DOCSLIB.ORG

(Boraginaceae) and Related Taxa Author(S): James Isaac Cohen, and Jerrold I Davis Source: Systematic Botany, 37(2):490-506

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(Boraginaceae) and Related Taxa Author(S): James Isaac Cohen, and Jerrold I Davis Source: Systematic Botany, 37(2):490-506 Molecular Phylogenetics, Molecular Evolution, and Patterns of Clade Support in Lithospermum (Boraginaceae) and Related Taxa Author(s): James Isaac Cohen, and Jerrold I Davis Source: Systematic Botany, 37(2):490-506. 2012. Published By: The American Society of Plant Taxonomists URL: http://www.bioone.org/doi/full/10.1600/03634412X635539 BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder. BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. Systematic Botany (2012), 37(2): pp. 490–506 © Copyright 2012 by the American Society of Plant Taxonomists DOI 10.1600/03634412X635539 Molecular Phylogenetics, Molecular Evolution, and Patterns of Clade Support in Lithospermum (Boraginaceae) and Related Taxa James Isaac Cohen,1,3 and Jerrold I Davis2 1Department of Biology and Chemistry, Texas A & M International University, 379E Lamar Bruni Vergara Science Center, 5201 University Boulevard, Laredo, Texas 78041, U. S. A. 2Department of Plant Biology, Cornell University, 412 Mann Library Building, Ithaca, New York 14853, U. S. A. 3Author for Correspondence ([email protected]) Communicating Editor: Jennifer Tate Abstract—Utilizing 10 cpDNA regions and thorough taxon sampling, a phylogeny is reconstructed for Lithospermum and related members of both Lithospermeae, the tribe to which it is assigned, and Boraginaceae. Lithospermum is supported as monophyletic, and the genus is hypothesized to have originated in the Old World, after which there was one colonization of the New World. The heterostylous breeding system is inferred to have originated within Lithospermum either seven times or six times with one loss, and with other independent origins within Lithospermeae. The stability of the 10-region matrix is investigated, as are the number and combination of regions necessary to accurately reconstruct phylogenies. The combination of concatenated regions is important, and the following regions are recommended for future phylogenetic studies of genera of Boraginaceae: the rpl16 intron, matK, psbA-trnH, trnL-rpl32, and trnQ-rps16. The use of these recommended regions is conservative, and it contrasts with most intrageneric studies of Boraginaceae, which often are based on the trnL-trnF spacer and nuclear ribosomal ITS. Keywords—Boraginaceae, cpDNA, heterostyly, Lithospermum, molecular evolution, sampling. Lithospermum L. (Boraginaceae) comprises approximately seven new genera of Lithospermeae. These efforts cul- 60 species. The genus has a cosmopolitan distribution, with a minated in revisions of both taxa (Johnston 1952, 1953a, b, center of diversity in the southwestern U. S. A. and Mexico, 1954a, b). In these publications, Johnston noted that all of the and with more than half of the species endemic to this region. genera endemic to the New World share a series of nutlet, In the present study, relationships and patterns of character pollen, and floral characters with Lithospermum (Johnston evolution are examined among species of Lithospermum and 1954a, b). Though he hypothesized various relationships their close relatives. Outgroups include representatives of among the genera of the tribe, these were not explicit phylo- more distantly related members of Boraginaceae, and pat- genetic hypotheses. terns of cpDNA evolution are examined within Lithospermum, Until recently, Johnston’s hypotheses remained untested. Lithospermeae, and Boraginaceae. In 2009, Cohen and Davis presented a phylogeny based Linnaeus (1753) described Lithospermum in Species Plantarum, on cpDNA sequence data, including representatives of and he included six species within it. This initial circumscrip- Lithospermum and five of the six genera of Lithospermeae tion encompassed species with smooth, white, lustrous, erect endemic to the New World. This phylogeny provided evi- nutlets, and this Lithospermum-type of nutlet consistently dence that all of these New World genera (Lasiarrhenum has been recognized as characterizing the genus. This