed sequences were assembled using Trinity software (v. r2011-11-26) with default parameters (Grabherr and others 2011). A reference database was created by pooling all the assembled contigs from the two treatments using CD-HIT-EST software. A reference database was annotated using Blast2Go by blasting the sequences against NCBI non-redundant database with
BlastX algorithm. Trimmed reads were mapped to the reference database via bowtie (v.
1.x.). Read counts for four libraries were obtained by Sam2Counts. Differentially expressed genes were identified by DESeq, an R based statistical package that follows negative binomial distribution with a False Discovery Rate (FDR) of 5% (Anders and
Huber 2010). Genes with a P < 0.05 were considered differentials and were annotated via
128
Swissprot and Interproscan in blast2Go. Gene Ontology (GO) enrichment (Fisher exact test) analysis was performed using Blast2GO with a term filter value of 0.05 to identify enriched GO terms between the two transcriptomes. Validation of candidate genes was performed using RT-qPCR as described in chapter 3. Primers used in the study are given in Table 6.1.
Phenolic-targeted metabolomics:
Phenolic profiles of phloem and frass samples were characterized from extracts with 70% methanol in water, as described in chapter 4. Phenolics separation, identification, and quantification were conducted using a Waters Alliance 2695 separation module (Milford, MA) with Waters XterraTM RP18, 5 m, 4.6 X 150 mm column, 3.9 m, 3.0 X 20 mm guard column, 996 photodiode array detector, and a
Micromass ZQ mass spectrometer. Sample injection volume was 10µl. Samples were eluted at a flow rate of 0.3ml/min. The binary mobile phase consisted of HPLC-grade water with 0.1% formic acid (solvent A) and methanol with 0.1% formic acid (solvent
B). ESI mass spectra were collected in both negative and positive mode using the following parameters: capillary voltage of 3.50 kV, cone voltage of 25V, desolvation and source temperatures of 350 and 130°C, respectively, and desolvation and cone gas flow rates of 350 and 50 L/hr, respectively. Quantification of total phenolics was based on peak areas in the UV chromatogram. Compound identification was determined by integrating UV spectra, negative and positive ESI mass spectra, and retention times, and
129 comparing these data to literature values (Eyles and others 2007; Whitehill and others
2012).
Molecular characterization of CYP6FH1:
Differentially expressed P450 was sequenced by Sanger sequencing using two sets of gene-specific PCR primers (Table 4.1). The sequence was further identified and named according to the P450 nomenclature (Nelson 2009). The PCR reaction mixture included 20ng cDNA template (2µl), 10 pmol each of forward and reverse primers (1µl each), and Green Taq DNA polymerase (2X, GeneScript). Thermocycler conditions were
950C (3 min); 40 cycle amplification at 950C (1 min), 550C (1.30 min), 720C (1.30 min) and a final step at 720C (10 min). The resultant PCR products were separated on 1% agarose gel in 1X TAE buffer. The gel was stained with ethidium bromide solution
(10µl/200ml), and the bands were photographed using a Kodak Gel logic 100 imaging system. The resultant PCR products were purified using a Qiagen PCR purification kit.
Concentration of purified PCR products was determined with Thermo scientific
Nanodrop 2000 and sequenced at Purdue genomics core facility.
130
Homology modeling and molecular docking of CYP6FH1:
A 3D model of CYP6FH1 was built by homology modeling based on high- resolution crystal structure of homologous proteins. The crystal structure of the closest homolog available in the Brookhaven Protein Data Bank was searched by determining the sequence similarity aided by a BLAST (NCBI) search. Human microsomal cytochrome P450 3A4 (PDB ID: 1TQN) with a resolution of 2.05 Å was determined to be a suitable template based on an identity score of 32% and an E-value of 7e-65.
Thereafter, the coordinates of the crystal structure of the P450 3A4 were used as a template to build the model by multiple sequence alignment using ClustalW software.
The 3D models of CYP6 were generated by the homology modeling tool, Modeller. The steepest descent energy minimization was performed using the Gromos96 43a1 force field to regularize the protein structure geometry. Automated docking analysis was performed using Autodock 4.0 with the compounds present in green and Manchurian ash phloem. The molecular models of the compounds were built and minimized with the
Discovery Studio 3.1 software package (accelrys). To recognize the binding sites in
CYP6, blind docking was carried out essentially as described earlier for CYPP397A1V2
(Mamidala and others 2012).
131
Statistics:
Overall phenolic profiles were compared using principal component analysis
(PCA) in Minitab (v. 16). Relative fold change in mRNA levels of candidate genes obtained from RT-qPCR was analyzed using the generalized linear model in Minitab (v.
16). Mean separation was calculated by Tukey’s method (α = 0.05). Data was analyzed for normality and homogeneity of variance. For each treatment there were three biological replicates. Total phenolics present in green and Manchurian ash phloem and their corresponding frass was analyzed using the general linear model in Minitab (v. 16).
Results
Transcriptomics (RNA-seq):
Illumina sequencing of midgut tissue of A.planipennis larvae feeding on green ash
(Fp-MG) and Manchurian ash (Fm-MG) yielded approximately 36 and 43 million reads each. Further, reads were assembled to 47,580 and 59,528 contigs, respectively. Statistics of the sequencing is described in Table 6.2. Balst2GO results were similar to that observed from 454 pyroseqeuncing of midgut tissue reported earlier (Mittapalli and others 2010). The reference database combining Fp-MG and Fm-MG yielded 58,871 high quality expressed sequence tags.
Differential gene expression analysis using DESeq showed 380 differentially expressed genes (Figure 6.1A) with 114 and 266 genes with higher mRNA levels in Fp- 132
MG and Fm-MG, respectively. Among these sequences 94.23% belong to eukaryotes and
0.01% to prokaryotes. Prokaryotic sequences differentially expressed belonged to
Bacillus megaterium, Pseudomonas spp, Paenibacillus mucilaginosus, and
Colletotrichum gloeosporioides. Expression of Pseudomonas gene was higher in Fp-MG whereas expression of P. mucilaginosus, B. megaterium and C. gloeosporioides coding lyase gene was higher in Fm-MG. Paenibacillus spp is pathogenic to insects (Enright and Griffin 2004) and higher expression of this bacterial sequence suggests possible infection of A.planipennis larvae feeding on Manchurian.
Interproscan analysis of the differentials annotated only 73 genes in Fm- MG and
56 genes in Fp - MG. The annotated differential genes were categorized into different groups based on the biological processes they participate in (Table 6.3). Biological processes including digestion, transporter activity, and detoxification were differentially represented between Fp-MG and Fm-MG (Figure 6.1B). The transcriptome of Fp-MG was enriched with digestion related genes, including β-glucosidases, which were the most abundant genes, followed by lipases and proteases. Amino acid transporters, a monocarboxylate transporter, and ABC transporters were also present at higher levels in
Fp-MG than Fm-MG. In addition, detoxification genes including cytochrome P450s
(P450) and glutathione-S-transferase (GST) were also present in higher levels in Fp-MG relative to the Fm-MG transcriptome.
In the Fm-MG transcriptome, genes involved in chitin metabolism, including peritrophic matrix proteins, chitin deacetylase, and chitinase were more highly expressed than in Fp-MG. Additionally, serine protease transcripts were also present in higher
133 numbers in Fm-MG relative to Fp-MG. Transporters including a sugar transporter, an organic cation transporter, and a trehalose transporter were also present in higher levels.
Genes involved in detoxification, including carboxylesterases (CE), sulfotransferase
(ST), and lactoylglutathione lyase (LGSH), had higher mRNA levels in Fm-MG compared to Fp-MG. Another candidate gene with higher transcript levels in Fm-MG transcriptome was β- amyloid. A comparative GO enrichment analysis between Fp-MG and Fm-MG showed hydrolases as the enriched GO term in the Fp-MG transcriptome; whereas chitin metabolic process and chitin binding as the enriched GO terms in Fm-MG transcriptome. From the differentially regulated biological processes including digestion, transport, and detoxification, 16 candidate genes were validated using RT-qPCR (Figure
6.1B). Expression patterns between qPCR and RNA-seq were highly correlated (P <
0.001, r = 0.7).
Phenolic targeted metabolomics:
The four samples analyzed included green and Manchurian ash phloem and their respective larval frass showed unique phenolic profile for each sample Principal component analysis showed two distinct clusters for Fp and Fm phloem whereas their respective frass samples i.e. Fp and Fm frass showed an overlap (Figure 6.2A). The first two principal components explained 43.5% variation in the data. Compounds present in green and Manchurian ash phloem were identified as per the literature (Table 6.3). There was no significant difference between the phloem of green and Manchurian ash (Figure
134
6.2B). Similarly, there was no significant difference between the total phenolics of larval frass feeding on green and Manchurian ash (Figure 6.2B).
Among simple phenolics, tyrosol hexoside and hydroxytyrosol hexoside were detected in both Fp and Fm-phloem, but their presence was not detected in Fp and Fm frass. Coumarins were found only in Fm-phloem and were also present in Fm-frass, except for methylesculin and mandschurin. A monolignol, syringin was found only in Fp- phloem and was also detected in Fp-frass. Lignans were found in both Fp and Fm phloem. Among phenylethanoids, calceolariosides A, B and C were found only in Fm- frass and were also identified in Fm-frass at lower levels. In contrast, verbascoside A, B and C was present in both Fp and Fm phloem. Interestingly, only verbascoside A was found in the Fp and Fm frass. Secoiridoids including oleuropein hexoside, oleuropein B oleuropein and ligustroside were detected in both Fp and Fm phloem. Except for oleuropein hexoside and oleuropein B, other secoiridoids were detected in Fp and Fm frass.
Compounds shared between Fp and Fm phloem including hydroxytyrosol hexoside, tyrosol hexoside, hydroxyoleuropein, pinoresinol glucoside, verbascocide A and B, oleuropein, ligustroside were metabolized similarly by A.planipennis. Along with this, there were several new compounds present in the frass of both Fp-frass and Fm- frass.
135
Modeling and docking:
A full-length sequence of a differentially expressed P450 was identified as
CYP6FH1. The deduced amino acid sequence of CYP6FH1 showed the following conserved domains: a heme binding sequence motif FGEGPRICIG (443aa - 453aa), a C- helix sequence WKALR (119aa - 123aa), an oxygen binding motif AGFET (310aa -
314aa), a K-helix motif ETLRKYP (368aa - 373aa) and a sequence motif before the heme thiolate ligand PDKFDP (419aa - 427aa) (Figure 6.3). An in silico 3D protein model was constructed using human CYP3A4 as a template (Figure 6.4). An iron-heme group was covalently attached to sulfur atom of the conserved cysteine residue (Cys450).
A diagnostic test with Ramachandran plot revealed 12.7 % residues occur in the acceptable region with 2% and 2.3% residues occurring in generally allowed and disallowed regions, confirming the structural fold of CYP6FH1. Docking of CYP6FH1 model with compounds present in green and Manchurian ash showed compounds present in green ash phloem and common compounds between both the species as potential metabolic targets (Table 6.4).
Discussion
Previous studies analyzing the molecular differences underlying interspecific variation in resistance between Asian and North American ash species have focused on comparing ash phloem and have been conducted at the metabolomic and/or proteomic
136 level (Cipollini and others 2011; Whitehill and others 2012; Whitehill and others 2011).
In this study I used transcriptomics and targeted metabolomics to distinguish the underlying physiological differences in A.planipennis larval midgut tissue feeding on resistant Manchurian ash and susceptible green ash in addition to comparing ash phloem and larval frass. Illumina sequencing of Fp-MG and Fm-MG yielded a higher number of reads compared to the reads yielded by pyrosequencing showing the comprehensiveness of Illumina sequencing (Mittapalli and others 2010). Reference database created by combining the databases of Fp-MG and Fm-MG yielded two times more (58,871) number of high quality expresses sequence tags (ESTs) than generated by pyrosequencing (25,173) ), indicating that this study was able to enrich the existing database with new transcripts.
Differential expression yielded 380 midgut specific sequences differentially regulated genes between the Fp-MG and Fm-MG transcriptomes. Similar to other wood boring beetles A.planipennis larval midgut harbor a wide variety of bacteria among which
Pseudomonas spp are the most abundant species in early fourth instar larvae
(Vasanthakumar and others 2008). Hydrolases was the enriched GO term in Fp-MG transcriptome. Hydrolases include a large group of enzymes that are involved in hydrolysis of a wide range of chemical bonds like glycosidic, ester, ether, epoxide etc.
(Kanehisa and Goto 2000). In Fp-MG the major hydrolases included β-glucosidases, enzymes hydrolyzing glycosidic bonds mainly involved in digestion. In contrast Fm-MG was enriched with genes involved in chitin binding and chitin metabolism which are key components of peritrophic membrane in insect midgut (Lehane 1997). Though GO
137 enrichment analysis demonstrated hydrolases and chitin metabolism as the significantly different molecular functions between Fp-MG and Fm-MG, all the annotated differentials were classified in to biological processes to shed light on some candidate genes.
Digestion:
In Fp-MG transcriptome, digestion related genes were present in higher numbers.
β- glucosidases were the most abundant genes among the highly expressed genes in Fp-
MG. β- glucosidases are midgut epithelial enzymes that can metabolize toxic plant β- glycosides and cellobiose to their respective products (Terra and Ferreira 1994). Phloem feeders encounter high amounts of cellulose in their diet, which requires a complex process for degradation. β- glucosidases play a role in the degradation of cellulose along with other enzymes, but they also hydrolyze plant β-glucosides to aglycones. However, the function of A.planipennis β-glucosidases requires further study, as there is a lack of research on cellulose digestion of wood-boring beetles. Additionally, lipases and a chymotrypsin-like protease were also present in Fp-MG in higher levels. The expression of this suite of digestion-related transcripts, might suggest that A.planipennis larvae might have efficient digestive metabolism on green ash when compared to feeding on
Manchurian ash.
Most of the genes with higher mRNA levels in Fm-MG belonged to chitin metabolism and peritrophic membrane proteins, which are principal components of the peritrophic membrane (PM) framework in midgut. In insects, PM plays a critical role
138 during digestion by compartmentalizing the midgut lumen to prevent the loss of digestive enzymes (Terra and Ferreira 1994). It also protects midgut tissue from abrasion, viruses, plant allelochemicals, and antioxidants (Hegedus and others 2009; Lehane 1997), and thus plays an important role in structural integrity of the midgut. Plants have evolved defense mechanisms against insect PMs by producing secondary chemicals and proteases that cause lesions or holes in PMs, hindering the digestion process (Harper and others
1998; Mohan and others 2006; Pechan and others 2002). Insects counter defend PM damage by overproduction of PM to repair the lesions (Harper and others 1998) .
Manchurian ash has very high levels of aspartic protease, which was proposed to damage
PM of A.planipennis as observed in other insects (Pechan and others 2002; Whitehill and others 2011).
Further, on-going studies on comparative ash transcriptomics revealed another class of proteases (cysteine) that are higher in Manchurian ash compared to NA ash
(Mamidala et al., Unpublished). Higher transcript levels of PM metabolism genes might indicate counter defense mechanisms of A.planipennis to a damaged PM by Manchurian ash proteases. Higher transcripts of serine proteases in Fm-MG might indicate a compensation mechanism for digestion or a counter response to higher amounts of aspartic proteases found in Manchurian ash phloem(Fescemyer and others 2013).
139
Transporters:
Transporters were highly expressed in both Fp-MG and Fm-MG. However, the classes of transporters differed between the transcriptomes. High expression of amino acid transporters in Fm-MG correlates with the higher amino acid content of green ash phloem relative to Manchurian ash phloem (Hill et al., 2012). Expression of amino acid transporters is regulated by the presence of protein or amino acids in the diet (Erickson et al 1995). Amino acids are building blocks for proteins and enzymes, which are vital for survival and growth. Higher levels of amino acid transporters in Fp-MG suggest an active uptake/utilization of amino acids from the diet. A monocarboxylate transporter was also higher in the Fp-MG transcriptome compared to Fm-MG. Monocarboxylate transporters are present in active tissues and transport low molecular weight substrates (lactate, pyruvate, and branched chain oxo acids) which play a central role in metabolism and cellular communication (Halestrap and Price 1999). A higher mRNA level of monocarboxylate transporter in Fp-MG reflects a highly active state of the tissue
(Halestrap and Price, 1999). Another interesting group of transporters highly expressed in
Fp-MG relative to Fm-MG is that of the multidrug resistant transporters (MDR). These transporters belong to the family of ABC transporters and handle a wide range of substrates including sugars, peptides, and inorganic acids important for cellular metabolism (Higgins 1992). Along with this function, MDRs confer resistance against drugs to tumor cells, virulent bacteria, and nematodes by allowing for the rapid excretion of the xenobiotics (Higgins 1992, James and Davey 2007). The role of MDRs in insects
140 was recently investigated and they are known to be induced in the presence of toxins
(Chahine and O'Donnell, 2011; Simmons et al., 2012). Higher mRNA levels of ApMDR1 in Fp-MG may be a response of the midgut to green ash secondary metabolites.
