DOCSLIB.ORG

Mutation of Glutamic Acid-296 ANDERS WETTERHOLM*, JUAN F

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mutation of Glutamic Acid-296 ANDERS WETTERHOLM*, JUAN F Proc. Nati. Acad. Sci. USA Vol. 89, pp. 9141-9145, October 1992 Biochemistry Leukotriene A4 hydrolase: Abrogation of the peptidase activity by mutation of glutamic acid-296 ANDERS WETTERHOLM*, JUAN F. MEDINA*, OLOF RXDMARK*, ROBERT SHAPIROt, JESPER Z. HAEGGSTR6M*, BERT L. VALLEEt, AND BENGT SAMUELSSON* *Department of Physiological Chemistry, Karolinska Institutet, Box 60 400, S-104 01 Stockholm, Sweden; and tCenter for Biochemical and Biophysical Science and Medicine, Harvard Medical School, 250 Longwood Avenue, Boston, MA 02115 Contributed by Bengt Samuelsson, May 13, 1992 ABSTRACT The metal-binding motif in the sequence of lase (9, 10). Accordingly, LTA4 hydrolase was found to leukotriene A4 (LTA4) (EC 3.3.2.6), a bifunctional zinc metal- contain one atom of zinc per enzyme molecule (11-13) and loenzyme, contains a glutamic acid that is conserved in several also to exhibit peptidase activity toward synthetic substrates zinc hydrolases. To study its role for the two catalytic activities, (12-14). The primary function of the metal seems to be Glu-296 in mouse leukotriene A4 hydrolase was replaced by a catalytic because removal of the zinc atom resulted in loss of glutamine or alanine residue by site-directed mutagenesis. Wild- both enzymatic activities, which could be restored by addi- type and mutated cDNAs were expressed four or five times in tion of stoichiometric amounts of zinc or cobalt (11, 13, 14). Escherichia coli, and the resulting proteins were purified to In agreement with the sequence predictions, the three zinc- apparent homogeneity. With respect to their epoxide hydrolase binding ligands were identified as His-295 (L1), His-299 (L2), activities-i.e., the conversion ofLTA4 into leukotriene B4-the and Glu-318 (L3) by site-directed mutagenesis and zinc anal- mutated enzymes [Gln296]LTA4 hydrolase and [Ala296]LTA4 ysis (15). hydrolase exhibited specific activities of 1070 ± 160 and 90 ± 30 Besides the three amino acids involved in zinc coordina- nmol of LTB4 per mg of protein per min (mean + SD; n = 4 or tion, some of the zinc proteases and aminopeptidases, in- 5), respectively, corresponding to 150% and 15% of unmutated cluding LTA4 hydrolase, also share a conserved glutamic enzyme. In contrast, when the mutated proteins were assayed acid residue in juxtaposition to one (L1) of the primary for peptidase activity toward alanine-4-nitroanilide, they were zinc-binding ligands (ref. 10; Fig. 1). From x-ray crystallo- found to be virtually inactive (c0.2% ofunmutated enzyme). To graphic data, Glu-143 in thermolysin, a typical example of serve as a positive control, we also replaced Ser-298 with an such zinc hydrolases, has been implicated in the proteolytic alanine residue, which resulted in a protein ([Ala]LTA4 mechanism of this enzyme (16, 17). In the present study, we hydrolase) with catalytic properties almost indistnguishable replaced Glu-296, the corresponding amino acid in LTA4 from the wild-type enzyme. Substitution of Glu-296 by gluta- hydrolase, with a glutamine or alanine residue, purified the mine or alanine was also carried out with human LTA4 hydro- mutated proteins, and studied the effects of these mutations lase, and the mutated human enzymes displayed specific activ. on the enzyme activities. ities similar to the corresponding mouse proteins. Zinc analyses of the purified mouse and human proteins confirmed that the MATERIALS AND METHODS mutations did not significantly influence their zinc content. In conclusion, the results of the present study indicate a direct LTA4 methyl ester (Merck Frosst Labs, Pointe Claire, PQ, catalytic role for Glu-296 in the peptidase reaction of LTA4 Canada) was saponified in tetrahydrofuran with 1 M LiOH hydrolase, where it presumably acts as a base to polarize water, (6% vol/vol) for 48 hr at 4°C. Alanine-, leucine-, lysine-, whereas its function, if any, is apparently not essential in the valine-, methionine-, proline-, glycine-, and y-glutamyl-4- epoxide hydrolase reaction. nitroanilide were from Sigma. 