has I. M. Johnst., Macromeria D. Don, Nomosa I. M. Johnst., remained the case even as the circumscription of the genus Onosmodium Michx., Perritostema I. M. Johnst., and Psilolaemus has changed, as has occurred frequently. Of the six species I. M. Johnst.) are nested among species of Lithospermum.In that Linnaeus recognized within Lithospermum, most were light of these inferred relationships, the authors included subsequently transferred to other genera, and until recently, all members of these endemic New World genera in only the type species remained in the genus (Cohen and Lithospermum. This inclusion increased the number of species Davis 2009). Since the mid 1700s, taxonomists have consid- in the genus by 18, bringing the total number to approximately erably broadened the circumscription of Lithospermum in three 60 (Cohen and Davis 2009). Two features diagnose this more principal stages. The first major change occurred in the treat- broadly defined Lithospermum: the Lithospermum-type nutlet, ment of Boraginaceae for the Prodromus (de Candolle 1846). and corollas that are not blue or purple (two colors occur in De Candolle described the state of Lithospermum 90 yr after closely related genera). In contrast, species of Lithospermum Linneaus’ original generic circumscription. De Candolle cir- produce corollas that are yellow, yellow-green, orange, or white. cumscribed Lithospermum broadly, and added many new spe- Weigend et al. (2009) also have reconstructed a phylogeny cies to the genus. He included species currently recognized as of Lithospermum and related taxa. Their phylogeny was not as part of Lithospermum as well as others now placed in other, fully resolved as that of Cohen and Davis (2009), and the two closely related genera, such as Buglossoides Moench. and phylogenies conflicted in some respects but both placed the Lithodora Griseb. De Candolle recognized species currently New World genera among species of Lithospermum. placed in Lithospermum through the inclusion of all of those Phylogenies have been reconstructed for only a small num- that were known at the time in the subgenus Eulithospermum ber of genera in Boraginaceae, including Lithodora (Thomas DC. (with the exception of L. chinensis Hook. & Arn., currently et al. 2008; Ferrero et al. 2009), Cerinthe L. (Selvi et al. 2009), a member of Heliotropium L. [Zhu et al. 1995]). Echium L. (Bo¨hle et al. 1996), Anchusa L. (Hilger et al. 2004), During the early to mid 20th century, Johnston (e.g. 1935, Myosotis L. (Winkworth et al. 2002), Lobostemon Lehm. (Buys 1952) studied and reevaluated the taxonomy of Boraginaceae. 2006), Echiochilon Desf. (La˚ngstro¨m and Oxelman 2003) and Throughout his career, Johnston studied Lithospermum and Nonea Medik. (Selvi et al. 2006), but a comprehensive phylog- the tribe to which it is assigned, Lithospermeae. He described eny of Boraginaceae does not exist at present. Difficulties, 35 new species of Lithospermum and described or segregated such as lack of overlap among the taxon samples of different 490 2012] COHEN AND DAVIS: MOLECULAR PHYLOGENETICS OF LITHOSPERMUM 491 studies, have impeded attempts to cobble together a phylog- primers of the cited authors. The only exception was a pair of primers eny of Boraginaceae; therefore, reevaluation of the taxonomy designed by the authors to amplify part of matK for some species of Lithospermum (matK-Lith2F 50 CACGAGTATTGGAATCCTTTTATT 30 of Boraginaceae above the genus-level is problematic, espe- and matK-Lith806R 50 TTGTGTTTCCGAGCCAAAGT 30). PCR mixtures, cially as the family includes many small genera (i.e. with 25 mL in volume, consisted of 67 mM Tris-HCl with 2.1% DMSO and fewer than five species). Through phylogenetic investigation 0.01% TritonX per reaction or 1 +Ex Taq Buffer (Takara Bio Inc., Japan), m m of larger genera, it has been determined that in addition to 2 mM MgCl2, 0.2 mM to 0.25 mM dNTPs, 1 M of primers, 0.125 Lto m m m Lithospermum, other genera, such as Nonea (Selvi et al. 2006), 1 LofTaq polymerase, and 0.1 L to 2.5 L DNA sample, depending on the DNA concentration. Amplifications were performed in an Eppendorf Cryptantha Lehm. ex G. Don (Hasenstab and Simpson 2008), Mastercycler Gradient 5331 thermocycler with the programs and anneal- and Cynoglossum L., are not monophyletic. Although the ing temperatures listed in Cohen and Davis (2009). The PCR products present study focuses on the phylogenetics of Lithospermum were separated on a 1% to 1.5% agarose gel and stained with ethidium and its closest relatives, the outgroup sampling allows for the bromide to determine whether amplification had occurred. Prior to sequenc- ing, some PCR products were purified with the QIAquick PCR purifica- examination of relationships among some of the more dis- tion kit