The transcriptome of Fm-MG showed higher levels of a sugar transporter, a trehalose transporter, an organic cation transporter, and an ABC transporter. Sugar transporters include glucose, fructose, trehalose or galactose transporters. BlastX results of ApSuT demonstrated its similarity to either glucose or trehalose transporter. Sugar transporters are important in translocation of energy sources including glucose and trehalose or might play a role in maintaining osmotic stress. Trehalose is an important blood sugar in insects synthesized in the fat body. Overexpression of trehalose transporters is observed during dehydration and salt stress in sleeping chironomid,
Polypedilum vanderplanki (Kikawada and others 2007). Higher levels of sugar and trehalose in Fm-MG might indicate osmotic stress or translocation of molecules for energy production of larvae while feeding on Manchurian ash. As discussed earlier, mRNA levels of ApMDR-2 might indicate their role either in dealing with dietary toxins present in Manchurian ash phloem.
Detoxification / response to stress:
Higher levels of P450s and GSTs were observed in Fp-MG transcriptome compared to Fm-MG. P450s and GSTs are important players of phase I and phase II stages of the detoxification process. Detoxification is one of the critical defense
141 mechanisms in insects to deal with xenobiotics, including plant allelochemicals and insecticides (Terriere 1984). Induction of P450s in the presence of xenobiotics in insects and their role in providing resistance to xenobiotics including insecticides and secondary chemicals have been extensively reviewed (Bergé and others 1998; Feyereisen 1999;
Schuler 2011; Scott 1999). The differentially expressed GST belongs to class sigma. A spatial and temporal expression analysis of ApGSTS-1 showed higher expression in the fat body and in prepupal stages, indicating that it might play a role in developmentally derived physiological processes (Rajarapu and Mittapalli 2013).
Larvae feeding on Manchurian ash had higher levels of carboxylesterase (CE) and sulfotransferase (ST) compared to Fp-MG. Carboxylesterases are a superfamily of enzymes that hydrolyze carboxyl esters with a broad range of functions. In insects, they are known to play a role in providing insecticide resistance, which has been reviewed by
Wheelock et al. (2005). Induction of CEs was also observed in phytophagous insects encountering dietary allelochemicals (Ugale and others 2011a; Zhang and others 2011a;
Zhang and others 2012). They are also induced as a non-specific responses to stressors including temperature and insecticides (Ivanovic and Jankovic-Hladni 1991). Thus, we hypothesize that higher levels of CEs in Fm-MG might be expressed non-specifically in response to the compounds in Manchurian ash phloem. Sulfotransferases (ST) belong to the phase II detoxification process with a wide range of substrates. They catalyze the conjugation of sulfur to compounds including hormones, drugs, neurotransmitters and xenobiotic compounds thus increasing their solubility for excretion (Weinshilboum and others 1997). Their involvement in sulfating xenobiotic compounds was studied in
142 several invertebrates including insects (Assem and others 2006; Hattori and others 2007;
Hattori and others 2006). Manchurian ash phloem has 30 times the tyramine levels of green ash. Tyramine is a non-amino acid monoamine that is known to be a neuroactive chemical in insects (Lange, 2009). Sulfotransferase is involved in inactivating tyramine by sulfation. Higher expression of ST in Fm-MG might result from encountering higher levels of tyramine in Manchurian ash phloem.
. Along with CEs and STs, Fm-MG also had higher mRNA levels of lactoylglutathione lyase (LGSH) a key player in glyoxylase pathway. Cytotoxic methyl glyoxylate ion formed during glycolysis, amino acid metabolism and acetone metabolism is detoxified via glyoxylase pathway (Thornalley 1993). Higher transcript levels of
LSGH in Fm-MG relative to Fp-MG indicate either high metabolism of glucose via glycolysis or amino acid metabolism for energy production. Another interesting member with higher transcript levels in Fm-MG is a β-amyloid. In insects β-Amyloids play a protective role in eggs due to their mechanical and biological properties (Iconomidou and others 2000). Higher expression of β-Amyloid in Fm-MG might indicate a possible damage to midgut tissue compensated by the higher expression of structurally robust proteins like amyloids.
Phenolic profiles and molecular docking:
To further understand the physiological basis of successful development of
A.planipennis on susceptible NA ash, targeted metabolomics and molecular docking
143 approaches were taken. Consistent with previous reports we found significant differences between Fp- phloem and Fm-phloem (Eyles and others 2007; Whitehill and others 2012).
Hydroxycoumarins and phenylethanoids Calceolariosides A and B were found only in
Fm-phloem whereas syringin was found only in Fp-phloem. This difference is evident from the separation of Fp and Fm phloem in to distinct clusters by PCA analysis.
Interestingly, similar (52%) phenolic profiles of Fp and Fm frass indicates similar mechanisms used for dealing with the compounds encountered in the diet. This suggests that A.planipennis larvae might have mechanisms to deal with phenolics via potential detoxification enzymes with broader substrate specificities. This is evident from the higher expression of P450s and GSTs both in Fp and Fm midgut. Alternatively, the larvae might be impaired to synthesize the essential enzymes required for dealing with the compounds present in Fm-phloem (Rosenthal and Berenbaum 1979).
Metabolism (excretion and transformation) of compounds present in both Fp and
Fm phloem by the larvae might have evolved during its coexistence with Manchurian ash. Presence of new compounds in Fp and Fm frass correlates with higher levels of detoxification enzymes including P450s, GSTs, CEs and glucosyl transferases in both Fp and Fm-MG. These enzymes might potentially be involved in the dealing with phenolics.
Pinoresinol dihexoside was found in both green and Manchurian ash phloem which contradicts their role in contributing to the resistance of Manchurian ash (Whitehill and others 2012).
Further evidence for the involvement of A.planipennis P450s in dealing with ash phenolic was obtained by modeling and docking of CYP6FH1. Transcripts of CYP6FH1
144 were higher in Fp-MG. From the top 5 compounds (Table 6.3) that have high binding energy with CYP6FH1 in this study I identified only Oleuropein and Syringin. However, these two compounds were also present in the frass of Fp-MG. This indicates that larvae might combat these compounds by both detoxification and excretion mechanisms but needs further verification (Rosenthal and Janzen 1979).
In sum, phenolics might not have a potential effect on the A.planipennis survival.
These specialist insects might have adapted to phenolic rich hosts during their coevolution with their native hosts. Higher levels of peritrophic membrane genes might be induced to the potential damage caused to this structure. This might further synergize the effects of phenolics present in Manchurian ash phloem on A.planipennis. Results from this study shed deeper insights into ash phloem defenses and also contributes to the knowledge of molecular physiology of wood boring beetles, a vital group of ecologically important insect species worldwide.
Acknowledgements
I thank Vanessa Muilenberg for providing EAB larvae from her experiment. I thank
Jonathan Lelito and USDA APHIS PPQ for generously providing EAB ova. I also thank
Bryant Chambers, Patricia Verdesota, Bill Barrington, Kara Taylor, Diane Hartzler,
Jamie Imhoff, Samuel Discua, and Sebastian Nieto-Saenz for assistance with fieldwork and Patricia Verdesota, Kara Taylor, Loren Rivera Vega, Sara, Paul, David Showalter and Sebastian Nieto-Saenz for assistance with tree dissections. I thank Larry Phelan, 145
Department of Entomology, OSU for helping with metabolomics experiment and data analysis. I thank Babu Sudhamala, Department of Biochemistry, Hyderabad Central
University, India. I thank Asela Wijeratne for his help with preliminary data analysis and
Bert Cregg and Dave Smitley for their help in establishing the common garden. I thank
David Nelson for providing a nomenclature for P450.
146
Table 6.1: Summary statistics of Illumina reads of Agrilus planipennis larval midgut tissue
Treatment Replicate Total Number Contig size *N50 Average library number of of range (bp) contig reads contigs length(bp)
Larval 1 19,160,562 25,079 201-18348 2,022 1,120 midgut 2 17,152,366 22,501 201-14211 1,831 1,040 feeding on green ash
Larval 1 20,625,994 31,584 201-13421 2,650 1,393 midgut 2 23,318,676 27,944 201-25906 2,573 1,328 feeding on Manchurian ash
147
148
Figure 6.1 Differential transcriptome of A. planipennis midgut (A) Differential expression plot of midgut tissue of Agrilus planipennis larvae feeding on Fraxinus pennsylvanica (Fp-MG) versus F. mandshurica (Fm-MG). Red dots above the red line represent upregulated genes while under the line represent downregulated genes in Fm-MG relative to Fp-MG (B) Proportion of sequences belonging to biological processes (digestion, transporter activity and detoxification (C) Fold change of candidate gene mRNA levels in Fm-MG relative to Fp-MG. Error bars represent SEM of three biological replicates : β-glucosidases (Ap β-glc1, Apβ-glc2), glycoside hydrolases (Ap-GH), peritrophic membrane proteins (ApPM1, ApPM2); transport: Sodium dependent and independent amino acid transporters (ApNa-AAT, ApAAT), Sugar transporters (ApSuT), Multidrug resistant transporters (ApMDR); detoxification/response to stress: Cytochrome P450 (CYP6FH1, ApCYP6FH3), glutathione-s-transferase (ApGST), sulfotransferase (ApST), lactoyglutathione lyase (ApLGSH), carboxylesterase (ApCE), β-amyloid
148
Table 6.2: Differentially regulated biological process in the midgut of larvae feeding on Fraxinus pennsylvanica (green ash) and F. mandshurica (Manchurian ash). Fraxinus pennsylvanica (green ash) F. mandshurica (Manchurian ash) larval larval midgut midgut Functions/Biological Number of Functions/Biological Number of process genes Process genes Digestion* 22 Chitin metabolism* 34 (β-glucosidase, (Peritrophins, glycoside hydrolase, Chitin deacetylase lipases) Chitinase) Transporter 6 Transporter 4 (Amino transporters, (Sugar transporter, ABC transporters, Organic cation transporter, Monocarboxylate Trehalose transporter) transporter, Detoxification 5 Detoxification 2 (Cytochrome p450 (carboxylesterase, Glutathione-s-transferase) sulfotrasferase, lactoylglutathione lyase)
* indicates significantly different functional groups according to GO enrichment analysis
149
A
B Frass
Figure 6.2 Comparison of HPLC-UV chromatographic profiles of (A) Principal component analysis of phloem and frass samples(C) Total phenolics present in Manchurian ash phloem and its corresponding larval frass; green ash phloem and its corresponding larval frass
150
Table 6.3 Identification of compounds present in green ash, F. pennsylvanica (Fp) and Manchurian ash, F. mandshurica (Fm) phloem
Peak Phloem RT in Ions Putative Identification number sample HPLC-UV (Eyles et al 2011, Whitehill et (Retention al 2012) Time) 1 Fm, Fp 7.68 315, 135 Hydroxytryrosol hexoside 2 Fm, Fp 9.75 299 Tyrosol hexoside 3 Fm 10.38 339, 177 Esculin 4 Fm, Fp 11.52 431 Unknown 1 5 Fm, Fp 12.45 611, 403, 223 Elenolic acid derivative 6 Fm 12.67 353, 191 Methyl Esculin 7 Fp 12.89 417 Syringin 8 Fm 12.94 389,501 Oleoside 9 Fm 13.44 369, 207 Fraxin 10 Fm 14.14 385*, 223 Mandschurin 11 Fp 14.87 403, 447, 224 Unknown 12 Fm 15.6 477, 377, 341, 197 Calceolarioside C 13 Fm 15.9 519, 681 Pinoresinol dihexoside 14 Fm, Fp 17.2 373, 329 Hydroxypinoresinol diglucoside 15 Fm 18.09 477, 255, 179, 356 Calceolarioside A 16 Fp 18.15 565, 613, 241 Unknown 17 Fp 18.44 653 Unknown 18 Fm, Fp 18.82 623 Verbascoside 19 Fm, Fp 19.18 519, 357, 161 Pinoresinol glucoside 20 Fm 19.4 477, 316, 281, 161 Calceolarioside B 21 Fm, Fp 20.2 623, Verbascoside B 22 Fm, Fp 22.02 539, 377, 307, 275 Oleuropein 23 Fm, Fp 23.97 523, 361 Ligustroside 24 Fm 24.04 553, 289 Oleuropein related compound
Bold indicates the dominant ion. * represents compounds identified in ESI positive mode.
151
Figure 6.2: Characterization of CYP6FH1 (A) Nucleotide (first line) and the deduced amino acid sequence (second line) of CYP6FH1.Start codon ATG and its corresponding amino acid are represented in bold and an * in the amino acid sequence represents a stop. Underlined amino acids are the conserved domains forming catalytic and substrate binding sites of P450
152
Figure 6.4: Molecular modeling and docking of CYP6FH1 with F. pennsylvanica (green ash) allelochemicals. (A) Representation of the homology model of CYP6FH1. The cartoon model of CYP397A1V2 is colored using a blue to red gradient from N-terminus to C-terminus. The model was created with MODELLER 9v8 using human cytochrome P450 CYP3A4 as a template (B-E) green ash allelochemicals docked into the binding site of CYP6FH1. Images show the orientation of the compounds in catalytic site (red ring structure) and interacting amino acids (B) Syringaresinol, (C) Oleuropein (D) Apigenin and (E) syringin .
153
Table 6.4: Calculated Binding energies, Inhibition constant (Ki) and Binding constant (Ka) of compounds from Fraxinus pennsylvanica allelochemicals against CYP6FH1 ranked in ascending order of calculated Ka.
Compound Binding Inhibition Calculated Interacting amino acids in CYP6FH1 a Energya Constantb Binding catalytic pocket c (Kcal Ki Constant -1 -1 M ) (Ka) M Syraingaresinol -9.11 210.86 nM 4.74 x 106 Lys238, Ala272, Ser139, Asn242 Oleuropein -8.27 861.35 nM 1.16 x 106 Glu241, Val118, Val116 Apigenin -7.29 1.57 µM 6.36 x 105 Asn242, Ala360.
