sign in sign up
<<
Home , Alanine, Alanine (data page), Glutamic acid

Proc. Nati. Acad. Sci. USA Vol. 89, pp. 9141-9145, October 1992 A4 hydrolase: Abrogation of the peptidase activity by mutation of glutamic -296 ANDERS WETTERHOLM*, JUAN F. MEDINA*, OLOF RXDMARK*, ROBERT SHAPIROt, JESPER Z. HAEGGSTR6M*, BERT L. VALLEEt, AND BENGT SAMUELSSON* *Department of Physiological Chemistry, Karolinska Institutet, Box 60 400, S-104 01 Stockholm, Sweden; and tCenter for Biochemical and Biophysical Science and Medicine, Harvard Medical School, 250 Longwood Avenue, Boston, MA 02115 Contributed by Bengt Samuelsson, May 13, 1992

ABSTRACT The metal-binding motif in the sequence of lase (9, 10). Accordingly, LTA4 hydrolase was found to leukotriene A4 (LTA4) (EC 3.3.2.6), a bifunctional metal- contain one atom of zinc per molecule (11-13) and loenzyme, contains a that is conserved in several also to exhibit peptidase activity toward synthetic substrates zinc hydrolases. To study its role for the two catalytic activities, (12-14). The primary function of the metal seems to be Glu-296 in mouse leukotriene A4 hydrolase was replaced by a catalytic because removal of the zinc atom resulted in loss of or residue by site-directed mutagenesis. Wild- both enzymatic activities, which could be restored by addi- type and mutated cDNAs were expressed four or five times in tion of stoichiometric amounts of zinc or cobalt (11, 13, 14). Escherichia coli, and the resulting were purified to In agreement with the sequence predictions, the three zinc- apparent homogeneity. With respect to their epoxide hydrolase binding ligands were identified as His-295 (L1), His-299 (L2), activities-i.e., the conversion ofLTA4 into leukotriene B4-the and Glu-318 (L3) by site-directed mutagenesis and zinc anal- mutated [Gln296]LTA4 hydrolase and [Ala296]LTA4 ysis (15). hydrolase exhibited specific activities of 1070 ± 160 and 90 ± 30 Besides the three amino involved in zinc coordina- nmol of LTB4 per mg of per min (mean + SD; n = 4 or tion, some of the zinc and aminopeptidases, in- 5), respectively, corresponding to 150% and 15% of unmutated cluding LTA4 hydrolase, also share a conserved glutamic enzyme. In contrast, when the mutated proteins were assayed acid residue in juxtaposition to one (L1) of the primary for peptidase activity toward alanine-4-nitroanilide, they were zinc-binding ligands (ref. 10; Fig. 1). From x-ray crystallo- found to be virtually inactive (c0.2% ofunmutated enzyme). To graphic data, Glu-143 in , a typical example of serve as a positive control, we also replaced Ser-298 with an such zinc hydrolases, has been implicated in the proteolytic alanine residue, which resulted in a protein ([Ala]LTA4 mechanism of this enzyme (16, 17). In the present study, we hydrolase) with catalytic properties almost indistnguishable replaced Glu-296, the corresponding in LTA4 from the wild-type enzyme. Substitution of Glu-296 by gluta- hydrolase, with a glutamine or alanine residue, purified the mine or alanine was also carried out with human LTA4 hydro- mutated proteins, and studied the effects of these mutations lase, and the mutated human enzymes displayed specific activ. on the enzyme activities. ities similar to the corresponding mouse proteins. Zinc analyses of the purified mouse and human proteins confirmed that the MATERIALS AND METHODS mutations did not significantly influence their zinc content. In conclusion, the results of the present study indicate a direct LTA4 methyl ester (Merck Frosst Labs, Pointe Claire, PQ, catalytic role for Glu-296 in the peptidase reaction of LTA4 Canada) was saponified in tetrahydrofuran with 1 M LiOH hydrolase, where it presumably acts as a base to polarize water, (6% vol/vol) for 48 hr at 4°C. Alanine-, -, -, whereas its function, if any, is apparently not essential in the -, -, -, -, and y-glutamyl-4- epoxide hydrolase reaction. nitroanilide were from Sigma. 