4-Nitroaniline was from Merck. T7 sequencing kit, restriction endonucleases, and Leukotriene A4 (LTA4) hydrolase (EC 3.3.2.6) is a key nucleic acid-modifying enzymes were purchased from Phar- enzyme in the biosynthesis of leukotrienes and catalyzes the macia. Vent DNA polymerase was from New England Bio- hydrolysis of the unstable epoxide LTA4 [5(S)-trans-5,6- labs. Oligonucleotides were synthesized by Scandinavian oxido-7,9-trans-11,14-cis-eicosatetraenoic acid] into the Gene Synthesis (Koping, Sweden). proinflammatory substance leukotriene B4 [LTB4; 5(S), Site-Directed Mutagenesis of LTA4 Hydrolase cDNA and 12(R)-dihydroxy-6,14-cis-8,10-trans-eicosatetraenoic acid] Expression in Escherichia coli. Mutations of recombinant (1). The formation ofLTA4 is in turn catalyzed by the enzyme mouse LTA4 hydrolase (a fusion protein with 10 additional 5-lipoxygenase and involves the dioxygenation of arachi- amino acids at its N terminus; see ref. 8) were carried out by donic acid with subsequent epoxide formation. PCR mutagenesis as described (15). Primers A and B were LTA4 hydrolase has been purified from a variety of sources JF21 and JF27 (15). Primer C, the mutagenetic primer (5' -* as a soluble, monomeric protein of Mr 69 kDa (for reviews, 3', site mutation underlined), was one of the following: JF26 see refs. 2 and 3). The enzyme is inactivated by the substrate [d(CAAATATCTCATAGCTGGACAGG)] for [Gln296]LTA4 LTA4, an effect that seems directly coupled to the enzyme hydrolase, which for simplicity we call E296Q in single letter catalysis (4). The cDNAs coding for the human and mouse code for the Glu-296 -+ Gln amino acid change); JF36 enzymes have been cloned, sequenced, and expressed in [d(GCAATATCTCATAGCTGGACAGG)] for [Ala296]LTA4 Escherichia coli (5-8). hydrolase, which we call E296A for the Glu-296 -- Ala amino Recently, sequence comparisons with certain zinc metal- loenzymes-e.g., thermolysin and aminopeptidase M-re- Abbreviations: LTA4, leukotriene A4, 5(S)-trans-5,6-oxido-7,9-trans- vealed the presence of a zinc-binding motif in LTA4 hydro- 11,14-cis-eicosatetraenoic acid; LTB4, leukotriene B4, 5(S),12(R)- dihydroxy-6,14-cis-8,10-trans-eicosatetraenoic acid; PGB1, pros- taglandin B1; RT, room temperature; E296Q, [Gln296]LTA4 hydrolase; The publication costs of this article were defrayed in part by page charge hE296Q, human E296Q; E296A, [Ala29]LTA4 hydrolase; hE296A, payment. This article must therefore be hereby marked "advertisement" human E296A; S298A, [Ala2%]LTA4 hydrolase; H295Y, [Tyr295]- in accordance with 18 U.S.C. §1734 solely to indicate this fact. LTA4 hydrolase. 9141 Downloaded by guest on September 24, 2021 9142 Biochemistry: Wetterholm et al. Proc. Natl. Acad. Sci. USA 89 (1992) Li L2 L3 Thermolysin V V A H E L T H A V T G A I N E A I S D 142 146 166 Leukotriene A4 hydrolase V I A H E i S H S W T F W L N E G H T V 295 299 318 Aminopeptidase M V I A H E L A H Q W F L W L N E G F A S 388 392 411 Neutral endopeptidase V I G H E I T H G F D N T L G E N I A D 583 587 646 FIG. 1. Comparison of the zinc binding regions of thermolysin and LTA4 hydrolase, with the proposed zinc sites of neutral endopeptidase and aminopeptidase M. Adapted from ref. 10. acid change; and JF39 [d(GAAATAGCTCATAGCTGGA- of acetonitrile/methanol/water/acetic acid, 29:34:39:0.01 CAGG)] for [AlaW]LTA4 hydrolase, which we call S298A for (vol/vol), at a flow rate of0.8 ml/min. The absorbance ofthe the Ser-298 -* Ala amino acid change-all phosphorylated at eluate was monitored continuously at 270 nm. Quantitations their 5' end. of LTB4 were made by measurements of peak height ratios Primer D was JF13 [d(AATCAGCAACAATCAGT- between LTB4 and PGB1 as described (20). TCCT)], a reverse primer matching nucleotides 1856-1836 The