ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

Journal of Biological Diversity Volume 12 – Number 1 – January 2011

FIRST PUBLISHED: 2000

ISSN: 1412-033X (printed edition) 2085-4722 (electronic)

EDITORIAL BOARD (COMMUNICATING EDITORS): Abdel Fattah N.A. Rabou (Palestine), Dato A. Latiff Mohamad (Malaysia), Alan J. Lymbery (Australia), Ali Saad Mohamed (Sudan), Bambang H. Saharjo (Indonesia), Charles H. Cannon Jr. (USA), Edi Rudi (Indonesia), Guofan Shao (USA), Hassan Poorbabaei (Iran), Hwan Su Yoon (USA), Jamaluddin (India), Joko R. Witono (Indonesia), Katsuhiko Kondo (Japan), Livia Wanntorp (Sweden), Mahendra K. Rai (India), María La Torre Cuadros (Peru), Mariela A. Marinoff (Argentine), Mochamad A. Soendjoto (Indonesia), Salvador Carranza (Spain), Shahabuddin (Indonesia), Sonia Malik (Brazil), Sugiyarto (Indonesia), Thaweesakdi Boonkerd (Thailand)

EDITOR-IN-CHIEF: Sutarno

EDITORIAL MEMBERS: English Literary Editor: I Made Sudiana ([email protected]) Technical Editor & Banking: Solichatun ([email protected]) Distribution & Marketing: Rita Rakhmawati ([email protected]) Webmaster: Ari Pitoyo ([email protected])

MANAGING EDITORS: Ahmad Dwi Setyawan ([email protected])

PUBLISHER: Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Surakarta and The Society for Indonesian Biodiversity

ADDRESS: Jl. Ir. Sutami 36A Surakarta 57126. Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375, Email: [email protected]

BANKING: Solichatun, BNI KC Sebelas Maret, Acc. No. 0033691646

ONLINE: www.unsjournals.com

ACCREDITED BY DECREE OF THE DIRECTORATE GENERAL OF HIGHER EDUCATION, THE MINISTRY OF NATIONAL EDUCATION, REPUBLIC OF INDONESIA No. 65a/DIKTI/Kep/2008 (valid until October 2011)

EXPERTATION AND CORRESPONDING EMAIL OF THE COMMUNICATING EDITORS: GENETIC DIVERSITY: Alan J. Lymbery ([email protected]), Hwan Su Yoon ([email protected]), Mahendra K. Rai ([email protected]), Salvador Carranza ([email protected]), Sonia Malik ([email protected]). SPECIES DIVERSITY: Dato A. Latiff Mohamad ([email protected]), Joko R. Witono ([email protected]), Katsuhiko Kondo ([email protected]), Livia Wanntorp ([email protected]), Thaweesakdi Boonkerd ([email protected]). ECOSYSTEM DIVERSITY: Abdel Fattah N.A. Rabou ([email protected]), Ali Saad Mohamed ([email protected]), Bambang H. Saharjo ([email protected]), Charles H. Cannon Jr. ([email protected]), Edi Rudi ([email protected]), Guofan Shao ([email protected]), Hassan Poorbabaei ([email protected]), Jamaluddin ([email protected]), Mochamad A. Soendjoto ([email protected]), Shahabuddin ([email protected]), Sugiyarto ([email protected]). ETHNOBIOLOGY: María La Torre Cuadros ([email protected]), Mariela A. Marinoff ([email protected]). BIODIVERSITAS ISSN: 1412-033X (printed edition) Volume 12, Number 1, January 2011 ISSN: 2085-4722 (electronic) Pages: 1-6 DOI: 10.13057/biodiv/d120101

Identification and characterization of Salmonella typhi isolates from Southwest Sumba District, East Nusa Tenggara based on 16S rRNA gene sequences

CHARIS AMARANTINI1,♥, LANGKAH SEMBIRING2, HARIPURNOMO KUSHADIWIJAYA3, WIDYA ASMARA4 1Faculty of Biology, Duta Wacana Christian University (UKDW). Jl. Dr. Wahidin Sudirohusodo No. 5-27, Yogyakarta 55224, Indonesia. Tel.: +62-274- 563929. Fax.: +62-0274-4513235. email: [email protected] 2Faculty of Biology, Gadjah Mada University (UGM), Yogyakarta 55284, Indonesia. 3Field Epidemiology Training Program, Department of Public Health, Faculty of Medicine, Gadjah Mada University (UGM), Yogyakarta 55284, Indonesia. 4Department of Microbiology, Faculty of Veterinary Medicine, Gadjah Mada University (UGM), Yogyakarta 55284, Indonesia.

Manuscript received: 9 April 2010. Revision accepted: 23 August 2010.

ABSTRACT

Amarantini C, Sembiring L, Kushadiwijaya H, Asmara W (2011) Identification and characterization of Salmonella typhi isolates from Southwest Sumba District, East Nusa Tenggara based on 16S rRNA gene sequences. Biodiversitas 12: 1-6. The incidence rate of typhoid fever in the Southwest Sumba District, East Nusa Tenggara was approximately about 725/100,000. In spite of such rate, there was not much known-yet about the molecular epidemiology of the disease. Thus, having accurate data and a strong discriminatory ability was crucial to scrutinize the molecular epidemiology of S. typhi with a molecular phylogenetic approach based on 16S rRNA gene sequences. Sixteen isolates representative of S. typhi from different geographical regions in Southwest Sumba District along with the reference strain S. typhi NCTC 786 had been identified and characterized based on 16S rRNA gene sequences using PCR amplification and sequencing. The 16S rRNA sequences data were aligned with the corresponding available S. typhi sequences retrieved from the NCBI database by using CLUSTAL X software. Phylogenetic trees were generated with PHYLIP software package. Molecular phylogenetic analysis indicated that all the isolates belong to S. typhi species were suggested by their relativity with the type strain of S. typhi ATCC19430T. It was also found that the isolates which belong to S. typhi species formed several different centers of diversity within the 16S rRNA gene tree. Each clade consisted of the strains from different geographical places in the District. Thus, to conclude the inquiry, there was evident inter-geographical spread of the strains and it tended to spread further into more remote areas in the District.

Key words: Salmonella typhi strains, typhoid fever, 16S rRNA gene sequences, molecular phylogenetic analysis.

INTRODUCTION symptoms ranging from mild illness with slight fever, the body feels uncomfortable, coughing and the clinical There are 17 to 22 million cases of typhoid fever circumstances such as severe abdominal pain and worldwide per year and it causes 216,000 to 600,000 complications. This condition could often cause difficulties deaths annually (Steele 2008). Based on a preliminary to diagnose it when merely based only on clinical symptom survey, the fever was highly endemic in Southwest Sumba (Muliawan and Surjawidjaja 1999). In addition to such District, East Nusa Tenggara and it infected 725/ 100,000 high rate, information about the molecular epidemiology of people per year in the District according to the report made the disease was unknown. Thus, it was indispensable to by Karitas Hospital in 2006. Until recently however it has have accurate data and a strong discriminative ability to not been under controlled because the limitations of health distinguish the types of the strains of the pathogenic service units to diagnose the typhoid through laboratory bacteria needed in the epidemiological study. studies. The incidence rate in the area was higher than the The application of the molecular detection methods for incidence in rural areas (358/100,000) or semi rural areas the epidemiological study was advantageous because the (157/100,000 inhabitants). It was nearly the same as the genetic profile of the bacteria is a source of information to total number of people infected in urban areas map the spread of the bacteria in the community. (810/100,000) annually in Indonesia (WHO 2003). Henceforth it is beneficial to determine best-fitted control Typhoid fever is an acute systemic infection caused by strategies over the disease. With the given rationale, this Salmonella enterica subsp. enterica serotype typhi study was aimed to unravel the strain diversities belonging (Salmonella typhi). The acute systemic infection causes S. to the S. typhi species isolated from typhoid fever patients typhi get into the blood stream after passing through using a molecular phylogenetic approach based on 16S several organs in the host. This disease shows clinical rRNA gene sequences, and also to understand the spread of S. typhi based on its varieties and interrelations among the 2 BIODIVERSITAS 12 (1): 1-6, January 2011 strains isolated from the infected patients in Southwest edited and assembled with Finch TV 1.4.0 and DNA Baser Sumba District, East Nusa Tenggara. sequence analysis software. Complete assembled sequences were aligned with the corresponding S. typhi sequences retrieved from the NCBI database with CUSTAL X MATERIALS AND METHODS software (Thompson et al. 1997).

Bacterial strains Construction of phylogenetic tree In this inquiry, there were 16 representative isolates of Based on 16S rRNA nucleotide sequences, a S. typhi from different geographical regions in Southwest phylogenetic tree was constructed with PHYLIP software Sumba District. They were from infected patients in package (Felsenstein 1993) with the neighbor-joining Karitas Hospital in Weetabula, a private clinic in Elopada algorithm (Saito and Nei 1987). The evolutionary distance Subdistrict in Southwest Sumba District, and Lende Moripa matrix for the neighbor-joining method was generated in Hospital in Waikabubak, West Sumba District. Specimen accordance with the description introduced by Jukes and collection and microbiological identification methods were Cantor (1969). The phylogenetic distances were obtained described in the journal article published previously by adding only the values of the horizontal components. (Amarantini et al. 2009). Eventually, the matrix of the nucleotide similarity and difference was generated with PHYDIT software (Chun Extraction of bacterial DNA, PCR amplification and 1999). DNA sequencing Bacterial DNA was extracted in accordance with the Mapping the spread of S. typhi strains in Southwest protocol’s instructions using a PurelinkTM Genomic DNA Sumba District, East Nusa Tenggara Mini Kit (Invitrogen K1820-00). The bacterial DNA and The spread of S. typhi strains was isolated from the control were amplified with 0.2 µM primers (InvitrogenTM) endemic regions in Southwest Sumba District was mapped and PCR SuperMix (InvitrogenTM 11306-016). PCR according to the infected patients’ residences using a amplification for the 16S rRNA sequences showed bands satellite navigation system (Global Positioning System of 428 bp, 484 bp, and 483 bp. These fragments were /GPS). The spread of the strain types and the phylogenetic amplified using primer SR1/SR2, SR3/SR4, and SR5/SR6 relationships among the strains, as the results of the 16S respectively. The primers which were used to amplify these rRNA gene sequencing, were also mapped according to the fragments showed at Table 1 (Massi et al. 2005). The PCR geographical distribution of the diseases. mixtures were amplified for 40 cycles at 94ºC for 1 minute, 55ºC for 1 minute, and 72ºC for 2 minutes, with a final extension at 72ºC for 10 minutes in automated Applied RESULTS AND DISCUSSION Biosystems GeneAmp PCR System 2400. An aliquot of 10 µL of each amplified product was electrophorezed in 1.5% Molecular characterization of S. typhi strains using (wt/vol) agarose gel, with a DNA Molecular Weight phylogenetic approach based on 16S rRNA gene sequences Marker (Gel Pilot 100bp Ladder 100 Lanes, Qiagen, Based on 16S rRNA gene, the phylogenetic analysis of Germany) in parallel. the 16 isolates of S. typhi from different geographical The PCR product was gel purified with a QIAquick origins in Southwest Sumba District is shown in Figure 1. PCR purification kit (QIAgen, Germany). The purified There were 29 isolates of 16S rRNA gene sequences used PCR product was sequenced with ABI Prism 3100-Avant in constructing the phylogeny tree. It consisted of 18 S. Genetic Analyzer in accordance with the manufacture’s typhi strains, including the type strain of S. typhi ATCC instructions (Applied Biosystems, USA) using PCR 19430T (accession no. Z47544) which belonged to S. primers (Massi et al. 2005). enterica, one strain belonged to S. bongori BR 1859 (AF029227), and 11 strains from Enterobacteriaceae family Analysis and alignment of 16S rRNA nucleotide sequences [Escherichia coli ATCC 25922 (X80724.1), Citrobacter The 16S rRNA nucleotide sequences were analyzed, freundii ATCC 29935 (M59291.1), Serratia marcescens (M59160.1), Erwinia carotovora ATCC 15713 (M59149.1), Yersinia Table 1. The primers used for PCR amplification of 16S rRNA gene sequence of S. typhi ruckeri ATCC 29473 (X75275.1), (Massi et al. 2005). Yersinia intermedia ER-3854 (X75279.1), Hafnia alvei ATCC Primer Sequence Nucleotide position 13337 (M59155.1), Photobacter SR1 5’ AGTTTGATCCTGGCTCAG 3’ 3-20 (AC: Z47544) luminescens DSM 3368 (X82248.1), SR2 5’ AGTACTTTACAACCCGAAGG 3’ 411-430 (AC: Z47544) Xenorhabdus nematophilus DSM SR3 5’ AAGTACTTTCAGCGGGGA 3’ 424-441 (AC: Z47544) 3370 (X82251.1), Proteus vulgaris SR4 5’ TTGAGTTTTAACCTTGCGG 3’ 898-916 (AC: Z47544) IFAM 1731 (X07652.1), and SR5 5’ AACTCAAATGAATTGACGG 3’ 901-919 (AC: Z47544) Plesiomonas shigelloides (M59159)]. SR6 5’ AGGCCCGGGAACGTATTCAC 3’ 1364-1383 (AC: Z47544) Plesiomonas shigelloides was used as Note: AC: GenBank accession no. the out group strain in the root position since this species belongs to AMARANTINI et al. – Identification of Salmonella typhi based on 16S rRNA 3