Syringin -7.47 3.36 µM 2.97 x 105 Phe240, Glu119, Val118, Glu121,
154 Ser139, Phe138 5
p-coumaryl quinic -7.27 4.67 µM 2.14 x 10 Asn242, Leu557, Pro433
acid
Quercetin -7.09 6.39 µM 1.56 x 105 Ala360,Glu241, Asn242, Val118,
Glu119, Glu121, Phe138, Ser139,
Phe133
Tyrosol hexoside -7.02 7.19 µM 1.39 x 105 Ala360, Glu241, Asn242
Ligustroside -5.34 121.71 µM 8.21 x 102 Lys238, Phe240, Glu558, Asn554, Glu243 Nuezhenide -2.22 23.48 mM 4.25 x 101 Glu558, Glu243, Asn242, Glu241 Binding energy -Energy required by the enzyme to position the substrate at the catalytic site for efficient catalysis b Inhibitory Constant- is defined as the concentration required to produced half maximum inhibition. It is estimated using AUTODOCK c Binding constant- Determines the energy of enzyme substrate complex
154
References:
Amiour, N, Imbaud, S, Clement, G, Agier, N, Zivy, M, Valot, B, Balliau, T, Armengaud, P, Quillere, I, Canas, R, Tercet-Laforgue, T and Hirel, B (2012) The use of metabolomics integrated with transcriptomic and proteomic studies for identifying key steps involved in the control of nitrogen metabolism in crops such as maize. Journal of Experimental Botany 63: 5017-5033. Anders, S and Huber, W (2010) Differential expression analysis for sequence count data. Genome Biology 11. Assem, F, Kirk, C and Chipman, J (2006) Substrate characterisation of a recombinant sulfotransferase SULT1 and mRNA expression in chub ( Leuciscus cephalus) tissues. Biochemical and biophysical research communications 349: 900-905. Bergé, J, Feyereisen, R, Amichot, M, Bergé, J, Feyereisen, R and Amichot, M (1998) Cytochrome P450 monooxygenases and insecticide resistance in insects. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 353: 1701-1705. Cappaert, D, McCullough, DG, Poland, TM and Siegert, NW (2005) Emerald ash borer in North America: A research and regulatory challenge. American Entomologist 51: 152-165. Chahine, S and O'Donnell, MJ (2011) Interactions between detoxification mechanisms and excretion in Malpighian tubules of Drosophila melanogaster. Journal of Experimental Biology 214: 462-468. Chen, Y, Cassone, BJ, Bai, X, Redinbaugh, MG and Michel, AP (2012) Transcriptome of the Plant Virus Vector Graminella nigrifrons, and the Molecular Interactions of Maize fine streak rhabdovirus Transmission. Plos One 7: e40613-e40613. Choi, JY, Roh, JY, Wang, Y, Zhen, Z, Tao, XY, Lee, JH, Liu, Q, Kim, JS, Shin, SW and Je, YH (2012) Analysis of Genes Expression of Spodoptera exigua Larvae upon AcMNPV Infection. Plos One 7: e42462. Cipollini, D, Wang, Q, Whitehill, JGA, Powell, JR, Bonello, P and Herms, DA (2011) Distinguishing Defensive Characteristics in the Phloem of Ash Species Resistant and Susceptible to Emerald Ash Borer. Journal of Chemical Ecology 37: 450-459. Enright, M and Griffin, C (2004) Specificity of Association between Paenibacillus spp. and the Entomopathogenic Nematodes, Heterorhabditis spp. Microbial ecology 48: 414-423. Eyles, A, Jones, W, Riedl, K, Cipollini, D, Schwartz, S, Chan, K, Herms, DA and Bonello, P (2007) Comparative phloem chemistry of manchurian (Fraxinus mandshurica) and two north american ash species (Fraxinus americana and Fraxinus pennsylvanica). Journal of Chemical Ecology 33: 1430-1448. Ferreres, F, Sousa, C, Valentao, P, Pereira, JA, Seabra, RM and Andrade, PB (2007) Tronchuda cabbage flavonolds uptake by Pieris brassicae. Phytochemistry 68: 361-367. Fescemyer, HW, Sandoya, GV, Gill, TA, Ozkan, S, Marden, JH and Luthe, DS (2013) Maize toxin degrades peritrophic matrix proteins and stimulates compensatory
155
transcriptome responses in fall armyworm midgut. Insect Biochemistry and Molecular Biology 43: 280-91. Feyereisen, R (1999) Insect P450 enzymes. Annual Review of Entomology 44: 507-533. Fiehn, O (2002) Metabolomics - the link between genotypes and phenotypes. Plant Molecular Biology 48: 155-171. Fowler, DM, Koulov, AV, Balch, WE and Kelly, JW (2007) Functional amyloid - from bacteria to humans. Trends in Biochemical Sciences 32: 217-224. Fridman, E and Pichersky, E (2005) Metabolomics, genomics, proteomics, and the identification of enzymes and their substrates and products. Current Opinion in Plant Biology 8: 242-248. Ge, H, Liu, ZH, Church, GM and Vidal, M (2001) Correlation between transcriptome and interactome mapping data from Saccharomyces cerevisiae. Nature Genetics 29: 482-486. Ge, H, Walhout, AJM and Vidal, M (2003) Integrating 'omic' information: a bridge between genomics and systems biology. Trends in Genetics 19: 551-560. Grabherr, MG, Haas, BJ, Yassour, M, Levin, JZ, Thompson, DA, Amit, I, Adiconis, X, Fan, L, Raychowdhury, R, Zeng, Q, Chen, Z, Mauceli, E, Hacohen, N, Gnirke, A, Rhind, N, di Palma, F, Birren, BW, Nusbaum, C, Lindblad-Toh, K, Friedman, N and Regev, A (2011) Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology 29: 644-U130. Halestrap, AP and Price, NT (1999) The proton-linked monocarboxylate transporter (MCT) family: structure, function and regulation. Biochemical Journal 343: 281. Harper, M, Hopkins, T and Czapla, T (1998) Effect of wheat germ agglutinin on formation and structure of the peritrophic membrane in european corn borer (Ostrinia nubilalis) larvae. Tissue and Cell 30: 166-176. Hattori, K, Hirayama, M, Suzuki, H, Hamamoto, H, Sekimizu, K and Tamura, H-o (2007) Cloning and expression of a novel sulfotransferase with unique substrate specificity from Bombyx mori. Bioscience Biotechnology and Biochemistry 71: 1044-1051. Hattori, K, Inoue, M, Inoue, T, Arai, H and Tamura, H (2006) A novel sulfotransferase abundantly expressed in the dauer larvae of Caenorhabditis elegans. Journal of biochemistry 139: 355-362. Hegedus, D, Erlandson, M, Gillott, C and Toprak, U (2009) New insights into peritrophic matrix synthesis, architecture, and function. Annual Review of Entomology 54: 285-302. Hill, AL, Whitehill, JGA, Opiyo, SO, Phelan, PL and Bonello, P (2012) Nutritional attributes of ash (Fraxinus spp.) outer bark and phloem and their relationships to resistance against the emerald ash borer. Tree Physiology 32: 1522-1532. Hirai, MY, Klein, M, Fujikawa, Y, Yano, M, Goodenowe, DB, Yamazaki, Y, Kanaya, S, Nakamura, Y, Kitayama, M, Suzuki, H, Sakurai, N, Shibata, D, Tokuhisa, J, Reichelt, M, Gershenzon, J, Papenbrock, J and Saito, K (2005) Elucidation of gene-to-gene and metabolite-to-gene networks in Arabidopsis by integration of metabolomics and transcriptomics. Journal of Biological Chemistry 280: 25590- 25595. 156
Iconomidou, VA, Vriend, G and Hamodrakas, SJ (2000) Amyloids protect the silkmoth oocyte and embryo. Febs Letters 479: 141-145. Ivanovic, J and Jankovic-Hladni, M (1991) Hormones and metabolism in insect stress. CRC. Jansen, JJ, Allwood, JW, Marsden-Edwards, E, van der Putten, WH, Goodacre, R and van Dam, NM (2009) Metabolomic analysis of the interaction between plants and herbivores. Metabolomics 5: 150-161. Kanehisa, M and Goto, S (2000) KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Research 28: 27-30. Kikawada, T, Saito, A, Kanamori, Y, Nakahara, Y, Iwata, K, Tanaka, D, Watanabe, M and Okuda, T (2007) Trehalose transporter 1, a facilitated and high-capacity trehalose transporter, allows exogenous trehalose uptake into cells. Proceedings of the National Academy of Sciences 104: 11585-11590. Lahtinen, M, Kapari, L and Kentta, J (2006) Newly hatched neonate larvae can glycosylate: The fate of Betula pubescens bud flavonoids in first instar Epirrita autumnata. Journal of Chemical Ecology 32: 537-546. Lange, AB (2009) Tyramine: from octopamine precursor to neuroactive chemical in insects. General and comparative endocrinology 162: 18-26. Lehane, M (1997) Peritrophic matrix structure and function. Annual Review of Entomology 42: 525-550. Liu, B, Jiang, G, Zhang, Y, Li, J, Li, X, Yue, J, Chen, F, Liu, H, Li, H, Zhu, S, Wang, J and Ran, C (2011) Analysis of Transcriptome Differences between Resistant and Susceptible Strains of the Citrus Red Mite Panonychus citri (Acari: Tetranychidae). Plos One 6. Livak, KJ and Schmittgen, TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25: 402-408. Lou, Y-j (2012) Research progress in drug toxicology based on systems biology. Zhongguo Yaolixue Yu Dulixue Zazhi 26: 476-481. Mamidala, P, Wijeratne, AJ, Wijeratne, S, Kornacker, K, Sudhamalla, B, Rivera-Vega, LJ, Hoelmer, A, Meulia, T, Jones, SC and Mittapalli, O (2012) RNA-Seq and molecular docking reveal multi-level pesticide resistance in the bed bug. Bmc Genomics 13. Mittapalli, O, Bai, XD, Mamidala, P, Rajarapu, SP, Bonello, P and Herms, DA (2010) Tissue-Specific Transcriptomics of the Exotic Invasive Insect Pest Emerald Ash Borer (Agrilus planipennis). Plos One 5. Mohan, S, Ma, P, Pechan, T, Bassford, E, Williams, W and Luthe, D (2006) Degradation of the S. frugiperda peritrophic matrix by an inducible maize cysteine protease. Journal of Insect Physiology 52: 21-28. Nadella, KD, Marla, SS and Kumar, PA (2012) Metabolomics in Agriculture. Omics-a Journal of Integrative Biology 16: 149-159. Nelson, DR (2009) The Cytochrome P450 Homepage. Human Genomics 4: 59-65. Pascual, L, Jakubowska, AK, Blanca, JM, Canizares, J, Ferre, J, Gloeckner, G, Vogel, H and Herrero, S (2012) The transcriptome of Spodoptera exigua larvae exposed to 157
different types of microbes. Insect Biochemistry and Molecular Biology 42: 557- 570. Pechan, T, Cohen, A, Williams, WP and Luthe, DS (2002) Insect feeding mobilizes a unique plant defense protease that disrupts the peritrophic matrix of caterpillars. Proceedings of the National Academy of Sciences 99: 13319-13323. Poelchau, MF, Reynolds, JA, Denlinger, DL, Elsik, CG and Armbruster, PA (2011) A de novo transcriptome of the Asian tiger mosquito, Aedes albopictus, to identify candidate transcripts for diapause preparation. Bmc Genomics 12. Rajarapu, SP, Mamidala, P, Herms, DA, Bonello, P and Mittapalli, O (2011) Antioxidant genes of the emerald ash borer (Agrilus planipennis): Gene characterization and expression profiles. Journal of Insect Physiology 57: 819-824. Rajarapu, SP, Mamidala, P and Mittapalli, O (2012) Validation of reference genes for gene expression studies in the emerald ash borer (Agrilus planipennis). Insect Science 19: 41-46. Rebek, EJ, Herms, DA and Smitley, DR (2008) Interspecific variation in resistance to Emerald ash borer (Coleoptera : Buprestidae) among North American and Asian ash (Fraxinus spp.). Environmental Entomology 37: 242-246. Salminen, JP, Lahtinen, M, Lempa, K, Kapari, L, Haukioja, E and Pihlaja, K (2004) Metabolic modifications of birch leaf phenolics by an herbivorous insect: Detoxification of flavonoid aglycones via glycosylation. Zeitschrift Fur Naturforschung C-a Journal of Biosciences 59: 437-444. Schuler, MA (2011) P450s in plant-insect interactions. Biochimica Et Biophysica Acta- Proteins and Proteomics 1814: 36-45. Schuster, SC (2008) Next-generation sequencing transforms today's biology. Nature Methods 5: 16-18. Scott, JG (1999) Cytochromes P450 and insecticide resistance. Insect Biochemistry and Molecular Biology 29: 757-777. Simmons, J, D'Souza, O, Rheault, M and Donly, C (2012) Multidrug resistance protein gene expression in Trichoplusia ni caterpillars. Insect Molecular Biology. Terra, WR and Ferreira, C (1994) Insect Digestive Enzymes - Properties, Compartmentalization and Funtion Comparative Biochemistry and Physiology B- Biochemistry & Molecular Biology 109: 1-62. Terriere, LC (1984) Induction of detoxification enzymes in insects Annual Review of Entomology 29: 71-88. Thornalley, PJ (1993) The glyoxylase system in health and disease Molecular Aspects of Medicine 14: 287-371. Ugale, TB, Barkhade, UP, Moharil, MP and Ghule, S (2011) Induction of midgut carboxylesterase and cytochrome p-450 in Helicoverpa armigera (Hubner) by different hosts. Crop Research (Hisar) 42: 269-275. Vasanthakumar, A, Handelsman, J, Schloss, PD, Bauer, LS and Raffa, KF (2008) Gut microbiota of an invasive subcortical beetle, Agrilus planipennis Fairmaire, across various life stages. Environmental Entomology 37: 1344-1353. Walhout, AJM, Reboul, J, Shtanko, O, Bertin, N, Vaglio, P, Ge, H, Lee, H, Doucette- Stamm, L, Gunsalus, KC, Schetter, AJ, Morton, DG, Kemphues, KJ, Reinke, V, 158
Kim, SK, Piano, F and Vidal, M (2002) Integrating interactome, phenome, and transcriptome mapping data for the C-elegans germline. Current Biology 12: 1952-1958. Wang, Z, Gerstein, M and Snyder, M (2009) RNA-Seq: a revolutionary tool for transcriptomics. Nature Reviews Genetics 10: 57-63. Weinshilboum, RM, Otterness, D, Aksoy, IA, Wood, TC, Her, C and Raftogianis, R (1997) Sulfation and sulfotransferases 1: Sulfotransferase molecular biology: cDNAs and genes. The FASEB journal 11: 3-14. Wheelock, CE, Shan, G and Ottea, J (2005) Overview of carboxylesterases and their role in the metabolism of insecticides. Journal of Pesticide Science 30: 75-83. Whitehill, JGA, Opiyo, SO, Koch, JL, Herms, DA, Cipollini, DF and Bonello, P (2012) Interspecific Comparison of Constitutive Ash Phloem Phenolic Chemistry Reveals Compounds Unique to Manchurian Ash, a Species Resistant to Emerald Ash Borer. Journal of Chemical Ecology 38: 499-511. Whitehill, JGA, Popova-Butler, A, Green-Church, KB, Koch, JL, Herms, DA and Bonello, P (2011) Interspecific Proteomic Comparisons Reveal Ash Phloem Genes Potentially Involved in Constitutive Resistance to the Emerald Ash Borer. Plos One 6. Zhang, B, Liu, H, Hull-Sanders, H and Wang, JJ (2011) Effect of Host Plants on Development, Fecundity and Enzyme Activity of Spodoptera exigua (Hubner) (Lepidoptera: Noctuidae). Agricultural Sciences in China 10: 1232-1240. Zhang, YE, Ma, HJ, Feng, DD, Lai, XF, Chen, ZM, Xu, MY, Yu, QY and Zhang, Z (2012) Induction of Detoxification Enzymes by Quercetin in the Silkworm. Journal of Economic Entomology 105: 1034-1042.
159
Chapter 7 Summary and future directions
Several studies have aimed to understand the molecular traits underpinning interspecific variation in ash resistance. Comparative transcriptomics, proteomics and metabolomics between the phloem of NA ash spp. and Asian ash (F. mandshurica
Ruprecht, Manchurian ash) indicated higher levels of biotic and abiotic stress genes, defense proteins and unique compounds in Manchurian ash (Bai and others 2011;
Cipollini and others 2011; Eyles and others 2007; Whitehill and others 2012; Whitehill and others 2011). Unique phenolic compounds and high levels of proteases found in
Manchurian ash are hypothesized to be the potential defense mechanisms of Manchurian ash. In contrast to the progress that has been made in understanding ash defenses to
A.planipennis larvae, relatively little is known about A.planipennis defenses and physiological responses of A.planipennis on ash trees. Thus my objective for this dissertation was to decipher the molecular interactions of A.planipennis larvae with its native (Asian ash) and naïve (North American (NA) ash) hosts. My objectives were accomplished by an integrated omics approach including transcriptomics and metabolomics.
160
Antioxidation Mechanism:
Phenolics are pro-oxidant compounds, meaning they release reactive oxygen species upon oxidation. This phenomenon is favorable at alkaline pH in the gut of a phytophagous insect (Appel 1993). Woody plants have phenolics associated with cell walls to provide structural integrity. Wood feeding insects encounter these compounds very frequently and need to have efficient mechanisms to deal with these pro-oxidants in their diet. Antioxidation is the potential mechanism in insects to neutralize reactive oxygen species (Larson 1986). Enzymes involved in antioxidation are superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX) (Ahmad 1992) An assessment of mRNA levels of antioxidant genes in the larval tissues of A.planipennis showed the expression of these genes in midgut, fat body and Malpighian tubule.