specific peptidase activities were determined spectro- (according to the cDNA numbering in ref. 8). E296Q was also photometrically essentially as described (21) in 50 mM Tris constructed with JF24 [d(GATGCATGCTGGCTTTATGC)] chloride (pH 7.5) containing 100 mM NaCI. The assays were as primer D, which yields an isoform of the enzyme with a performed in the wells of a microtiterplate by incubating the lysine instead of an arginine residue in position 592 ([Gln29 , enzyme (1-26 pug) with 1 mM alanine4-nitroanilide in 250 !tl Lys592]LTA4 hydrolase) (8). For the construction of [Tyr295]- buffer at RT. The formation of product (4-nitroaniline) was LTA4 hydrolase, which we call H295Y for the His-295 -+ Tyr measured as the increase in absorbance at 405 nm by using a change, see ref. 15. Mutagenesis of human LTA4 hydrolase multiscan spectrophotometer, MCC/340 (Labsystems, Hel- was performed as described by Taylor et al. (18), using the sinki). Quantitations were made from a standard curve ob- oligonucleotides (5' -- 3', mutated bases underlined): d(AT- tained with known amounts of 4-nitroaniline in 50 mM Tris GAGATATTTGATGTGCAAT) for human E296Q (hE296Q) chloride (pH 8). Spontaneous hydrolysis ofthe substrate was and d(ATGAGATATTQCATGTGCAAT) for human E296A corrected for by subtracting the absorbance of control incu- (hE296A). Mutated proteins were expressed in E. coli (JM bations without enzyme. Reaction rates were calculated from 101) transformed with the corresponding mutated plasmid, as the increase in A405 over the first 20 min (unmutated enzymes described (15). Sequence analysis of the entire cDNA inserts and S298A) or 4-5 hr (E2%Q, E2%A, H295Y, hE296Q, and confirmed that no alterations of the protein primary struc- hE296A) of incubation. tures, other than the desired mutations, had occurred. Zinc Analyses. Prior to zinc analyses, the proteins were Purification ofRecombinant LTA4 Hydrolase.
Load more

Recommended publications
  • Insights Into the Molecular Basis for Substrate Binding and Specificity of the Wild-Type L-Arginine/Agmatine Antiporter Adic
    Insights into the molecular basis for substrate binding and specificity of the wild-type L-arginine/agmatine antiporter AdiC Hüseyin Ilgüa,b,1, Jean-Marc Jeckelmanna,b,1, Vytautas Gapsysc, Zöhre Ucuruma,b, Bert L. de Grootc, and Dimitrios Fotiadisa,b,2 aInstitute of Biochemistry and Molecular Medicine, University of Bern, CH-3012 Bern, Switzerland; bSwiss National Centre of Competence in Research TransCure, University of Bern, CH-3012 Bern, Switzerland; and cComputational Biomolecular Dynamics Group, Max-Planck-Institute for Biophysical Chemistry, D-37077 Goettingen, Germany Edited by Christopher Miller, Howard Hughes Medical Institute, Brandeis University, Waltham, MA, and approved July 26, 2016 (received for review April 4, 2016) Pathogenic enterobacteria need to survive the extreme acidity of Arg-bound states (10). The two outward-open, substrate-free the stomach to successfully colonize the human gut. Enteric bacteria structures are at the reasonable and moderate resolutions of 3.2 Å circumvent the gastric acid barrier by activating extreme acid- (8) and 3.6 Å (9), respectively, and the only ones available of wild- resistance responses, such as the arginine-dependent acid resistance type AdiC (AdiC-wt). The two other structures are with bound system. In this response, L-arginine is decarboxylated to agmatine, Arg and at 3-Å resolution, and could only be obtained as a result thereby consuming one proton from the cytoplasm. In Escherichia of the introduction of specific point mutations: AdiC-N22A (10) coli,theL-arginine/agmatine antiporter AdiC facilitates the export and AdiC-N101A (11). The N101A mutation results in a defective of agmatine in exchange of L-arginine, thus providing substrates for AdiC protein unable to bind Arg and with a dramatically de- further removal of protons from the cytoplasm and balancing the creased turnover rate compared with wild-type (11).