Enterobacteriaceae family and it formed a separate sub-line The last clade was named Clade Palekki since it of descent of the evolution of Salmonella, E. coli, and C. comprised of the isolates originally from Palekki in North freundii (Chang et al. 1997). Wewewa Subdistrict. It belonged to Biotype I. This clade The result of the phylogenetic analysis (Figure 1) was the most different isolates among the sixteen isolates showed that 16 representative isolates of S. typhi from because it was a single-member clade which contained only various regions in Southwest Sumba District, East Nusa one isolate (BPE 88.1-CCA). Tenggara belonged to S. typhi species because of their The 16S rRNA nucleotide similarity values (%) and the relativity with the type strain of S. typhi ATCC 19430T. number of nucleotide differences among 16 S. typhi They formed several different centers of diversity within isolates from the infected patients in different geographical the 16S rRNA gene tree. All the strains fell into four clades regions in Southwest Sumba District and the reference and form a clear center of diversity with the reference strain of S. typhi ATCC 19430T are shown in Table 2. All strain of S. typhi ATCC 19430T. the tested strains possess a 16S rRNA sequence with ≥99% The first clade consisted of eight strains, namely BPE similarity with the reference strain of S. typhi ATCC 121.1-MC isolates from Weedindi in East Wewewa 19430T. Based on the similarity scores, these strains were Subdistrict, RSK 32.1-CCA isolates from Pakamutu in identified as S. typhi (Drancourt et al. 2000). They were Kodi Subdistrict, two isolates (BPE 122.1-CCA and BPE entirely congruent either between similarity values and 122.4-CCA) from Durru Lodo in East Wewewa nucleotide differences or based on the phylogenetic Subdistrict, other two isolates (BPE 127.1-MC and BPE analysis. Thus, this inquiry concluded that the isolates 127.2-MC) from Elopada in East Wewewa Subdistrict, belong to S. typhi species even though they formed several BPE 123.1-CCA isolates from Kongge in East Wewewa, different centers of diversity within the 16S rRNA gene and one isolates (BPE 120.1-MC) from Omba Rade in East tree. Wewewa Subdistrict. It was also evident that in terms of similarity and According to the previous research (Amarantini et al. difference of nucleotide (Table 2), BPE 122.4-CCA was 2009), two isolates (BPE 121.1-MC and BPE 127.1-MC) identical with BPE 122.1-CCA. BPE 122.1-CCA was also were categorized as Biotype III (d-xilose +; l-arabinose +). like BPE 121.1-MC and BPE 120.1-MC. The last two All the others (RSK 32.1-CCA, BPE 122.1-CCA, BPE strains (BPE 121.1-MC and BPE 120.1-MC) were 122.4-CCA, BPE 127.2-MC, BPE 123.1-CCA and BPE identical. All these strains were originally from East 120.1-MC) were categorized as Biotype I (d-xilose +; l- Wewewa Subdistrict and classified into the first clade. arabinose -). Both categories were classified as one single Consequently, the similarity values and the number of clade. In the first clade, it was evident that the resistant nucleotide differences between the strains were completely strains and the sensitive strains from the same geographical congruent with the results of the phylogenetic analysis. area could be separated into different subclades. The strains were BPE 127.1-MC and BPE 127.2-MC from Elopada in Analysis of S. typhi isolates according to geographical East Wewewa and BPE 122.1-CCA and BPE 122.4-CCA distribution of the diseases using global positioning from Durru Lodo in East Wewewa. This research proved system and its public health implications that the phylogenetic classification for the first clade could The map of the S. typhi isolates according to the differentiate two strains with different characters in terms geographical distribution of the diseases using Global of their nalidixic acid resistance in separate subclade even Positioning System is shown in Figure 2. It revealed that though they were originally from the same geographical the phylogenetic relationships of S. typhi strains were based origin. on the phylogenetic distance value. In addition, the result The second clade consisted of four strains, they were of phylogeny tree analysis also shows that each clade was BPE74.1-CCA isolates from Weerambo, East Wewewa, made up of the strains from different places of origin in RSL 1.3-SSA isolates from Kampung Sawah, Waikabubak, Southwest Sumba District, East Nusa Tenggara. This fact BPE 7.10-MC isolates from Ombawawi, North Wewewa, indirectly answers the hypothesis of inter-geographical BPE 1.1-SSA isolates from Wanowitu, East Wewewa. It spread of the strains. meant that four isolates in this clade were closely related The spread of the strains within the first clade with S. typhi NCTC 786. According to the database, this originated from Durru Lodo, East Wewewa. It reached out strain was a culture collection of HPA in United Kingdom Weedindi in East Wewewa Subdistrict and went further out deposited by the Lister Institute (accession data: to Pakumutu in Kodi Subdistrict. The transmission was 01.01.1920). It was isolated in 1920 from a single colony indicated with the brown line. The other three strains of the of S. typhi Rawlings strains, NCTC 160. According to same clade spread circulatory in the territory of East WHO standard, this strain was categorized in the third Wewewa Subdistrict. As indicated by the red line, the group as hazardous pathogens. Thus, people should be very strain from Ombarade spread outward to Elopada and cautious to these strains. Kongge (Figure 2). The third clade consisted of three strains; they are RSK In the second clade, the strain from Wanowitu in East 5.1-SSA isolates from Watubero in North Kodi Subdistrict Wewewa Subdistrict spread outward to Ombawawi in and two isolates (RSK 22.2-CCA and RSK 22.4-CCA) North Wewewa Subdistrict, and then went further out to from Pala Mata Loko in North Wewewa. In this clade, the Kampung Sawah in Waikabubak Subdistrict and strains belong to Biotype I and Biotype III. All these Weerambo in East Wewewa Subdistrict. The spread of isolates were sensitive to nalidixic acid. these strains is indicated with the purple line (Figure 2). 4 BIODIVERSITAS 12 (1): 1-6, January 2011

Figure 1. Neighbor-joining (Saitou and Nei 1987) dendogram represents the phylogenetic relationships of the 16S rRNA gene of S. typhi strains from different geographical areas in Southwest Sumba District, East Nusa Tenggara and the representative strains of Enterobacteriaceae family. The arrow indicates estimated root.

DISTRICT

DISTRICT

Figure 2. The map of diversity and distribution of S. typhi strains in Southwest Sumba District, East Nusa Tenggara based on phylogenetic relationships. AMARANTINI et al. – Identification of Salmonella typhi based on 16S rRNA 3

Table 2. 16S rRNA similarities value (%) and the number of nucleotide difference between the sixteen strains of S. typhi originated from different geographical places in Southwest Sumba District, East Nusa Tenggara and the reference strain of S. typhi ATCC 19430T. AMARANTINI Strain A P E R K O J B L M D N F H I Q G Z47544 code A --- 5/1384 4/1382 5/1381 4/1382 6/1382 4/1382 6/1382 4/1381 4/1382 5/1380 11/1381 5/1381 3/1381 6/1381 5/1381 4/1381 7/1381 P 99.64 --- 3/1382 4/1381 1/1382 3/1382 1/1382 3/1382 1/1381 1/1382 6/1380 8/1381 4/1381 2/1381 5/1381 4/1381 3/1381 6/1381 E 99.71 99.78 --- 3/1381 2/1382 4/1382 2/1382 4/1382 2/1381 2/1382 4/1380 9/1381 3/1381 1/1381 4/1381 3/1381 2/1381 5/1381 et al. et R 99.64 99.71 99.78 --- 3/1381 5/1381 3/1381 5/1381 3/1381 3/1381 6/1380 10/1381 4/1381 2/1381 5/1381 4/1381 3/1381 6/1381

K 99.71 99.93 99.86 99.78 --- 2/1383 0/1383 2/1382 0/1381 1/1383 5/1380 7/1381 3/1381 1/1381 4/1381 3/1381 2/1381 5/1381 – Identificationof O 99.57 99.78 99.71 99.64 99.86 --- 2/1383 4/1382 2/1381 3/1383 7/1380 8/1381 5/1381 3/1381 6/1381 5/1381 4/1381 7/1381 J 99.71 99.93 99.86 99.78 100 99.86 --- 3/1383 0/1381 1/1384 5/1381 7/1382 3/1382 1/1381 4/1381 3/1381 2/1381 5/1381 B 99.57 99.78 99.71 99.64 99.86 99.71 99.78 --- 2/1381 3/1383 7/1381 10/1382 6/1382 3/1381 6/1381 5/1381 4/1381 7/1381 L 99.71 99.93 99.86 99.78 100 99.86 100 99.86 --- 0/1381 5/1380 7/1381 3/1381 1/1381 4/1381 3/1381 2/1381 5/1381

M 99.71 99.93 99.86 99.78 99.93 99.78 99.93 99.78 100 --- 5/1381 7/1382 3/1382 1/1381 4/1381 3/1381 2/1381 5/1381 typhi Salmonella D 99.64 99.57 99.71 99.57 99.64 99.49 99.64 99.49 99.64 99.64 --- 10/1381 6/1381 4/1380 7/1380 6/1380 5/1380 8/1380 N 99.2 99.42 99.35 99.28 99.49 99.42 99.49 99.28 99.49 99.49 99.28 --- 10/1382 8/1381 12/1382 11/1382 9/1381 12/1381 F 99.64 99.71 99.78 99.71 99.78 99.64 99.78 99.57 99.78 99.78 99.57 99.28 --- 2/1381 5/1381 4/1381 3/1381 6/1381 H 99.78 99.86 99.93 99.86 99.93 99.78 99.93 99.78 99.93 99.93 99.71 99.42 99.86 --- 3/1381 2/1381 1/1381 4/1381

I 99.57 99.64 99.71 99.64 99.71 99.57 99.71 99.57 99.71 99.71 99.49 99.13 99.64 99.78 --- 1/1382 4/1381 7/1381 onrRNA based 16S Q 99.64 99.71 99.78 99.71 99.78 99.64 99.78 99.64 99.78 99.78 99.57 99.2 99.71 99.86 99.93 --- 3/1381 6/1381 G 99.71 99.78 99.86 99.78 99.86 99.71 99.86 99.71 99.86 99.86 99.64 99.35 99.78 99.93 99.71 99.78 --- 3/1381 Z47544 99.49 99.57 99.64 99.57 99.64 99.49 99.64 99.49 99.64 99.64 99.42 99.13 99.57 99.71 99.49 99.57 99.78 --- Note: A (RSK 5.1-SSA); B (RSK 32.1-CCA); C (RSL 2.1-CCA); D (RSK 22.2-CCA); E (RSK 22.4-CCA); F (BPE 7.10-MC); G (BPE 88.1-CCA); H (BPE 1.1-SSA); I (BPE74.1-CCA); J (BPE 120.1-MC); K (BPE 121.1-MC); L (BPE 122.1-CCA); M (BPE 122.4-CCA); N (BPE 123.1-CCA); O (BPE 127.1-MC); P (BPE 127.2-MC); Q (RSL 3.1-SSA); R (S. typhi NCTC 786); Z47544 (S. typhi ATCC 19430T). 5 6 BIODIVERSITAS 12 (1): 1-6, January 2011

In the second clade, the strain from Wanowitu in East Southwest Sumba District, East Nusa Tenggara. Therefore, Wewewa Subdistrict spread outward to Ombawawi in it was reasonable to conclude that there was inter- North Wewewa Subdistrict, and then went further out to geographical spread of the strains and it tended to spread Kampung Sawah in Waikabubak Subdistrict and outward to more remote areas. Weerambo in East Wewewa Subdistrict. The spread of these strains is indicated with the purple line (Figure 2). In the third clade, the strain from Mataloko in North ACKNOWLEDGEMENTS Wewewa Subdistrict spread outward to Watubero in North Kodi Subdistrict (blue line). There was one strain (RSK A special gratitude is given to Karitas Hospital in 22.4-CCA) from North Wewewa Mataloko, which was Weetabula in Southwest Sumba District and Lende Moripa originally able to use l-arabinose (biotype III). Later on it Hospital in Waikabubak in West Sumba District, East Nusa shifted into a strain of RSK 22.2-CCA which has no ability Tenggara for their assistance in collecting the samples. I to use carbon sources (biotype I). The phylogenetic should also thank Sr. Sili Bouka ADM—the Director of distance showed that the horizontal line of the strain was Karitas Hospital, dr. Loeta Lapoe Moekoe—the Director of longer than that of the strains capable of using arabinose as Lende Moripa Hospital and all doctors of Karitas Hospital the source of carbon. This fact proved that the strain of S. for their assistance during the research. typhi Biotype I strains came up after the strain of S. typhi biotype III. Based on the distribution of S. typhi strains in REFERENCES Southwest Sumba District NTT, it was evident to conclude that the diversity and the spread of the strains were high Amarantini C, Sembiring L, Kushadiwijaya H, Asmara W (2009) only in East Wewewa Subdistrict. From the region, it Isolation, characterization and grouping of Salmonella typhi strains in spread outward to nearby subdistricts such as North the Southwest Sumba Regensy East Nusa Tenggara based on phenotypic characteristics. J Biol Res 14: 191-196. Wewewa and Waikabubak, and then went further out to Chang HR, Loo LH, Jeyaseelan K, Earnest L, Stackebrandt, E (1997) Kodi and North Kodi. The phylogenetic relationships of S. Phylogenetics relationships of Salmonella typhi and Salmonella typhi strains based on the phylogenetic distance value typhimurium based on 16S rRNA sequence analysis. Int J Syst significantly showed that the spread of the diseases as Bacteriol 47: 1253-1254. Chun J (1999) Phylogenetic Editor (PHYDIT). Windows Version. indicated with the blue line and the brown line tends to Drancourt M, Bollet C, Carlioz A, Martelin R, Gayral JP, Raoult D (2000) widen to more remote areas. 16S ribosomal DNA sequence analysis of a large collection of This tendency should get attention because the strains environmental and clinical unidentifiable bacterial isolates. J Clin which were originally from East Wewewa were very Microbiol 38: 3623-3630. Felsenstein J (1993) Phylogeny Inference Package version 3,5c. diverse, some of which were known to be resistant to Distributed by the author. Departement of Genetics, University of nalidixic acid. Moreover, the people who lived in the Washington. Seattle USA. remote rural areas have difficult lives, not only poor in Juke TH, Cantor CR (1969) Evolution of protein molecules. In: Munro economy but also poor in sanitation, food, water, HN (eds) Mammalian protein metabolism. Academic Press, New York. commodities, and limited medical care. Thus, it was Massi MN, Shirakawa T, Gotoh A, Hatta M, Kawabata M (2005) necessary to prevent the spread of the disease from East Identification and sequencing of Salmonella enterica Serotype Typhi Wewewa Subdistrict and to cut off all related factors isolates obtained from patients with perforation and non-perforation supporting its transmission. typhoid fever. Southeast Asian J Trop Med Public Health. 36: 118- 122. Muliawan SY, Surjawidjaja JE (1999) Early diagnosis of typhoid fever by using outer membrane protein of S. typhi as specific antigen. Cermin CONCLUSION Dunia Kedokteran. 124: 11-13. [Indonesia] Saitou N, Nei M (1987) The Neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406-425. All S. typhi isolates from the infected patients in Karitas Steele D (2008) The importance of generating evidence on typhoid fever Hospital in Southwest Sumba District, East Nusa Tenggara for implementing vaccination strategies. J Infect Developing belonged to S. typhi species because of their relativity with Countries 2: 250-252. T Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) the type strain of S. typhi ATCC 19430 . The genetic The CLUSTAL_X windows interface: flexible strategies for multiple diversity of the strains within S. typhi species could be sequence alignment aided by quality analysis tools. Nucleic Acids disclosed using a molecular genetic approach based on 16S Res 25: 4876-4882. rRNA gene sequences. It was evident that the isolates WHO (2003) Background document: the diagnosis, treatment and prevention of typhoid fever. Communicable Disease Surveillance and belonging to S. typhi species form several different centers Response Vaccines and Biologicals. whqlibdoc.who.int/hq/2003/ of diversity within the 16S rRNA gene tree. Each clade WHO_V&B_03.07.pdf. consisted of the strains from different places of origin in BIODIVERSITAS ISSN: 1412-033X (printed edition) Volume 12, Number 1, January 2011 ISSN: 2085-4722 (electronic) Pages: 7-11 DOI: 10.13057/biodiv/d120102

Species diversity of Amorphophallus (Araceae) in Bali and Lombok with attention to genetic study in A. paeoniifolius (Dennst.) Nicolson

AGUNG KURNIAWAN♥, I PUTU AGUS HENDRA WIBAWA, BAYU ADJIE Bali Botanic Garden, Indonesian Institute of Science (LIPI), Candikuning, Baturiti, Tabanan 82191, Bali, Indonesia. Tel.: +62-368-21273; Fax.: +62- 368-22051; email: [email protected]

Manuscript received: 2 July 2010. Revision accepted: 16 August 2010.