Load more

Recommended publications
  • Natural Heritage Program List of Rare Plant Species of North Carolina 2016
    Natural Heritage Program List of Rare Plant Species of North Carolina 2016 Revised February 24, 2017 Compiled by Laura Gadd Robinson, Botanist John T. Finnegan, Information Systems Manager North Carolina Natural Heritage Program N.C. Department of Natural and Cultural Resources Raleigh, NC 27699-1651 www.ncnhp.org C ur Alleghany rit Ashe Northampton Gates C uc Surry am k Stokes P d Rockingham Caswell Person Vance Warren a e P s n Hertford e qu Chowan r Granville q ot ui a Mountains Watauga Halifax m nk an Wilkes Yadkin s Mitchell Avery Forsyth Orange Guilford Franklin Bertie Alamance Durham Nash Yancey Alexander Madison Caldwell Davie Edgecombe Washington Tyrrell Iredell Martin Dare Burke Davidson Wake McDowell Randolph Chatham Wilson Buncombe Catawba Rowan Beaufort Haywood Pitt Swain Hyde Lee Lincoln Greene Rutherford Johnston Graham Henderson Jackson Cabarrus Montgomery Harnett Cleveland Wayne Polk Gaston Stanly Cherokee Macon Transylvania Lenoir Mecklenburg Moore Clay Pamlico Hoke Union d Cumberland Jones Anson on Sampson hm Duplin ic Craven Piedmont R nd tla Onslow Carteret co S Robeson Bladen Pender Sandhills Columbus New Hanover Tidewater Coastal Plain Brunswick THE COUNTIES AND PHYSIOGRAPHIC PROVINCES OF NORTH CAROLINA Natural Heritage Program List of Rare Plant Species of North Carolina 2016 Compiled by Laura Gadd Robinson, Botanist John T. Finnegan, Information Systems Manager North Carolina Natural Heritage Program N.C. Department of Natural and Cultural Resources Raleigh, NC 27699-1651 www.ncnhp.org This list is dynamic and is revised frequently as new data become available. New species are added to the list, and others are dropped from the list as appropriate.
    [Show full text]
  • And Related Taxa: Evolutionary Relationships and Character Evolution
    Cladistics Cladistics 27 (2011) 559–580 10.1111/j.1096-0031.2011.00352.x A phylogenetic analysis of morphological and molecular characters of Lithospermum L. (Boraginaceae) and related taxa: evolutionary relationships and character evolution James I. Cohen* Department of Biology and Chemistry, Texas A&M International University, LBVSC 379E, 5201 University Blvd, Laredo, TX 78041, USA Accepted 12 January 2011 Abstract Lithospermum (Boraginaceae) includes ca. 60 species and exhibits a wide range of floral, palynological, and vegetative diversity. Phylogenetic analyses based on 10 chloroplast DNA regions and 22 morphological characters were conducted in order to (i) examine evolutionary relationships within Lithospermum and among related genera of Boraginaceae, and (ii) investigate patterns of morphological evolution. Several morphological features, such as long-funnelform corollas, faucal appendages, reciprocal herkogamy, and evident secondary leaf venation, have evolved multiple times within the genus. In contrast, other morphological features, including the presence of glands and the position and number of pollen pores, are less plastic and tend to characterize larger clades. Some features, including the presence of glands, are interpreted as symplesiomorphic for Lithospermum, while others, such as evident secondary leaf venation, appear to have originated repeatedly. The range of structural diversity that occurs among the species of Lithospermum suggests the potential utility of this genus as a model for integrative studies of evolution, development, and molecular biology. Ó The Willi Hennig Society 2011. Lithospermum L., a genus in the family Boraginaceae, the other New World members of Lithospermeae, previ- comprises ca. 60 species, with a centre of diversity in ously placed in Lasiarrhenum I.M.