    [Show full text]
  • Separation of Isomers <Emphasis Type="Italic">L </Emphasis>-Alanine and Sarcosine in Urine by Electrospra
    SHORT COMMUNICATION Separation of Isomers L-Alanine and Sarcosine in Urine by Electrospray Ionization and Tandem Differential Mobility Analysis-Mass Spectrometry Pablo Martínez-Lozanoa and Juan Rusb a Institute for Biomedical Technologies-National Research Council, Milan, Italy b SEADM, Valladolid, Spain Sarcosine, an isomer of L-alanine, has been proposed as a prostate cancer progression biomarker [1]. Both compounds are detected in urine, where the measured sarcosine/alanine ratio has been found to be higher in prostate biopsy-positive group versus controls. We present here preliminary evidence showing that urine samples spiked with sarcosine/alanine can be partially resolved in 3 min via tandem differential mobility analysis-mass spectrometry (DMA-MS). Based on the calibration curves obtained for two mobility peaks, we finally estimate their concentration ratio in urine. (J Am Soc Mass Spectrom 2010, 21, 1129–1132) © 2010 American Society for Mass Spectrometry rostate cancer is a leading cause of death among the tive-ion mode at the DMA entrance slit. Our nanospray male population. Sarcosine, an isomer of alanine, parameters were: capillary 360 ␮m o.d., 50 ␮m i.d., length Pwas recently proposed as a prostate cancer progres- 22 cm, driving pressure 75 mbar, and 3.8 kV. The ions sion biomarker [1]. In particular, the sarcosine/alanine entered the separation region propelled by an electric field ratio was found to be significantly higher in urine derived and against a counterflow gas (0.2 L/min). Sheath gas from biopsy-positive prostate cancer patients compared flow was kept constant, and the classification voltage was with biopsy-negative controls.
    [Show full text]
  • Beta Alanine
    PERFORMANCE ENHANCERS FACTS AND BOTTOM LINE BETA ALANINE What is it? B-alanine is a naturally occurring amino acid (a non-essential amino acid) not used by the body to make muscle tissue. Rather, research has shown that B-alanine works by increasing the muscle content of an important compound – carnosine. In fact, the production of carnosine is limited by the availability of B-alanine. Carnosine is highly concentrated in muscle tissue where its role is primarily to soak up hydrogen ions. Does it work? B-alanine is one of the few dietary supplements that actually have good scientific evidence that it can possibly enhance performance. How does it work? When you exercise intensely the body produces hydrogen ions. The longer you exercise the more hydrogen ions you produce and this reduces the pH level in your muscles. Muscles work best in a very specific pH range and when the pH drops below that level then muscular performance also starts to decrease. Anything that helps to prevent or delay that drop in pH will help delay muscle fatigue. This is where B-alanine has proven to be very helpful. Beta-alanine increases the levels of carnosine in your slow and fast twitch muscle fibers and carnosine is a buffer that basically soaks up hydrogen ions and so reduces the drop in pH. By keeping your hydrogen ion levels lower, B-alanine allows you to train harder and longer. The bottom line is that B-alanine works by increasing the hydrogen ion buffering abilities of your muscles. What benefits does it offer? B-alanine has been shown to increase muscle strength, increase muscle mass, increase anaerobic endurance, increase aerobic endurance and increase exercise capacity.