4-Nitroaniline was from Merck. T7 sequencing kit, restriction endonucleases, and Leukotriene A4 (LTA4) hydrolase (EC 3.3.2.6) is a key nucleic acid-modifying enzymes were purchased from Phar- enzyme in the of and catalyzes the macia. Vent DNA polymerase was from New England Bio- hydrolysis of the unstable epoxide LTA4 [5(S)-trans-5,6- labs. Oligonucleotides were synthesized by Scandinavian oxido-7,9-trans-11,14-cis-eicosatetraenoic acid] into the Gene Synthesis (Koping, Sweden). proinflammatory substance leukotriene B4 [LTB4; 5(S), Site-Directed Mutagenesis of LTA4 Hydrolase cDNA and 12(R)-dihydroxy-6,14-cis-8,10-trans-eicosatetraenoic acid] Expression in Escherichia coli. Mutations of recombinant (1). The formation ofLTA4 is in turn catalyzed by the enzyme mouse LTA4 hydrolase (a fusion protein with 10 additional 5-lipoxygenase and involves the dioxygenation of arachi- amino acids at its N terminus; see ref. 8) were carried out by donic acid with subsequent epoxide formation. PCR mutagenesis as described (15). Primers A and B were LTA4 hydrolase has been purified from a variety of sources JF21 and JF27 (15). Primer C, the mutagenetic primer (5' -* as a soluble, monomeric protein of Mr 69 kDa (for reviews, 3', site mutation underlined), was one of the following: JF26 see refs. 2 and 3). The enzyme is inactivated by the substrate [d(CAAATATCTCATAGCTGGACAGG)] for [Gln296]LTA4 LTA4, an effect that seems directly coupled to the enzyme hydrolase, which for simplicity we call E296Q in single letter catalysis (4). The cDNAs coding for the human and mouse code for the Glu-296 -+ Gln amino acid change); JF36 enzymes have been cloned, sequenced, and expressed in [d(GCAATATCTCATAGCTGGACAGG)] for [Ala296]LTA4 Escherichia coli (5-8). hydrolase, which we call E296A for the Glu-296 -- Ala amino Recently, sequence comparisons with certain zinc metal- loenzymes-e.g., thermolysin and aminopeptidase M-re- Abbreviations: LTA4, leukotriene A4, 5(S)-trans-5,6-oxido-7,9-trans- vealed the presence of a zinc-binding motif in LTA4 hydro- 11,14-cis-eicosatetraenoic acid; LTB4, leukotriene B4, 5(S),12(R)- dihydroxy-6,14-cis-8,10-trans-eicosatetraenoic acid; PGB1, pros- taglandin B1; RT, room temperature; E296Q, [Gln296]LTA4 hydrolase; The publication costs of this article were defrayed in part by page charge hE296Q, human E296Q; E296A, [Ala29]LTA4 hydrolase; hE296A, payment. This article must therefore be hereby marked "advertisement" human E296A; S298A, [Ala2%]LTA4 hydrolase; H295Y, [Tyr295]- in accordance with 18 U.S.C. §1734 solely to indicate this fact. LTA4 hydrolase. 9141 Downloaded by guest on September 24, 2021 9142 Biochemistry: Wetterholm et al. Proc. Natl. Acad. Sci. USA 89 (1992)

Li L2 L3 Thermolysin V V A H E L T H A V T G A I N E A I S D 142 146 166

Leukotriene A4 hydrolase V I A H E i S H S W T F W L N E G H T V 295 299 318

Aminopeptidase M V I A H E L A H Q W F L W L N E G F A S 388 392 411