Distribution of antioxidant genes in these tissues indicates the oxidative stress challenged by these important tissues. In particular, midgut specific expression of catalase indicates its role in encountering hydrogen peroxide formed in this tissue either from diet or endogenous metabolism (Chapter 2). During development, CAT had fluctuating expression patterns in larval stages with a sudden decrease in adults, whereas SOD and
GPX had similar levels throughout development. However, specific activities of all the antioxidant enzymes were similar in neonates, larvae and adults. This expression pattern of antioxidant enzymes both at mRNA/protein level indicates that an efficient antioxidant mechanism is essential for A.planipennis. This mechanism might be important irrespective of the host they feed, as it is evident in the larval midgut feeding on green, F.
161 pennsylvanica, and Manchurian, F. mandshurica ash, wherein expression levels of antioxidant genes were higher and similar in larvae feeding on both these hosts.
Detoxification mechanism:
Phase I and phase II enzymes are important players of detoxification pathway in herbivorous insects to overcome their host defenses and develop successfully.
Cytochrome P450s (P450) are the major group of phase I detoxification enzymes. In larvae feeding on green ash, mRNA levels of P450s were higher in midgut and
Malpighian tubule (Chapter 3). Studies have shown the participation of these two tissues in detoxification along with other physiological functions (Dow 1986; Dow and Davies
2006). Modeling of a P450, CYP6FH1, highly expressed in A.planipennis larval
Malpighian tubule, feeding on green ash, showed an array of compounds unique in green ash and those shared between both the ash species (green and Manchurian ash) as potential substrates. This indicates that A.planipennis might have developed P450 derived detoxification mechanisms to encounter phenolics during its coevolution with its Asian hosts. This is further supported by fewer number of P450s differentially expressed between larval midgut of A.planipennis feeding on green and Manchurian ash.This suggests that larvae feeding on Manchurian ash might use P450s with broader substrate specificity to detoxify Fraxinus spp allelochemicals. Nevertheless, P450s with higher mRNA levels in larval midgut feeding on green ash, relative to those feeding on
Manchurian ash, might be an adaptation to the new host. A continuous participation of
162 these enzymes might also be required throughout development in A.planipennis to establish a successful feeding site, as similar mRNA and enzyme levels were observed in all the developmental stages.
Glutathione-S-transferase (GSTs) constitutes major phase II enzymes in detoxification pathway. Among the different classes of GSTs, epsilon class members are known to participate in dealing with allelochemicals. Higher expression of GSTs in metabolically active tissues such as midgut and Malpighian tubule indicates their active role in encountering host or endogenous metabolism derived stress (Chapter 3). Higher expression of an epsilon GST relative to neonates during feeding instars suggests their potential role in dealing with the allelochemicals. However, specific activity of total
GSTs was similar in all the developmental stages indicating the importance of higher titers of these enzymes in A.planipennis. These observations suggest that A.planipennis might require GST derived detoxification mechanisms along with P450 based mechanisms. These two mechanisms might act in parallel to catabolize a single compound or independently, metabolizing different compounds. Similar to P450s, GSTs were also highly expressed in larval midgut of A.planipennis feeding on green and
Manchurian, indicating that these mechanisms might be well developed in A.planipennis larvae to encounter ash allelochemicals. Targeted metabolomic of phloem, larval tissues and frass suggested efficient catabolism of phenolics present in green ash phloem
(Chapter 4). In addition to this, presence of new compounds in tissues indicates potential transformation of phloem phenolics. Along with this, few compounds were excreted without modification, although the quantities excreted were lower in frass. Overall,
163 phenolic flux and their metabolism inside A.planipennis larvae can be summarized using a model.
Hypothetical model:
According to the model, few ingested phenolics might undergo pH depended oxidation in the foregut of the larvae and pass through the midgut lumen. Phytophagous insect midgut lumen is an active site for digestion and antioxidation (Barbehenn 2002).
However, detoxification activities were not measured in the gut lumen of insects.
Presence of new compounds in gut lumen indicates potential transformation/detoxification mechanisms. A.planipennis larval midgut and Malpighian tubules tissues might be an active site for P450s and GSTs derived detoxification, evident from the presence of new compounds in this tissue. Few compounds might also be absorbed and circulated in the hemolymph, which are dealt by other tissues. Multidrug resistance transporters found in midgut tissue might play a role in reabsorption of compounds present in the hemolymph.
164
Figure 7.1: Ash allelochemical (phenolic) flux inside A.planipennis larvae. Arrows indicate the direction of phenolic flow inside the larvae. Yellow structures indicate potential sites for transformation. P450s – cytochrome P450, GST- Glutathione-S- Transferases.
Larvae feeding on green, F. pennsylvanica, vs Manchurian, F. mandshurica, ash:
In addition to P450s and GSTs, RNA seq of A.planipennis larval midgut revealed other phase II detoxification genes including carboxylesterases (CE) and glucosyl transferases, highly expressed in larval midgut feeding on green and Manchurian ash. A comparative expression pattern between the larval midguts feeding on two hosts indicates that A.planipennis might have similar mechanisms to deal with allelochemicals encountered in these hosts. This observation is supported by the targeted metabolic
165 profiles of green ash phloem and Manchurian ash phloem along with the- larval frass feeding on them. Phenolic profiles of larval frass feeding on green and Manchurian ash were similar indicating similar catabolism of phenolics corroborating with similar mechanisms of the larvae at gene level. Further, identification of these compounds will shed light on the potential mechanisms used by A.planipennis larvae.
Larval midgut feeding on Manchurian ash showed higher expression of sulfotransferases. These enzymes participate in detoxification of phenolic compounds in other insects (Hattori and others 2007). They also deactivate endogenous compounds such as neurotransmitters and proteins (Weinshilboum and others 1997). Higher levels of sulfotransferase in A.planipennis feeding on Manchurian ash might indicate their participation in neutralization of unique phenolic compounds or non-protein amino acid, tyramine, in Manchurian ash phloem. Tyramine is 30 times higher in Manchurian ash phloem relative to North American ash hosts (Hill and others 2012). It is a potential neurotransmitter in insects which is deactivated by sulfation (Lange 2009). Tyramine might cause behavioral changes in A.planipennis larvae such as inducing excessive feeding leading to increased intake of allelochemicals. It would be interesting to test this hypothesis in A.planipennis as the effect of tyramine on insect behavior is unknown.
Peritrophic membrane synthesis genes were highly expressed in A.planipennis larvae feeding on Manchurian ash, indicating a possible damage to this important structure in midgut. Damage caused to peritrophic membrane might affect digestion, which is evident from relatively lower levels of digestion genes and might also act in synergizing the effect of Manchurian ash phenolics on A.planipennis larvae.
166
Future directions:
Results obtained lay a foundation for studying wood boring beetle physiology in the context of counterdefense mechanisms employed against host defenses and asks new questions about the adaptation of these insects. Induction of detoxification enzymes occur in presence of xenobiotics (Terriere 1984). Though higher transcript levels of detoxification and antioxidant genes was observed in A. planipennis larval tissues and developmental stages, contribution of these genes to A. planipennis survival is elusive.
Studies in other insects have used enzyme inhibitors to deduce their role in xenobiotic resistance (Karatolos and others 2012). Similar bioassays with artificial diet containing inhibitors of enzymes (E.g. Piperonyl butoxide for P450s, Sulfasalizine for GSTs,
Bisbenzene sulfonamides) along with phenolic extract would demonstrate the role of these enzymes in adaption of A.planipennis on phenolic rich diet. Further, at gene level, knockdown of specific candidate genes via RNA interference (RNAi) would allow to determine the functional importance of the gene for detoxifying putative toxins (Bautista and others 2009). RNAi is a very efficient tool to elucidate the functional properties of genes. This mechanism was efficiently used in members of Lepidoptera, Hemiptera,
Diptera and Coleoptera and is recently reviewed (Li and others 2013; Yu and others
2013).
Results from RNA-seq have brought to light other candidate genes that might be playing role in A.planipennis- Fraxinus spp interactions. β- Glucosidases were the most abundant genes with higher levels in A. planipennis larval midgut tissue feeding on green
167 ash phloem. Studies in insects demonstrate the role of β-glucosidases in digestion and allelochemical detoxification. It would be interesting to analyze the enzymatic properties of β- glucosidases in A. planipennis to understand their role in these beetles. Another interesting group of genes were multi drug resistance transporters (MDR). In specialist herbivores they are proposed to expel the toxins from circulation (Sorensen and Dearing
2006). To test this in A. planipennis, functional characterization of MDR gene can be achieved by injecting the mRNA into Xenopus oocytes. Developing Xenopus embryos is an efficient system and is widely used for studying gene function (Vize and others 1991).
Along with these carboxylesterase (CEs) was also present among the differentially expressed transcripts. CEs are also known to detoxify xenobiotics and have been studied least in insect-plant interaction. Characterizing these genes in A.planipennis might give more insights in to CE bases detoxification in this wood boring beetle. Higher expression of peritrophic membrane synthesizing genes in larvae feeding on Manchurian ash is predicted due to the damage caused by the aspartic and cysteine proteases. A confirmation of this observation can be further accomplished by analyzing the microscopic sections of midgut tissue of larvae feeding on Manchurian ash with high level of proteases plus with supplementary artificial diet experiments.
Lastly, modeling studies of a differentially expressed P450 has shown the array of compounds present in green ash phloem as putative substrates. However, metabolomic profiles of phloem and larval samples have shown the presence of these compounds in frass also indicating their expulsion without modification. Therefore, further testing of the model in vitro for its substrate specificity is needed. Integrating this study with
168 metabolomics or identifying the compounds formed in frass would further contribute to the mechanisms employed by A. planipennis larvae dealing with phenolics. Further, it would also be interesting to analyze the response of A. planipennis larvae feeding on stressed Manchurian ash. This would complement the on-going studies to understand the metabolomic differences between healthy and stressed ash trees.
169
References: Ahmad S. 1992. Biochemical Defence of Pro-Oxidant Plant Allelochemicals by Herbivorous Insects. Biochemical Systematics and Ecology 20(4):269-296. Appel HM. 1993. Phenolics in Ecological Interactions: The Importance of Oxidation. Journal of Chemical Ecology 19(7):1521-1552. Bai, X, Rivera-Vega, L, Mamidala, P, Bonello, P, Herms, DA and Mittapalli, O (2011) Transcriptomic signatures of ash (fraxinus spp.) phloem. Plos One 6. Barbehenn RV. 2002. Gut-Based Antioxidant Enzymes in a Polyphagous and a Graminivorous Grasshopper. Journal of Chemical Ecology 28(7):1329-1347. Bautista, MAM, Miyata, T, Miura, K and Tanaka, T (2009) Rna interference-mediated knockdown of a cytochrome p450, cyp6bg1, from the diamondback moth, plutella xylostella, reduces larval resistance to permethrin. Insect Biochemistry and Molecular Biology 39: 38-46. Cipollini, D, Wang, Q, Whitehill, JGA, Powell, JR, Bonello, P and Herms, DA (2011) Distinguishing defensive characteristics in the phloem of ash species resistant and susceptible to emerald ash borer. Journal of Chemical Ecology 37: 450-459. Dow JAT. 1986. Insect Midgut Function. Advances in Insect Physiology 19:187-328. Dow JAT, Davies SA. 2006. The Malpighian Tubule: Rapid Insights from Post-Genomic Biology. Journal of Insect Physiology 52(4):365-378. Eyles, A, Jones, W, Riedl, K, Cipollini, D, Schwartz, S, Chan, K, Herms, DA and Bonello, P (2007) Comparative phloem chemistry of manchurian (fraxinus mandshurica) and two north american ash species (fraxinus americana and fraxinus pennsylvanica). Journal of Chemical Ecology 33: 1430-1448. Hattori K, Hirayama M, Suzuki H, Hamamoto H, Sekimizu K, Tamura H-o. 2007. Cloning and Expression of a Novel Sulfotransferase with Unique Substrate Specificity from Bombyx Mori. Bioscience Biotechnology and Biochemistry 71(4):1044-1051. Hill AL, Whitehill JGA, Opiyo SO, Phelan PL, Bonello P. 2012. Nutritional Attributes of Ash (Fraxinus Spp.) Outer Bark and Phloem and Their Relationships to Resistance against the Emerald Ash Borer. Tree Physiology 32(12):1522-1532. Karatolos, N, Williamson, MS, Denholm, I, Gorman, K, Ffrench-Constant, RH and Bass, C (2012) Over-expression of a cytochrome p450 is associated with resistance to pyriproxyfen in the greenhouse whitefly trialeurodes vaporariorum. Plos One 7: e31077. Lange AB. 2009. Tyramine: From Octopamine Precursor to Neuroactive Chemical in Insects. General and comparative endocrinology 162(1):18-26. Larson RA. 1986. Insect Defenses against Phototoxic Plant-Chemicals. Journal of Chemical Ecology 12(4):859-870. Li, J, Wang, XP, Wang, MQ, Ma, WH and Hua, HX (2013) Advances in the use of the rna interference technique in hemiptera. Insect Science 20: 31-39. Sorensen, JS and Dearing, MD (2006) Efflux transporters as a novel herbivore countermechanism to plant chemical defenses. Journal of Chemical Ecology 32: 1181-1196.
170
Terriere, LC (1984) Induction of detoxification enzymes in insects Annual Review of Entomology 29: 71-88. Vize, PD, Melton, DA, Hemmatibrivanlou, A and Harland, RM (1991) Assays for gene- function in developing xenopus-embryos. Methods in Cell Biology 36: 367-&. Weinshilboum RM, Otterness D, Aksoy IA, Wood TC, Her C, Raftogianis R. 1997. Sulfation and Sulfotransferases 1: Sulfotransferase Molecular Biology: Cdnas and Genes. The FASEB journal 11(1):3-14. Whitehill, JGA, Opiyo, SO, Koch, JL, Herms, DA, Cipollini, DF and Bonello, P (2012) Interspecific comparison of constitutive ash phloem phenolic chemistry reveals compounds unique to manchurian ash, a species resistant to emerald ash borer. Journal of Chemical Ecology 38: 499-511. Whitehill, JGA, Popova-Butler, A, Green-Church, KB, Koch, JL, Herms, DA and Bonello, P (2011) Interspecific proteomic comparisons reveal ash phloem genes potentially involved in constitutive resistance to the emerald ash borer. Plos One 6. Yu, N, Christiaens, O, Liu, JS, Niu, JZ, Cappelle, K, Caccia, S, Huvenne, H and Smagghe, G (2013) Delivery of dsrna for rnai in insects: An overview and future directions. Insect Science 20: 4-14.