    [Show full text]
  • Poly(L-Alanine) As a Universal Reference Material for Understanding Protein Energies and Structures TERESA HEAD-GORDON, FRANK H
    Proc. Nati. Acad. Sci. USA Vol. 89, pp. 11513-11517, December 1992 Biophysics Poly(L-alanine) as a universal reference material for understanding protein energies and structures TERESA HEAD-GORDON, FRANK H. STILLINGER, MARGARET H. WRIGHT, AND DAVID M. GAY AT&T Bell Laboratories, Murray Hill, NJ 07974 Contributed by Frank H. Stillinger, June 17, 1992 ABSTRACT We present a proposition, the "poly(L- alanine) hypothesis," which asserts that the native backbone geometry for any polypeptide or protein of M residues has a closely mimicking, mechanically stable, image in poly(L- POLY-L-ALANINE alanine) of the same number of residues. Using a molecular co mechanics force field to represent the relevant potential energy a: hypersurfaces, we have carried out calculations over a wide z range of M values to show that poly(L-alanine) possesses the w structural versatility necessary to satisfy the proposition. These w include poly(L-alanine) representatives of minima correspond- U- ing to secondary and supersecondary structures, as well as PROTEIN poly(L-alanine) images for tertiary structures of the naturally occurring proteins bovine pancreatic trypsin inhibitor, crambin, ribonuclease A, and superoxide dismutase. The suc- cessful validation of the hypothesis presented in this paper BACKBONE COORDINATES indicates that poly(L-alanine) will serve as a good reference FIG. 1. Topographic basis ofthe poly(L-alanine) hypothesis. Free material in thermodynamic perturbation theory and calcula- energy hypersurfaces are compared for a given protein and for tions aimed at evaluating relative free energies for competing poly(L-alanine) with the same number of residues. candidate tertiary structures in real polypeptides and proteins.
    [Show full text]
  • Alcohol Use Disorder
    Section: A B C D E Resources References Alcohol Use Disorder (AUD) Tool This tool is designed to support primary care providers (family physicians and primary care nurse practitioners) in screening, diagnosing and implementing pharmacotherapy treatments for adult patients (>18 years) with Alcohol Use Disorder (AUD). Primary care providers should routinely offer medication for moderate and severe AUD. Pharmacotherapy alone to treat AUD is better than no therapy at all.1 Pharmacotherapy is most effective when combined with non-pharmacotherapy, including behavioural therapy, community reinforcement, motivational enhancement, counselling and/or support groups. 2,3 TABLE OF CONTENTS pg. 1 Section A: Screening for AUD pg. 7 Section D: Non-Pharmacotherapy Options pg. 4 Section B: Diagnosing AUD pg. 8 Section E: Alcohol Withdrawal pg. 5 Section C: Pharmacotherapy Options pg. 9 Resources SECTION A: Screening for AUD All patients should be screened routinely (e.g. annually or when indicators are observed) with a recommended tool like the AUDIT. 2,3 It is important to screen all patients and not just patients eliciting an index of suspicion for AUD, since most persons with AUD are not recognized. 4 Consider screening for AUD when any of the following indicators are observed: • After a recent motor vehicle accident • High blood pressure • Liver disease • Frequent work avoidance (off work slips) • Cardiac arrhythmia • Chronic pain • Rosacea • Insomnia • Social problems • Rhinophyma • Exacerbation of sleep apnea • Legal problems Special Patient Populations A few studies have reviewed AUD in specific patient populations, including youth, older adults and pregnant or breastfeeding patients. The AUDIT screening tool considered these populations in determining the sensitivity of the tool.
