Molecular Phylogenetics, Molecular Evolution, and Patterns of Clade Support in Lithospermum (Boraginaceae) and Related Taxa Author(s): James Isaac Cohen, and Jerrold I Davis Source: Systematic Botany, 37(2):490-506. 2012. Published By: The American Society of Plant Taxonomists URL: http://www.bioone.org/doi/full/10.1600/03634412X635539 BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder. BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. Systematic Botany (2012), 37(2): pp. 490–506 © Copyright 2012 by the American Society of Plant Taxonomists DOI 10.1600/03634412X635539 Molecular Phylogenetics, Molecular Evolution, and Patterns of Clade Support in Lithospermum (Boraginaceae) and Related Taxa James Isaac Cohen,1,3 and Jerrold I Davis2 1Department of Biology and Chemistry, Texas A & M International University, 379E Lamar Bruni Vergara Science Center, 5201 University Boulevard, Laredo, Texas 78041, U. S. A. 2Department of Plant Biology, Cornell University, 412 Mann Library Building, Ithaca, New York 14853, U. S. A. 3Author for Correspondence ([email protected]) Communicating Editor: Jennifer Tate Abstract—Utilizing 10 cpDNA regions and thorough taxon sampling, a phylogeny is reconstructed for Lithospermum and related members of both Lithospermeae, the tribe to which it is assigned, and Boraginaceae. Lithospermum is supported as monophyletic, and the genus is hypothesized to have originated in the Old World, after which there was one colonization of the New World. The heterostylous breeding system is inferred to have originated within Lithospermum either seven times or six times with one loss, and with other independent origins within Lithospermeae. The stability of the 10-region matrix is investigated, as are the number and combination of regions necessary to accurately reconstruct phylogenies. The combination of concatenated regions is important, and the following regions are recommended for future phylogenetic studies of genera of Boraginaceae: the rpl16 intron, matK, psbA-trnH, trnL-rpl32, and trnQ-rps16. The use of these recommended regions is conservative, and it contrasts with most intrageneric studies of Boraginaceae, which often are based on the trnL-trnF spacer and nuclear ribosomal ITS. Keywords—Boraginaceae, cpDNA, heterostyly, Lithospermum, molecular evolution, sampling. Lithospermum L. (Boraginaceae) comprises approximately seven new genera of Lithospermeae. These efforts cul- 60 species. The genus has a cosmopolitan distribution, with a minated in revisions of both taxa (Johnston 1952, 1953a, b, center of diversity in the southwestern U. S. A. and Mexico, 1954a, b). In these publications, Johnston noted that all of the and with more than half of the species endemic to this region. genera endemic to the New World share a series of nutlet, In the present study, relationships and patterns of character pollen, and floral characters with Lithospermum (Johnston evolution are examined among species of Lithospermum and 1954a, b). Though he hypothesized various relationships their close relatives. Outgroups include representatives of among the genera of the tribe, these were not explicit phylo- more distantly related members of Boraginaceae, and pat- genetic hypotheses. terns of cpDNA evolution are examined within Lithospermum, Until recently, Johnston’s hypotheses remained untested. Lithospermeae, and Boraginaceae. In 2009, Cohen and Davis presented a phylogeny based Linnaeus (1753) described Lithospermum in Species Plantarum, on cpDNA sequence data, including representatives of and he included six species within it. This initial circumscrip- Lithospermum and five of the six genera of Lithospermeae tion encompassed species with smooth, white, lustrous, erect endemic to the New World. This phylogeny provided evi- nutlets, and this Lithospermum-type of nutlet consistently dence that all of these New World genera (Lasiarrhenum has been recognized as characterizing the genus. This has I. M. Johnst., Macromeria D. Don, Nomosa I. M. Johnst., remained the case even as the circumscription of the genus Onosmodium Michx., Perritostema I. M. Johnst., and Psilolaemus has changed, as has occurred frequently. Of the six species I. M. Johnst.) are nested among species of Lithospermum.In that Linnaeus recognized within Lithospermum, most were light of these inferred relationships, the authors included