    [Show full text]
  • In Vitro Studies of Α-Glucosidase Inhibitors and Antiradical
    Food Chemistry 136 (2013) 1390–1398 Contents lists available at SciVerse ScienceDirect Food Chemistry journal homepage: www.elsevier.com/locate/foodchem In vitro studies of a-glucosidase inhibitors and antiradical constituents of Glandora diffusa (Lag.) D.C. Thomas infusion ⇑ Federico Ferreres a, , Juliana Vinholes b, Angel Gil-Izquierdo a, Patrícia Valentão b, ⇑ Rui F. Gonçalves b, Paula B. Andrade b, a Research Group on Quality, Safety and Bioactivity of Plant Foods, Department of Food Science and Technology, CEBAS (CSIC), P.O. Box 164, 30100 Campus University Espinardo, Murcia, Spain b REQUIMTE/Laboratório de Farmacognosia, Departamento de Química, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira, n.° 228, 4050-313 Porto, Portugal article info abstract Article history: Glandora diffusa (Lag.) D.C. Thomas (Boraginaceae) is a species traditionally consumed as an infusion. The Received 25 June 2012 phenolic profile of its aqueous extract was assessed by HPLC–DAD–ESI/MSn. Twenty-seven compounds Received in revised form 12 August 2012 were identified, comprising caffeic and p-coumaric acids, seventeen polymers of caffeic acid and eight Accepted 24 September 2012 3-O-glycosylated flavonols. Caffeic, rosmarinic, and salvianolic acids were the most representative com- Available online 5 October 2012 pounds, accounting for more than 75% of the phenolic fraction. The potential of G. diffusa aqueous extract to act as radical scavenger was assessed against DPPHÅ, superoxide and nitric oxide. A dose-dependent Keywords: response was observed against all reactive species. Moreover, the extract showed promising results as Glandora diffusa (Lag.) D.C. Thomas inhibitor of -glucosidase, being almost 9 times more effective than acarbose.
    [Show full text]
  • Species List For: Valley View Glades NA 418 Species
    Species List for: Valley View Glades NA 418 Species Jefferson County Date Participants Location NA List NA Nomination and subsequent visits Jefferson County Glade Complex NA List from Gass, Wallace, Priddy, Chmielniak, T. Smith, Ladd & Glore, Bogler, MPF Hikes 9/24/80, 10/2/80, 7/10/85, 8/8/86, 6/2/87, 1986, and 5/92 WGNSS Lists Webster Groves Nature Study Society Fieldtrip Jefferson County Glade Complex Participants WGNSS Vascular Plant List maintained by Steve Turner Species Name (Synonym) Common Name Family COFC COFW Acalypha virginica Virginia copperleaf Euphorbiaceae 2 3 Acer rubrum var. undetermined red maple Sapindaceae 5 0 Acer saccharinum silver maple Sapindaceae 2 -3 Acer saccharum var. undetermined sugar maple Sapindaceae 5 3 Achillea millefolium yarrow Asteraceae/Anthemideae 1 3 Aesculus glabra var. undetermined Ohio buckeye Sapindaceae 5 -1 Agalinis skinneriana (Gerardia) midwestern gerardia Orobanchaceae 7 5 Agalinis tenuifolia (Gerardia, A. tenuifolia var. common gerardia Orobanchaceae 4 -3 macrophylla) Ageratina altissima var. altissima (Eupatorium rugosum) white snakeroot Asteraceae/Eupatorieae 2 3 Agrimonia pubescens downy agrimony Rosaceae 4 5 Agrimonia rostellata woodland agrimony Rosaceae 4 3 Allium canadense var. mobilense wild garlic Liliaceae 7 5 Allium canadense var. undetermined wild garlic Liliaceae 2 3 Allium cernuum wild onion Liliaceae 8 5 Allium stellatum wild onion Liliaceae 6 5 * Allium vineale field garlic Liliaceae 0 3 Ambrosia artemisiifolia common ragweed Asteraceae/Heliantheae 0 3 Ambrosia bidentata lanceleaf ragweed Asteraceae/Heliantheae 0 4 Ambrosia trifida giant ragweed Asteraceae/Heliantheae 0 -1 Amelanchier arborea var. arborea downy serviceberry Rosaceae 6 3 Amorpha canescens lead plant Fabaceae/Faboideae 8 5 Amphicarpaea bracteata hog peanut Fabaceae/Faboideae 4 0 Andropogon gerardii var.