    [Show full text]
  • A Review of Dietary (Phyto)Nutrients for Glutathione Support
    nutrients Review A Review of Dietary (Phyto)Nutrients for Glutathione Support Deanna M. Minich 1,* and Benjamin I. Brown 2 1 Human Nutrition and Functional Medicine Graduate Program, University of Western States, 2900 NE 132nd Ave, Portland, OR 97230, USA 2 BCNH College of Nutrition and Health, 116–118 Finchley Road, London NW3 5HT, UK * Correspondence: [email protected] Received: 8 July 2019; Accepted: 23 August 2019; Published: 3 September 2019 Abstract: Glutathione is a tripeptide that plays a pivotal role in critical physiological processes resulting in effects relevant to diverse disease pathophysiology such as maintenance of redox balance, reduction of oxidative stress, enhancement of metabolic detoxification, and regulation of immune system function. The diverse roles of glutathione in physiology are relevant to a considerable body of evidence suggesting that glutathione status may be an important biomarker and treatment target in various chronic, age-related diseases. Yet, proper personalized balance in the individual is key as well as a better understanding of antioxidants and redox balance. Optimizing glutathione levels has been proposed as a strategy for health promotion and disease prevention, although clear, causal relationships between glutathione status and disease risk or treatment remain to be clarified. Nonetheless, human clinical research suggests that nutritional interventions, including amino acids, vitamins, minerals, phytochemicals, and foods can have important effects on circulating glutathione which may translate to clinical benefit. Importantly, genetic variation is a modifier of glutathione status and influences response to nutritional factors that impact glutathione levels. This narrative review explores clinical evidence for nutritional strategies that could be used to improve glutathione status.
    [Show full text]
  • Amino Acid Chemistry
    Handout 4 Amino Acid and Protein Chemistry ANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES Amino Acid Chemistry I. Chemistry of amino acids A. General amino acid structure + HN3- 1. All amino acids are carboxylic acids, i.e., they have a –COOH group at the #1 carbon. 2. All amino acids contain an amino group at the #2 carbon (may amino acids have a second amino group). 3. All amino acids are zwitterions – they contain both positive and negative charges at physiological pH. II. Essential and nonessential amino acids A. Nonessential amino acids: can make the carbon skeleton 1. From glycolysis. 2. From the TCA cycle. B. Nonessential if it can be made from an essential amino acid. 1. Amino acid "sparing". 2. May still be essential under some conditions. C. Essential amino acids 1. Branched chain amino acids (isoleucine, leucine and valine) 2. Lysine 3. Methionine 4. Phenyalanine 5. Threonine 6. Tryptophan 1 Handout 4 Amino Acid and Protein Chemistry D. Essential during rapid growth or for optimal health 1. Arginine 2. Histidine E. Nonessential amino acids 1. Alanine (from pyruvate) 2. Aspartate, asparagine (from oxaloacetate) 3. Cysteine (from serine and methionine) 4. Glutamate, glutamine (from α-ketoglutarate) 5. Glycine (from serine) 6. Proline (from glutamate) 7. Serine (from 3-phosphoglycerate) 8. Tyrosine (from phenylalanine) E. Nonessential and not required for protein synthesis 1. Hydroxyproline (made postranslationally from proline) 2. Hydroxylysine (made postranslationally from lysine) III. Acidic, basic, polar, and hydrophobic amino acids A. Acidic amino acids: amino acids that can donate a hydrogen ion (proton) and thereby decrease pH in an aqueous solution 1.
    [Show full text]
  • L -Glutamic Acid (G1251)
    L-Glutamic acid Product Number G 1251 Store at Room Temperature Product Description Precautions and Disclaimer Molecular Formula: C5H9NO4 For Laboratory Use Only. Not for drug, household or Molecular Weight: 147.1 other uses. CAS Number: 56-86-0 pI: 3.081 Preparation Instructions 1 pKa: 2.10 (α-COOH), 9.47 (α-NH2), 4.07 (ϕ-COOH) This product is soluble in 1 M HCl (100 mg/ml), with 2 Specific Rotation: D +31.4 ° (6 N HCl, 22.4 °C) heat as needed, yielding a clear, colorless solution. Synonyms: (S)-2-aminoglutaric acid, (S)-2- The solubility in water at 25 °C has been reported to aminopentanedioic acid, 1-aminopropane-1,3- be 8.6 mg/ml.2 dicarboxylic acid, Glu2 Storage/Stability L-Glutamic acid is one of the two amino acids that Aqueous glutamic acid solutions will form contains a carboxylic acid group in its side chains. pyrrolidonecarboxylic acid slowly at room temperature Glutamic acid is commonly referred to as "glutamate", and more rapidly at 100 °C.9 because its carboxylic acid side chain will be deprotonated and thus negatively charged in its References anionic form at physiological pH. In amino acid 1. Molecular Biology LabFax, Brown, T. A., ed., BIOS metabolism, glutamate is formed from the transfer of Scientific Publishers Ltd. (Oxford, UK: 1991), p. amino groups from amino acids to α-ketoglutarate. It 29. thus acts as an intermediary between ammonia and 2. The Merck Index, 12th ed., Entry# 4477. the amino acids in vivo. Glutamate is converted to 3. Biochemistry, 3rd ed., Stryer, L., W.