Neutral endopeptidase V I G H E I T H G F D N T L G E N I A D 583 587 646 FIG. 1. Comparison of the zinc binding regions of thermolysin and LTA4 hydrolase, with the proposed zinc sites of neutral endopeptidase and aminopeptidase M. Adapted from ref. 10. acid change; and JF39 [d(GAAATAGCTCATAGCTGGA- of acetonitrile/methanol/water/acetic acid, 29:34:39:0.01 CAGG)] for [AlaW]LTA4 hydrolase, which we call S298A for (vol/vol), at a flow rate of0.8 ml/min. The absorbance ofthe

the Ser-298 -* Ala amino acid change-all phosphorylated at eluate was monitored continuously at 270 nm. Quantitations their 5' end. of LTB4 were made by measurements of peak height ratios Primer D was JF13 [d(AATCAGCAACAATCAGT- between LTB4 and PGB1 as described (20). TCCT)], a reverse primer matching nucleotides 1856-1836 The specific peptidase activities were determined spectro- (according to the cDNA numbering in ref. 8). E296Q was also photometrically essentially as described (21) in 50 mM Tris constructed with JF24 [d(GATGCATGCTGGCTTTATGC)] chloride (pH 7.5) containing 100 mM NaCI. The assays were as primer D, which yields an isoform of the enzyme with a performed in the wells of a microtiterplate by incubating the lysine instead of an residue in position 592 ([Gln29 , enzyme (1-26 pug) with 1 mM alanine4-nitroanilide in 250 !tl Lys592]LTA4 hydrolase) (8). For the construction of [Tyr295]- buffer at RT. The formation of product (4-nitroaniline) was

LTA4 hydrolase, which we call H295Y for the His-295 -+ Tyr measured as the increase in absorbance at 405 nm by using a change, see ref. 15. Mutagenesis of human LTA4 hydrolase multiscan spectrophotometer, MCC/340 (Labsystems, Hel- was performed as described by Taylor et al. (18), using the sinki). Quantitations were made from a standard curve ob- oligonucleotides (5' -- 3', mutated bases underlined): d(AT- tained with known amounts of 4-nitroaniline in 50 mM Tris GAGATATTTGATGTGCAAT) for human E296Q (hE296Q) chloride (pH 8). Spontaneous hydrolysis ofthe substrate was and d(ATGAGATATTQCATGTGCAAT) for human E296A corrected for by subtracting the absorbance of control incu- (hE296A). Mutated proteins were expressed in E. coli (JM bations without enzyme. Reaction rates were calculated from 101) transformed with the corresponding mutated plasmid, as the increase in A405 over the first 20 min (unmutated enzymes described (15). Sequence analysis of the entire cDNA inserts and S298A) or 4-5 hr (E2%Q, E2%A, H295Y, hE296Q, and confirmed that no alterations of the protein primary struc- hE296A) of incubation. tures, other than the desired mutations, had occurred. Zinc Analyses. Prior to zinc analyses, the proteins were Purification ofRecombinant LTA4 Hydrolase. Both mutated washed by repeated ultrafiltration on a Centricon-30 micro- and unmutated proteins were purified essentially as de- concentrator by using 5-10 mM Tris chloride (pH 8) prepared scribed (13). The procedure involved precipitations, anion from reagent grade Tris and Milli-Q water (Waters- exchange, hydrophobic interaction, and chromatofocusing Millipore). Zinc determinations were performed by electro- chromatographies and resulted in apparently homogeneous thermal atomic absorption spectrometry with a Perkin-Elmer proteins. The yield was -0.5-1 mg of protein per liter of cell model 5000 atomic absorption spectrophotometer equipped culture. After the final purification step, the buffer was with a HGA 500 graphite furnace, as described (15). The changed to 10 mM Tris chloride (pH 8) by repeated centrif- result obtained for each batch of enzyme is an average of ugation on a Centricon-30 microconcentrator (Amicon), and duplicate determinations on two different dilutions ofsample. the protein was stored at 4°C. SDS/PAGE was