ABSTRACT

Kurniawan A, Wibawa IPAH, Adjie B (2011) Species diversity of Amorphophallus (Araceae) in Bali and Lombok with attention to genetic study in A. paeoniifolius (Dennst.) Nicolson. Biodiversitas 12: 7-11. Amorphophallus belongs to Araceae family that consists of more than 170 species worldwide and distributed predominantly in tropical countries, especially in Asia and Africa. The study of Amorphophallus in Bali and Lombok Islands had been conducted to reveal its diversity. Genetic study was also conducted among Amorphophallus paeoniifolius species to recognize the variation within the species. The fieldworks showed three species Amorphophallus distributed in Bali, notably A. muelleri Blume, A. paeoniifolius (Dennst.) Nicolson, A. variabilis Blume and two species in Lombok, notably A. muelleri and A. paeoniifolius. Var. hortensis and var. sylvestris were two varieties of A. paeoniifolius that commonly found either in Bali or in Lombok. Genetic study on A. paeoniifolius indicated that there was no genetic variation in cpDNA region of trnL-F IGS within the species.

Key words: Amorphophallus paeoniifolius, diversity, genetic variation, cpDNA.

INTRODUCTION orange-red, white, white-and-yellow, blue. Seeds globose, subglobose, ovate, elliptic (Hetterscheid and Ittenbach Amorphophallus is belonging to Araceae family that 1996; Jansen et al. 1996; Mayo et al. 1997). consists of more than 170 species worldwide and Amorphophallus paeoniifolius (Dennst.) Nicolson or A. distributed predominantly in tropical countries, especially campanulatus Decne is widely distributed and cultivated in in Asia and Africa. This genus mostly grow in secondary Indonesia and other Asian countries. It has large variation forests or disturbed spots in primary forests and forest in petiole color, such as light to dark green, blackish green, margins, also in tropical humid forest, seasonal forest and gray, reddish or pinkish white. Petiole structure divide in sometimes in humus deposits on rocks (limestone). The two varies, notably rough and smooth. Usually classified majority of Amorphophallus species seem to be pioneers in into two groups A. campanulatus (A. paeoniifolius) var. disturbed vegetations. Many are found at forest margins, in hortensis (smooth petiole) and A. campanulatus (A. open savannah forests, on (steep) slopes, in disturbed parts paeoniifolius) var. sylvestris (rough petiole) (Sugiyama and of primary forest. Relatively few species are known to live Santosa 2008). in dense forest (Hetterscheid and Ittenbach 1996; Mayo et Bali is closely neighboring to Lombok that laid on the al. 1997; Sugiyama and Santosa 2008). Middle to East Indonesia and just separated with 35 km The genus of Amorphophallus has seasonally dormant. strait but the existence of Wallacea line between these The leaves are emerging from tuber, solitary in adult islands make them unique and interesting. Wallace line was plants; the petiole is long, smooth, conspicuously spotted known as imaginary line separating the Oriental (Sunda and marked in a variety of patterns. Blade divided in three Shelf) and Australian (Sahul Shelf) biotas-extends Bali and main branches, primary divisions pinnatisect, secondary Lombok and between Sulawesi and Borneo/Philippines. and tertiary divisions approximately regularly pinnatifid to Alfred Russell Wallace was one of the first to draw pinnatisect. Inflorescence always solitary, usually worldwide attention to the dramatic change in especially flowering without leaves. Spathe variously coloured, inner the fauna of central Malesia region between Southeast surface smooth. Spadix sessile or stipitate; female zone Asian and New Guinean-Australian fauna (van Welzen et shorter, equaling or longer than male zone; subglobose, al. 2005). The fauna studies in Wallacea areas are more terminal appendix usually present, erect. Flowers extensive than flora studies especially in Bali and Lombok. unisexual. Male flower: stamens free, short, filaments The diversity of Amorphophallus never been studied absent or distinct. Female flower: stigma variably shaped, specifically in Bali and Lombok Islands except globally entire and sub-globose or 2-4 lobed or stellate or rarely mentioned on Jansen et al. (1996) and Mayo et al. (1997). punctiform. Infructescence usually long-peduncled; fruiting Technical progress in the determination of DNA part globose or elongate; berries globose or elongate, red, sequence has resulted in an enormous amount of DNA 8 BIODIVERSITAS 12 (1): 7-11, January 2011 sequence data, with technical innovations such as the with 2% glycerol concentration. Electrophoresis was polymerase chain reaction (PCR) accelerating the rate of carried out at 18o C, and 300 volts run for 7 hours in 0.5X increase of this data. This combination of data and TBE buffer. The DNA bands were then visualized using a techniques makes it possible now to exploit sequence DNA Silver Staining method (Pharmacia Biotech, differences between individuals. Such studies can answer Sweden). biological questions, such as genetic variation, allele diversity and hybrid origin. Making comparative studies between individuals inevitably deals with a large number of RESULTS AND DISCUSSION samples, thus the methods employed in such studies should be simple (Hayasi 1991). One such method is PCR-single- Amorphophallus species strand conformation polymorphism (SSCP) analysis. SSCP Based on fieldwork activity, there are three species of is an accurate method for detecting nucleotide differences Amorphophallus obtained from Bali and two species from among PCR products (Lessa and Appelbaum 1993; Yap Lombok. Amorphophallus muelleri Blume, A. paeoniifolius and McGee 1994; Sunnucks et al. 2000). This possibility (Dennst.) Nicolson and A. variabilis Blume represent the promoted our interest in exploring genetic variation in Bali’s Amorphophallus. The Amorphophallus species that Amorphophallus paeoniifolius. recorded in Lombok are A. muelleri and A. paeoniifolius (Table 1). Jansen et al. (1996) reported that Indonesian A. muelleri MATERIALS AND METHODS is found in Sumatra, Java, Flores and Timor. It is not mentioned in Bali and Lombok Island. This species is Species diversity cultivated in Java especially in East Java, conversely Fieldworks conducted at several districts in Bali and cultivated A. muelleri is never found in Bali or Lombok. Lombok to obtain the recent data of Amorphophallus This species is still uncommonly for farmer in Indonesia species. Some reports from fieldworks of Bali Botanic (Soemarwoto 2005). It is still wild and can be found in the Garden staff in both areas are also examined to figure out natural area, such as forest, in the river sides or in the Amorphophallus diversity in the past. The living undisturbing area in Bali and Lombok Islands. Amorphophallus collections of Bali Botanic Garden and its Two varieties of A. paeoniifolius are found either in herbarium specimens in Herbarium Hortus Botanicus Bali or Lombok. A. paeoniifolius var. hortensis (known as Baliense also checked. suweg in Bali and lombos in Lombok) is frequently planted in Bali and Lombok, because its tuber is edible and easily Genetic study processing before consumed. Another variety is A. To study intraspecific genetic variation, multiple paeoniifolius var. sylvestris (known as tiyih in Bali and samples were examined for Amorphophallus paeoniifolius. lombos babi/lombos sawak in Lombok). The last variant is The total DNA was extracted from dried leaf samples from almost not cultivated, whereas it’s commonly found wild in 24 accessions using DNeasy Plant Mini Kit (Qiagen, the forest boundary or in disturbed/unused land. Actually, Tokyo, Japan). The region from trnL (UAA)5´exon to trnF Jansen et al. (1996) separated wild species of A. (GAA), later called trnL-F, was amplified with primer e paeoniifolius into two varieties, notably var. sylvestris and primer f of Taberlet et al. (1991). The PCR products Backer and var. paeoniifolius. The cultivated species also were analyzed using the single-strand conformation divided into two varieties, such as var. hortensis Backer polymorphism (SSCP) method following the procedure of and var. campanulatus (Decaisne) Sivadasan. Watano et al. (2004). The gel was made by using MDE™ gel solution (Cambrex Bio Science Rockhland, Inc., USA)

Table 1. Amorphophallus Species in Bali and Lombok Islands

Samples from Bali Samples from Lombok Scientific name West Central Buleleng Jembrana Karangasem Tabanan Lombok Lombok A. muelleri - - - Ag.225 Ag.173 Ag.183, Ag.184, Ag.185 A. paeoniifolius Ag.195, Ag.196*, Ag.139*, Ag.140* Wb.10, Wb.11*, Ag.148*, Ag.153, Ag.155*, - var. hortensis Ag.197*, Ag.210*, Wb.12a*, Ag.223*, Ag.156*, Ag.160*, Ag.213*, Ag.216*, Wb.12b*, Wb.13, Ag.224*, Ag.162. Ag.171*, Ag.225a, Ag.227* Ag.175*, Ag.181, Ag.182 A. paeoniifolius Ag.205*, Ag.207*, Ag.146*, Ag.147* Wb.14 Ag.228* Ag.161, - var. sylvestris A. variabilis Ag.200, Ag.202, - Wb.16, Wb.17, - - - Ag.203, Ag.204, Ag.206, Ag.208, Ag.209, Ag.211 Note: * = leaves samples of A. paeoniifolius were used in genetic test. KURNIAWAN et al. – Species diversity of Amorphophallus in Bali and Lombok 9

Amorphophallus variabilis is only known wild in Amorphophallus variabilis several Island in Indonesia such as Java, Madura and Diameter tuber is commonly small, about 10-15 cm, Kangean Islands (Jansen et al. 1996). In fact, this species very dark, rough, producing seasonal rhizomatous buds. also distribute in some districts in Bali Island. It could be a Petiole 50-75 cm long and up to 120 cm according to new record for uncommon A. variabilis in Bali although it Jansen et al. (1996), smooth, sometimes glossy, variegated can be recognized easily from its bad smell flowers when surface color from pale green, greenish brown, pure green come close to the night. to pale brown, with randomly whitish green to dark green The diversity of Amorphophallus that mentioned above irregular spots. Lamina or blade 50-75 cm in diameter and represented that the Wallace line is not to be the strict up to 125 cm (Jansen et al. 1996); almost similar with A. boundaries between Bali and Lombok although each island paeoniifolius lamina, leaflets elliptical to lanceolate, 4-34 is separated with this line. This result is probably agreed cm x 2-12 cm. Peduncle about 50-60 cm, 1-2 cm diameter. with van Welzen et al. (2005) that mentioned the Wallacea Inflorescence is longest than A. muelleri and A. area comprises Java, the Philippines, Sulawesi, the Lesser paeoniifolius; spathe narrowly short, up to 20 cm or 1/3-1/4 Sunda Islands (include Bali and Lombok Island), and spadix length, limb pale green-green with randomly whitish Maluku. So the diversity between Bali and Lombok is spots outside, creamy white-ivory inside. Spadix is similar because it’s still in the same region, Wallacea. commonly very longer than spathe. When inflorescence is flowering, it’s commonly known with bad smell that Amorphophallus descriptions appearing early in the evening. Only unripening Amorphophallus muelleri infructescens found during fieldwork, cylindrical, densely Diameter tuber 20 cm and up to 28 cm, dark brown, arranged, green. Jansen et al. (1996) reported the ripening smooth, often without nodes or bud, with densely whitish- fruit is orange-red with 1-3 seeded. ivory root in petiole base. Petiole about 40-50 cm long, diameter 1-5 cm, smooth, pale green and rarely brownish, Key to Bali and Lombok of Amorphophallus species with numerous whitish green continuous spot. Lamina or 1.a. Leaflets without bulbils on the venation blade very dissected, carrying epiphyllar bulbils on the intersections ...... 2 major ramifications on the venation intersections; leaflets 1.b. Leaflets with several bulbils on the venation lanceolate, 10-35 cm x 4-9 cm. Peduncle 30 cm and up 60 intersections ...... A. muelleri cm (Jansen et al. 1996), diameter 1-3 cm. Inflorescence smaller than A. paeoniifolius but wider and bigger than A. 2.a. Petiole smooth or slightly glabrous ...... 3 variabilis, inflorescence is absent during fieldwork. 2.b. Petiole strongly verrucose-echinate or corrugate ..... According to Jansen et al. (1996), spathe size is 7.5-27 cm ...... A. paeoniifolius var. sylvestris x 6-27 cm, limb semi erect or spreading, brownish-purple or grayish-greenish outside, inside purplish or brownish 3.a. Inflorescence bigger and wider; limb spreading with greenish or brownish spots; spadix longer than spathe, and strongly undulate, pale green to brown with 8-30 cm long. Inflorescence does not produce unpleasant pale green-whitish green spot outside, glossy dark odors. Infructescence cylindrical to narrowly triangular, brown to dark red-purple inside ...... berry cylindrical to ovoid, 12-18 mm long, bright red...... A. paeoniifolius var. hortensis 3.b. Inflorescence narrowly long, smaller. limb pale Amorphophallus paeoniifolius green-green with randomly whitish spots outside, Diameter tuber 25 cm and up to 30 cm, dark brown, creamy white-ivory inside ...... A. variabilis rough with several nodes and producing seasonal rhizomatous buds. Petiole 100 cm and up to 200 cm height, Genetic study on A. paeoniifolius diameter 5-10 cm; strongly verrucose-echinate until The extracted DNA showed high concentration (Figure shallowly corrugate surface, dark green to brownish green 1), and the PCR products were easily amplified about 400 (wild species), slightly verrucose to smooth surface, pale bp of the trnL-F IGS region (Figure 2) which is suitable green to green (cultivated species); with whitish green size for SSCP analysis. The SSCP gels showed only single spots either in wild or cultivated species. Lamina or blade banding pattern for all accessions, this can be interpreted 100-150 in diameter, deeply dissected, rachises winged; there is no sequence variation among the PCR products. leaflets ovate to lanceolate, 3-35 cm x 2-12 cm. Peduncle The accessions which include two varieties of A. 3-15 cm in height and elongating when fruiting until 75 paeoniifolius (var. hortensis and var. sylvestris); however, cm, peduncle surface is similar with petiole both in wild the region examined was not differentiated. The cpDNA and cultivated species; peduncle turns brownish green- known to have very slow mutation rate (Clegg et al. 1994) brown when fruit is ripening. Inflorescence is biggest and would be better to use in the study between species. among two other Amorphophallus. Spathe 10-30 cm x 15- Thus, the placement of two varieties in one species A. 50 cm, limb spreading and strongly undulate, pale green to paeoniifolius may be appropriate. The application of PCR- brown with pale green-whitish green spot outside, glossy SSCP method was widely used in various taxa such as dark brown to dark red-purple inside. Spadix is longer than ferns (Ebihara et al. 2005; Terada and Takamiya 2006; spathe, 10-25 cm long. Inflorescence produces very Adjie et al. 2007; 2008; Adjie and Lestari 2009), upleasant odors like carcass smell. Infructescens cylindric; gymnosperm (Watano et al. 2004) to human (Orita et al. berry cylindrical, less than 2 cm, bright red. 1989). 10 BIODIVERSITAS 12 (1): 7-11, January 2011

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

Figure 1. Total DNA extracted from Amorphophallus paeoniifolius. M=DNA marker фX174 HaeIII digest (Takara, Tokyo, Japan), 1=Ag139, 2=Ag175, 3=Ag140, 4=Ag146, 5=Ag147, 6=Ag148, 7=Ag156, 8=Ag160, 9=Ag171, 10=Ag196, 11=Ag197, 12=Ag205, 13=Ag207, 14=Ag210, 15=Ag213, 16=Ag216, 17=Ag223, 18=Ag224, 19=Ag227, 20=Ag228, 21=Wb11, 22=Wb12a, 23=Wb12b and 24=Ag155

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Figure 2. PCR product of trnL-F IGS about 450 bp. M=100bp DNA Ladder (Toyobo, Japan).