    [Show full text]
  • Solutions to 7.012 Problem Set 1
    MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Solutions to 7.012 Problem Set 1 Question 1 Bob, a student taking 7.012, looks at a long-standing puddle outside his dorm window. Curious as to what was growing in the cloudy water, he takes a sample to his TA, Brad Student. He wanted to know whether the organisms in the sample were prokaryotic or eukaryotic. a) Give an example of a prokaryotic and a eukaryotic organism. Prokaryotic: Eukaryotic: All bacteria Yeast, fungi, any animial or plant b) Using a light microscope, how could he tell the difference between a prokaryotic organism and a eukaryotic one? The resolution of the light microscope would allow you to see if the cell had a true nucleus or organelles. A cell with a true nucleus and organelles would be eukaryotic. You could also determine size, but that may not be sufficient to establish whether a cell is prokaryotic or eukaryotic. c) What additional differences exist between prokaryotic and eukaryotic organisms? Any answer from above also fine here. In addition, prokaryotic and eukaryotic organisms differ at the DNA level. Eukaryotes have more complex genomes than prokaryotes do. Question 2 A new startup company hires you to help with their product development. Your task is to find a protein that interacts with a polysaccharide. a) You find a large protein that has a single binding site for the polysaccharide cellulose. Which amino acids might you expect to find in the binding pocket of the protein? What is the strongest type of interaction possible between these amino acids and the cellulose? Cellulose is a polymer of glucose and as such has many free hydroxyl groups.
    [Show full text]
  • Proline- and Alanine-Rich N-Terminal Extension of the Basic Bovine P-Crystallin B1 Chains
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Volume 161, number 2 FEBS 0790 September 1983 Proline- and alanine-rich N-terminal extension of the basic bovine P-crystallin B1 chains G.A.M. Berbers, W.A. Hoekman, H. Bloemendal, W.W. de Jong, T. Kleinschmidt* and G. Braunitzer* Laboratorium voor Biochemie, Universiteit van Nijmegen, Geert Grooteplein Noord 21, 6525 EZ Nijmegen, The Netherlands and *Max-Planck-Institut ft’ir Biochemie, Abteilung Proteinchemie, D-8033 Martinsried bei Miinchen, FRG Received 22 June 1983 The amino acid sequence of the N-terminal region of the two basic bovine &crystallin B1 chains has been analyzed. The results reveal that @Bibis derived in vivo from the primary gene product @la by removal of a short N-terminal sequence. It appears that them1 chains have the same domain structure as observed in other /3- and y-crystallin chains. They have, however, a very long N-terminal extension in comparison with other &chains. This extension is mainly composed of a remarkable Pro- and Ala-rich sequence, which suggests an interaction of these structural proteins with the cytoskeleton and/or the plasma membranes of the lens cells. Protein sequence Bovine &crystallin N-terminal extension Proline- and aianine-rich Domain structure 1. INTRODUCTION 33 000 and 31000, respectively, are characteristic for fltikt, [ 111. ,8Fha is a primary gene product, from The crystallins are evolutionary highly conserv- which ,8&b arises by post-translational modifica- ed structural eye lens proteins, which can be divid; tion [lo-121, most probably a proteolytic step ed into 4 classes: (Y-,,&, y- and t-crystallin [ 11.