171
References:
Adamski Z, Ziemnicki K, Fila K, Zikic R, Stajn A. 2003. Effects of Long-Term Exposure to Fenitrothion on Spodoptera Exigua and Tenebrio Molitor Larval Development and Antioxidant Enzyme Activity. Biol. Lett 40(1):43-52. Adewale IO, Afolayan A. 2006. Studies on Glutathione Transferase from Grasshopper (Zonocerus Variegatus). Pesticide Biochemistry and Physiology 85(1):52-59. Ahmad S. 1992. Biochemical Defence of Pro-Oxidant Plant Allelochemicals by Herbivorous Insects. Biochemical Systematics and Ecology 20(4):269-296. Ahmad S, Forgash AJ. 1976. Nonoxidative Enzymes in Metabolism of Insecticides. Drug Metabolism Reviews 5(1):141-164. Ahmad S, Yu SJ, Mullin CA, Brattsten LB. 1986. Enzymes Involved in the Metabolism of Plant Allelochemicals. Molecular Aspects of Insect-Plant Associations / Edited by Lena B. Brattsten and Sami Ahmad: New York : Plenum Press, c1986. p 73-151. Aliabadi A, Renwick JAA, Whitman DW. 2002. Sequestration of Glucosinolates by Harlequin Bug Murgantia Histrionica. Journal of Chemical Ecology 28(9):1749- 1762. Amiour N, Imbaud S, Clement G, Agier N, Zivy M, Valot B, Balliau T, Armengaud P, Quillere I, Canas R and others. 2012. The Use of Metabolomics Integrated with Transcriptomic and Proteomic Studies for Identifying Key Steps Involved in the Control of Nitrogen Metabolism in Crops Such as Maize. Journal of Experimental Botany 63(14):5017-5033. Anders S, Huber W. 2010. Differential Expression Analysis for Sequence Count Data. Genome Biology 11(10). Appel HM. 1993. Phenolics in Ecological Interactions: The Importance of Oxidation. Journal of Chemical Ecology 19(7):1521-1552. Argentine JA, Zhu KY, Lee SH, Clark JM. 1994. Biochemical-Mechanisms of Azinphosmethyl Resistance in Isogenic Strains of Colorado Potato Beetle. Pesticide Biochemistry and Physiology 48(1):63-78. Assem F, Kirk C, Chipman J. 2006. Substrate Characterisation of a Recombinant Sulfotransferase Sult1 and Mrna Expression in Chub ( Leuciscus Cephalus) Tissues. Biochemical and biophysical research communications 349(3):900-905. Aw T, Schlauch K, Keeling CI, Young S, Bearfield JC, Blomquist GJ, Tittiger C. 2010. Functional Genomics of Mountain Pine Beetle (Dendroctonus Ponderosae) Midguts and Fat Bodies. Bmc Genomics 11(1):215. Bai X, Rivera-Vega L, Mamidala P, Bonello P, Herms DA, Mittapalli O. 2011. Transcriptomic Signatures of Ash (Fraxinus Spp.) Phloem. Plos One 6(1). Barbehenn RV. 2002. Gut-Based Antioxidant Enzymes in a Polyphagous and a Graminivorous Grasshopper. Journal of Chemical Ecology 28(7):1329-1347. Barbehenn RV, Martin MM. 1995. Peritrophic Envelope Permeability in Herbivorous Insects. Journal of Insect Physiology 41(4):303-311. Bariami V, Jones CM, Poupardin R, Vontas J, Ranson H. 2012. Gene Amplification, Abc Transporters and Cytochrome P450s: Unraveling the Molecular Basis of 172
Pyrethroid Resistance in the Dengue Vector, Aedes Aegypti. Plos Neglected Tropical Diseases 6(6). Bass C, Carvalho RA, Oliphant L, Puinean AM, Field LM, Nauen R, Williamson MS, Moores G, Gorman K. 2011. Overexpression of a Cytochrome P450 Monooxygenase, Cyp6er1, Is Associated with Resistance to Imidacloprid in the Brown Planthopper, Nilaparvata Lugens. Insect Molecular Biology 20(6):763- 773. Bautista MAM, Miyata T, Miura K, Tanaka T. 2009. Rna Interference-Mediated Knockdown of a Cytochrome P450, Cyp6bg1, from the Diamondback Moth, Plutella Xylostella, Reduces Larval Resistance to Permethrin. Insect Biochemistry and Molecular Biology 39(1):38-46. Bentley MD, Leonard DE, Reynolds EK, Leach S, Beck AB, Murakoshi I. 1984. Lupine Alkaloids as Larval Feeding Deterrents for Spruce Budworm, Choristoneura- Fumiferana (Lepidoptera, Tortricidae). Annals of the Entomological Society of America 77(4):398-400. Berenbaum MR. 1986. Target Site Insensitivity in Insect-Plant Interactions. Molecular Aspects of Insect-Plant Associations / Edited by Lena B. Brattsten and Sami Ahmad: New York : Plenum Press, c1986. p 257-272. Bergé J, Feyereisen R, Amichot M, Bergé J, Feyereisen R, Amichot M. 1998. Cytochrome P450 Monooxygenases and Insecticide Resistance in Insects. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 353(1376):1701-1705. Bernays E, Singer M, Rodrigues D. 2004. Trenching Behavior by Caterpillars of the Euphorbia Specialist, Pygarctia Roseicapitis: A Field Study. Journal of Insect Behavior 17(1):41-52. Beyenbach KW, Skaer H, Dow JAT. 2010a. The Developmental, Molecular, and Transport Biology of Malpighian Tubules. Annual Review of Entomology 55:351-374. Beyenbach KW, Skaer H, Dow JAT. 2010b. The Developmental, Molecular, and Transport Biology of Malpighian Tubules. Annual Review of Entomology. p 351-374. Bi J, Felton G. 1995. Foliar Oxidative Stress and Insect Herbivory: Primary Compounds, Secondary Metabolites, and Reactive Oxygen Species as Components of Induced Resistance. Journal of Chemical Ecology 21(10):1511-1530. Bier FF, Kleinjung F. 2001. Feature-Size Limitations of Microarray Technology - a Critical Review. Fresenius Journal of Analytical Chemistry 371(2):151-156. Blomquist GJ, Keeling CI, Gilg-Young A, Bearfield J, Ginzel MD, Young S, Tittiger C. 2004. Juvenile Hormone Regulation of Bark Beetle Monoterpenoid Pheromone Biosynthesis. Journal of Insect Science (Tucson) 4. Bogwitz MR, Chung H, Magoc L, Rigby S, Wong W, O'Keefe M, McKenzie JA, Batterham P, Daborn PJ. 2005. Cyp12a4 Confers Lufenuron Resistance in a Natural Population of Drosophila Melanogaster. Proceedings of the National Academy of Sciences of the United States of America 102(36):12807-12812.
173
Bouayad N, Rharrabe K, Lamhamdi M, Nourouti NG, Sayah F. 2012. Dietary Effects of Harmine, a Beta-Carboline Alkaloid, on Development, Energy Reserves and Alpha-Amylase Activity of Plodia Interpunctella Hubner (Lepidoptera: Pyralidae). Saudi Journal of Biological Sciences 19(1):73-80. Bown DP, Wilkinson HS, Gatehouse JA. 1997. Differentially Regulated Inhibitor- Sensitive and Insensitive Protease Genes from the Phytophagous Insect Pest, Helicoverpa Armigara, Are Members of Complex Multigene Families. Insect Biochemistry and Molecular Biology 27(7):625-638. Brattsten LB, Wilkinson CF, Eisner T. 1977. Herbivore-Plant Interactions - Mixed- Function Oxidases and Secondary Plant Substances. Science 196(4296):1349- 1352. Brenner S, Johnson M, Bridgham J, Golda G, Lloyd DH, Johnson D, Luo S, McCurdy S, Foy M, Ewan M. 2000. Gene Expression Analysis by Massively Parallel Signature Sequencing (Mpss) on Microbead Arrays. Nature Biotechnology 18(6):630-634. Broehan G, Kroeger T, Lorenzen M, Merzendorfer H. 2013. Functional Analysis of the Atp-Binding Cassette (Abc) Transporter Gene Family of Tribolium Castaneum. Bmc Genomics 14:6-6. Brower LP, Brower JV, Corvino JM. 1967. Plant Poisons in a Terrestrial Food Chain. Proceedings of the National Academy of Sciences of the United States of America 57(4):893-&. Brown PO, Botstein D. 1999. Exploring the New World of the Genome with DNA Microarrays. Nature Genetics 21(1 Suppl):33-37. Buchel K, Malskies S, Mayer M, Fenning TM, Gershenzon J, Hilker M, Meiners T. 2011. How Plants Give Early Herbivore Alert: Volatile Terpenoids Attract Parasitoids to Egg-Infested Elms. Basic and Applied Ecology 12(5):403-412. Bull DL, Ivie GW, Beier RC, Pryor NW. 1986. Invitro Metabolism of a Linear Furanocoumarin (8-Methoxypsoralen, Xanthotoxin) by Mixed-Function Oxidases of Larvae of Black Swallowtail Butterfly and Fall Armyworm. Journal of Chemical Ecology 12(4):885-892. Bundy JG, Davey MP, Viant MR. 2009. Environmental Metabolomics: A Critical Review and Future Perspectives. Metabolomics 5(1):3-21. Burges HD, Grove JF, Pople M. 1979. Internal Microbial-Flora of the Elm Bark Beetle, Scolytus Scolytus, at All Stages of Its Development. Journal of Invertebrate Pathology 34(1):21-25. Burns RM, Honkala BH. Tech. Coords.(1990) Silvics of North America: 1. Conifers; 2. Hardwoods. Agriculture Handbook 654:877. Butler LG, Rogler JC. 1992. Biochemical-Mechanisms of the Antinutritional Effects of Tannins. Acs Symposium Series 506:298-304. Calderon O, Berkov A. 2012. Midgut and Fat Body Bacteriocytes in Neotropical Cerambycid Beetles (Coleoptera: Cerambycidae). Environmental Entomology 41(1):108-117.
174
Cappaert D, McCullough DG, Poland TM, Siegert NW. 2005. Emerald Ash Borer in North America: A Research and Regulatory Challenge. American Entomologist 51(3):152-165. Carino F, Koener J, Plapp F, Feyereisen R. 1994. Constitutive Overexpression of the Cytochrome P450 Gene Cyp6a1in a House Fly Strain with Metabolic Resistance to Insecticides. Insect Biochemistry and Molecular Biology 24(4):411-418. Celorio-Mancera MdlP, Sundmalm SM, Vogel H, Rutishauser D, Ytterberg AJ, Zubarev RA, Janz N. 2012. Chemosensory Proteins, Major Salivary Factors in Caterpillar Mandibular Glands. Insect Biochemistry and Molecular Biology 42(10):796-805. Chahine S, O'Donnell MJ. 2011. Interactions between Detoxification Mechanisms and Excretion in Malpighian Tubules of Drosophila Melanogaster. Journal of Experimental Biology 214(3):462-468. Chapman RF. 2003. Contact Chemoreception Infeeding by Phytophagous Insects. Annual Review of Entomology 48:455-484. Chararas C, Courtois JE. 1976. Nutrition and Digestive Enzymes Activity of Dendroctonus Micans Kug. Comptes Rendus Des Seances De La Societe De Biologie Et De Ses Filiales 170(6):1155-1158. Chen MS. 2008. Inducible Direct Plant Defense against Insect Herbivores: A Review. Insect Science 15(2):101-114. Chen Y, Cassone BJ, Bai X, Redinbaugh MG, Michel AP. 2012. Transcriptome of the Plant Virus Vector Graminella Nigrifrons, and the Molecular Interactions of Maize Fine Streak Rhabdovirus Transmission. Plos One 7(7):e40613-e40613. Choi JY, Roh JY, Wang Y, Zhen Z, Tao XY, Lee JH, Liu Q, Kim JS, Shin SW, Je YH. 2012. Analysis of Genes Expression of Spodoptera Exigua Larvae Upon Acmnpv Infection. Plos One 7(7):e42462. Church A, Legters C, Papa J, Tymochko L, Elnitsky MA. 2012. Antioxidant Capacity and Oxidative Stress in the Freeze-Tolerant Woolly Bear Caterpillar, Pyrrharctia Isabella. Integrative and Comparative Biology 52:E226-E226. Cianfrogna JA, Zangerl AR, Berenbaum MR. 2002. Dietary and Developmental Influences on Induced Detoxification in an Oligophage. Journal of Chemical Ecology 28(7):1349-1364. Cifuentes D, Chynoweth R, Guillen J, De La Rua P, Bielza P. 2012. Novel Cytochrome P450 Genes, Cyp6eb1 and Cyp6ec1, Are over-Expressed in Acrinathrin-Resistant Frankliniella Occidentalis (Thysanoptera: Thripidae). Journal of Economic Entomology 105(3):1006-1018. Cipollini D, Wang Q, Whitehill JGA, Powell JR, Bonello P, Herms DA. 2011. Distinguishing Defensive Characteristics in the Phloem of Ash Species Resistant and Susceptible to Emerald Ash Borer. Journal of Chemical Ecology 37(5):450- 459. Close DC, McArthur C. 2002. Rethinking the Role of Many Plant Phenolics–Protection from Photodamage Not Herbivores? Oikos 99(1):166-172. David J, Boyer S, Mesneau A, Ball A, Ranson H, Dauphin-Villemant C. 2006. Involvement of Cytochrome P450 Monooxygenases in the Response of Mosquito
175
Larvae to Dietary Plant Xenobiotics. Insect Biochemistry and Molecular Biology 36(5):410-420. Debnath M, Prasad G, Bisen PS. 2010. Omics Technology. New York: Springer. 11-31 p. Degraeve GM, Geiger DL, Meyer JS, Bergman HL. 1980. Acute and Embryo-Larval Toxicity of Phenolic-Compounds to Aquatic Biota. Archives of Environmental Contamination and Toxicology 9(5):557-568. Despres L, David J-P, Gallet C. 2007. The Evolutionary Ecology of Insect Resistance to Plant Chemicals. Trends in Ecology & Evolution 22(6):298-307. Dobler S, Dalla S, Wagschal V, Agrawal AA. 2012. Community-Wide Convergent Evolution in Insect Adaptation to Toxic Cardenolides by Substitutions in the Na,K-Atpase. Proceedings of the National Academy of Sciences of the United States of America 109(32):13040-13045. Dow JAT. 1986. Insect Midgut Function. Advances in Insect Physiology 19:187-328. Dow JAT. 2009. Insights into the Malpighian Tubule from Functional Genomics. Journal of Experimental Biology 212(3):435-445. Dow JAT, Davies SA. 2006. The Malpighian Tubule: Rapid Insights from Post-Genomic Biology. Journal of Insect Physiology 52(4):365-378. Dreher-Lesnick SM, Mulenga A, Simser JA, Azad AF. 2006. Differential Expression of Two Glutathione S-Transferases Identified from the American Dog Tick, Dermacentor Variabilis. Insect Molecular Biology 15(4):445-453. Dreyer DL, Jones KC. 1981. Feeding Deterrency of Flavonoids and Related Phenolics Towards Schizaphis Graminum and Myzus Persicae - Aphid Feeding Deterrents in Wheat. Phytochemistry 20(11):2489-2493. DUffey SS. 1980. Sequestration of Plant Natural Products by Insects. Annual Review of Entomology 25(1):447-477. Ehrlich PR, Raven PH. 1964. Butterflies and Plants - a Study in Coevolution. Evolution 18(4):586-608. Enayati AA, Ranson H, Hemingway J. 2005. Insect Glutathione Transferases and Insecticide Resistance. Insect Molecular Biology 14(1):3-8. Enright M, Griffin C. 2004. Specificity of Association between Paenibacillus Spp. And the Entomopathogenic Nematodes, Heterorhabditis Spp. Microbial ecology 48(3):414-423. Eyles A, Jones W, Riedl K, Cipollini D, Schwartz S, Chan K, Herms DA, Bonello P. 2007. Comparative Phloem Chemistry of Manchurian (Fraxinus Mandshurica) and Two North American Ash Species (Fraxinus Americana and Fraxinus Pennsylvanica). Journal of Chemical Ecology 33(7):1430-1448. Felton G, Donato K, Del Vecchio R, Duffey S. 1989. Activation of Plant Foliar Oxidases by Insect Feeding Reduces Nutritive Quality of Foliage for Noctuid Herbivores. Journal of Chemical Ecology 15(12):2667-2694. Felton GW, Donato KK, Broadway RM, Duffey SS. 1992. Impact of Oxidized Plant Phenolics on the Nutritional Quality of Dietary-Protein to a Noctuid Herbivore, Spodoptera Exigua. Journal of Insect Physiology 38(4):277-285.
176
Felton GW, Summers CB. 1995. Antioxidant Systems in Insects. Archives of Insect Biochemistry and Physiology 29(2):187-197. Feng QL, Davey KG, Pang ASD, Ladd TR, Retnakaran A, Tomkins BL, Zheng SC, Palli SR. 2001. Developmental Expression and Stress Induction of Glutathione S- Transferase in the Spruce Budworm, Choristoneura Fumiferana. Journal of Insect Physiology 47(1):1-10. Ferreira C, Parra JRP, Terra WR. 1997. The Effect of Dietary Plant Glycosides on Larval Midgut Beta-Glucosidases from Spodoptera Frugiperda and Diatraea Saccharalis. Insect Biochemistry and Molecular Biology 27(1):55-59. Ferreres F, Sousa C, Valentao P, Pereira JA, Seabra RM, Andrade PB. 2007. Tronchuda Cabbage Flavonolds Uptake by Pieris Brassicae. Phytochemistry 68(3):361-367. Ferreres F, Valentão P, Pereira JA, Bento A, Noites A, Seabra RM, Andrade PB. 2008. Hplc-Dad-Ms/Ms-Esi Screening of Phenolic Compounds in Pieris Brassicae L. Reared on Brassica Rapa Var. Rapa L. Journal of Agricultural and Food Chemistry 56(3):844-853. Fescemyer HW, Sandoya GV, Gill TA, Ozkan S, Marden JH, Luthe DS. 2013. Maize Toxin Degrades Peritrophic Matrix Proteins and Stimulates Compensatory Transcriptome Responses in Fall Armyworm Midgut. Insect Biochemistry and Molecular Biology 43(3):280-91. Feyereisen R. 1999. Insect P450 Enzymes. Annual Review of Entomology 44:507-533. Feyereisen R. 2006. Evolution of Insect P450. Biochemical Society Transactions 34:1252-1255. Feyereisen R. 2011. Arthropod Cypomes Illustrate the Tempo and Mode in P450 Evolution. Biochimica Et Biophysica Acta-Proteins and Proteomics 1814(1):19- 28. Flanagan JU, Smythe ML. 2011. Sigma-Class Glutathione Transferases. Drug Metabolism Reviews 43(2):194-214. Francis F, Vanhaelen N, Haubruge E. 2005. Glutathione S-Transferases in the Adaptation to Plant Secondary Metabolites in the Myzus Persicae Aphid. Archives of Insect Biochemistry and Physiology 58(3):166-174. Fridman E, Pichersky E. 2005. Metabolomics, Genomics, Proteomics, and the Identification of Enzymes and Their Substrates and Products. Current Opinion in Plant Biology 8(3):242-248. Fridovich I. 1983. Superoxide Radical - an Endogenous Toxicant. Annual Review of Pharmacology and Toxicology 23:239-257. Fridovich I. 1995. Superoxide Radical and Superoxide Dismutases. Annual review of biochemistry 64(1):97-112. Gandhi KJK, Herms DA. 2010. Direct and Indirect Effects of Alien Insect Herbivores on Ecological Processes and Interactions in Forests of Eastern North America. Biological Invasions 12(2):389-405. Ge H, Liu ZH, Church GM, Vidal M. 2001. Correlation between Transcriptome and Interactome Mapping Data from Saccharomyces Cerevisiae. Nature Genetics 29(4):482-486.