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

Figure 3. PCR-SSCP gels show no sequence variations within accessions.

Using AFLP and SSR markers (Sugiyama et al. 2006; ACKNOWLEDGEMENTS Santosa et al. 2007) also suggest little variation within A. paeoniifolius collected from Java. These results suggest We wish to acknowledge I Nyoman Sudiatna and I that people play important role in the selection and Nengah Nada for fully assistance in this project. We thank distribution of A. paeoniifolius, reducing genetic variation Dr. Tadashi Kajita and Prof. Yasuyuki Watano (Chiba in a region (Sugiyama and Santosa 2008). They also University, Japan) for invitation and permission to use their suggest the effectiveness of farmers’ participation in the laboratory. This research was funded by Incentive selection of new cultivars in the breeding program. Programs in 2009 Researchers and Engineers-DIKTI LIPI (No.: 22/SU/SP/Insf-Dikti/VI/09).

CONCLUSION REFERENCES This study concluded that: (i) There are three species Amorphophallus in Bali, notably Amorphophallus muelleri Adjie B, Masuyama S, Ishikawa H, Watano Y (2007) Independent origins Blume, A. paeoniifolius (Dennst.) Nicolson and A. of tetraploid cryptic species in the fern Ceratopteris thalictroides. J Plant Res 120: 129-138. variabilis Blume. Whereas, only two species in Lombok Adjie B, Takamiya M, Ohta M, Ohsawa TA, Watano Y (2008) Molecular are A. muelleri and A. paeoniifolius. A. paeoniifolius phylogeny of the lady fern genus Athyrium in Japan based on consists of two varieties, such as A. paeoniifolius var. chloroplast rbcL and trnL-trnF sequences. Acta Phytotax Geobot 59 hortensis and A. paeoniifolius var. sylvestris. (ii) There is (2): 79-95. Adjie B, Lestari WS (2009) Genetic diversity in the fern genus no genetic variation in cpDNA region of trnL-F IGS within Ceratopteris Brongn. Biosaintifika 1 (2): 139-146. [Indonesia] the Amorphophallus paeoniifolius accessions. KURNIAWAN et al. – Species diversity of Amorphophallus in Bali and Lombok 11

Clegg MT, Gaut BS, Learn GH, Morton BR (1994) Rates and patterns of Soemarwoto (2005) Iles-iles (Amorphophallus muelleri Blume); chloroplast DNA evolution. Proc Natl Acad Sci USA 91: 6795-6801. description and other characteristics. Biodiversitas 6 (3): 185-190 Ebihara A, Ishikawa H, Matsumoto S, Lin S, Iwatsuki K, Takamiya M, [Indonesia] Watano Y, Ito M (2005) Nuclear DNA, chloroplast DNA, and ploidy Sugiyama N, Santosa E, Lee ON, Hikosaka S, Nakata M (2006) analysis clarified biological complexity of the Vandenboschia Classification of elephant foot yam (Amorphophallus paeoniifolius) radicans complex (Hymenophyllaceae) in Japan and adjacent areas. cultivars in Java using AFLP markers. Japanese J Trop Agric 50: 215- Am J Bot 92:1535-1547. 218. Hayasi K (1991) PCR-SSCP: A Simple and sensitive method for detection Sugiyama N, Santosa E (2008) Edible Amorphophallus in Indonesia- of mutation in genomic DNA. Genome Res 1: 34-38. potential crops in agroforestry. Gadjah Mada University Press. Hetterscheid WLA, Ittenbach S (1996) Everything you always wanted to Yogyakarta. [Indonesia] know about Amorphophallus, but were afraid to stick your nose Sunnucks P, Wilson ACC, Beheregaray LB, Zenger K, French J, Taylor into!!!! Aroideana 19: 7-131. AC (2000) SSCP is not so difficult: the application and utility of Jansen PCM, van der Wilk C, Hetterscheid WLA (1996) Amorphophallus single-stranded conformation polymorphism in evolutionary biology Blume ex Decaisne. In: Flach M, Rumawas F (eds) Plant Resources and molecular ecology. Mol Ecol 9: 1699-1710. of South-East Asia No. 9. Plants yielding non-seed carbohydrate. Taberlet P, Gielly L, Pautau G, Bouvet J (1991) Universal primers for Prosea, Bogor. amplification of three non-coding regions of chloroplast DNA. Plant Lessa EP, Appelbaum G (1993) Screening techniques for detecting allelic Mol Biol 17: 1105-1110. variation in DNA sequences. Mol Ecol 2: 121-129. Terada Y, Takamiya M (2006) Cytological and genetic study of two Mayo SJ, Bogner J, Boyce PC (1997) The Genera of Araceae. Royal putative hybrids and their parents of Athyrium (Woodsiaceae; Botanic Garden, Kew. Pteridophyta) in Yakushima island, southwestern Japan. Acta Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T (1989) Detection Phytotax Geobot 57 (1): 95-106. of polymorphisms of human DNA by gel electrophoresis as single- van Welzen PC, Silk JWF, Alahuhta J (2005) Plant distribution patterns strand conformation polymorphism. Proc Natl Acad Sci USA 86: and plate tectonics in Malesia. Biol Skr 55: 199-217. 2766-2770. Watano Y, Kanai A, Tani N (2004) Genetic structure of hybrid zones Santosa E, Lian C, Paisooksantivatana Y, Sugiyama N (2007) Isolation between Pinus pumila and P. parviflora var. pentaphylla (Pinaceae) and development of polymorphic microsatellite markers in revealed by molecular hybrid index analysis. Am J Bot 9:65-72. Amorphophallus paeoniifolius (Dennst.) Nicolson, Araceae. Mol Ecol Yap EPH, McGee JOD (1994) PCR Technology current innovation. CRC, Notes 7 (5): 814-817. London. BIODIVERSITAS ISSN: 1412-033X (printed edition) Volume 12, Number 1, January 2011 ISSN: 2085-4722 (electronic) Pages: 12-16 DOI: 10.13057/biodiv/d120103

Pulsed Field Gel Electrophoresis (PFGE): a DNA finger printing technique to study the genetic diversity of blood disease bacterium of banana

HADIWIYONO1,♥, JAKA WIDADA2, SITI SUBANDIYAH2, MARK FEGAN3 1Departement of Agronomy, Faculty of Agriculture, Sebelas Maret University (UNS), Jl. Ir. Sutami 36A, Surakarta 57126, Central Java, Indonesia. Tel.: +62-21-0271637457, Fax.: +62-21-0271637457 , email: [email protected] 2Post Graduate School, Faculty of Agriculture, Gadjah Mada University (UGM), Yogyakarta 55281, Indonesia 3School of Molecular and Microbial Sciences, and Cooperative Research Center for Tropical Plant Protection, University of Queensland, Australia

Manuscript received: 30 April 2010. Revision accepted: 10 August 2010.

ABSTRACT

Hadiwiyono, Widada J, Subandiyah S, Fegan F (2011) Pulsed Field Gel Electrophoresis (PFGE): a DNA finger printing technique to study the genetic diversity of blood disease bacterium of banana. Biodiversitas 12: 12-16. Blood disease bacterium (BDB) is the most important pathogen of bananas in Indonesia. In some field, the disease incidence reaches over 80%. Epidemiologically, the disease is similar to Moko disease in South America and Bugtok disease in the Philippines caused by Ralstonia solanacearum race 2. However, BDB is different in phenotype and genotype from the two diseases. Previously BDB was limited in South Sulawesi since 1920s – 1980s and recently was reported in 27 of 30 provinces in Indonesia. Pulsed-Field Gel Electrophoresis (PFGE) is a genomic DNA fingerprinting method, which employs rare cutting restriction endonucleases to digest genome prior to electrophoresis using specialized condition to separate of large DNA fragments. The results showed that PFGE analysis was a discriminative tool to study the genetic diversity of BDB. Based on the PFGE analysis, BDB isolates obtained from different localities in Yogyakarta and Central Java were quit diverse.

Key words: blood disease bacterium, banana, PFGE.

INTRODUCTION disease incidences varied from 10 thousands to millions of banana cluster (General Directorate of Horticulture of In growing bananas (banana and plantain), blood Indonesia 2006; Subandiyah et al. 2006). disease was a major obstacle of banana production in Up to now, the blood disease is still difficult to control Indonesia (Supriadi 2005). The causal agent of the disease due to a poor fundamental knowledge about ecology and is called blood disease bacterium (BDB) that formerly was epidemiology of the disease such as how the pathogen called Pseudomonas celebensis by Gauman and used to survive in soil, whether the pathogen associates with root reinstatement by Eden-Green at al. (1988), but it is no systems of non-host plants, and whether widespread is the longer valid and has disappeared in the latest literatures problem in naturally occurring Heliconia and Musa spp. (Supriadi 2005). Epidemiologically, the disease is similar etc. It is obvious that in-depth studies on the ecology and to Moko disease in South America and Bugtok disease in epidemiology of blood disease bacterium of banana are the Philippine caused by Ralstonia solanacearum race 2. urgently required (Fegan 2005). However, BDB is different in phenotype and genotype Genetic variability of pathogen is one of the important from the two diseases (Eden-Green 1994; Eden-Green et al. themes in ecological study on bacterial wilt disease 1998; Prior and Fegan 2005). In the fields, the pathogen is (Persley et al. 1985). Ecologically, Cook and Baker (1983) high virulent in cooking banana (ABB genomic group) viewed that the occurrence of a plant disease epidemic varieties (Eden-Green 1994) but other varieties were also indicated that some aspect of the biological network is not susceptible to BDB by artificial inoculation (Sudirman and equilibrium: (i) the pathogen is genetically homogeneous Supeno 2002). The national loss of banana production due and highly virulent, in high inoculums density, or not in to the blood disease was estimated around 36% in 1991 equilibrium with the antagonists; (ii) the abiotic (Muharam and Subijanto 1991). The damage of banana environment is relatively more favorable to the pathogen plants in certain districts where ABB genomic group are than to the host and/or antagonists; (iii) the host plant is planted such as Bondowoso and Lombok, were extremely genetically homogeneous, highly susceptible, and serious. The disease incidence could reach over 80%s continuously or extensively grown; (iv) the antagonists are (Mulyadi and Hernusa 2002; Supeno 2002; Supriadi 2005). absent or in low populations, lack nutrients, or the proper Cahyaniati et al. (1997) estimated the actual loss from environment to function as antagonist, are inhibited by Lampung Province was about 64%s. The pathogen has other microorganisms. Conversely, the absence of a disease been distributed in 90%s of provinces in Indonesia with the epidemic indicates that the pathogen is absent, or its HADIWIYONO et al. – PGFE for blood disease bacterium of banana 13 population genetically diverse, the host is highly resistant digestion, 1 mL of 0.5xTBE was added to the Eppendorf or at least minimally diverse, the abiotic environment is tube to stop the reaction and allowed the plugs to sit in unfavorable to the pathogen in a part or all of the time, or running buffer for at least 15 minutes. The λ marker was antagonists are inhibitory to the pathogen. also pre-incubated in the running buffer for 15 minutes. Ecologically, to sustain their generation, to survive, to CHEF type (BioRadTM) was used for PFGE running. persist and to adapt a life in their habitat or varies Running conditions: the electrophoresis chamber was filled unfavorable environmental condition, organism species with 2.2 L of fresh 0.5xTBE buffer, and chiller was evolve a complex genetic character and each character is adjusted to get 14°C. The running program was consisted genetically diverse in a species. A complex interaction of initial switch time, 2.16s; final switch time, 54.17 s; among many different gene products determines the ability duration of run, 19 h, angle, 120°; gradient, 6 V/cm with a of a bacterium to cause disease (Brown and Caitilyn 2005). linear ramping factor. DNA fragments were stained with Among the genetic characters are pathogenicity fitness, EtBr. DNA fragments were visualized under UV virulence, aggressiveness, penetration capability in host, transilluminator and documented using digital camera. survival capability in host and/or environment etc. NTSYS soft ware was used to analyze the similarity of The capacity to cause plant disease has evolved in DNA banding pattern and dendrogram. PFGE grouping relatively small number of bacterial species which are was based on reproducibility of the technique. The phenotypically and genetically diverse. Below the level of reproducibility was determined by repeating PFGE with the species the strains that make up these species also vary isolate PTI-1 on three separate occasions. In addition, DNA in genotype and phenotype. Traditionally phenotypic from this isolate was run three times in each gel as standard techniques such as substrate utilization profiles and total for PFGE typing (Valverde et al. 2007). fatty acid composition have been employed to characterize plant pathogenic bacteria. Recently more reliable DNA- based methods have been applied which provide a more RESULTS AND DISCUSSION complete understanding of genetic and evolutionary relationships of bacteria (Fegan and Hayward 2004). Fourteen isolates of BDB were analyzed to investigate Pulsed-field gel electrophoresis (PFGE) is a genomic the genetic diversity of the isolates. DNA fragments DNA fingerprinting method, which employs rare cutting generated by XbaI restriction endonuclease digestion of restriction endonucleases to digest the genomic DNA of genomic DNAs of the isolates prior to PFGE analysis were bacteria which is then subjected to electrophoresis using presented in Figure 1. specialized condition for separation of large fragments of The results showed that PFGE analysis was a DNA (Fegan and Prior 2005). Coenye et al. (2002) suggested discriminative tool to study genetic diversity of BDB. Using that PFGE are the best method to study epidemiology of 14 isolates from Yogyakarta and Central Java areas, BDB human bacterial diseases, such as Neisseria meningitides were quit diverse. Digestion of BDB genome with XbaI (Popovic at al. 2001), Campylobacter jejuni (Ribot et al. and visualization with PFGE showed that each isolate 2002), Stenotrophomonas maltophilia (Berg et al. 1999, could generate between 14 to 17 convenient fragments with Valdezate 2004) Staphylococcus aureus (Schlichting at al. average 15.64±0.74. Whereas based on position of the 1993) Salmonella enterica, Shigella sonnei and Listeria fragments within 14 isolates of BDB, the PFGE could monocytogenes (Hunter et al. 2005; Kubota 2005). generate 21 fragments. Clinically, it is an invaluable tool in detecting the Through analysis with the un-weighted pair group occurrence of an outbreak and trying to determine its method arithmetic average (UPGMA) to fragment pattern source (Hentea 2004). This paper reports the evaluation of of 14 isolates of BDB generated a tree plots with PFGE analysis as a tool for analyzing diversity of BDB coefficient of similarity among the isolates (Figure 2). In isolates from some district in Yogyakarta and Central Java. reproducibility testing, the banding pattern of the reference isolate was obtained a baseline of the level of similarity between three different replicates, at 94%. Therefore, a cut MATERIALS AND METHODS off the value of 94% was used to define as a PFGE type. Based on the criterion, the PFGE analysis generated 5 The PFGE method used in this study was based upon strains of 14 isolates of BDB. It means that BDB in procedures as described by Popovic et al. (2001) with some Yogyakarta and Central Java are diverse. At least 9 isolates modifications. Plugs were prepared with 1 mL of the bacterial from Yogyakarta and Central Java were grouped in one 8 suspension with OD600nm=0.1 ( 10 cfu/mL), harvested pulsed-field gel types (strain III). The isolates were GRG-1, from 5 days BDB culture on CPG broth. Proteinase-K was KRA-1, SRG-1, MGL-1, TMG-1, TMG-2, SMG-1, BTL-1, used for lysing of the bacterial cells in the plugs with and KLT-1, implying that those strains were the most conditioning at 50 oC over night, continued by soaking the common pathogen in the provinces. Whereas the other plugs in 3 mL TE and shaking for an hour. This washing isolates (strains I, II, IV, V) were the minor strain in the step was done 4 times, and then the plugs were placed in a provinces. final volume of 1 mL TE (Tris-EDTA) and stored at 4oC. The PFGE method is excellent in type ability, Restriction enzyme XbaI was used for digesting the reproducibility, and discriminatory (Basim and Basim bacterial DNA genome (at 20 units per 20 µl prepared in 2001; Coenye at al. 2002). Whereas Hielm et al. (1998) restriction buffer) and incubated at 37 oC for 4 hours. After suggested that PFGE analysis is a reproducible and 14 BIODIVERSITAS 12 (1): 12-16, January 2011 discriminating epidemiological method for studying decades (Supriadi 2005). It is possible that blood disease Clostridium botulinum group II at the molecular level. The epidemics in out of Sulawesi Islands are related to blood present results indicated that BDB was a diverse pathogen. disease epidemic in the first island and it should be In facts, previously reported that BDB was limited in confirmed with farther researches using a number of BDB Sulawesi Island (Eden-Green 1994) and significant isolates originated from different provinces in Indonesia. explosive incidence of the disease occurred in the latest