    [Show full text]
  • Herbarium Scientific Name Minnesota DNR Common Name Status Allium Stellatum Prairie Wild Onion Alopecurus Carolinianus Carolina
    Red Rock Prairie Plant List Herbarium Scientific Name Minnesota DNR Common Name Status Allium stellatum prairie wild onion Alopecurus carolinianus Carolina foxtail Anemone cylindrica long-headed thimbleweed Buchloe dactyloides buffalo grass SC Cirsium arvense Canada thistle Dalea candida white prairie clover Eleocharis wolfii Wolf's spikerush E Euthamia gymnospermoides great plains goldenrod Geum triflorum prairie smoke Heuchera richardsonii alumroot Lactuca ludoviciana Louisiana lettuce Lathyrus venosus veiny pea Lespedeza leptostachya prairie bush clover T Limosella aquatica mudwort SC Lithospermum canescens hoary puccoon Lithospermum caroliniense croceum hairy puccoon Lithospermum incisum narrow-leaved puccoon Lomatium orientale desert parsley Lythrum alatum alatum wing-angled loosestrife Mirabilis nyctaginea heart-leaved four o'clock Myosurus minimus mousetail Oenothera biennis biennis common evening primrose Onosmodium molle occidentale false gromwell Oxalis dillenii southern wood sorrel Oxalis violacea violet wood sorrel Phlox pilosa fulgida prairie phlox Physalis virginiana Virginia ground cherry Plantago patagonica patagonica Pursh's plantain Polygonum tenue slender knotweed Potentilla recta rough-fruited cinquefoil Ratibida pinnata gray-headed coneflower Schedonnardus paniculatus tumble grass SC Schizachyrium scoparium scoparium little bluestem Sisyrinchium campestre field blue-eyed grass Solidago missouriensis Missouri goldenrod Solidago rigida humilis stiff goldenrod Tradescantia bracteata bracted spiderwort Veronica peregrina purslane speedwell Vicia americana American vetch Viola palmata pedatifida bearded birdfoot violet Zizia aptera heart-leaved alexanders © 2013 MinnesotaSeasons.com. All rights reserved. Herbarium Scientific Name Minnesota DNR Common Name Status Source: J. F. Bell Museum of Natural History Herbarium, Vascular plant collection database; Retrieved 12/12/2013 12/12/2013 © 2013 MinnesotaSeasons.com. All rights reserved..
    [Show full text]
  • Aullwood's Prairie Plants
    Aullwood's Prairie Plants Taxonomy and nomenclature generally follow: Gleason, H.A. and A. Cronquist. 1991. Manual of Vascular Plants of the Northeastern United States and Adjacent Canada. Second ed. The New York Botanical Garden, Bronx, N.Y. 910 pp. Based on a list compiled by Jeff Knoop, 1981; revised November 1997. 29 Families, 104 Species (98 Native Species, 6 Non-Native Species) Angiosperms Dicotyledons Ranunculaceae - Buttercup Family Anemone canadensis - Canada Anemone Anemone virginiana - Thimble Flower Fagaceae - Oak Family Quercus macrocarpa - Bur Oak Caryophyllaceae - Pink Family Silene noctiflora - Night Flowering Catchfly* Dianthus armeria - Deptford Pink* Lychnis alba - White Campion* (not in Gleason and Cronquist) Clusiaceae - St. John's Wort Family Hypericum perforatum - Common St. John's Wort* Hypericum punctatum - Spotted St. John's Wort Primulaceae - Ebony Family Dodecatheon media - Shooting Star Mimosacea Mimosa Family Desmanthus illinoensis - Prairie Mimosa Caesalpiniaceae Caesalpinia Family Chaemaecrista fasiculata - Partridge Pea Fabaceae - Pea Family Baptisia bracteata - Creamy False Indigo Baptisia tinctoria - False Wild Indigo+ Baptisia leucantha (alba?) - White False Indigo Lupinus perennis - Wild Lupine Desmodium illinoense - Illinois Tick Trefoil Desmodium canescens - Hoary Tick Trefoil Lespedeza virginica - Slender-leaved Bush Clover Lespedeza capitata - Round-headed Bush Clover Amorpha canescens - Lead Plant Dacea purpureum - Purple Prairie Clover Dacea candidum - White Prairie Clover Amphicarpa bracteata