177
Ge H, Walhout AJM, Vidal M. 2003. Integrating 'Omic' Information: A Bridge between Genomics and Systems Biology. Trends in Genetics 19(10):551-560. Gershenzon J, Rossiter M, Mabry TJ, Rogers CE, Blust MH, Hopkins TL. 1985. Insect Antifeedant Terpenoids in Wild Sunflower - a Possible Source of Resistance to the Sunflower Moth. Acs Symposium Series 276:432-446. Ghumare SS, Mukherjee SN, Sharma RN. 1989. Effect of Rutin on the Neonate Sensitivity, Dietary Utilization and Midgut Carboxylesterase Activity of Spodoptera Litura (Fabricius) (Lepidoptera, Noctuidae). Proceedings of the Indian Academy of Sciences-Animal Sciences 98(6):399-404. Glauser G, Marti G, Villard N, Doyen GA, Wolfender JL, Turlings TCJ, Erb M. 2011. Induction and Detoxification of Maize 1,4-Benzoxazin-3-Ones by Insect Herbivores. Plant Journal 68(5):901-911. Goh DKS, Anspaugh DD, Motoyama N, Rock GC, Roe RM. 1995. Isolation and Characterization of an Insecticide-Resistance-Associated Esterase in the Tobacco Budworm Heliothis Virescens (F). Pesticide Biochemistry and Physiology 51(3):192-204. Gomez NE, Witte L, Hartmann T. 1999. Chemical Defense in Larval Tortoise Beetles: Essential Oil Composition of Fecal Shields of Eurypedus Nigrosignata and Foliage of Its Host Plant, Cordia Curassavica. Journal of Chemical Ecology 25(5):1007-1027. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, Adiconis X, Fan L, Raychowdhury R, Zeng Q and others. 2011. Full-Length Transcriptome Assembly from Rna-Seq Data without a Reference Genome. Nature Biotechnology 29(7):644-U130. Green TR, Ryan CA. 1972. Wound-Induced Proteinase Inhibitor in Plant Leaves - Possible Defense Mechanism against Insects. Science 175(4023):776-&. Gunasekaran K, Muthukumaravel S, Sahu SS, Vijayakumar T, Jambulingam P. 2011. Glutathione S Transferase Activity in Indian Vectors of Malaria: A Defense Mechanism against Ddt. Journal of Medical Entomology 48(3):561-569. Guzov VM, Unnithan GC, Chernogolov AA, Feyereisen R. 1998. Cyp12a1, a Mitochondrial Cytochrome P450 from the House Fly. Archives of Biochemistry and Biophysics 359(2):231-240. Haack RA, Jendek E, Liu H, Marchant KR, Petrice TR, Poland TM, Ye H. 2002. The Emerald Ash Borer: A New Exotic Pest in North America. Newsletter of the Michigan Entomological Society 47(3-4):1-5. Habig WH, Pabst MJ, Jakoby WB. 1974. Glutathione S-Transferases - First Enzymatic Step in Mercapturic Acid Formation. Journal of Biological Chemistry 249(22):7130-7139. Hakim RS, Baldwin K, Smagghe G. 2010. Regulation of Midgut Growth, Development, and Metamorphosis. Annual Review of Entomology. p 593- 608. Halliwell B, Gutteridge JMC. 1999. Free Radicals in Biology and Medicine: Oxford university press Oxford.
178
Hampton T. 2010. Body Louse Genome. JAMA: The Journal of the American Medical Association 304(7):733-733. Hanham AF, Dunn BP, Stich HF. 1983. Clastogenic Activity of Caffeic Acid and Its Relationship to Hydrogen Peroxide Generated During Autooxidation. Mutation Research/Genetic Toxicology 116(3):333-339. Hao Z, Kasumba I, Aksoy S. 2003. Proventriculus (Cardia) Plays a Crucial Role in Immunity in Tsetse Fly (Diptera: Glossinidiae). Insect Biochemistry and Molecular Biology 33(11):1155-1164. Harper M, Hopkins T, Czapla T. 1998. Effect of Wheat Germ Agglutinin on Formation and Structure of the Peritrophic Membrane in European Corn Borer (Ostrinia Nubilalis) Larvae. Tissue and Cell 30(2):166-176. Hattori K, Hirayama M, Suzuki H, Hamamoto H, Sekimizu K, Tamura H-o. 2007. Cloning and Expression of a Novel Sulfotransferase with Unique Substrate Specificity from Bombyx Mori. Bioscience Biotechnology and Biochemistry 71(4):1044-1051. Hattori K, Inoue M, Inoue T, Arai H, Tamura H. 2006. A Novel Sulfotransferase Abundantly Expressed in the Dauer Larvae of Caenorhabditis Elegans. Journal of biochemistry 139(3):355-362. Hazelton GA, Lang CA. 1983. Glutathione Biosynthesis in the Aging Adult Yellow- Fever Mosquito Aedes Aegypti (Louisville). Biochemical Journal 210(2):289-295. Heckel DG. 2003. Genomics in Pure and Applied Entomology. In: Berenbaum MR, Carde RT, Robinson GE, editors. Annual Review of Entomology. Volume 48. p 235-260. Heckel DG. 2012. Learning the Abcs of Bt: Abc Transporters and Insect Resistance to Bacillus Thuringiensis Provide Clues to a Crucial Step in Toxin Mode of Action. Pesticide Biochemistry and Physiology 104(2):103-110. Hegedus D, Erlandson M, Gillott C, Toprak U. 2009. New Insights into Peritrophic Matrix Synthesis, Architecture, and Function. Annual Review of Entomology 54:285-302. Heid CA, Stevens J, Livak KJ, Williams PM. 1996. Real Time Quantitative Pcr. Genome research 6(10):986-994. Herms DA, Stone AK, Chatfield JA. 2004. Emerald Ash Borer: The Beginning of the End of Ash in North America? Special Circular-Ohio Agricultural Research and Development Center:62-71. Hernandez-Martinez P, Sara Hernandez-Rodriguez C, Krishnan V, Crickmore N, Escriche B, Ferre J. 2012. Lack of Cry1fa Binding to the Midgut Brush Border Membrane in a Resistant Colony of Plutella Xylostella Moths with a Mutation in the Abcc2 Locus. Applied and Environmental Microbiology 78(18):6759-6761. Higgins CF. 1992a. Abc Transporters - from Microorganisms to Man. Annual review of cell biology 8:67-113. Higgins CF. 1992b. Abc Transporters: From Microorganisms to Man. Annual review of cell biology 8(1):67-113.
179
Hill AL, Whitehill JGA, Opiyo SO, Phelan PL, Bonello P. 2012. Nutritional Attributes of Ash (Fraxinus Spp.) Outer Bark and Phloem and Their Relationships to Resistance against the Emerald Ash Borer. Tree Physiology 32(12):1522-1532. Hirai MY, Klein M, Fujikawa Y, Yano M, Goodenowe DB, Yamazaki Y, Kanaya S, Nakamura Y, Kitayama M, Suzuki H and others. 2005. Elucidation of Gene-to- Gene and Metabolite-to-Gene Networks in Arabidopsis by Integration of Metabolomics and Transcriptomics. Journal of Biological Chemistry 280(27):25590-25595. Hlavica P. 2006. Functional Interaction of Nitrogenous Organic Bases with Cytochrome P450: A Critical Assessment and Update of Substrate Features and Predicted Key Active-Site Elements Steering the Access, Binding, and Orientation of Amines. Biochimica Et Biophysica Acta-Proteins and Proteomics 1764(4):645-670. Holzinger F, Frick C, Wink M. 1992. Molecular-Basis for the Insensitivity of the Monarch (Danaus Plexippus) to Cardiac-Glycosides. Febs Letters 314(3):477- 480. Holzinger F, Wink M. 1996. Mediation of Cardiac Glycoside Insensitivity in the Monarch Butterfly (Danaus Plexippus): Role of an Amino Acid Substitution in the Ouabain Binding Site of Na+,K+-Atpase. Journal of Chemical Ecology 22(10):1921-1937. Hu X, Chen L, Xiang X, Yang R, Yu S, Wu X. 2012. Proteomic Analysis of Peritrophic Membrane (Pm) from the Midgut of Fifth-Instar Larvae, Bombyx Mori. Molecular Biology Reports 39(4):3427-3434. Huang J, Wu S, Ye G. 2011. Molecular Characterization of the Sigma Class Gutathione S-Transferase from Chilo Suppressalis and Expression Analysis Upon Bacterial and Insecticidal Challenge. Journal of Economic Entomology 104(6):2046-2053. Hung CF, Kao CH, Liu CC, Lin JG, Sun CN. 1990. Detoxifying Enzymes of Selected Insect Species with Chewing and Sucking Habits. Journal of Economic Entomology 83(2):361-365. Iconomidou VA, Vriend G, Hamodrakas SJ. 2000. Amyloids Protect the Silkmoth Oocyte and Embryo. Febs Letters 479(3):141-145. Imlay JA, Chin SM, Linn S. 1988. Toxic DNA Damage by Hydrogen Peroxide through the Fenton Reaction in Vivo and in Vitro. Science (New York, NY) 240(4852):640. Ishimoto M, Kuroda M, Yoza K, Nishizawa K, Teraishi M, Mizutani N, Ito K, Moriya S. 2012. Heterologous Expression of Corn Cystatin in Soybean and Effect on Growth of the Stink Bug. Bioscience Biotechnology and Biochemistry 76(11):2142-2145. Isman MB, Duffey SS. 1982. Toxicity of Tomato Phenolic-Compounds to the Fruitwom, Heliothis Zea. Entomologia Experimentalis Et Applicata 31(4):370-376. Ivanovic J, Jankovic-Hladni M. 1991. Hormones and Metabolism in Insect Stress: CRC. Jansen JJ, Allwood JW, Marsden-Edwards E, van der Putten WH, Goodacre R, van Dam NM. 2009. Metabolomic Analysis of the Interaction between Plants and Herbivores. Metabolomics 5(1):150-161. 180
Jones CM, Daniels M, Andrews M, Slater R, Lind RJ, Gorman K, Williamson MS, Denholm I. 2011. Age-Specific Expression of a P450 Monooxygenase (Cyp6cm1) Correlates with Neonicotinoid Resistance in Bemisia Tabaci. Pesticide Biochemistry and Physiology 101(1):53-58. Jones DT. 1999. Protein Secondary Structure Prediction Based on Position-Specific Scoring Matrices. Journal of molecular biology 292(2):195-202. Jongsma MA, Beekwilder J. 2011. Co-Evolution of Insect Proteases and Plant Protease Inhibitors. Current Protein & Peptide Science 12(5):437-447. Kanehisa M, Goto S. 2000. Kegg: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Research 28(1):27-30. Kanofsky J, Axelrod B. 1986. Singlet Oxygen Production by Soybean Lipoxygenase Isozymes. Journal of Biological Chemistry 261(3):1099-1104. Kao LR, Motoyama N, Dauterman WC. 1984. Studies on Hydrolases in Various Housefly Strains and Their Role in Malathion Resistance. Pesticide Biochemistry and Physiology 22(1):86-92. Karatolos N, Williamson MS, Denholm I, Gorman K, Ffrench-Constant RH, Bass C. 2012. Over-Expression of a Cytochrome P450 Is Associated with Resistance to Pyriproxyfen in the Greenhouse Whitefly Trialeurodes Vaporariorum. Plos One 7(2):e31077. Karban R, Agrawal AA. 2002. Herbivore Offense. Annual Review of Ecology and Systematics 33:641-664. Ketterman AJ, Saisawang C, Wongsantichon J. 2011. Insect Glutathione Transferases. Drug Metabolism Reviews 43(2):253-265. Kikawada T, Saito A, Kanamori Y, Nakahara Y, Iwata K, Tanaka D, Watanabe M, Okuda T. 2007. Trehalose Transporter 1, a Facilitated and High-Capacity Trehalose Transporter, Allows Exogenous Trehalose Uptake into Cells. Proceedings of the National Academy of Sciences 104(28):11585-11590. Kim BY, Hui WL, Lee KS, Wan H, Yoon HJ, Gui ZZ, Chen S, Jin BR. 2011. Molecular Cloning and Oxidative Stress Response of a Sigma-Class Glutathione S- Transferase of the Bumblebee Bombus Ignitus. Comparative Biochemistry and Physiology B-Biochemistry & Molecular Biology 158(1):83-89. Kodzius R, Kojima M, Nishiyori H, Nakamura M, Fukuda S, Tagami M, Sasaki D, Imamura K, Kai C, Harbers M. 2006. Cage: Cap Analysis of Gene Expression. Nature Methods 3(3):211-222. Kostaropoulos I, Mantzari AE, Papadopoulos AI. 1996. Alterations of Some Glutathione S-Transferase Characteristics During the Development of Tenebrio Molitor (Insecta: Coleoptera). Insect Biochemistry and Molecular Biology 26(8):963-969. Kostaropoulos I, Papadopoulos AI, Metaxakis A, Boukouvala E, Papadopoulou- Mourkidou E. 2001. Glutathione S-Transferase in the Defence against Pyrethroids in Insects. Insect Biochemistry and Molecular Biology 31(4-5):313-319. Krieger RI, Feeny PP, Wilkinso.Cf. 1971. Detoxication Enzymes in Guts of Caterpillars - Evolutionary Answer to Plant Defenses. Science 172(3983):579-&.