—727.5kb — 582.0kb

— 339.5kb

—194.0kb

— 97.0kb — 48.5kb — 30kb

Figure 1. DNA fragments generated by Restriction endonuclease digestion of total DNAs from isolates of BDB with XbaI after pulsed field gel electrophoresis (PFGE), where 1. PTI-1 (Pati), 2. GRB-1, 3. GRB 3 (Grobogan), 4. PWR-1 (Purworejo), 5. KRA-1 (Kranganyar), 6. SRG-1 (Sragen), 7. BYL-1 (Boyolali), 8. KLT-1 (KLT), 9. SMG-1 (Semarang), 10. BTL-1 (Bantul), 11. TMG-1, 12. TMG-2 (Temanggung), 13. MGL-1 (Magelang), 14. SLM-1 (Sleman), M. Marker (Lambda Ladder).

0.94 Groups/ Types

PTI-1 — I GRG- — II 1 GRG- 3 KRA-1 SRG-1

MGL-1

TMG-2 III TMG-1 BTL-1

SMG-1 KLT-1 BYL-1 IV SLM-1 PWR-1 — V

0.70 0.77 0.85 0.92 1.00 Coefficient of similarity

Figure 2. The UPGMA-dendrogram presenting the diversities of BDB isolates based on DNA fragments generated by restriction endonuclease digestion of total DNAs with XbaI visualized by PFGE, where 1. PTI-1 (Pati), 2. GRB-1, 3. GRB 3 (Grobogan), 4. PWR-1 (Purworejo), 5. KRA-1 (Karanganyar), 6. SRG-1 (Sragen), 7. BYL-1 (Boyolali), 8. KLT-1 (Klaten), 9. SMG-1 (Semarang), 10. BTL-1 (Bantul), 11. TMG-1, 12. TMG-2 (Temanggung), 13. MGL-1 (Magelang), 14. SLM-1 (Sleman), M. Marker (Lambda Ladder) HADIWIYONO et al. – PGFE for blood disease bacterium of banana 15

Basically, BDB is diverse in population. The spreading ACKNOWLEDGEMENTS BDB to other provinces in Indonesia may lead to an increase the heterogeneousness of BDB due to its internal This research was major founded by Fundamental interaction within strains and with others environmental Research Program of The General Directorate of the conditions in where pathogen was introduced. Goto (1990) Graduate School, The Department of Indonesian National explained that bacteria have a great capacity to adapt to Education, Contract No. 017/SP2H/PP/DP2M/III/2008 and diverse environments through mutation, gene transfer, of partially by Gadjah Mada University (GMU)-Australian metabolic regulator. Basim et al (1999) opinioned the Center for International Agricultural Researches, Contract frequency of horizontal gene transfer among bacterial No. ACIAR CP2004/034 with Prof. Dr. Siti Subandiyah as strains could be in a high level. The authors verified that a leader of the project. the frequency of kanamycin resistance transfer to recipient was more than 75 times greater in planta (paper leaves) than in vitro. This gene transfer explains the great frequent REFERENCES among strains of bacterial spot pathogen (X. axonopodis pv. vesicatoria) in term of polymorphism, which is General Directorate of Horticulture of Indonesia (2006) Distribution indicated by the high diversity in population. pattern of plant pests and diseases. www.deptan.go.id/ditlinhorti. Comparing to the diversity of BDB generated by rep- [Indonesia]. Basim H, Stall RE, Minsavage GV, Jones JB (1999) Chromosomal gene PCR with BOXAIR primer (Subandiyah et al. 2006), this transfer by conjugation in the plant pathogen Xanthomonas results showed that PFGE is more distinctive than those axonopodis pv. vesicatoria. Phytopathology 89: 1044-1049. rep-PCR. rep-PCR could generated 10 fragments with Basim E, Basim H (2001) Pulsed-field gel electrophoresis (PFGE) different position and among 20 isolates only isolate 29- techniques and its use in molecular biology. Turk J Biol 25: 408-418. Berg G, Roskot N, Smalla K, (1999) Genotypic and phenotypic LPG and 32-PLU (Central Sulawesi) showed specific relationships between clinical, and environmental isolates of fragment pattern. Whereas the PFGE could generate 21 Stenotrophomonas maltophilia. J Clin Microbiol 37: 3594-3600. different positioned fragments and generated 5 groups or Brown D, Caitilyn (2005) Understanding the molecular basis of bacterial pulsed field gel types of 14 isolates. Moreover, Coenye et wilt disease: a view from the inside out. In: Allen C, Prior P, Hayward AC (eds). Bacterial wilt disease and the Ralstonia solanacearum al. (2002) suggested that PFGE was more reproducible than species complex. APS Press, St. Paul, Minnesota USA. RAPD (random amplified polymorphic DNA) and BOX- Cahyaniati C, Mortensen N, Mathur SB (1997) Bacterial wilt of banana in PCR finger printing in genomic typing of Burkholderia Indonesia. Technical Bulletin. Directorate Plant Protection of cepacia Genomovar III. Indonesia, Jakarta. Coenye T, Spilker T, Martin A, LiPuma JJ (2002) Comparative Frey et al. (1996) characterized a number isolate of P. assessment of genotyping method of Burkholderia cepacia genevor solanacearum. Comparison of among data obtained clearly III. J Clin Microbiol 40: 3300-3307. identified that PFGE is the most discriminatory method Eden-Green SJ (1994) Diversity of Pseudomonas solanacearum and delineating 17 pulse-field gel types, rep-PCR and related bacteria in South East Asia: new direction for moko disease. In: Hayward AC, Hartman GL (eds) Bcaterial wilt: the disease and its bacteriocin typing identified nine rep-PCR profile types causative agent, Pseudomonas solanacearum. CAB International, and nine bacterioncin groups. In a research employed by California. Smith et al. (1995), showed that genomic fingerprinting of Eden-Green S.J, Supriadi, Hastati SY (1998) Characteristics of P. solanacearum by PFGE revealed a level of genetic Pseudomonas celebensis, the cause of blood disease of banana in Indonesia. In: Proceedings of the 5thinternational congress of plant diversity previously unrealized using both ERIC-PCR and pathology (abstract). Kyoto, August 20-27, 1998. BOX-PCR. Basim et al. (1999) used PFGE for Fegan M (2005) Bacterial wilt diseases of banana: evolution and ecology. investigating the frequency of chromosomal gene transfer In: Allen C, Prior P, Hayward AC (eds) Bacterial wilt disease and the by conjugation and PFGE could verified the transfer gene Ralstonia solanacearum species complex. APS Press, St. Paul, Minnesota USA. occurrence among strain of Xanthomonas axonopodis pv. Fegan M, Prior P (2005) How complex is the “Ralstonia solanacearum vesicatoria in a natural niche of the bacterium. Zhang and species complex”? In: Allen C, Prior P, Hayward AC (eds) Bacterial Geider (2005) observed isolates of Erwinia amylovora wilt disease and the Ralstonia solanacearum species complex. APS using PFGE analysis, and through this way the bacteria Press, St. Paul, Minnesota USA. Fegan M, Hayward C (2004) Genetic diversity of bacterial pathogen. In: were grouped and differentiated into several strains Gillings M, Holmes A (eds) Plant microbiology. Bios Scientific, correlated to their origin. So it is useful to hints about London. course and distribution of the plant disease. Frey P, Smith JJ, Albar L, Prior P, Saddler GS, Trigalet-Demery D, Trigalet A (1996) Bacteriocin typing of Burkholderia (Pseudomonas) solanacearum race 1 of the Frence West Indies and correlation with genomic variation of pathogen. Appl Environ Microbiol 62: 473-479. Goto M (1990) Fundamental of bacterial plant pathology. Academic CONCLUSION Press, San Diego, CA. Hentea C (2004) Pulsed-field gel electrophoresis: a microbial experience. http//www.cdc.gov/pulse net/publication/2004/Hnetea_e.htm. Hielm B, Bjorkroth J, Hyytia E, Koreala H (1998) Genomic analysis of Pulsed-field gel electrophoresis (PFGE) analysis was a Clostridium botulinum group ii by pulsed-field gel electrophoresis. discriminative tool to study the genetic diversity of blood Appl Environ Microbiol 64: 703-708. disease bacterium (BDB). Based on the PFGE analysis, Hunter SB, Vauterin P, Lambert-Fair MA, van Duyne MS, Kubota K, BDB isolates obtained from different localities in Graves L, Wrigley D, Barrett T, Ribot E (2005) Establishment of universal size standard strain for use with the pulsed-field gel Yogyakarta and Central Java were quit diverse. electrophoresis protocols: converting the national databases to new size standard. J Clin Microbiol 43 : 1045-1050. 16 BIODIVERSITAS 12 (1): 12-16, January 2011

Kubota K, Barrett TJ, Ackers ML, Brachman PS, Mintz ED (2005) Smith JJ, Offord LI, Holddrness M, Saddler GS (1995) Genetic diversity Analysis of Salmonella enterica serotypic pulsed-field gel of Burkholderia solanacearum (synonym Pseudomonas electrophoresis patterns associated with international travel. J Clin solanacearum) race 3 in Kenya. Appl Environ Micribiol 61: 4263- Microbiol. 43: 1205-1209. 4268. Mulyadi, Hernusa T (2002) Blood disease intensity on banana caused by Subandiyah S, Hadiwiyono, Nur E, Wibowo A, Fegan M, Taylor P (2006) bacterium of Pseudomonas solanacearum in Bondowoso. In: Survival of blood disease bacterium of banana in soil. In: Proceeding Proceeding of the 16th congress and national seminar of the of the 11th international conference on plant pathogenic bacteria. Indonesian Phytopathological Society. Bogor, 22-24 August 2001 Edinburgh, 10-14 July 2006. [Indonesia]. Sudirman, Supeno B (2002) Screening some varieties of banana to Persley GJ (ed). 1985. Bacterial Wilt Disease in Asia and the South infection of blood disease of banana. In: Proceeding of the 16th Pacific. ACIAR Proceedings No. 13, 15-24, Canberra, Australia. congress and national seminar of the Indonesian Phytopathological Popovic T, Schmink S, Rosentein NA, Ahello GW, Reeves MW, Plikaytis Society. Bogor, 22-24 August 2001 [Indonesia]. B, Hunter SB, Ribot EM, Boxrud D, Tondella MI, Kim C, Noble C, Supeno B. 2002. Isolation and characterization of banana blood disease in Mothershed E, Besser J, Perkins BA (2001) Evaluation pulsed-field Lombok. In: Proceeding of the 16th congress and national seminar of gel electrophoresis in epidemiological investigations of the Indonesian Phytopathological Society. Bogor, 22-24 August 2001 meningococcal disease outbreaks caused by Neisseria meningitidis [Indonesia]. serogrop. J Clin Microbiol 39: 75-85. Supriadi (2005) Present status of blood disease in Indonesia. In: Allen C, Prior P, Fegan M (2005) Diversity and molecular detection of Rasltonia Prior P, Hayward AC (eds) bacterial wilt disease and the Ralstonia race 2 strains by multiplex PCR. In: Allen C, Prior P, Hayward AC solanacearum species complex. APS Press, St. Paul, Minnesota USA. (eds) Bacterial wilt disease and the Ralstonia solanacearum species Valdezate S, Vindel A, Martin-Davila P, Del Saz BS, Baguero F, Canton complex. APS Press, St. Paul, Minnesota USA. R (2004) High genetic diversity among Stenotrophomonas Ribot EM, Fitzgerald C, Kubota K, Swaminatan B, Barett TJ (2002) maltophilia strains despite their originating at a single hospital. J Clin Rapid pulsed-field gel electrophoresis protocol for subtyping of Microbiol 42: 693-699. Campylobacter jejuni. J Clin Microbiol 39: 1889-1894. Valverde A, Hubert T, Stolov A, Dagar A, Kopelowitz J, Burdman S Schlichting C, Branger C, Fournier JM, Witte W, Boutonnier A, Woltz C, (2007) Assessment of genetic diversity of Xanthomonas campestris Goullet P, Doring G (1993) Typing of Staphylococcus aureus by pv. campestris isolates from Israel by various DNA fingerprinting pulsed-field gel electrophoresis, zymotyping, capsular typing, and techniques. Plant Pathol 56: 17-25. phage typing resolution of clonal relationships. J Clin Microbiol 20: Zhang Y, Geider K (2005) Differentiation of Erwinia amylovora strains 2599-2605. by pulsed-field gel electrophoresis. Appl Environ Microbiol 63: 4421- 4426. BIODIVERSITAS ISSN: 1412-033X (printed edition) Volume 12, Number 1, January 2011 ISSN: 2085-4722 (electronic) Pages: 17-21 DOI: 10.13057/biodiv/d120104