performed on Protein concentrations were determined by amino acid anal- a Phast system (Pharmacia) with 10-15% gradient gels. ysis with the Pico Tag (Waters/Millipore) methodology. Bands of protein were visualized by staining with Coomassie brilliant blue. Protein concentrations were determined by the Bradford method (19) with bovine serum albumin as stan- RESULTS dard. Glu-296 in recombinant mouse LTA4 hydrolase was substi- Determinations of Enzyme Activities. Specific epoxide hy- tuted by a glutamine or alanine residue by site-directed drolase activities (i.e., the hydrolysis of the epoxide LTA4 mutagenesis, and the resulting cDNAs were expressed in E. into LTB4) of wild-type and mutated enzymes were deter- coli. Four or five batches (obtained from separate expres- mined at room temperature (RT) from duplicate incubations sions) of wild-type and mutated proteins E296Q and E296A of enzyme (2.5-26 jig in 100 ,ul of 50 mM Hepes or Tris were purified to apparent homogeneity and assayed for chloride, pH 8) with 30-60 ,uM LTA4 added in 1 ,lI of epoxide hydrolase and peptidase activity (Fig. 2). For each tetrahydrofuran. After 15 s, the reaction was quenched with batch, the specific activity was calculated from one to seven 200 .ul of methanol, and the internal standard, prostaglandin analyses. E296Q (2.5 ,ug) was found to convert LTA4 into B1 (PGB1; Upjohn), was added. The samples were acidified LTB4 with a specific activity of 1070 + 160 nmol of LTB4 per to pH 3 with 0.1 M HCl immediately before reverse-phase mg of protein per min (mean + SD, n = 5) corresponding to HPLC analysis, which was performed on a column (Radial- 150%o of the unmutated enzyme, which exhibited a specific Pak C18 cartridge, 100 x 5 mm; Waters) eluted with a mixture activity of 700 + 90 nmol/mg per min (n = 5) (Table 1). Downloaded by guest on September 24, 2021 Biochemistry: Wetterholm et al. Proc. Natl. Acad. Sci. USA 89 (1992) 9143

1 2 3 4 5 which one of the zinc binding ligands (His-295) has been 94.0 replaced with a residue, did not exhibit any signif- 67.0 icant epoxide hydrolase or peptidase activity (0.01% and <0.1% of 43.0-o unmutated enzyme, respectively), in agreement with our previous report (15). Mutagenetic replacements of Glu-296 by a glutamine or 30.0 alanine residue were also carried out with human LTA4 20.1 -' hydrolase. In a single series of expression and purification, 14.4 ; the resulting mutated proteins, hE2%Q and hE296A, exhib- ited catalytic properties similar to the corresponding mouse FIG. 2. SDS/PAGE of purified mutated and wild-type recombi- mutants (Table 2). Thus, the epoxide hydrolase activities for nant mouse LTA4 hydrolase proteins. The mutated proteins S298A hE2%Q and hE2%A were 1380 and 190 nmol ofLTB4 per mg (lane 2), E2%A (lane 3), and E296Q (lane 4) and wild-type mouse of protein per min, respectively, corresponding to 150%o and LTA4 hydrolase (lane 5) (0.5 ,ug each) were electrophoresed on a 20%o of unmutated enzyme. The differences in epoxide Phast-Gradient gel 10-15 hy- (Pharmacia Phast System) and stained with drolase activities between the recombinant human and mouse Coomassie brilliant blue. The molecular mass markers (lane 1) were enzymes a phosphorylase b (94.0 kDa), bovine serum albumin (67.0 kDa), (Tables 1 and 2) may reflect species difference, the ovalbumin (43.0 kDa), carbonic anhydrase (30.0 kDa), presence of a short fusion part (10 amino acids) at the N trypsin inhibitor (20.1 kDa), and a-lactalbumin (14.4 kDa). terminus of the mouse protein, and/or assay conditions. The peptidase activities of hE2%Q and hE296A were calculated Replacement of Glu-296 by an alanine residue resulted in a to be 0.07 and 0.1 nmol of4-nitroaniline per mg ofprotein per protein (E296A) with significantly reduced albeit clearly min, respectively, corresponding to 0.02% and 0.03% of the detectable epoxide hydrolase activity. From incubations of wild-type enzyme (Table 2). 