subsequently transferred to other genera, and until recently, all members of these endemic New World genera in only the type species remained in the genus (Cohen and Lithospermum. This inclusion increased the number of species Davis 2009). Since the mid 1700s, taxonomists have consid- in the genus by 18, bringing the total number to approximately erably broadened the circumscription of Lithospermum in three 60 (Cohen and Davis 2009). Two features diagnose this more principal stages. The first major change occurred in the treat- broadly defined Lithospermum: the Lithospermum-type nutlet, ment of Boraginaceae for the Prodromus (de Candolle 1846). and corollas that are not blue or purple (two colors occur in De Candolle described the state of Lithospermum 90 yr after closely related genera). In contrast, species of Lithospermum Linneaus’ original generic circumscription. De Candolle cir- produce corollas that are yellow, yellow-green, orange, or white. cumscribed Lithospermum broadly, and added many new spe- Weigend et al. (2009) also have reconstructed a phylogeny cies to the genus. He included species currently recognized as of Lithospermum and related taxa. Their phylogeny was not as part of Lithospermum as well as others now placed in other, fully resolved as that of Cohen and Davis (2009), and the two closely related genera, such as Buglossoides Moench. and phylogenies conflicted in some respects but both placed the Lithodora Griseb. De Candolle recognized species currently New World genera among species of Lithospermum. placed in Lithospermum through the inclusion of all of those Phylogenies have been reconstructed for only a small num- that were known at the time in the subgenus Eulithospermum ber of genera in Boraginaceae, including Lithodora (Thomas DC. (with the exception of L. chinensis Hook. & Arn., currently et al. 2008; Ferrero et al. 2009), Cerinthe L. (Selvi et al. 2009), a member of Heliotropium L. [Zhu et al. 1995]). Echium L. (Bo¨hle et al. 1996), Anchusa L. (Hilger et al. 2004), During the early to mid 20th century, Johnston (e.g. 1935, Myosotis L. (Winkworth et al. 2002), Lobostemon Lehm. (Buys 1952) studied and reevaluated the taxonomy of Boraginaceae. 2006), Echiochilon Desf. (La˚ngstro¨m and Oxelman 2003) and Throughout his career, Johnston studied Lithospermum and Nonea Medik. (Selvi et al. 2006), but a comprehensive phylog- the tribe to which it is assigned, Lithospermeae. He described eny of Boraginaceae does not exist at present. Difficulties, 35 new species of Lithospermum and described or segregated such as lack of overlap among the taxon samples of different 490 2012] COHEN AND DAVIS: MOLECULAR PHYLOGENETICS OF LITHOSPERMUM 491 studies, have impeded attempts to cobble together a phylog- primers of the cited authors. The only exception was a pair of primers eny of Boraginaceae; therefore, reevaluation of the taxonomy designed by the authors to amplify part of matK for some species of Lithospermum (matK-Lith2F 50 CACGAGTATTGGAATCCTTTTATT 30 of Boraginaceae above the genus-level is problematic, espe- and matK-Lith806R 50 TTGTGTTTCCGAGCCAAAGT 30). PCR mixtures, cially as the family includes many small genera (i.e. with 25 mL in volume, consisted of 67 mM Tris-HCl with 2.1% DMSO and fewer than five species). Through phylogenetic investigation 0.01% TritonX per reaction or 1 +Ex Taq Buffer (Takara Bio Inc., Japan), m m of larger genera, it has been determined that in addition to 2 mM MgCl2, 0.2 mM to 0.25 mM dNTPs, 1 M of primers, 0.125 Lto m m m Lithospermum, other genera, such as Nonea (Selvi et al. 2006), 1 LofTaq polymerase, and 0.1 L to 2.5 L DNA sample, depending on the DNA concentration. Amplifications were performed in an Eppendorf Cryptantha Lehm. ex G. Don (Hasenstab and Simpson 2008), Mastercycler Gradient 5331 thermocycler with the programs and anneal- and Cynoglossum L., are not monophyletic. Although the ing temperatures listed in Cohen and Davis (2009). The PCR products present study focuses on the phylogenetics of Lithospermum were separated on a 1% to 1.5% agarose gel and stained with ethidium and its closest relatives, the outgroup sampling allows for the bromide to determine whether amplification had occurred. Prior to sequenc- ing, some PCR products were purified with the QIAquick PCR purifica- examination of relationships among some of the more dis- tion kit