Diversity and phosphate solubilization by bacteria isolated from Laki Island coastal ecosystem

SRI WIDAWATI♥ Microbiology Division, Research Centre for Biology, Indonesian Institute of Sciences (LIPI), Jl. Raya Bogor-Jakarta km 46, Cibinong-Bogor 16911, West Java, Indonesia, Tel.: +62-21-8765 066-67, Fax.: +62-21-8765 , email: [email protected]

Manuscript received: 5 June 2010. Revision accepted: 30 July 2010.

ABSTRACT

Widawati S (2011) Diversity and phosphate solubilization by bacteria isolated from Laki Island coastal ecosystem. Biodiversitas 12: 17- 21. Soil, water, sand, and plant rhizosphere samples collected from coastal ecosystem of Laki Island, Jakarta, Indonesia were screened for phosphate solubilizing bacteria (PSB). While the population was dependent on the cultivation media and the sample type, the highest bacterial population was observed in the rhizosphere of Ipomoea aquatica. The PSB strains isolated from the sample registered 18.59 g- 1L-1, 18.31 g-1L-1, and 5.68 g-1L-1 of calcium phosphate (Ca-P), Al-P and rock phosphate solubilization after 7-days. Phosphate solubilizing capacity was the highest in the Ca-P medium. Two strains, 13 and 14, registered highest phosphomonoesterase activities (2.01 µgNP.g-1.h-1 and 1.85NP µg.g-1.h-1) were identified as Serratia marcescens, and Pseudomonas fluorescens, respectively. Both strains were isolated from the crops of Amaranthus hybridus and I. aquatica, respectively, which are commonly observed in coastal ecosystems. The presence of phosphate solubilizing microorganisms and their ability to solubilize various types of phosphate species are indicative of the important role of both species of bacteria in the biogeochemical cycle of phosphorus and the plant growth in coastal ecosystems.

Key words: phosphate solubilization, coastal ecosystem, Serratia marcescens, Pseudomonas fluorescens.

INTRODUCTION lactate, oxalate, malate and citrate), amino acids, vitamin and growth promoting substances like (IAA/indole-3-acetic Soil microorganisms play a significant role in the food acid) as well as gibberellic acid that stimulate the growth of chain and the various biogeochemical cycling of carbon, the plants (Richardson 2001; Gyaneshwar et al. 2002; nitrogen, sulfur and phosphorus (Kummerer 2004; Das et Ponmurugan and Gopi 2006). The mineralization of organic al. 2007; Banig et al. 2008). Though phosphate solubilizing phosphate have been reported to be mediated through the bacteria (PSB) like Pseudomonas, Serratia, Bacillus, production of phosphatase enzymes (phosphomonoesterase, Flavobacterium and Corynebacterium have been reported phosphodiesterase, triphosphomonoesterase and phosphor- - from various ecosystem types such as terrestrial ecosystem amidase) which hydrolyse organic-P into H2PO4 and = especially soil, and water ecosystem including coastal, HPO4 (Pang and Kolenk 1986; Mearyard 1999; Lal 2002). offshore and mangrove ecosystems (Seshadri et al. 2002; Research on the phosphatase enzyme can benefit Young et al. 2006), their population has been occasionally sustainable organic farming systems especially in coastal very low, about less than 10-2 CFU per gram (Peix et al. ecosystems, and reduce the utilization of agrochemicals in 2004). A series of observation indicates that the highest agricultural fields in Indonesian coasts. As isolation of PSB population of PSB (an average of 108 CFU per gram of from the highly saline farmlands have been termed sample) was found in fertile soil of forests, organic farming important prior to the use of PSB as biofertilizer in those and rhizosphere (Widawati et al. 2005; Widawati and areas (Bashan et al. 2000), this study was conducted to Suliasih 2006; Widawati and Suliasih 2009), as well as determine the potentials of PSB isolated from Laki Island mangrove and shorelines (De Souza et al. 2000). coasts, Jakarta bay, Indonesia and surroundings to enhance the Phosphate solubilizing bacteria form sea sediments organic farming in the high saline areas. were reported to be capable of accelerating the dissolution of apatite phosphate within the phosphorus cycle interacting with the carbon cycle (Thingstad and Rossouzadegan MATERIAL AND METHODS 1995). Phosphate solubilizing bacteria (PSB) living in both terrestrial and water ecosystem play a vital role in Isolation and enumeration of PSB supplying phosphorus to plants (Gyaneshwar et al. 2002; Samples were collected from soil and rhizosphere of Widawati and Rahmansyah 2009), which improves and plant in coastal areas, mangrove, and sea water (Figure 1). maintain the fertility of farmlands (Shekar et al. 2000). About 0.2 mL of serially diluted sample was put into a They are capable of producing organic acids (acetate, formate, sterile petridish containing Pikovskaya’s medium - PM1 [5 18 BIODIVERSITAS 12 (1): 17-21, January 2011

g of Ca3(PO4)2. 0.5 g of (NH4)2SO4; 0.2 g of NaCl; 0.1 g of in Schinner et al. (1996). One mL of culture supernatant MgSO4. 7H2O; 0.2 g of KCl; 10 g of Glucose; 0.5 g of was added to 1 mL of 115 mM p-NPP phosphate substrate yeast extract; 20 g of agar; MnSO4 and a little FeSO4, 1000 and 4 mL of buffer at pH 6.5 for acid PMEase and pH 7.5 l-1 of aquadest] (Gaur 1981). For the preparation of other for alkaline PMEase and incubated at 38oC for 1 hour. media, the same media composition was retained but were Subsequently 1 mL 0.5M CaCl2 was added to the reaction. changed as follows; PM1 + 1% NaCl (media 2), PM1 A control reaction was also maintained along with the substituted with seawater (media 3), PM1 with Al3(PO4) sample. The absorbance of both the sample and control was (media 4), PM1 with rock phosphate (media 5). All the measured spectrophotometrically at 400 nm. flasks were incubated at 30oC and observed for 3 to 7 days Identification of PSB for bacterial growth. Population was enumerated daily by Identification of the best isolates was carried out plate count method (Rao 1982). The PSB showing through a 16S RNA analysis (Pitcher et al. 1989). The formation of halozones on around the colonies were scored method of amplification and sequencing of 16S rDNA as positive. The colony of PSB was then purified and sub- according to Rivas et al. (2001) and the sequence obtained cultured in Pikovskaya’s medium for further studies. was compared with those in GenBank by using the FASTA PSB qualitative test program (Pearson and Lipman 1988). The size of halozones determines the ability level of microbes to dissolve the bonded P The purified PSB were then streaked on plates to test their ability to dissolve RESULTS AND DISCUSSION Ca3(PO4)2., Al3(PO4) and rock phosphate. The solubilization was marked with halozone formation around the growing Population of PSBs observed from different environmental colonies and the halozones size were expressed as samples grown on various media is shown in Table 1. Only solubilization efficiency as described by Nguyen et al. Fifteen isolates from twenty five isolates showed formation (1992) and Seshadri et al. (2002) method: E = of halozones around the growing colonies. Phosphate tested Solubilization diameter/growth diameter x 100. (Ca3(PO4)2. Al3(PO4) and rock phosphate) were clearly dissolved by growing colonies (Table 1). Similar results was also found by Antoun (2009, pers. comm.), which Broth assay The PSBs were grown in 100 mL Pikovskaya broth in proves that only 10 out of 31 tested bacteria were able to 250 mL Erlenmeyer flasks containing 5 g L-1 of Ca (PO ) form halozones within the media that contain Ca-P and Al- 3 4 2 P as the source of P. Halozones are formed because of and Al3(PO4) (Gaur 1981). Each flask was inoculated with 9 -1 transformation of glucose into organic acids (Sudiana 2010, 1 mL (10 cfu mL ) of culture and incubated in a rotary o personal communication). Glucose was the carbon source shaker at 120 rpm and 30 C for 7 days. The cultures were used in the test of PSB isolated from the sea to dissolve the centrifuged and analyzed for soluble phosphates (Allen, 1974), pH, and PME activity. bonded phosphor marked by halozones (De Souza et al. 2000). De Souza et al. (2000) and Seshadri et al. (2002) reported that the PSB isolated from coastal, offshore, pH, acid and alkaline of PME mangrove and sea water were able to dissolve P from zinc The pH of culture supernatant was measured directly phosphate (30%), from calcium triphosphate (19%) and using a pH meter. The phosphomonoesterase activities from calcium triphosphate (18%). (acid and alkaline) were measured following the technique

Table 1. Population of PSB in various types of habitats enumerated using five different media; and phosphate dissolution by PSB on plates containing five different media

Altitude Isolate Population of PSB ( 7) Phosphate dissolution by PSB (EP) The ecosystem type of sample collected ∑pop.10 asl. (feet) no. 1 2 3 4 5 1 2 3 4 5 0 Sediment, mangrove, Banten (1) SMJ 12 cd 11 ab 9 ab 0.9 a 7 ab 200 a 100 a 100 a 80 a 50 a 0 Sediment, mangrove, Laki Island (2) SMLI 12 cd 11 ab 9 ab 0.8 a 7 ab 200 a 100 a 100 a 90 a 50 a 0 Sand, Coastal area, Jakarta (3) SCJ 11 cd 10 ab 9 ab 0.8 a 7 ab 200 a 150 a 100 a 100 a 50 a 0 Sand, Coastal area, Laki Island (4) SCLI 11 cd 10 ab 8 ab 0.8 a 6 b 200 a 150 a 100 a 90 a 50 a 0 Sea water, 50 meter from Jakarta (5) SWJ50 8 d 9 b 7 ab 0.7 ab 5 b 200 a 200 a 100 a 80 a 50 a 0 Sea water, 50 meter from Laki Island (6) SWLI50 8 d 9 b 6 b 0.6 ab 5 b 200 a 100 a 100 a 100 a 50 a 0 Sea water (between Jakarta-Laki Island) (7) SWJLI1 7 d 9 b 9 ab 0.5 b 4 b 200 a 150 a 100 a 100 a 100 a 0 Sea water (between Jakarta-Laki Island) (8) SWJLI2 7 d 9 b 8 ab 0.4 b 8 ab 200 a 150 a 100 a 70 a 100 a 23 Rhizosphere mangrove, Banten (9) RMJ 15 c 12 ab 7 ab 0.9 a 9 ab 200 a 100 a 100 a 80 a 100 a 32 Rhizosphere mangrove, Laki Island (10) RMLI 15 c 12 ab 8 ab 0.8 a 10 ab 200 a 200 a 100 a 100 a 150 a 32 Rhizosphere L. leucocephala, Jakarta (11) RLJ 27 b 13 ab 7 ab 0.9 a 10 ab 200 a 200 a 100 a 100 a 100 a 32 Rhizosphere O. sativa, Banten (12) ROJ 30 b 13 ab 9 ab 0.6 ab 10 a 200 a 200 a 100 a 100 a 100 a 32 Rhizosphere A. hybridus, Banten (13) RAJ 32 b 14 a 10 a 0.9 a 11 a 200 a 200 a 200 a 200 a 200 a 32 Rhizosphere I. aquatica, Banten (14) RIJ 40 a 14 a 10 a 0.9 a 11 a 200 a 200 a 200 a 200 a 200 a 32 Soil without plant (15) SWP 15 c 10 ab 7 ab 0.6 ab 10 ab 200 a 200 a 100 a 90 a 100 a Note: Alphabets followed by the same letters in the column are not significantly different analyzed through Duncan’s Multiple Range Test (0.5% level). Nos. 9-15 are the ebb and tide farmlands in the coastal areas. Ability of phosphate dissolution by PSB were recorded after 7-days. WIDAWATI – Phosphate solubilizing bacteria from Laki Island 19

10 11 1 0 1 0 4 2000 6000 1 0001 0001 7 00 00 1 1 8 1 3 1 5 1 1 1 19 1

15 12 14 1 0 1 1 0 13 0 000 000 1 000 000 000 000000 00 00 000 00 Figure 1. Sampling site location. No. of 1-15 refer to Table 1.1 1 000 1 1

PM 1 PM 2 PM 3 PM 4 PM 5 Figure 2. The ability of isolate 14 to dissolve the bonded phosphor within 5 types of Pikovskaya media (PM) and the isolate was identified as Pseudomonas fluorescens species.