10 ,ug of E296A, this activity was calculated to be 90 ± 30 Zinc analyses were carried out on the purified recombinant nmol/mg per min (n = 4, Table 1). mouse and human proteins (Tables 1 and 2). Although the When 1 ,g ofunmutated enzyme was incubated for 20 min metal-protein stoichiometries in certain analyses of the with alanine4-nitroanilide, the peptidase activity was calcu- mouse proteins deviated from the expected value of 1 mol/ lated to be 280 ± 60 nmol of 4-nitroaniline per mg of protein mol, repeated analyses resulted in mean values of 0.97, 1.0, per min (n = 5). Under somewhat different conditions (10-25 0.89, and 0.96 mol/mol for wild-type enzyme, E296Q, ,ug of protein and 4-5 hr of incubation), E2%Q and E2%A E2%A, and S298A, respectively. hydrolyzed alanine-4-nitroanilide with specific activities of 0.6 ± 0.8 and 0.4 ± 0.4 nmol/mg per min (n = 4-5, Table 1). E296Q was also essentially inactive towards leucine-, lysine-, DISCUSSION valine-, methionine-, proline-, glycine-, and y-glutamyl4- Several zinc proteases or mono zinc aminopeptidases, such nitroanilide (data not shown). as thermolysin, neutral endopeptidase, and aminopeptidase In contrast to the effects of mutagenetic replacements at M, share a conserved glutamic acid located in the immediate position 2%, replacement of Ser-298 with an alanine residue vicinity of the first zinc-binding , denoted L1 in Fig. 1 resulted in a mutated protein (S298A) that had intact epoxide (see ref. 10). This structural feature is also observed in LTA4 hydrolase activity and retained 75% of the peptidase activity hydrolase in which a glutamic acid residue is positioned next (Table 1). Another previously constructed mutant H295Y, in to the zinc-binding ligand His-295. To study the role of Table 1. Enzyme activities and zinc content of recombinant mouse LTA4 hydrolase and the mutants E296Q, E2%A, and S298A Epoxide hydrolase activity,* Peptidase activity,t Batch nmol of LTB4 per mg of nmol of 4-nitroaniline per mg Zinc content, Enzyme no. protein per min (% of control) of protein per min (% of control) mol/mol of protein Unmutated control 1 537 188 0.66 2 750 328 1.22 3 709 287 0.76 4 779 325 0.94 5 715 289 1.28 Mean + SD 700 ± 90 (100) 280 ± 60 (100) 0.97 + 0.27 E296Q Pt 995 2 1.10 2t 1278 0.1 1.04 3 1081 0.34 0.41 4 1152 0.06 1.07 5 866 0.25 1.38 Mean ± SD 1070 ± 160 (150) 0.6 ± 0.8 (0.2) 1.00 ± 0.36 E296A 1 125 0.51 0.83 2 69 0.9 0.42 3 68 0.06 0.79 4 112 0.24 1.53 Mean + SD 90 ± 30 (15) 0.4 ± 0.4 (0.15) 0.89 + 0.46 S298A 1 662 230 0.69 2 773 187 1.22 Mean 720 (100) 210 (75) 0.9 *Determined from incubations (15 s at RT) of various amounts of enzyme (2.5 Ag for unmutated control, E296Q, and S298A or 10,ug for E296A) at a substrate concentration of 30-60 ,IM LTA4 as described. tDetermined from incubations of either 1 ug of protein for 20 min (unmutated control and S298A) or 10-25 ,ug of protein for 4-5 hr (E296Q and E296A) at a substrate concentration of 1 mM alanine-4-nitroanilide as described. tIsoenzyme with a lysine instead of an arginine in position 592 (see ref. 8). Downloaded by guest on September 24, 2021 9144 Biochemistry: Wetterholm