181
Krishnan N, Kodrík D. 2006. Antioxidant Enzymes in Spodoptera Littoralis (Boisduval): Are They Enhanced to Protect Gut Tissues During Oxidative Stress? Journal of Insect Physiology 52(1):11. Krishnan N, Kodrík D, Turanli F, Sehnal F. 2007. Stage-Specific Distribution of Oxidative Radicals and Antioxidant Enzymes in the Midgut of Leptinotarsa Decemlineata. Journal of Insect Physiology 53(1):67-74. Kristensen M. 2005. Glutathione S-Transferase and Insecticide Resistance in Laboratory Strains and Field Populations of Musca Domestica. Journal of Economic Entomology 98(4):1341-1348. Krug E, Proksch P. 1993. Influence of Dietary Alkaloids on Survival and Growth of Spodoptera Littoralis. Biochemical Systematics and Ecology 21(8):749-756. Kumar S, Christophides GK, Cantera R, Charles B, Han YS, Meister S, Dimopoulos G, Kafatos FC, Barillas-Mury C. 2003. The Role of Reactive Oxygen Species on Plasmodium Melanotic Encapsulation in Anopheles Gambiae. Proceedings of the National Academy of Sciences 100(24):14139-14144. Labbe R, Caveney S, Donly C. 2011a. Expression of Multidrug Resistance Proteins Is Localized Principally to the Malpighian Tubules in Larvae of the Cabbage Looper Moth, Trichoplusia Ni. Journal of Experimental Biology 214(6):937-944. Labbe R, Caveney S, Donly C. 2011b. Genetic Analysis of the Xenobiotic Resistance- Associated Abc Gene Subfamilies of the Lepidoptera. Insect Molecular Biology 20(2):243-256. Lahtinen M, Kapari L, Kentta J. 2006. Newly Hatched Neonate Larvae Can Glycosylate: The Fate of Betula Pubescens Bud Flavonoids in First Instar Epirrita Autumnata. Journal of Chemical Ecology 32(3):537-546. Lange AB. 2009. Tyramine: From Octopamine Precursor to Neuroactive Chemical in Insects. General and comparative endocrinology 162(1):18-26. Langenheim JH. 1994. Higher-Plant Terpenoids - a Phytocentric Overview of Their Ecological Roles. Journal of Chemical Ecology 20(6):1223-1280. Lanning CL, Fine RL, Corcoran JJ, Ayad HM, Rose RL, AbouDonia MB. 1996. Tobacco Budworm P-Glycoprotein: Biochemical Characterization and Its Involvement in Pesticide Resistance. Biochimica Et Biophysica Acta-General Subjects 1291(2):155-162. Larson RA. 1986. Insect Defenses against Phototoxic Plant-Chemicals. Journal of Chemical Ecology 12(4):859-870. Le Goff G, Hilliou F, Siegfried BD, Boundy S, Wajnberg E, Sofer L, Audant P, Ffrench- Constant RH, Feyereisen R. 2006. Xenobiotic Response in Drosophila Melanogaster: Sex Dependence of P450 and Gst Gene Induction. Insect Biochemistry and Molecular Biology 36(8):674-682. Lee K, Berenbaum MR. 1989. Action of Antioxidant Enzymes and Cytochrome-P-450 Monooxygenases in the Cabbage-Looper in Response to Plant Phototoxins. Archives of Insect Biochemistry and Physiology 10(2):151-162. Lee KW, Berenbaum MR. 1990. Defense of Parsnip Webworm against Phototoxic Furanocoumarins - Role of Antioxidant Enzymes. Journal of Chemical Ecology 16(8):2451-2460. 182
Lehane M. 1997. Peritrophic Matrix Structure and Function. Annual Review of Entomology 42(1):525-550. Levinson HZ. 1976. Defensive Role of Alkaloids in Insects and Plants. Experientia 32(4):408-411. Li C, Song X, Li G, Wang P. 2009. Midgut Cysteine Protease-Inhibiting Activity in Trichoplusia Ni Protects the Peritrophic Membrane from Degradation by Plant Cysteine Proteases. Insect Biochemistry and Molecular Biology 39(10):726-734. Li J-Y, Li J-S, Zhong B-X. 2012. Proteomic Profiling of the Hemolymph at the Fifth Instar of the Silkworm Bombyx Mori. Insect Science 19(4):441-454. Li J, Wang XP, Wang MQ, Ma WH, Hua HX. 2013. Advances in the Use of the Rna Interference Technique in Hemiptera. Insect Science 20(1):31-39. Li XC, Berenbaum MR, Schuler MA. 2002. Plant Allelochemicals Differentially Regulate Helicoverpa Zea Cytochrome P450 Genes. Insect Molecular Biology 11(4):343-351. Lindroth RL. 1988. Hydrolysis of Phenolic Glycosides by Midgut Beta-Glucosidases in Papilio Glaucus Subspecies. Insect Biochemistry 18(8):789-792. Lindroth RL, Weisbrod AV. 1991. Genetic-Variation in Response of the Gypsy-Moth to Aspen Phenolic Glycosides. Biochemical Systematics and Ecology 19(2):97-103. Listowsky I, Abramovitz M, Homma H, Niitsu Y. 1988. Intracellular Binding and Transport of Hormones and Xenobiotics by Glutathione-S-Transferases. Drug Metabolism Reviews 19(3-4):305-318. Liu B, Jiang G, Zhang Y, Li J, Li X, Yue J, Chen F, Liu H, Li H, Zhu S and others. 2011. Analysis of Transcriptome Differences between Resistant and Susceptible Strains of the Citrus Red Mite Panonychus Citri (Acari: Tetranychidae). Plos One 6(12). Liu H, Bauer LS, Gao R, Zhao T, Petrice TR, Haack RA. 2003. Exploratory Survey for the Emerald Ash Borer, Agrilus Planipennis (Coleoptera: Buprestidae), and Its Natural Enemies in China. Great Lakes Entomologist 36:191-204. Liu Y. 1966. A Study on the Ash Buprestid Beetle, Agrilus Sp. Shenyang. Annual Report of Shenyang Horticulture Research Institute, Shenyang, Liaoning, China:1-16. Liu ZL, Ho SH, Goh SH. 2008. Effect of Fraxinellone on Growth and Digestive Physiology of Asian Corn Borer, Ostrinia Furnacalis Guenee. Pesticide Biochemistry and Physiology 91(2):122-127. Liu ZL, Ho SH, Goh SH. 2009. Modes of Action of Fraxinellone against the Tobacco Budworm, Heliothis Virescens. Insect Science 16(2):147-155. Livak KJ, Schmittgen TD. 2001. Analysis of Relative Gene Expression Data Using Real- Time Quantitative Pcr and the 2(T)(-Delta Delta C) Method. Methods 25(4):402- 408. Lou Y-j. 2012. Research Progress in Drug Toxicology Based on Systems Biology. Zhongguo Yaolixue Yu Dulixue Zazhi 26(4):476-481. Lu K-H, Wu M-C. 2007. Juvenile Hormone Induction of Glutathione S-Transferase Activity in Larval Fat Body of the Common Cutworm, Spodoptera Litura (Lepidoptera : Noctuidae). Entomological Research 37(Suppl. 1):A107. Lumjuan N, McCarroll L, Prapanthadara LA, Hemingway J, Ranson H. 2005. Elevated Activity of an Epsilon Class Glutathione Transferase Confers Ddt Resistance in 183
the Dengue Vector, Aedes Aegypti. Insect Biochemistry and Molecular Biology 35(8):861-871. Lumjuan N, Stevenson BJ, Prapanthadara L-a, Somboon P, Brophy PM, Loftus BJ, Severson DW, Ranson H. 2007. The Aedes Aegypti Glutathione Transferase Family. Insect Biochemistry and Molecular Biology 37(10):1026-1035. Mamidala P, Wijeratne AJ, Wijeratne S, Kornacker K, Sudhamalla B, Rivera-Vega LJ, Hoelmer A, Meulia T, Jones SC, Mittapalli O. 2012. Rna-Seq and Molecular Docking Reveal Multi-Level Pesticide Resistance in the Bed Bug. Bmc Genomics 13. Mao LX, Henderson G. 2007. Antifeedant Activity and Acute and Residual Toxicity of Alkaloids from Sophora Flavescens (Leguminosae) against Formosan Subterranean Termites (Isoptera : Rhinotermitidae). Journal of Economic Entomology 100(3):866-870. Mao W, Schuler MA, Berenbaum MR. 2011. Cyp9q-Mediated Detoxification of Acaricides in the Honey Bee (Apis Mellifera). Proceedings of the National Academy of Sciences of the United States of America 108(31):12657-12662. Marie JP. 1992. Drug-Resistance Genes. Presse Medicale 21(22):1033-1037. Martemyanov VV, Dubovskiy IM, Belousova IA, Pavlushin SV, Domrachev DV, Rantala MJ, Salminen JP, Bakhvalov SA, Glupov VV. 2012. Rapid Induced Resistance of Silver Birch Affects Both Innate Immunity and Performance of Gypsy Moths: The Role of Plant Chemical Defenses. Arthropod-Plant Interactions 6(4):507-518. Marty MA, Krieger RI. 1984. Metabolism of Uscharidin, a Milkweed Cardenolide, by Tissue Homogenates of Monarch Butterfly Larvae, Danaus Plexippus L. Journal of Chemical Ecology 10(6):945-956. Matsukura K, Shiba T, Sasaki T, Matsumura M. 2012. Enhanced Resistance to Four Species of Clypeorrhynchan Pests in Neotyphodium Uncinatum Infected Italian Ryegrass. Journal of Economic Entomology 105(1):129-134. Mayhew PJ. 1997. Adaptive Patterns of Host-Plant Selection by Phytophagous Insects. Oikos:417-428. Mayhew PJ. 2001. Herbivore Host Choice and Optimal Bad Motherhood. Trends in Ecology & Evolution 16(4):165-167. McMahon TF, Beierschmitt WP, Weiner M. 1987. Changes in Phase-I and Phase-Ii Biotransformation with Age in Male Fischer-344 Rat Colon - Relationship to Colon Carcinogenesis. Cancer Letters 36(3):273-282. Miles PW, Oertli JJ. 1993. The Significance of Antioxidants in the Aphid-Plant Interaction - the Redox Hypothesis. Entomologia Experimentalis Et Applicata 67(3):275-283. Mithöfer A, Boland W. 2012. Plant Defense against Herbivores: Chemical Aspects. Annual Review of Plant Biology 63:431-450. Mittapalli O, Bai XD, Mamidala P, Rajarapu SP, Bonello P, Herms DA. 2010. Tissue- Specific Transcriptomics of the Exotic Invasive Insect Pest Emerald Ash Borer (Agrilus Planipennis). Plos One 5(10).
184
Mittapalli O, Neal JJ, Shukle RH. 2007a. Antioxidant Defense Response in a Galling Insect. Proceedings of the National Academy of Sciences 104(6):1889-1894. Mittapalli O, Neal JJ, Shukle RH. 2007b. Tissue and Life Stage Specificity of Glutathione S-Transferase Expression in the Hessian Fly, Mayetiola Destructor: Implications for Resistance to Host Allelochemicals. Journal of Insect Science 7. Mohan S, Ma P, Pechan T, Bassford E, Williams W, Luthe D. 2006. Degradation of the S. Frugiperda Peritrophic Matrix by an Inducible Maize Cysteine Protease. Journal of Insect Physiology 52(1):21-28. Mole S, Rogler JC, Butler LG. 1993. Growth Reduction by Dietary Tannins - Different Effects Due to Different Tannins. Biochemical Systematics and Ecology 21(6- 7):667-677. Moore LV, Scudder GGE. 1986. Ouabain-Resistant Na,K-Atpases and Cardenolide Tolerance in the Large Milkweed Bug, Oncopeltus Fasciatus. Journal of Insect Physiology 32(1):27-33. Morgan ED. 2010. Plant Substances Altered and Sequestered by Insects. 315-331 p. Mu S-F, Liang P, Gao X-W. 2006. Effects of Quercetin on Specific Activity of Carboxylesterase and Glutathione S-Transferases in Bemisia Tabaci. Chinese Bulletin of Entomology 43(4):491-495. Müller C, Agerbirk N, Olsen CE, Boevé J-L, Schaffner U, Brakefield PM. 2001. Sequestration of Host Plant Glucosinolates in the Defensive Hemolymph of the Sawfly Athalia Rosae. Journal of Chemical Ecology 27(12):2505-2516. Mullin CA, Alfatafta AA, Harman JL, Serino AA, Everett SL. 1991. Corn-Rootworm Feeding on Sunflower and Other Compositae - Influence of Floral Terpenoid and Phenolic Factors. Acs Symposium Series 449:278-292. Munks R, Sant’Anna M, Grail W, Gibson W, Igglesden T, Yoshiyama M, Lehane S, Lehane M. 2005. Antioxidant Gene Expression in the Blood‐Feeding Fly Glossina Morsitans Morsitans. Insect Molecular Biology 14(5):483-491. Murray CL, Quaglia M, Arnason JT, Morris CE. 1994. A Putative Nicotine Pump at the Metabolic Blood-Brain-Barrier of the Tobacco Hornworm. Journal of Neurobiology 25(1):23-34. Murray KD, Hasegawa S, Alford AR. 1999. Antifeedant Activity of Citrus Limonoids against Colorado Potato Beetle: Comparison of Aglycones and Glucosides. Entomologia Experimentalis Et Applicata 92(3):331-334. Nadella KD, Marla SS, Kumar PA. 2012. Metabolomics in Agriculture. Omics-a Journal of Integrative Biology 16(4):149-159. Nealis VG, Nault JR. 2005. Seasonal Changes in Foliar Terpenes Indicate Suitability of Douglas-Fir Buds for Western Spruce Budworm. Journal of Chemical Ecology 31(4):683-696. Nebert DW, Gonzalez F. 1987. P450 Genes: Structure, Evolution, and Regulation. Annual review of biochemistry 56(1):945-993. Nelson DR. 2009. The Cytochrome P450 Homepage. Human Genomics 4(1):59-65.
185
Nicholson SJ, Hartson SD, Puterka GJ. 2012. Proteomic Analysis of Secreted Saliva from Russian Wheat Aphid (Diuraphis Noxia Kurd.) Biotypes That Differ in Virulence to Wheat. Journal of Proteomics 75(7):2252-2268. Nishida R. 2002. Sequestration of Defensive Substances from Plants by Lepidoptera. Annual Review of Entomology 47(1):57-92. Niu G, Rupasinghe SG, Zangerl AR, Siegel JP, Schuler MA, Berenbaum MR. 2011. A Substrate-Specific Cytochrome P450 Monooxygenase, Cyp6ab11, from the Polyphagous Navel Orangeworm (Amyelois Transitella). Insect Biochemistry and Molecular Biology 41(4):244-253. Ottea J, Plapp F. 1981. Induction of Glutathione S-Aryl Transferase by Phenobarbital in the House Fly. Pesticide Biochemistry and Physiology 15(1):10-13. Pascual L, Jakubowska AK, Blanca JM, Canizares J, Ferre J, Gloeckner G, Vogel H, Herrero S. 2012. The Transcriptome of Spodoptera Exigua Larvae Exposed to Different Types of Microbes. Insect Biochemistry and Molecular Biology 42(8):557-570. Pauchet Y, Wilkinson P, Vogel H, Nelson DR, Reynolds SE, Heckel DG, Ffrench- Constant RH. 2010. Pyrosequencing the Manduca Sexta Larval Midgut Transcriptome: Messages for Digestion, Detoxification and Defence. Insect Molecular Biology 19(1):61-75. Pechan T, Cohen A, Williams WP, Luthe DS. 2002. Insect Feeding Mobilizes a Unique Plant Defense Protease That Disrupts the Peritrophic Matrix of Caterpillars. Proceedings of the National Academy of Sciences 99(20):13319-13323. Poelchau MF, Reynolds JA, Denlinger DL, Elsik CG, Armbruster PA. 2011. A De Novo Transcriptome of the Asian Tiger Mosquito, Aedes Albopictus, to Identify Candidate Transcripts for Diapause Preparation. Bmc Genomics 12. Poland TM, McCullough DG. 2006. Emerald Ash Borer: Invasion of the Urban Forest and the Threat to North Americas Ash Resource. Journal of Forestry 104(3):118- 124. Rajarapu SP, Mamidala P, Herms DA, Bonello P, Mittapalli O. 2011. Antioxidant Genes of the Emerald Ash Borer (Agrilus Planipennis): Gene Characterization and Expression Profiles. Journal of Insect Physiology 57(6):819-824. Rajarapu SP, Mamidala P, Mittapalli O. 2012. Validation of Reference Genes for Gene Expression Studies in the Emerald Ash Borer (Agrilus Planipennis). Insect Science 19(1):41-46. Ranson H, Rossiter L, Ortelli F, Jensen B, Wang XL, Roth CW, Collins FH, Hemingway J. 2001. Identification of a Novel Class of Insect Glutathione S-Transferases Involved in Resistance to Ddt in the Malaria Vector Anopheles Gambiae. Biochemical Journal 359:295-304. Rawlings ND, Tolle DP, Barrett AJ. 2004. Evolutionary Families of Peptidase Inhibitors. Biochemical Journal 378:705-716. Rebek EJ, Herms DA, Smitley DR. 2008. Interspecific Variation in Resistance to Emerald Ash Borer (Coleoptera : Buprestidae) among North American and Asian Ash (Fraxinus Spp.). Environmental Entomology 37(1):242-246.