Though maximum P solubilization efficiency of 15 was PSB on backwaters (16.7%) is more than that in the coastal observed in two isolates 13 and 14 isolated from areas (15.6%), in the offshore areas (8.7%), and in the rhizosphere of Amaranthus hybridus and Ipomoea beaches (8.1%). This is due to the fact that the organic aquatica, there were differences among the fifteen isolates phosphate is rare in the offshore areas and thus the (Table 1). The size of halozones determines the ability population of PSB is low. The growth of PSB is impeded level of microbes to dissolve the bonded P (Rachmiati with the absence of soluble organic P (Hoppe and Ullrich 1995). The more the size of the halozones formed, the more 1999) and low absorption of C (De Souza et al. 2000). likely the isolates dissolving the bonded P (Figure 2). The ability of PSB to quantitatively dissolve phosphate The PSB population from 15 in 5 types of pikovskaya and pH of the liquid media with various P sources after 7- media show that highest population observed in day incubation was measured using spectrophotometer. It rhizosphere sample of I. aquatica plant. The average shows that all of the tested isolates were able to dissolve 7 7 7 ( ) ( ) number was 40x10 (media 1), 14x10 (media 2), 10x10 the inorganic phosphate of Ca3 PO4 2. Al3 PO4 2 and rock (media 3), 0.9x107 (media 4), and 11x107 (media 5). Thus, phosphate within the medium of liquid Pikovskaya. The more population of PSB was observed in terrestrial highest concentration of dissolve P was found in isolate (rhizosphere soil) than in water (sea, coastal areas, offshore number 14: 18.59 L-1, 18.31 L-1 and 5.68 L-1 (Table 2). areas and mangrove). The results can be seen in Table 1 Meanwhile, isolate number 13 dissolves the highest P and were supported by a research conducted by Kucey et source only in rock phosphate. The lowest concentration al. (1989), which shows that the population of PSB in the was found in the isolates from the sea water, namely rhizosphere areas is more than that in the areas without isolates number 7 and 8 (Table 3). When the phosphate in 5 vegetation. Research conducted by De Souza et al. (2000) media of liquid pikovskaya was dissolved, the pH in all of and Seshadri et al. (2002) reveals that the population of the media decreased (Table 3). The dissolution of 20 BIODIVERSITAS 12 (1): 17-21, January 2011

phosphate involving alteration in pH with the occurrence of synthetic organic compounds released to the medium, oxidation-reduction reactions, and organic ligand competitor (Cunningham and Kuiack 1992). A test conducted by Jeon et al. (2003) shows that Pseudomonas fluorescens dissolves Ca3(PO4)2 after 5-day incubation and pH drops to 4.4. Perez et al. (2007) stated the acidity of a liquid culture is the main mechanism of phosphate dissolution. Whitelaw et al. (1999) also stated that the concentration of phosphate dissolved in the culture media is in line with the acidity and concentration of amino acid as well as pH shift. Rao (1982) stated that the mechanism of inorganic phosphate dissolution, including Ca3PO4, involves pH alteration due to the production of organic acids, such as acetate, citrate and oxalate. Ramachandran et al. (2007) stated that since the isolate is able to release inorganic phosphate from Ca3(PO4)2 in the liquid media, the bacteria have the potentials to dissolve the bonded P and thus make it available for the plants. All of the isolates were grown in the media using 3 different sources of phosphate (Ca3(PO4)2. ), Al3(PO4)2. and rock phosphate). All of the tested isolates produce fosfomonoesterse enzyme (PME-ase acid and base). Isolate 13 reaches the highest value, namely: 2.01 ugPNP g-1h-1 (PME-ase acid), 1.85 ugPNP g-1h-1 (PME-ase base), 2.01 ugPNP g-1h-1 (PME-ase acid), 1.36 ugPNP g-1h-1 (PME-ase base), and 3.14 ugPNP g-1h-1 (PME-ase acid), 0.57 ugPNP g-1h-1 (PME-ase base) (Table 2). Isolate number 14 also reaches the highest value: 2.01 ugPNP g-1h-1 (PME-ase acid and base), 2.01 ugPNP g-1h-1 (PME-ase acid) and 1.92 (PME-ase base), and 3.23 ugPNP g-1h-1 (PME-ase acid) and 0.57 ugPNP g-1h-1 (PME-ase base) (Table 2). The highest activities of both acid enzyme and base enzyme were found in the PSB isolated from the soil where Amaranthus hybridus and Ipomoea aquatica plants grow. The tests show that the activities of the enzymes were determined by the number of PSB population, habitat types and vegetation types. However, the research conducted by Pang and Kolenk (1986) reveals that the activities of the enzyme are determined by types of vegetation that grow on the surface and yet the PSB population has no impacts on the activities. The activities of enzyme PMEase-acid and base increased during incubation. This may due to induced when the amount of P in the culture growth was limited, which proves that P is much in demand (Savine et al. 2000). The activity of PMEase-acid and base reach its lowest and highest point during the 7-day incubation (Table 2). Phosphate is released from fosfomonoester by phosphomonoesterase through an enzyme-based hydrolysis (Ponmurugan and Gopi 2006). Research shows that isolate number 13 and 14 were the most excellent P-solubilizing capacity throughout all tests (Table 1, 2, 3). Those isolates were identified using gene 16S RNA analysis (Pitcher et al. 1989). It shows that isolate number 13 and 14 belongs to the species Serratia marcescens and Pseudomonas fluorescens, with homology reaching 99%. The results support and elaborate the previous research. Rodriguez and Fraga (1999), for example, stated that Pseudomonas was the strain that best WIDAWATI – Phosphate solubilizing bacteria from Laki Island 21 dissolves the bonded P from any source of P and is Lal L (2002) Phosphate biofertilizers. Agrotech Publ Acad, Udaipur, India. dominant in the mineralization of organic phosphorus. This Mearyard B (1999) Phosphate enzymes from plants. J Biol Educ 33(2): 109-112. type of bacteria is found as a dominant cluster primarily on Nguyen C, Yan W, Tacon FL, Lapeyrie F (1992) Genetic viability of East Indian coast (Seshadri et al. 2002) and in on extreme phosphate solubilizing activity by monocaryotic and dicatyotic saline water habitat and alkaline (De Souza et al. 2000). mycelia of the ectomycorrhyzal fungus Laccaria bicolor (Maire) PD Orton. Plant Soil 143: 193-199. Pang PCK, Kolenk H (1986) Phosphomonoesterase activity in forest soils. Soil Biol Biochem 18 (1): 35-40. CONCLUSION Pearson W, Lipman D (1988) Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 85: 2444-2448. Perez E, Sulbaran M, Ball MM, Yarzabal LA (2007) Isolation and Phosphate solubilizing bacteria (PSB) were found in the characterization of mineral phosphate solubilizing bacteria naturally coastal, offshore, shorelines and mangrove ecosystem colonizing a limonitic crust in the south-eastern Venezuela region. indicating that their wide distribution. Serratia marcescens, Soil Biol Biochem 39: 2905-2914. and Pseudomonas fluorescens were isolated from the Pitcher DG, Owen RJ (1989) Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett Appl Microbiol 8: 151-156. rhizosphere of Amaranthus hybridus and Ipomoea aquatic Ponmurugan P, Gopi C (2006) In vitro production of growth regulators respectively showed highest population in media 1, 2, 3, 4 and phosphatase activity by phosphate solubilizing bacteria. African J and 5, and dissolved wide range of P including Al-P, Ca-P Biotech 5(4): 348-350. and rock phosphate and also produced both alkaline and acid Rachmiati Y (1995) Phosphate solubilizing bacteria from rhizosphere crop and his ability in dissolving phosphate. National congres phosphatases. proceeding VI HITI, Jakarta, 12-15 Desember 1995. [Indonesia] Ramachandran K, Srinivasan V, Hamza S, Anandaraj M (2007) Phosphate solubilizing bacteria isolated from the rhizosphere soil and its growth ACKNOWLEDGEMENTS promotion on black pepper (Piper nigrum L.) cutting. Plant Soil Sci 102: 325 -331. Rao NS (1982) Soil microorganism and plant growth. 2nd ed. Indonesia This research was conducted with the support of DIPA University Press, Jakarta. project. The author expresses her gratitude to Yohanes B. Richardson AE (2001) Prospect for using soil microorganisms to improve the a quisition of phosphorus by plants. Aust J Plant Physiol 58: 797-906. Subowo, project leader of DIPA project and Prof. Dr. I Rivas R, Velazquez E, Valverde A, Mateos PF, Martinez-Molina E (2001) Made Sudiana for guidance. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species. Electrophoresis 22: 1086-1089. Rodriguez H, Fraga R (1999) Phosphate solubilizing bacteria and their REFERENCES role in plant growth promotion. Biotech Adv 17: 319-339. Savine MC, Taylor H, Görres JH, Amador JA (2000) Seasonal variation Allen SE (1974) Chemical analysis of ecological materials. Blackwell, in acid phosphatase activity as a function of landscape position and Oxford, England. nutrient inputs. Agron Abst 92: 391. Peix A, Rivas R, Santa-Regina I, Mateos PF, Martínez-Molina E, Schinner FE, Kandeler E, Ohlinger R, Margesin R (1996) Method in Soil Rodríguez-Barrueco C, Velázquez E (2004) Pseudomonas lutea sp. Biology. Springer, Berlin. nov., a novel phosphate-solubilizing bacterium isolated from the Seshadri S, Ignacimuthu S, Lakshminarsimhan C (2002) Variations in rhizosphere of grasses. J Syst Evol Microbiol 54: 847-850. heterotrophic and phosphate solubilizing bacteria from Chennai, Banig AE, Aly EA, Khaled AA, Amel KA (2008) Isolation, characterization southeast coast of India. Indian J Mar Sci 31: 69-72. and application of bacterial population from agricultural soil at Sohag Shekar NC, Shipra B, Kumar P, Lal H, Monhal R, Verma D (2000) Stress Province, Egypt. Malaysian J Microbiol 4 (2): 42-50. induced phosphate solubilization in bacteria isolated from alkaline Bashan Y, Moreno M, Troyo E (2000) Growth promotion of the seawater- soils. FEMS Microbiol Lett 182: 291-296. irrigated oil seed halophyte Salicornia bigelovii inoculated with Thingstad TF, Rassoulzadegan F (1995) Nutrient limitations, microbial mangrove rhizosphere bacteria and halotolerant Azospirillum spp. food webs, and ‘biological pumps’: suggested interactions in a P- Biol Fert Soils 32: 265-272. limited Mediterranean. Mar Ecol Prog Ser 117: 299-306. Cunningham JE, Kuiack C (1992) Production of citric and oxalic acid and Widawati S, Rahmansyah M (2009) The influence of bacteria inoculation solubilization of calcium phosphate by Penicillium billail. Appl to jarak pagar (Jatropha curcas L.) growth. J Biol Indon 6 (1): 107- Environ Microbiol 58: 1451-1458 117 [Indonesia] Das S, Lyla PS, Ajmal-Khan S (2007) Biogeochemical processes in the Widawati S, Suliasih, Latupuapua HJD, Sugiharto A (2005) Biodiversity continental slope of Bay of Bengal: I. Bacterial solubilization of of soil microbes from rhizospore at Wamena Biological Garden inorganic phosphate. Rev Biol Trop (Int J Trop Bio) 55 (1): 1-9 (WBiG), Jayawijaya, Papua. Biodiversitas 6 (1): 6-11. De Souza MJBD, Nair S, Chandramohan D (2000) Phosphate solubilizing Widawati S, Suliasih (2006) Augmentation of potential phosphate bacteria around Indian Peninsula. Indian J Mar Sci 29: 48-51. solubilizing bacteria (PSB) stimulate growth of green mustard Gaur AC (1981) Phospho-microorganism and varians transformation In (Brassica caventis Ocd.) in marginal soil. Biodiversitas 7(1): 10-14 Compost Technology, Project Field Document No. 13 FAO, Rome, (Indonesia) Italy. P.106-111 Widawati S, Suliasih (2009) The role of phosphate solubilizing bacteria Gyaneshwar P, Kumar GN, Parekh LJ, Poole PS (2002) Role of soil and free living nitrogen fixing bacteria on the growth and adaptation microorganism in improving P nutrition of plants. Plant Soil 245: 83-93. of Gmelina arborea Roxb. grown on degraded land. International Hoppe HG, Ullrich S (1999) Profiles of ectoenzymes in the Indian Ocean: Seminar to Protect Diversity of Bioresources in the Tropical Area. phenomena of phosphatase activity in the mesopelagic zone. Aquat Research Center for Biology LIPI, Cibinong, 25-26 November 2009. Microb Ecol 19: 139-148. Whitelaw MA, Harden TJ, Heylar KR (1999) Phosphate solubilization in Jeon JS, Lee SS, Kim HY, Ahn TS, Song HG (2003) Plant growth solution culture by the soil fungus Penicillium radicum. Soil Biol promotion in soil by some inoculated microorganisms. J Microbiol 41 Biochem 31: 655-665. (4): 271-276 Young CC, Chen YP, Rekha PD, Arun AB, Shen FT, Lai WA (2006) Kucey RMN, Tanzen HH, Leggett ME (1989) Microbially mediated Phosphate solubilizing bacteria from tropical soil and their tricalsium increases in plant available phosphorus. Adv Agron 42: 199-228 phosphate solubilizing bacteria abilities. Appl Soil Ecol 34: 33-34. Kummerer (2004) Resistance in the environment. J Antimicrob Chemotax 45: 311-320. BIODIVERSITAS ISSN: 1412-033X (printed edition) Volume 12, Number 1, January 2011 ISSN: 2085-4722 (electronic) Pages: 22-27 DOI: 10.13057/biodiv/d120105

Epiphytic orchids and host trees diversity at Gunung Manyutan Forest Reserve, Wilis Mountain, Ponorogo, East Java

NINA DWI YULIA♥, SUGENG BUDIHARTA Purwodadi Botanic Garden-Indonesian Institute of Sciences (LIPI). Jl. Raya Surabaya-Malang Km. 65, Purwodadi, Pasuruan 67163, East Java, Indonesia. Tel.: +62 341 426046; Fax.: +62 341 426046; ♥e-mail: [email protected]

Manuscript received: 1 July 2010. Revision accepted: 1 September 2010.

ABSTRACT

Yulia ND, Budiharta S (2011) Epiphytic orchids and host trees diversity at Gunung Manyutan Forest Reserve, Wilis Mountain, Ponorogo, East Java. Biodiversitas 12: 22-27. Natural forests in Wilis Mountain have been destroyed by forest fires, landslides and illegal logging. As a consequence, biological diversity in this area is threatened by local extinctions, particularly of orchid species. This study was aimed to explore, document and analyze the diversity of epiphytic orchids at Gunung Manyutan Forest Reserve, a natural forest area in Wilis Mountain. Purposive sampling on 1 hectare (50 x 200 m2) contiguous plot was used. This plot was divided into eight subplots (25 x 50 m2). All data on orchid species were recorded including its number, host trees and zone of the host tree where the orchid attached. The results showed that there were 29 epiphytic orchid species recorded. Flickingeria angulata was the most abundant species (Relative Abundance of orchids/ %Fo = 38.74), continued by Appendicula sp. (%Fo = 10.91) and Eria hyacinthoides (%Fo = 6.57). The three most important host trees were Pinus merkusii, Schima wallichii and Engelhardia spicata. Zone 3 (bottom part of the branches) was revealed as the most favorable part at the host tree (281 individuals), while Zone 1 (bottom part of the main stem) was the least preferable one.