et al. Proc. Natl. Acad Sci. USA 89 (1992) Table 2. Enzyme activities and zinc content of recombinant human LTA4 hydrolase and the mutants hE296Q and hE296A Epoxide hydrolase activity,* Peptidase activityt nmol of LTB4 per mg of nmol of 4-nitroanilUne per mg Zinc content, Enzyme protein per min (% of control) of protein per min (% of control) mol/mol of protein Unmutated control 940 (100) 375 (100) 0.71 hE296Q 1380 (150) 0.07 (0.02) 0.82 hE296A 190 (20) 0.1 (0.03) 0.75 Values of zinc content and enzyme activities were obtained from one batch of the respective purified enzyme. *Determined from incubations (15 s at RT) of various amounts of enzyme (2.5 ;ug for unmutated control and hE296Q or 10 ,ug for hE296A) at a substrate concentration of 30-60 FLM LTA4 as described. tDetermined from incubations of either 1 lug ofprotein for 20 min (unmutated control) or 20 jig of protein for 4 hr (hE296Q and hE296A) at a substrate concentration of 1 mM alanine-4-nitroanilide as described. Glu-2% for the two catalytic activities ofLTAi hydrolase, we able to assume that the peptidase activity of LTA4 hydrolase replaced this amino acid with a glutamine or alanine residue functions according to a similar mechanism (Fig. 3). by site-directed mutagenesis on both mouse and human Apparently, the carboxylate of Glu-296 is not essential for cDNA. Following expression in E. coli, the mutated proteins the epoxide hydrolysis catalyzed by LTA4 hydrolase. Thus, were purified to apparent homogeneity (Fig. 2), to allow replacement ofthe carboxyl group with an amide (E296Q) did enzyme-activity determinations and zinc analyses, the re- not reduce but rather slightly increased the specific epoxide sults of which are presented in Tables 1 and 2. hydrolase activity (Tables 1 and 2). Replacement of Glu-296 Replacement of Glu-2% with a glutamine residue in mouse with an alanine residue (E296A) certainly reduced the ep- LTA4 hydrolase resulted in a protein, E296Q, with intact or oxide hydrolase activity by >80%o, but this effect was per- even slightly increased epoxide hydrolase activity as com- haps not unexpected considering the chemical differences pared to unmutated wild-type enzyme. In contrast, the pep- between alanine and glutamic acid-e.g., polarity and length tidase activity toward alanine4-nitroanilide and several other of the side chain. Nevertheless, we cannot exclude that aromatic amides was practically abolished (Table 1). A Glu-296 in some way participates in the epoxide hydrolase similar, although less striking, selective abrogation of the reaction, although this particular amino acid is not a prereq- peptidase activity was observed with the mutant E296A. This uisite for catalysis. Further studies with additional mutage- enzyme displayed a substantially reduced albeit clearly de- netic replacements at position 296 may clarify this point. tectable epoxide hydrolase activity corresponding to p15% When the zinc site of LTA4 hydrolase was identified and of wild-type enzyme, whereas its peptidase activity was the catalytic role of the zinc atom for the epoxide hydrolase negligible. The minimal peptidase activities observed forboth and peptidase activities was established (9-15), it seemed E2%Q and E2%A may in fact be overestimated. In compar- likely that the catalytic site was one and the same for both ison to the assay of unmutated enzyme, they were deter- activities. This view was further strengthened by the obser- mined with 10-25 times more protein during 12-15 times vations that both activities were