Proc. Nati. Acad. Sci. USA Vol. 89, pp. 9141-9145, October 1992 Biochemistry Leukotriene A4 hydrolase: Abrogation of the peptidase activity by mutation of glutamic acid-296 ANDERS WETTERHOLM*, JUAN F. MEDINA*, OLOF RXDMARK*, ROBERT SHAPIROt, JESPER Z. HAEGGSTR6M*, BERT L. VALLEEt, AND BENGT SAMUELSSON* *Department of Physiological Chemistry, Karolinska Institutet, Box 60 400, S-104 01 Stockholm, Sweden; and tCenter for Biochemical and Biophysical Science and Medicine, Harvard Medical School, 250 Longwood Avenue, Boston, MA 02115 Contributed by Bengt Samuelsson, May 13, 1992 ABSTRACT The metal-binding motif in the sequence of lase (9, 10). Accordingly, LTA4 hydrolase was found to leukotriene A4 (LTA4) (EC 3.3.2.6), a bifunctional zinc metal- contain one atom of zinc per enzyme molecule (11-13) and loenzyme, contains a glutamic acid that is conserved in several also to exhibit peptidase activity toward synthetic substrates zinc hydrolases. To study its role for the two catalytic activities, (12-14). The primary function of the metal seems to be Glu-296 in mouse leukotriene A4 hydrolase was replaced by a catalytic because removal of the zinc atom resulted in loss of glutamine or alanine residue by site-directed mutagenesis. Wild- both enzymatic activities, which could be restored by addi- type and mutated cDNAs were expressed four or five times in tion of stoichiometric amounts of zinc or cobalt (11, 13, 14). Escherichia coli, and the resulting proteins were purified to In agreement with the sequence predictions, the three zinc- apparent homogeneity. With respect to their epoxide hydrolase binding ligands were identified as His-295 (L1), His-299 (L2), activities-i.e., the conversion ofLTA4 into leukotriene B4-the and Glu-318 (L3) by site-directed mutagenesis and zinc anal- mutated enzymes [Gln296]LTA4 hydrolase and [Ala296]LTA4 ysis (15). hydrolase exhibited specific activities of 1070 ± 160 and 90 ± 30 Besides the three amino acids involved in zinc coordina- nmol of LTB4 per mg of protein per min (mean + SD; n = 4 or tion, some of the zinc proteases and aminopeptidases, in- 5), respectively, corresponding to 150% and 15% of unmutated cluding LTA4 hydrolase, also share a conserved glutamic enzyme. In contrast, when the mutated proteins were assayed acid residue in juxtaposition to one (L1) of the primary for peptidase activity toward alanine-4-nitroanilide, they were zinc-binding ligands (ref. 10; Fig. 1). From x-ray crystallo- found to be virtually inactive (c0.2% ofunmutated enzyme). To graphic data, Glu-143 in thermolysin, a typical example of serve as a positive control, we also replaced Ser-298 with an such zinc hydrolases, has been implicated in the proteolytic alanine residue, which resulted in a protein ([Ala]LTA4 mechanism of this enzyme (16, 17). In the present study, we hydrolase) with catalytic properties almost indistnguishable replaced Glu-296, the corresponding amino acid in LTA4 from the wild-type enzyme. Substitution of Glu-296 by gluta- hydrolase, with a glutamine or alanine residue, purified the mine or alanine was also carried out with human LTA4 hydro- mutated proteins, and studied the effects of these mutations lase, and the mutated human enzymes displayed specific activ. on the enzyme activities. ities similar to the corresponding mouse proteins. Zinc analyses of the purified mouse and human proteins confirmed that the MATERIALS AND METHODS mutations did not significantly influence their zinc content. In conclusion, the results of the present study indicate a direct LTA4 methyl ester (Merck Frosst Labs, Pointe Claire, PQ, catalytic role for Glu-296 in the peptidase reaction of LTA4 Canada) was saponified in tetrahydrofuran with 1 M LiOH hydrolase, where it presumably acts as a base to polarize water, (6% vol/vol) for 48 hr at 4°C. Alanine-, leucine-, lysine-, whereas its function, if any, is apparently not essential in the valine-, methionine-, proline-, glycine-, and y-glutamyl-4- epoxide hydrolase reaction. nitroanilide were from Sigma. 4-Nitroaniline was from Merck. T7 sequencing kit, restriction endonucleases, and Leukotriene A4 (LTA4) hydrolase (EC 3.3.2.6) is a key nucleic acid-modifying enzymes were purchased from Phar- enzyme in the biosynthesis of leukotrienes and catalyzes the macia. Vent DNA polymerase was from New England Bio- hydrolysis of the unstable epoxide LTA4 [5(S)-trans-5,6- labs. Oligonucleotides were synthesized by Scandinavian oxido-7,9-trans-11,14-cis-eicosatetraenoic acid] into the Gene Synthesis (Koping, Sweden). proinflammatory substance leukotriene B4 [LTB4; 5(S), Site-Directed Mutagenesis of LTA4 Hydrolase cDNA and 12(R)-dihydroxy-6,14-cis-8,10-trans-eicosatetraenoic acid] Expression in Escherichia coli. Mutations of recombinant (1). The formation ofLTA4 is in turn catalyzed by the enzyme mouse LTA4 hydrolase (a fusion