    [Show full text]
  • The Vascular Flora of Boone County, Iowa (2005-2008)
    Journal of the Iowa Academy of Science: JIAS Volume 117 Number 1-4 Article 5 2010 The Vascular Flora of Boone County, Iowa (2005-2008) Jimmie D. Thompson Let us know how access to this document benefits ouy Copyright © Copyright 2011 by the Iowa Academy of Science, Inc. Follow this and additional works at: https://scholarworks.uni.edu/jias Part of the Anthropology Commons, Life Sciences Commons, Physical Sciences and Mathematics Commons, and the Science and Mathematics Education Commons Recommended Citation Thompson, Jimmie D. (2010) "The Vascular Flora of Boone County, Iowa (2005-2008)," Journal of the Iowa Academy of Science: JIAS, 117(1-4), 9-46. Available at: https://scholarworks.uni.edu/jias/vol117/iss1/5 This Research is brought to you for free and open access by the Iowa Academy of Science at UNI ScholarWorks. It has been accepted for inclusion in Journal of the Iowa Academy of Science: JIAS by an authorized editor of UNI ScholarWorks. For more information, please contact [email protected]. Jour. Iowa Acad. Sci. 117(1-4):9-46, 2010 The Vascular Flora of Boone County, Iowa (2005-2008) JIMMIE D. THOMPSON 19516 515'h Ave. Ames, Iowa 50014-9302 A vascular plant survey of Boone County, Iowa was conducted from 2005 to 2008 during which 1016 taxa (of which 761, or 75%, are native to central Iowa) were encountered (vouchered and/or observed). A search of literature and the vouchers of Iowa State University's Ada Hayden Herbarium (ISC) revealed 82 additional taxa (of which 57, or 70%, are native to Iowa), unvouchered or unobserved during the current study, as having occurred in the county.
    [Show full text]
  • The Aromatic-Medicinal Plant Taxa of Pure Scots Pine Stands in Sürmene - Camburnu (Trabzon)
    Int. J. Sec. Metabolite, Vol. 4: 3 (2017) pp. 517-529 Special Issue 2: Research Article ISSN: 2148-6905 online Journal homepage: http://www.ijate.net/index.php/ijsm The Aromatic-Medicinal Plant Taxa of pure Scots pine stands in Sürmene - Camburnu (Trabzon) Arzu ERGÜL BOZKURT *1, Salih TERZİOĞLU2 1Artvin Çoruh University, Faculty of Forestry, Artvin, Turkey 2Karadeniz Technical University, Faculty of Forestry, Trabzon, Turkey Received: 04 May 2017 – Revised: 21 September 2017 - Accepted: 03 November 2017 Abstract: Forests not only produce wood raw material ecosystems, but also that have rich medicinal and aromatic plants. In addition to this situation, forests have been produced many goods and services. Regulation of protection- utilization balance with wood and non-wood herbal products is very important to these ecosystems. In order to ensure sustainable utilization of forest ecosystems, first of all, it is necessary to identify the natural resource components in these ecosystems. In this study, medicinal-aromatic plants of natural Scots pine (Pinus sylvestris L.) stands, which are a sensitive ecosystem, were investigated in 2013-2014. Pinus sylvestris has special ecological conditions in Sürmene-Çamburnu (Trabzon) region because in this region Pinus sylvestris is descending down to the beach. In the study, 81 (77%) out of 105 vascular plant taxa were found to have medicinal-aromatic potential. The parts of the identified plant taxa used for different medical and aromatic purposes are explained in detail. In addition, recommendations were made about regulation of utilization in sensitive ecosystems. Keywords: Pinewood, medicinal-aromatic plant, flora 1. INTRODUCTION Forests are the ecosystems that produce not only wood raw material but as well non-wood forest products.