186
Rehman F, Khan FA, Badruddin SMA. 2012. Role of Phenolics in Plant Defense against Insect Herbivory. Khemani LD, Srivastava MM, Srivastava S, editors. 309-313 p. Rosenthal GA, Janzen DH. 1979. Herbivores and Their Interaction with Plant Secondary Metabolites. XIII+718P-XIII+718P p. Roth SK, Lindroth RL, Montgomery ME. 1994. Effects of Foliar Phenolics and Ascorbic Acid on Performance of the Gypsy Moth (< I> Lymantria Dispar). Biochemical Systematics and Ecology 22(4):341-351. Ryan CA. 1989. Proteinase-Inhibitor Gene Families - Strategies for Transformation to Improve Plant Defenses against Herbivores. Bioessays 10(1):20-24. Ryan CA. 1990. Protease Inhibitors in Plants - Genes for Improving Defenses against Insects and Pathogens. Annual Review of Phytopathology 28:425-449. Salminen JP, Lahtinen M, Lempa K, Kapari L, Haukioja E, Pihlaja K. 2004. Metabolic Modifications of Birch Leaf Phenolics by an Herbivorous Insect: Detoxification of Flavonoid Aglycones Via Glycosylation. Zeitschrift Fur Naturforschung C-a Journal of Biosciences 59(5-6):437-444. Schena M, Shalon D, Davis RW, Brown PO. 1995. Quantitative Monitoring of Gene- Expression Patterns with a Complementary-Dna Microarray. Science 270(5235):467-470. Schloss PD, Delalibera Jr I, Handelsman J, Raffa KF. 2006. Bacteria Associated with the Guts of Two Wood-Boring Beetles: Anoplophora Glabripennis and Saperda Vestita (Cerambycidae). Environmental Entomology 35(3):625-629. Schuler MA. 2011. P450s in Plant-Insect Interactions. Biochimica Et Biophysica Acta- Proteins and Proteomics 1814(1):36-45. Schuster SC. 2008. Next-Generation Sequencing Transforms Today's Biology. Nature Methods 5(1):16-18. Scott JG. 1999. Cytochromes P450 and Insecticide Resistance. Insect Biochemistry and Molecular Biology 29(9):757-777. Serdjukova IR. 1993. Investigation of Digestive Enzymes of Some Wood-Boring Beetles Larvae (Coleoptera, Anobiidae). Zoologichesky Zhurnal 72(6):43-51. Sharma R, Negi DS, Shin WKP, Gibbons S. 2006. Characterization of an Insecticidal Coumarin from Boenninghausenia Albiflora. Phytotherapy Research 20(7):607- 609. Shi J, Karlsson HL, Johansson K, Gogvadze V, Xiao L, Li J, Burks T, Garcia-Bennett A, Uheida A, Muhammed M and others. 2012. Microsomal Glutathione Transferase 1 Protects against Toxicity Induced by Silica Nanoparticles but Not by Zinc Oxide Nanoparticles. Acs Nano 6(3):1925-1938. Simmons J, D'Souza O, Rheault M, Donly C. 2012. Multidrug Resistance Protein Gene Expression in Trichoplusia Ni Caterpillars. Insect Molecular Biology. Sintim HO, Tashiro T, Motoyama N. 2012. Effect of Sesame Leaf Diet on Detoxification Activities of Insects with Different Feeding Behavior. Archives of Insect Biochemistry and Physiology 81(3):148-159. Snyder M, Glendinning J. 1996. Causal Connection between Detoxification Enzyme Activity and Consumption of a Toxic Plant Compound. Journal of Comparative 187
Physiology A: Neuroethology, Sensory, Neural, and Behavioral Physiology 179(2):255-261. Snyder MJ, Stevens JL, Andersen JF, Feyereisen R. 1995. Expression of Cytochrome P450 Genes of the Cyp4 Family in Midgut and Fat Body of the Tobacco Hornworm, Manduca Sexta. Archives of Biochemistry and Biophysics 321(1):13- 20. Snyder MJ, Walding JK, Feyereisen R. 1994. Metabolic-Fate of the Allelochemical Nicotine in the Tobacco Hornworm Manduca Sexta. Insect Biochemistry and Molecular Biology 24(8):837-846. Sonoda S, Ashfaq M, Tsumuki H. 2006. Genomic Organization and Developmental Expression of Glutathione S-Transferase Genes of the Diamondback Moth, Plutella Xylostella. Journal of Insect Science 6. Sonoda S, Tsumuki H. 2005. Studies on Glutathione S-Transferase Gene Involved in Chlorfluazuron Resistance of the Diamondback Moth, Plutella Xylostella L. (Lepidoptera : Yponomeutidae). Pesticide Biochemistry and Physiology 82(1):94- 101. Sorensen JS, Dearing MD. 2006. Efflux Transporters as a Novel Herbivore Countermechanism to Plant Chemical Defenses. Journal of Chemical Ecology 32(6):1181-1196. Stevens JL, Snyder MJ, Koener JF, Feyereisen R. 2000. Inducible P450s of the Cyp9 Family from Larval Manduca Sexta Midgut. Insect Biochemistry and Molecular Biology 30(7):559-568. Sun HL, Blanford S, Guo YY, Fu XJ, Shi WP. 2012a. Toxicity and Influences of the Alkaloids from Cynanchum Komarovii Al. Iljinski (Asclepiadaceae) on Growth and Cuticle Components of Spodoptera Litura Fabricius (Noctuidae) Larvae. Natural Product Research 26(10):903-912. Sun SF, Cheng ZS, Fan J, Cheng XH, Pang Y. 2012b. The Utility of Camptothecin as a Synergist of Bacillus Thuringiensis Var. Kurstaki and Nucleopolyhedroviruses against Trichoplusia Ni and Spodoptera Exigua. Journal of Economic Entomology 105(4):1164-1170. Swain T. 1977. Secondary Compounds as Protective Agents. Annual Review of Plant Physiology 28(1):479-501. Tamura K, Dudley J, Nei M, Kumar S. 2007. Mega4: Molecular Evolutionary Genetics Analysis (Mega) Software Version 4.0. Molecular Biology and Evolution 24(8):1596-1599. Terra WR, Ferreira C. 1994. Insect Digestive Enzymes - Properties, Compartmentalization and Funtion Comparative Biochemistry and Physiology B- Biochemistry & Molecular Biology 109(1):1-62. Terriere LC. 1984. Induction of Detoxification Enzymes in Insects Annual Review of Entomology 29:71-88. Thornalley PJ. 1993. The Glyoxylase System in Health and Disease Molecular Aspects of Medicine 14(4):287-371. Tokuda G, Miyagi M, Makiya H, Watanabe H, Arakawa G. 2009. Digestive Beta- Glucosidases from the Wood-Feeding Higher Termite, Nasutitermes 188
Takasagoensis: Intestinal Distribution, Molecular Characterization, and Alteration in Sites of Expression. Insect Biochemistry and Molecular Biology 39(12):931- 937. Ugale TB, Barkhade UP, Moharil MP, Ghule S. 2011a. Induction of Midgut Carboxylesterase and Cytochrome P-450 in Helicoverpa Armigera (Hubner) by Different Hosts. Crop Research (Hisar) 42(1-3):269-275. Ugale TB, Barkhade UP, Moharil MP, Ghule S. 2011b. Induction of Midgut Glutathione S-Transferase in Helicoverpa Armigera (Hubner) by Different Hosts and Its Influence on Insecticide Metabolism. Crop Research (Hisar) 42(1-3):276-283. Vandenborre G, Smagghe G, Van Damme EJM. 2011. Plant Lectins as Defense Proteins against Phytophagous Insects. Phytochemistry 72(13):1538-1550. Vanhaelen N, Haubruge E, Lognay G, Francis F. 2001. Hoverfly Glutathione S- Transferases and Effect of Brassicaceae Secondary Metabolites. Pesticide Biochemistry and Physiology 71(3):170-177. Vasanthakumar A, Handelsman J, Schloss PD, Bauer LS, Raffa KF. 2008. Gut Microbiota of an Invasive Subcortical Beetle, Agrilus Planipennis Fairmaire, across Various Life Stages. Environmental Entomology 37(5):1344-1353. Velculescu VE, Zhang L, Vogelstein B, Kinzler KW. 1995. Serial Analysis of Gene Expression. Science-AAAS-Weekly Paper Edition 270(5235):484-486. Vera N, Popich S, Luna L, Cravero R, Sierra MG, Bardón A. 2006. Toxicity and Synergism in the Feeding Deterrence of Some Coumarins on Spodoptera Frugiperdasmith (Lepidoptera: Noctuidae). Chemistry & biodiversity 3(1):21-26. Vihakas MA, Kapari L, Salminen J-P. 2010. New Types of Flavonol Oligoglycosides Accumulate in the Hemolymph of Birch-Feeding Sawfly Larvae. Journal of Chemical Ecology 36(8):864-872. Vize PD, Melton DA, Hemmatibrivanlou A, Harland RM. 1991. Assays for Gene Funtion in Developing Xenopus Oocytes. Methods in Cell Biology 36:367-&. Walhout AJM, Reboul J, Shtanko O, Bertin N, Vaglio P, Ge H, Lee H, Doucette-Stamm L, Gunsalus KC, Schetter AJ and others. 2002. Integrating Interactome, Phenome, and Transcriptome Mapping Data for the C-Elegans Germline. Current Biology 12(22):1952-1958. Wang Y, Qiu L, Ranson H, Lumjuan N, Hemingway J, Setzer WN, Meehan EJ, Chen L. 2008. Structure of an Insect Epsilon Class Glutathione S-Transferase from the Malaria Vector Anopheles Gambiae Provides an Explanation for the High Ddt- Detoxifying Activity. Journal of Structural Biology 164(2):228-235. Wang Y, Wang L, Zhu Z, Ma W, Lei C. 2012. The Molecular Characterization of Antioxidant Enzyme Genes in Helicoverpa Armigera Adults and Their Involvement in Response to Ultraviolet-a Stress. Journal of Insect Physiology 58(9):1250-1258. Wang Z, Gerstein M, Snyder M. 2009. Rna-Seq: A Revolutionary Tool for Transcriptomics. Nature Reviews Genetics 10(1):57-63. Weinhold LC, Ahmad S, Pardini RS. 1990. Insect Glutathione-S-Transferase - a Predictor of Allelochemical and Oxidative Stress. Comparative Biochemistry and Physiology B-Biochemistry & Molecular Biology 95(2):355-363. 189
Weinshilboum RM, Otterness D, Aksoy IA, Wood TC, Her C, Raftogianis R. 1997. Sulfation and Sulfotransferases 1: Sulfotransferase Molecular Biology: Cdnas and Genes. The FASEB journal 11(1):3-14. Wheelock CE, Shan G, Ottea J. 2005. Overview of Carboxylesterases and Their Role in the Metabolism of Insecticides. Journal of Pesticide Science 30(2):75-83. White KP, Rifkin SA, Hurban P, Hogness DS. 1999. Microarray Analysis of Drosophila Development During Metamorphosis. Science 286(5447):2179-2184. Whitehill JGA, Opiyo SO, Koch JL, Herms DA, Cipollini DF, Bonello P. 2012. Interspecific Comparison of Constitutive Ash Phloem Phenolic Chemistry Reveals Compounds Unique to Manchurian Ash, a Species Resistant to Emerald Ash Borer. Journal of Chemical Ecology 38(5):499-511. Whitehill JGA, Popova-Butler A, Green-Church KB, Koch JL, Herms DA, Bonello P. 2011. Interspecific Proteomic Comparisons Reveal Ash Phloem Genes Potentially Involved in Constitutive Resistance to the Emerald Ash Borer. Plos One 6(9). Whitfield CW, Cziko A, Band M, Liu L, Pardinas J, Soares B, Robertson H, Robinson GE. 2001. Social Regulation of Behavior in the Honey Bee: Expressed Sequence Tags and Microarray Analysis of Gene Expression in the Brain. Society for Neuroscience Abstracts 27(2):2541-2541. Whyard S, Downe AER, Walker VK. 1994a. Isolation of an Esterase Conferring Insecticide Resistance in the Mosquito Culex Tarsalis. Insect Biochemistry and Molecular Biology 24(8):819-827. Whyard S, Russell RJ, Walker VK. 1994b. Insecticide Resistance and Malathion Carboxylesterase in the Sheep Blowfly, Lucilia-Cuprina. Biochemical Genetics 32(1-2):9-24. Wu S, Yang Y, Yuan G, Campbell PM, Teese MG, Russell RJ, Oakeshott JG, Wu Y. 2011. Overexpressed Esterases in a Fenvalerate Resistant Strain of the Cotton Bollworm, Helicoverpa Armigera. Insect Biochemistry and Molecular Biology 41(1):14-21. Yamamoto K, Kimura M, Aso Y, Banno Y, Koga K. 2007. Characterization of Superoxide Dismutase from the Fall Webworm, Hyphantria Cunea: Comparison of Its Properties to Superoxide Dismutase from the Silkworm Bombyx Mori. Applied Entomology and Zoology 42(3):465-472. Yamamoto K, Teshiba S, Aso Y. 2008. Characterization of Glutathione S-Transferase of the Rice Leaffolder Moth, Cnaphalocrocis Medinalis (Lepidoptera: Pyralidae): Comparison of Its Properties of Glutathione S-Transferases from Other Lepidopteran Insects. Pesticide Biochemistry and Physiology 92(3):125-128. Yamamoto K, Teshiba S, Shigeoka Y, Aso Y, Banno Y, Fujiki T, Katakura Y. 2011. Characterization of an Omega-Class Glutathione S-Transferase in the Stress Response of the Silkmoth. Insect Molecular Biology 20(3):379-386. Yamamoto K, Zhang PB, Banno Y, Fujii H. 2006. Identification of a Sigma-Class Glutathione-S-Transferase from the Silkworm, Bombyx Mori. Journal of Applied Entomology 130(9-10):515-522.
190
Yang LH, Huang H, Wang JJ. 2010. Antioxidant Responses of Citrus Red Mite, Panonychus Citri (Mcgregor)(Acari: Tetranychidae), Exposed to Thermal Stress. Journal of Insect Physiology 56(12):1871-1876. Yu N, Christiaens O, Liu JS, Niu JZ, Cappelle K, Caccia S, Huvenne H, Smagghe G. 2013. Delivery of Dsrna for Rnai in Insects: An Overview and Future Directions. Insect Science 20(1):4-14. Yu S. 1986. Consequences of Induction of Foreign Compound-Metabolizing Enzymes in Insects. Yu SJ. 1982. Host Plant Induction of Glutathione S-Transferase in the Fall Armyworm. Pesticide Biochemistry and Physiology 18(1):101-106. Yu SJ. 1992. Plant-Allelochemical-Adapted Glutathione Transferases in Lepidoptera. Acs Symposium Series 505:174-190. Yu SJ, Huang SW. 2000. Purification and Characterization of Glutathione S-Transferases from the German Cockroach, Blattella Germanica (L.). Pesticide Biochemistry and Physiology 67(1):36-45. Zalucki MP, Malcolm SB, Paine TD, Hanlon CC, Brower LP, Clarke AR. 2001. It’s the First Bites That Count: Survival of First-Instar Monarchs on Milkweeds. Austral Ecology 26(5):547-555. Zangerl AR, Bazzaz FA. 1992. Theory and Pattern in Plant Defense Allocation. Plant resistance to herbivores and pathogens: ecology, evolution, and genetics. University of Chicago Press, Chicago, Illinois, USA:363-391. Zdobnov EM, Bork P. 2007. Quantification of Insect Genome Divergence. Trends in Genetics 23(1):16-20. Zhang B, Liu H, Hull-Sanders H, Wang JJ. 2011a. Effect of Host Plants on Development, Fecundity and Enzyme Activity of Spodoptera Exigua (Hubner) (Lepidoptera: Noctuidae). Agricultural Sciences in China 10(8):1232-1240. Zhang T, Wei Z-G, Gao R-N, Wang R-X, Zhao G-D, Li B, Shen W-D. 2011b. Induction of Expression of Partial Glutathione-S-Transferase Genes in Bombyx Mori by Rutin. Acta Entomologica Sinica 54(1):20-26. Zhang YE, Ma HJ, Feng DD, Lai XF, Chen ZM, Xu MY, Yu QY, Zhang Z. 2012. Induction of Detoxification Enzymes by Quercetin in the Silkworm. Journal of Economic Entomology 105(3):1034-1042. Zhou XJ, Sheng CF, Li M, Wan H, Liu D, Qiu XH. 2010. Expression Responses of Nine Cytochrome P450 Genes to Xenobiotics in the Cotton Bollworm Helicoverpa Armigera. Pesticide Biochemistry and Physiology 97(3):209-213.
191