protein with 10 additional 5-lipoxygenase and involves the dioxygenation of arachi- amino acids at its N terminus; see ref. 8) were carried out by donic acid with subsequent epoxide formation. PCR mutagenesis as described (15). Primers A and B were LTA4 hydrolase has been purified from a variety of sources JF21 and JF27 (15). Primer C, the mutagenetic primer (5' -* as a soluble, monomeric protein of Mr 69 kDa (for reviews, 3', site mutation underlined), was one of the following: JF26 see refs. 2 and 3). The enzyme is inactivated by the substrate [d(CAAATATCTCATAGCTGGACAGG)] for [Gln296]LTA4 LTA4, an effect that seems directly coupled to the enzyme hydrolase, which for simplicity we call E296Q in single letter catalysis (4). The cDNAs coding for the human and mouse code for the Glu-296 -+ Gln amino acid change); JF36 enzymes have been cloned, sequenced, and expressed in [d(GCAATATCTCATAGCTGGACAGG)] for [Ala296]LTA4 Escherichia coli (5-8). hydrolase, which we call E296A for the Glu-296 -- Ala amino Recently, sequence comparisons with certain zinc metal- loenzymes-e.g., thermolysin and aminopeptidase M-re- Abbreviations: LTA4, leukotriene A4, 5(S)-trans-5,6-oxido-7,9-trans- vealed the presence of a zinc-binding motif in LTA4 hydro- 11,14-cis-eicosatetraenoic acid; LTB4, leukotriene B4, 5(S),12(R)- dihydroxy-6,14-cis-8,10-trans-eicosatetraenoic acid; PGB1, pros- taglandin B1; RT, room temperature; E296Q, [Gln296]LTA4 hydrolase; The publication costs of this article were defrayed in part by page charge hE296Q, human E296Q; E296A, [Ala29]LTA4 hydrolase; hE296A, payment. This article must therefore be hereby marked "advertisement" human E296A; S298A, [Ala2%]LTA4 hydrolase; H295Y, [Tyr295]- in accordance with 18 U.S.C. §1734 solely to indicate this fact. LTA4 hydrolase. 9141 Downloaded by guest on September 24, 2021 9142 Biochemistry: Wetterholm et al. Proc. Natl. Acad. Sci. USA 89 (1992) Li L2 L3 Thermolysin V V A H E L T H A V T G A I N E A I S D 142 146 166 Leukotriene A4 hydrolase V I A H E i S H S W T F W L N E G H T V 295 299 318 Aminopeptidase M V I A H E L A H Q W F L W L N E G F A S 388 392 411 Neutral endopeptidase V I G H E I T H G F D N T L G E N I A D 583 587 646 FIG. 1. Comparison of the zinc binding regions of thermolysin and LTA4 hydrolase, with the proposed zinc sites of neutral endopeptidase and aminopeptidase M. Adapted from ref. 10. acid change; and JF39 [d(GAAATAGCTCATAGCTGGA- of acetonitrile/methanol/water/acetic acid, 29:34:39:0.01 CAGG)] for [AlaW]LTA4 hydrolase, which we call S298A for (vol/vol), at a flow rate of0.8 ml/min. The absorbance ofthe the Ser-298 -* Ala amino acid change-all phosphorylated at eluate was monitored continuously at 270 nm. Quantitations their 5' end. of LTB4 were made by measurements of peak height ratios Primer D was JF13 [d(AATCAGCAACAATCAGT- between LTB4 and PGB1 as described (20). TCCT)], a reverse primer matching nucleotides 1856-1836 The specific peptidase activities were determined spectro- (according to the cDNA numbering in ref. 8). E296Q was also photometrically essentially as described (21) in 50 mM Tris constructed with JF24 [d(GATGCATGCTGGCTTTATGC)] chloride (pH 7.5) containing 100 mM NaCI. The assays were as primer D, which yields an isoform of the enzyme with a performed in the wells of a microtiterplate by incubating the lysine instead of an arginine residue in position 592 ([Gln29 , enzyme (1-26 pug) with 1 mM alanine4-nitroanilide in 250 !tl Lys592]LTA4 hydrolase) (8). For the construction of [Tyr295]- buffer at RT. The formation of product (4-nitroaniline) was LTA4 hydrolase, which we call H295Y for the His-295 -+ Tyr measured as the increase in absorbance at 405 nm by using a change, see ref. 15. Mutagenesis of human LTA4 hydrolase multiscan spectrophotometer, MCC/340 (Labsystems, Hel- was performed as described by Taylor et al. (18), using the sinki). Quantitations were made from a standard curve ob- oligonucleotides (5' -- 3', mutated bases underlined): d(AT- tained with known amounts of 4-nitroaniline in 50 mM Tris GAGATATTTGATGTGCAAT) for human E296Q (hE296Q) chloride (pH 8). Spontaneous hydrolysis ofthe substrate was and d(ATGAGATATTQCATGTGCAAT) for human E296A corrected for by subtracting the absorbance of control incu- (hE296A). Mutated proteins were expressed in E. coli (JM bations without enzyme. Reaction rates were calculated from 101) transformed with the corresponding mutated plasmid, as the increase in A405 over the first 20 min (unmutated enzymes described (15). Sequence analysis of the entire cDNA inserts and S298A) or 4-5 hr (E2%Q, E2%A, H295Y, hE296Q, and confirmed that no alterations of the protein primary struc- hE296A) of incubation. tures, other than the desired mutations, had occurred. Zinc Analyses. Prior to zinc analyses, the proteins were Purification ofRecombinant LTA4 Hydrolase.