    [Show full text]
  • Folegandros Island (Kiklades, Greece)
    EDINBURGH JOURNAL OF BOTANY 72 ( 3 ): 391 – 412 (2015) 391 © Trustees of the Royal Botanic Garden Edinburgh (2015) doi:10.1017/S0960428615000128 CONTRIBUTION TO THE FLORA AND BIOGEOGRAPHY OF THE KIKLADES: FOLEGANDROS ISLAND (KIKLADES, GREECE) K . K OUGIOUMOUTZIS , A . T INIAKOU , O . G EORGIOU & T . G EORGIADIS The island of Folegandros, located between the Milos and Santorini archipelagos in the southern Kiklades (Greece), constitutes together with Ios and Sikinos the south-central part of the phytogeographical region of the Kiklades. Its flora consists of 474 taxa, 47 of which are under statutory protection, 40 are Greek endemics and 145 are reported here for the first time. We show that Folegandros has the highest percentage of Greek endemics in the phytogeographical area of the Kiklades. The known distribution of the endemic Muscari cycladicum subsp. cycladicum is expanded, being reported for the first time outside the South Aegean Volcanic Arc. The floristic cross-correlation between Folegandros and other parts of the phytogeographical region of the Kiklades by means of Sørensen’s index revealed that its phytogeographical affinities are stronger to Anafi Island than to any other part of the Kiklades. Keywords . Aegean flora , biodiversity , endemism , phytogeography . I NTRODUCTION The Aegean Sea has long attracted the attention of biogeographers (Turrill, 1929 ; Strid, 1996 ), since it is characterised by high environmental and topographical hetero- geneity (Blondel et al. , 2010 ), diversity and endemism (Strid, 1996 ). The Aegean archipelago consists of more than 7000 islands and islets (Triantis & Mylonas, 2009 ), most of which are located in the phytogeographical region of the Kiklades. Intensive field work has taken place in this region, which is characterised as one of the most floristically explored phytogeographical regions of Greece (Dimopoulos et al.
    [Show full text]
  • Istanbul Üniversitesi Fen Bilimleri Enstitüsü Doktora Tezi
    İSTANBUL ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ DOKTORA TEZİ ELMACIK DAĞI ( DÜZCE ) VEJETASYONU Orm. Yük. Müh. Necmi AKSOY Orman Mühendisliği Anabilim Dalı Orman Botaniği Programı Danışman Prof. Dr. Asuman EFE Temmuz, 2006 İSTANBUL ÖNSÖZ Ülkemiz, doğal kaynak rezervleri içerisinde, floristik ve vejetasyon yapısı yönünden zengin bir çeşitliliğe sahiptir. Özellikle ülkemizin florası ve vejetasyon yapısıyla ilgili çalışmalar son yıllarda artsa da; lokal alanlardaki bitkisel yapı ve çeşitliliğini ortaya koymak için yeterli değildir. İstanbul Üniversitesi, Fen Bilimleri Enstitüsü, Orman Mühendisliği Anabilim Dalı, Orman Botaniği Programında Doktora tezi olarak hazırlanan “Elmacık Dağı (Düzce) Vejetasyonu” adlı bu doktora çalışmasının bu alanda bir katkı sağlayacağına inanıyorum. Tez süresince desteğini esirgemeyen danışman hocam Sayın Prof. Dr. Asuman EFE’ ye, çalışmam konusundaki bilimsel yorumları ve desteğinden dolayı hocam, Prof. Dr. Gülen ÖZALP’e, Prof. Dr. Engin ÖZHATAY’ a, Doç. Dr. Ünal AKKEMİK’ e, Araş. Gör.Ali KAVGACI’ ya ve diğer çalışma arkadaşlarıma teşekkür ederim. Ayrıca, araştırma alanındaki bazı bitki taksonlarının teşhislerinde yardımlarından için, Prof. Dr. Hayri DUMAN’a, Prof. Dr. Neriman ÖZHATAY’a, Prof. Dr. Adil GÜNER’e, Prof. Dr. Tuna EKİM, Prof. Dr. Mehmet Koyuncu’ya, Doç. Dr. Emine AKALIN’a, Doç. Dr. Franz SPETA’ya, Yard. Doç. Dr. Ramazan S. Göktürk’e vejetasyon birimlerinin oluşturulmasında yardımlarından dolayı Prof. Dr. Mecit VURAL’a, literatür ve bilimsel desteklerinden dolayı hocalarım, Prof. Dr. Hüseyin AKSOY’a, Prof Dr. Tekin BABAÇ’a, vejetasyon haritalarının oluşturulmasındaki yardımları için, Araş. Gör. Hayati ZENGİN ve Araş. Gör. Ulaş Y. ÖZKAN’a, toprak alım ve analizlerindeki yardımlarından dolayı, Araş. Gör. Murat SANGIRCI’ya, Araş. Gör. Mehmet ÖZCAN’a ve Yüksek Kimyager Ümit KILIÇ’a, herbaryum çalışmam sırasındaki yardımlarından dolayı Salih Sercan KANOĞLU’ ve Ali KAYA’ya teşekkür ederim.