susceptible to inactivation longer incubation periods (4-5 hr), conditions under which by LTA4 and could be inhibited by bestatin and captopril, an even minute amounts ofcontaminating proteases or wild type inhibitor of angiotensin converting enzyme (12-14, 23, 24). enzyme may be detected. Zinc analyses of the purified However, in at least two ways the activities differ, indicating proteins confirmed that none of the mutagenetic replace- that the catalytically important amino acids are not identical ments at position 2% had significantly influenced the zinc for the peptidase and epoxide hydrolase reactions. First, we content of the corresponding proteins (Tables 1 and 2). To have observed that the peptidase activity is stimulated by serve as a positive control, we also constructed the mutant several halides and other monovalent anions, most notably S298A in which a residue located next to the second chloride and thiocyanate, in a fashion that suggests the zinc-binding ligand L2 (see Fig. 1) was replaced with an presence ofan anion binding site (25). The epoxide hydrolase alanine residue. As expected, the specific activities of S298A activity was not stimulated by chloride but rather slightly were quite similar to those of wild-type enzyme (Table 1). In inhibited. Second, the results of the present study indicate contrast, H295Y in which one zinc-binding ligand, His-295, that Glu-296 (and particularly its carboxyl moiety) has a has been replaced with a tyrosine, did not display significant levels of either activity. Taken together, these results allow His 295 us to conclude that the peptidase activity but not the epoxide His 299 G}lu 296 hydrolase activity of LTA4 hydrolase is critically dependent Base on the presence of a glutamic acid at position 2%. In line with our findings, site-directed mutagenesis of Glu-584 in neutral 0I 0 endopeptidase to either an or valine residue Glu abolished its catalytic activity but not the binding of a substrate-related inhibitor (22). H X-ray crystallographic analysis of thermolysin, a ^^OH with a catalytic zinc site structurally similar to that of LTA4 hydrolase, has identified Glu-143 as a putative catalytic NH.-HC H amino acid. Two reaction mechanisms have been discussed NH - C~ C-g- N (\ /N2 in which Glu-143 either acts as a general base or forms an anhydride with the substrate. In the former and most favored CH3 H mechanism, a water molecule is displaced from the zinc atom - by the carbonyl oxygen ofthe substrate and then polarized by ( donor the carboxylate of the glutamic acid to promote an attack of the carbonyl of the scissile bond. Simultane- FIG. 3. Putative reaction mechanism for the hydrolysis of ala- ously, a proton is transferred to the of the peptide nine-4-nitroanilide by LTA4 hydrolase, based on the models pre- bond from an adjacent amino acid (16, 17). It appears reason- sented in refs. 16 and 17. Downloaded by guest on September 24, 2021 Biochemistry: Wetterholm et al. Proc. Natl. Acad. Sci. USA 89 (1992) 9145 unique role in the peptidase mechanism but not in the epoxide Suzuki, K., Ohishi, N., Shimizu, T. & Seyama, Y. (1988) FEBS hydrolase mechanism. Defined as all structural elements of Lett. 229, 279-282. 8. Medina, J. F., Radmark, O., Funk, C. D. & Haeggstrom, J. Z. the protein that participate in the catalytic reaction, the active (1991) Biochem. Biophys. Res. Commun. 176, 1516-1524. sites thus seem to be overlapping rather than identical. 9. Malfroy, B., Kado-Fong, H., Gros, C., Giros, B., Schwartz, In conclusion, the results of the present study establish an J.