    [Show full text]
  • The Efficacy and Safety of Six-Weeks of Pre-Workout Supplementation in Resistance Trained Rats
    W&M ScholarWorks Undergraduate Honors Theses Theses, Dissertations, & Master Projects 4-2017 The Efficacy and Safety of Six-Weeks of Pre-Workout Supplementation in Resistance Trained Rats Justin P. Canakis College of William and Mary Follow this and additional works at: https://scholarworks.wm.edu/honorstheses Part of the Animal Sciences Commons, Exercise Science Commons, Laboratory and Basic Science Research Commons, and the Other Nutrition Commons Recommended Citation Canakis, Justin P., "The Efficacy and Safety of Six-Weeks of Pre-Workout Supplementation in Resistance Trained Rats" (2017). Undergraduate Honors Theses. Paper 1128. https://scholarworks.wm.edu/honorstheses/1128 This Honors Thesis is brought to you for free and open access by the Theses, Dissertations, & Master Projects at W&M ScholarWorks. It has been accepted for inclusion in Undergraduate Honors Theses by an authorized administrator of W&M ScholarWorks. For more information, please contact [email protected]. 1 2 Title Page……………………………………………………………………………………...…..1 Abstract…………………………………………………………………………………………....5 Acknowledgement……………………………………………………………………….………..6 Background.………………………………………………………………………..……………...7 DSEHA and its Effect on the VMS Industry………………...……………………………7 History of Adverse Side Effects from Pre-Workout Supplements ………….……………8 Ingredient Analysis ………………………………………..……………….……………..……....9 2.5g Beta-Alanine…………………………..……………………………………………..9 1g Creatine Nitrate……………………………...……………………………………..…12 500mg L-Leucine……………………………………………………………………...…16 500mg Agmatine Sulfate……………………….………………………………..………18
    [Show full text]
  • Nucleotide Base Coding and Am1ino Acid Replacemients in Proteins* by Emil L
    VOL. 48, 1962 BIOCHEMISTRY: E. L. SAIITH 677 18 Britten, R. J., and R. B. Roberts, Science, 131, 32 (1960). '9 Crestfield, A. M., K. C. Smith, and F. WV. Allen, J. Biol. Chem., 216, 185 (1955). 20 Gamow, G., Nature, 173, 318 (1954). 21 Brenner, S., these PROCEEDINGS, 43, 687 (1957). 22 Nirenberg, M. WV., J. H. Matthaei, and 0. WV. Jones, unpublished data. 23 Crick, F. H. C., L. Barnett, S. Brenner, and R. J. Watts-Tobin, Nature, 192, 1227 (1961). 24 Levene, P. A., and R. S. Tipson, J. Biol. Ch-nn., 111, 313 (1935). 25 Gierer, A., and K. W. Mundry, Nature, 182, 1437 (1958). 2' Tsugita, A., and H. Fraenkel-Conrat, J. Mllot. Biol., in press. 27 Tsugita, A., and H. Fraenkel-Conrat, personal communication. 28 Wittmann, H. G., Naturwissenschaften, 48, 729 (1961). 29 Freese, E., in Structure and Function of Genetic Elements, Brookhaven Symposia in Biology, no. 12 (1959), p. 63. NUCLEOTIDE BASE CODING AND AM1INO ACID REPLACEMIENTS IN PROTEINS* BY EMIL L. SMITHt LABORATORY FOR STUDY OF HEREDITARY AND METABOLIC DISORDERS AND THE DEPARTMENTS OF BIOLOGICAL CHEMISTRY AND MEDICINE, UNIVERSITY OF UTAH COLLEGE OF MEDICINE Communicated by Severo Ochoa, February 14, 1962 The problem of which bases of messenger or template RNA' specify the coding of amino acids in proteins has been largely elucidated by the use of synthetic polyri- bonucleotides.2-7 For these triplet nucleotide compositions (Table 1), it is of in- terest to examine some of the presently known cases of amino acid substitutions in polypeptides or proteins of known structure.
    [Show full text]