    [Show full text]
  • Evolutionary Transitions of Style Polymorphisms in Lithodora (Boraginaceae) V
    ARTICLE IN PRESS Perspectives in Plant Ecology, Evolution and Systematics Perspectives in Plant Ecology, Evolution and Systematics 11 (2009) 111–125 www.elsevier.de/ppees Evolutionary transitions of style polymorphisms in Lithodora (Boraginaceae) V. Ferreroa,Ã, J. Arroyob, P. Vargasc, J.D. Thompsond, L. Navarroa aDepartamento de Biologı´a Vegetal y Ciencias del Suelo, Facultad de Biologı´a, Universidad de Vigo, As Lagoas-Marcosende 36200 Vigo, Spain bDepartamento de Biologı´a Vegetal y Ecologı´a, Universidad de Sevilla, Apartado 1095, E-41080 Sevilla, Spain cReal Jardı´n Bota´nico de Madrid, CSIC, Plaza Murillo 2, 28014 Madrid, Spain dUMR 5175 Centre d’Ecologie Fonctionnelle et Evolutive, CNRS, 1919 Route de Mende, F-34293 Montpellier Cedex 5, France Received 22 September 2008; received in revised form 10 January 2009; accepted 19 January 2009 Abstract Floral polymorphisms provide suitable model systems to test hypotheses concerning the evolution of outbreeding in plants. Although heterostyly has evolved in more than 28 angiosperm families, the evolutionary pathways involving related floral conditions have not yet been fully resolved. In this study, the reconstruction of ancestral states of style polymorphism, with both parsimony and maximum likelihood methods, was carried out for Boraginaceae species in the tribe Lithospermeae, particularly in the genus Lithodora sensu lato, where species present a wide variety of stylar conditions. Detailed floral morphometric analysis confirm different types of style polymorphism within Lithodora. They also reveal a novel style polymorphism (relaxed style dimorphism) in which anther height is variable within a flower (each anther being at a different height), which contrasts to regular distyly (constant anther height within flowers).
    [Show full text]
  • CONSEJO SUPERIOR DE INVESTIGACIONES CIENTÍFICAS Anales Del Jardín Botánico De Madrid 70(1): 39-47, Enero-Junio 2013
    Volumen 70 N.º 1 enero-junio 2013 Madrid (España) ISSN: 0211-1322 REAL JARDÍN BOTÁNICO CONSEJO SUPERIOR DE INVESTIGACIONES CIENTÍFICAS Anales del Jardín Botánico de Madrid 70(1): 39-47, enero-junio 2013. ISSN: 0211-1322. doi: 10.3989/ajbm. 2350 Genome size variation and polyploidy incidence in the alpine flora from Spain João Loureiro*, Mariana Castro, José Cerca de Oliveira, Lucie Mota & Rubén Torices Centre for Functional Ecology, Department of Life Sciences, University of Coimbra, P.O. Box 3046, 3001-401 Coimbra, Portugal [email protected]; [email protected]; [email protected]; [email protected]; [email protected] Abstract Resumen Loureiro, J., Castro, M., Cerca de Oliveira, J., Mota, L. & Torices, R. 2013. Loureiro, J., Castro, M., Cerca de Oliveira, J., Mota, L. & Torices, R. 2013. Genome size variation and polyploidy incidence in the alpine flora from Variación en el tamaño del genoma e incidencia de la poliploidía en la flo- Spain. Anales Jard. Bot. Madrid 70(1): 39-47. ra alpina española. Anales Jard. Bot. Madrid 70(1): 39-47 (en inglés). The interest to study genome evolution, in particular genome size varia- El interés en el estudio de la evolución del genoma, especialmente de la va- tion and polyploid incidence, has increased in recent years. Still, only a few riación en tamaño y de la incidencia de poliploidía, se ha incrementado en studies have been focused at a community level. Of particular interest are los últimos años. Sin embargo, sólo unos pocos estudios se han centrado high mountain species, because of the high frequency of narrow endemics en el nivel de comunidades.
    [Show full text]