-C. & Hellmiss, R. (1989) Biochem. Biophys. Res. Commun. essential role of Glu-296 for the peptidase activity of LTA4 161, 236-241. hydrolase. Furthermore, the relatively modest effects of 10. Vallee, B. L. & Auld, D. S. (1990) Biochemistry 29, 5647-5659. mutations on the epoxide hydrolase activity suggest that 11. Haeggstrom, J. Z., Wetterholm, A., Shapiro, R., Vallee, B. L. & Samuelsson, B. (1990) Biochem. Biophys. Res. Commun. Glu-296 has not been conserved to allow the biosynthesis of 172, %5-970. LTB4 from LTA4 but rather to maintain or develop some 12. Minami, M., Ohishi, N., Mutoh, H., Izumi, T., Bito, H., Wada, other biochemical function, yet to be identified. Since this H., Seyama, Y., Toh, H. & Shimizu, T. (1990) Biochem. glutamic acid residue and the binding motif of the catalytic Biophys. Res. Commun. 173, 620-626. zinc atom are shared between a number ofzinc proteases and 13. Wetterholm, A., Medina, J. F., Radmark, O., Shapiro, R., aminopeptidases (10), the implications of our results may Haeggstrom, J. Z., Vallee, B. L. & Samuelsson, B. (1991) Biochim. Biophys. Acta 1080, 96-102. pertain to other members of these enzyme families. 14. Haeggstrom, J. Z., Wetterholm, A., Vallee, B. L. & Samuels- son, B. (1990) Biochem. Biophys. Res. Commun. 173, 431-437. We are greatly indebted to Ms. Eva Ohlson and Ms. Agneta 15. Medina, J. F., Wetterholm, A., Radmark, O., Shapiro, R., Nordberg for excellent technical assistance. We also thank Dr. Haeggstrom, J. Z., Vallee, B. L. & Samuelsson, B. (1991) A. W. Ford-Hutchinson (Merck Frosst Labs) for the generous gift of Proc. Natl. Acad. Sci. USA 88, 7620-7624. LTA4. This project was financially supported by the Swedish Med- 16. Pangburn, M. K. & Walsh, K. A. (1975) Biochemistry 14, ical Research Council (03X-217), Stiftelsen Lars Hiertas minne and 4050-4054. 0. E. & Edla Johanssons foundations, and Svenska Sillskapet f6r 17. Kester, W. R. & Matthews, B. W. (1977) Biochemistry 16, Medicinsk Forskning. 2506-2516. 18. Taylor, J. W., Ott, J. & Eckstein, F. (1985) Nucleic Acids Res. 1. Samuelsson, B. (1983) Science 220, 568-575. 13, 8764-8785. 2. Samuelsson, B. & Funk, C. D. (1989) J. Biol. Chem. 264, 19. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254. 20. Radmark, O., Shimizu, T., Jornvall, H. & Samuelsson, B. 19469-19472. (1984) J. Biol. Chem. 259, 12339-12345. 3. RAdmark, 0. & Haeggstrom, J. (1990) Adv. Prostaglandin 21. Sjostrom, H., Nortn, O., Jeppesen, L., Staun, M., Svensson, Thromboxane Leukotriene Res. 20, 35-45. B. & Christiansen, L. (1978) Eur. J. Biochem. 88, 503-511. 4. Orning, L., Jones, D. A. & Fitzpatrick, F. A. (1990) J. Biol. 22. Devault, A., Nault, C., Zollinger, M., Fournie-Zaluski, M.-C., Chem. 265, 14911-14916. Roques, B. P., Crine, P. & Boileau, G. (1988) J. Biol. Chem. 5. Funk, C. D., Ridmark, O., Fu, J. Y., Matsumoto, T., J6rnvall, 263, 4033-4040. H., Shimizu, T. & Samuelsson, B. (1987) Proc. Natl. Acad. Sci. 23. Orning, L., Krivi, G. & Fitzpatrick, F. A. (1991) J. Biol. Chem. USA 84, 6677-6681. 266, 1375-1378. 6. Minami, M., Ohno, S., Kawasaki, H., Radmark, O., Samuels- 24. Orning, L., Krivi, G., Bild, J., Aykent, S. & Fitzpatrick, F. A. son, B., Jornvall, H., Shimizu, T., Seyama, Y. & Suzuki, K. (1991) J. Biol. Chem. 266, 16507-16511. (1987) J. Biol. Chem. 262, 13873-13876. 25. Wetterholm, A. & Haeggstrom, J. Z. (1992) Biochim. Biophys. 7. Minami, M., Minami, Y., Emori, Y., Kawasaki, H., Ohno, S., Acta 1123, 275-281. Downloaded by guest on September 24, 2021