Key words: diversity, epiphytic orchid, Flickingeria angulata, host tree, Wilis Mountain.

INTRODUCTION Therefore, data and information gathering on the occurrence of orchids in their natural habitats is urgently The orchid arguably gets more attention than any other required in order to develop potential conservation kind of plant because of its unique shape and variety of strategies. This effort is important considering the fact that colors of its flowers. According to Puspitaningtyas (2005), in Java, large expanses of natural forest have been even though orchids are not heavily used for basic human converted into human settlements, agricultural lands and needs they are commonly cultivated as ornamental plants, plantations, which can lead to local population extinction thus awareness arises about their extinction due to the of orchids. The impacts of such land conversion will be accelerating rate of destruction as their natural forest exaggerated if extinction occurs before species can be habitats. Epiphytic vascular plants, including epiphytic described and documented. Comber (1990) mentioned that orchids, are major components in tropical wet forests in there are 731 orchid species recorded in Java; with 390 terms of diversity and biomass (Gravendeel et al. 2004; among them are recorded in East Java. Cardelus and Mack 2010). This study aims at documenting and analyzing the One of orchids’ natural habitats in Java which has not diversity and abundance of epiphytic orchids at Gunung been explored so far is Gunung Manyutan Forest Reserve Manyutan Forest Reserve. This was achieved by in Wilis Mountain. Previous study revealed that the conducting a fieldwork in order to record all data on orchid diversity of medicinal plants in Wilis Mountain was very in the area. Orchids diversity and abundances were high, totaling 61 species in the eastern part of Wilis slope at calculated in order to reveal the most important orchid Purut, Parang Village, District of Kediri (Tyas et al. 1999). species. Local forest rangers reported that the studied area However, there is no accurate information on orchid is rich in epiphytic orchids species particularly from the diversity of the area. Nowadays, the natural forest in Wilis genus Vanda (Perhutani’s forest rangers, pers. comm.). This Mountain is destroyed by various causes including forest was used as baseline information in conducting this research. fires, landslides and illegal logging. Inevitably, these processes have threatened biological diversity of the area, and particularly orchid species, which are further MATERIALS AND METHODS threatened by illegal harvesting (Perhutani’s forest rangers, pers. comm.). This local decline in orchid diversity and Study site abundance in Wilis is being repeated in many protected This study was conducted from 26 April to 3 May 2010 areas throughout Java (Puspitaningtyas 2005, 2007). at Gunung Manyutan Forest Reserve, Wilis Mountain YULIA & BUDIHARTA – Orchid diversity and its host tree in Wilis Mountain 23

(7º46.751’ S; 111º39.637’ E) (Figure 1). This area is data were also recorded including temperature, humidity administratively located at Pupus Village, Sub-district of and elevation. Ngebel, District of Ponorogo, East Java and managed by Kesatuan Pemangkuan Hutan (Sub-forest District) Wilis Data analysis Barat under Perum Perhutani (State Owned Forest All data were recorded in a spreadsheet, and the Company). following parameters were calculated: Nt is the number of trees in the plot hosting a particular orchid species; No is Sampling the number of individuals of a particular orchid species We used purposive sampling at site with the richest within the plot. Based on these two parameters, Relative orchid’s diversity based on information from forest rangers. Frequency of host tree (%Ft) and Relative Abundance of At this site, which was located in the forest interior, we orchid (%Fo) were computed as below: established a 50 x 200 m2 (1 ha) plot. Within this plot we created eight subplots (25 x 50 m2) contiguously (Muñoz et Nt %Ft = ×100 al. 2003). All epiphytic orchid species attached to trees Total number of all host trees within the subplots were recorded. Various data were also collected including the species name of host tree and the No zone on the tree where the orchid attached. Epiphyte %Fo = × 100 position on the host tree was divided into five zones based Total number of all orchids on Dressler (1990), which are: (i) Zone 1: the bottom part (1/3) of the main stem; (ii) Zone 2: the upper part (2/3) of the main stem; (iii) Zone 3: the bottom part of the Orchids were identified to species level if possible, and branches; (iv) Zone 4: the middle part of the branches; and the genus level otherwise using the books by Comber (v) Zone 5: the outer part of the branches. Environmental (1990, 2001) as references.

Wonogiri Madiun

A

B

Pacitan

C Trenggalek

E

D

Figure 1. Location of study site at Gunung Manyutan Forest Reserve, in Wilis Mountain (dashed circle), and some of orchid species at this area: (A) Eria flavescens, (B) Coelogyne longifolia, (C) Coelogyne speciosa, (D) Dendrobium linearifolium and Flickingeria angulata.

24 BIODIVERSITAS 12 (1): 22-27, January 2011

RESULTS AND DISCUSSION wide-ranging geographic distribution), and therefore not classified as endemics. Puspitaningtyas et al. (2003) The results showed that of eight subplots of 25 x 50 m2 mentioned that in general, orchid diversity is highest at at Gunung Manyutan Forest Reserve, there were 29 altitudes 500 and 1500 m asl. and tends to decrease out of epiphytic orchid species belonging to 14 genera recorded. this range. The high level of Eria diversity is presumably The most abundant species in the area were Flickingeria related to relatively low temperature (28o-30o C during the angulata (RA = 38.74%), Appendicula sp. (RA = 10.91%) day) and middle range humidity (60-80%). Most Eria and Eria hyacinthoides (RA = 6.57%) (Table 1). These species were recorded at altitudes between 500 and 2500 m three are very abundant in Java and found mostly at asl (Mahyar and Sadili 2003). elevations between 500 and 1500 m asl. Preliminary communication indicated that Vanda tricolor was abundant at Gunung Manyutan Forest Reserve Table 1. List of epiphytic orchid species at the study site and the (Perhutani’s forest rangers, pers. comm.). However, we value of parameters (Nt is the number of trees in the plot hosting a only find V. tricolor at four plots with a total of 39 particular orchid species; No is the number of individuals of a individuals, much fewer than F. angulata (277 individuals). particular orchid species within the plot; %Ft is Relative The low abundance of V. tricolor is presumably caused Frequency of host tree; %Fo is Relative Abundance of orchid) either by illegal exploitation by outsiders or gathering by

local communities to be planted at their home gardens. The Orchid species Nt No %Ft %Fo survival of epiphytic orchids depends on its host trees. In Agrostophyllum majus 1 1 0.53 0.14 this study, 13 species of host trees were recorded, with 91 Agrostophyllum sp. 1 1 0.53 0.14 individuals (Table 2). The most important host trees were Appendicula sp. 20 78 10.53 10.91 Pinus merkusii (24 individuals), Schima wallichii and Bulbophyllum sp. 9 30 4.74 4.20 Engelhardia spicata (19 individuals each). Bulbophyllum sp.3 3 21 1.58 2.94 Table 2. Environmental conditions at Gunung Manyutan Forest Bulbophyllum sp.4 3 16 1.58 2.24 Reserve Coelogyne longifolia 2 2 1.05 0.28 Coelogyne speciosa 1 2 0.53 0.28 Environmental data Value Dendrobium linearifolium 1 1 0.53 0.14 o o Dendrobium sp. 3 10 1.58 1.40 Air temperature (during day) 28 -30 C Dendrochilum sp. 5 8 2.63 1.12 Relative humidity 60-80% Eria flavescens 5 13 2.63 1.82 Elevation 1300-1413 m asl Eria hyacinthoides 9 47 4.74 6.57 Eria javanica 3 5 1.58 0.70 Eria moluccana 6 9 3.16 1.26 All host trees recorded are mountain specialist species Eria monostachya 12 37 6.32 5.17 and characterized by rough bark that made them favorable Eria oblitterata 1 1 0.53 0.14 by orchids for root attachment. This fact is in line with Eria sp. 13 37 6.84 5.17 Flores-Palacios and Ortiz-Pulido (2005) that epiphytic orchids are likely to attach to host trees with rough bark Flickingeria angulata 46 277 24.21 38.74 rather than smooth one. In addition, the typical peeling Flickingeria sp. 3 19 1.58 2.66 bark with cracked and soft texture apparently catches more Liparis condylobulbon 5 9 2.63 1.26 water and nutrients than the smooth bark. Therefore, orchid Liparis sp. 2 7 1.05 0.98 seeds lodged in the crevices of bark more readily grow Luisia zollingeri 4 7 2.11 0.98 because of the available substrate necessary for the growth Trichoglottis sp. 1 2 0.53 0.28 of seeds. However, the result of Bergstrom and Carter Thrixspermum sp. 10 21 5.26 2.94 (2008) suggests that the structure of the bark is not the Thrixspermum subulatum 3 13 1.58 1.82 most important factor to the occurrence of epiphytic orchid Trichotosia angulata 1 1 0.53 0.14 since they found a host tree with smooth and relatively thin Vanda limbata 1 1 0.53 0.14 bark that preferred by a particular orchid. Also, due to the Vanda tricolor 16 39 8.42 5.45 canopy structure of the host trees, which is not too dense, 190 715 100 100 sunlight is allowed to penetrate to the part the tree where orchids grow. According to Seitske et al. (2001), epiphytic orchids in Indonesia are rarely found on trees with dense The dominance of F. angulata over other epiphytic canopy since sunlight is hindered to go through. orchids is also recorded at Penanggungan Mountain in East Epiphytic orchids are not positioned randomly on all Java (Yulia and Yanti 2010). Lugrayasa et al. (2004) noted parts of the host. Dressler (1990) divides the part of host that F. angulata is at most abundant on the slope of tree where the epiphytic orchid grows into five zones. The mountains with altitude of ca. 500 m asl. and humidity 89- occurrence of orchids at each zone depends on its 92%. All orchid species recorded at the study site (Table 1) requirements for light and nutrients. Naturally, most are known as euryecious orchids (kind of orchid that is orchids tend to grow at the particular part of the host tree usually adaptable to various types of environment and has that optimizes their resource acquisition. This study

YULIA & BUDIHARTA – Orchid diversity and its host tree in Wilis Mountain 25 showed that epiphytic orchids were found mostly at Zone 3 correlate with substrate availability. In this study, Zone 3, (281 individuals), followed by Zone 4 (201 individuals) which is located at the bottom part of the branches, is the (Figure 2). In contrast, Zone 1 and Zone 5 were disfavored most favorable zone for epiphytic orchids to grow. This is by orchids, in that only 17 and 52 individuals were attached presumably in relation with the structure of Zone 3, which at these zones, respectively (Table 3). allows seeds to be trapped easily and then nourished with light, water and nutrients. In contrast, there were small numbers of orchids recorded at Zone 1. The rationale is that at this zone, light intensity is very low. Puspitaningtyas 300 and Fatimah (1999) mentioned that orchids grew at Zone 3, Zone 4 and Zone 5 are those that favor plenty of sunlight.

250 However, the individual state of the host tree also

influences the occurrence of epiphytic orchids in terms of 200 creating appropriate conditions such as light intensity, 150 aeration and humidity (Zotz and Hietz 2001). Table 3 suggests that epiphytic orchid at Gunung 100 Manyutan Forest Reserve may attach to more than one host tree, implying either orchid or host tree listed in Table 4 Number ofindividual 50 above are generalist species. A study on specific associations between host trees and epiphytic orchids in

0 Meru Betiri National Park (Puspitaningtyas 2007) also

Zone 1 Zone 2 Zone 3 Zone 4 Zone 5 stated a similar conclusion with our study. A study on the Zone relationship between epiphytic orchids and host trees in sub-tropical forest in Taiwan also showed that generalist Figure 2. Number of epiphytic orchids at each zone of host tree orchid species tend to grow on various host tree with no (Zone 1: the bottom part (1/3) of the main stem; Zone 2: the specific association with a particular tree species (Martin et upper part (2/3) of the main stem; Zone 3: the bottom part of the al. 2007). Also in Panamanian lowland forest, the branches; Zone 4: the middle part of the branches; Zone 5: the relationship between host tree and epiphytic vascular plants outer part of the branches) is random without any host specificity (Laube and Zotz 2006). However, the occurrence of some particular epiphytic orchids is highly associated with the occurrence There are some environmental factors important for of particular host tree, showing strong preferences of an orchids to grow, such as light, temperature, wind speed and orchid to a host tree species such as Epidendrum magnoliae water availability (Parnata 2005). The distributional with Quercus virginiana (Bergstrom and Carter 2008), and patterns of epiphytic orchids on the stems and branches of Dendrobium capra with Tectona grandis (Yulia and host trees are influenced by the needs of sunlight and Ruseani 2008). humidity that make epiphytic orchids favor specific zones (Yulia and Yanti 2010). In addition, O’Malley (2009) stated that branch height and position on host tree highly CONCLUSION

Epiphytic orchid diversity and Table 3. List of host tree species recorded and numbers of individuals at each plot abundance at Gunung Manyutan Forest Reserve in Wilis Mountain is SP SP SP SP SP SP SP SP Total number relatively high. Within one hectare Species of host tree 1 2 3 4 5 6 7 8 of individual contiguous area, there were 29 Lithocarpus sp. 2 3 5 epiphytic orchid species (totally 715 Schima wallichii 3 13 1 2 19 individuals) recorded. The most Pinus merkusii 4 4 7 1 8 24 abundant orchid species were Engelhardia spicata 1 2 2 8 6 19 Flickingeria angulata, followed by Callophyllum sp. 1 1 Appendicula sp. and Eria Lithocarpus teysmannii 4 1 1 1 7 hyacinthoides. In addition, there were 13 host tree species recorded, with Lithocarpus sundaicus 1 4 3 8 three most important host species Proteacea 3 3 being Pinus merkusii, Schima Nauclea sp. 1 1 wallichii and Engelhardia spicata. Eudia sp. 1 1 Zone 3 (bottom part of the branches) Litsea sp. 1 1 was noted as the most preferred zone Bridelia sp. 1 1 on host trees to be attached by Tree stump 1 1 epiphytic orchid species, while Zone Sum 6 18 8 9 8 11 19 12 91 1 (bottom part of the main stem) was the least preferred.

26 BIODIVERSITAS 12 (1): 22-27, January 2011

Table 4. Recapitulation of orchid species at each zone of host tree

Species of orchid Species of host tree F host tree Number of orchids at each zone Total number 1 2 3 4 5 Flickingeria angulata Lithocarpus sp. 5 13 19 27 59 Schima wallichii 12 14 33 15 62 Pinus merkusii 20 57 40 5 102 Lithocarpus teysmannii 4 8 22 8 38 Lithocarpus sundaicus 4 1 7 7 15 Engelhardia spicata 1 1 1 Vanda tricolor Lithocarpus sp. 1 2 2 Engelhardia spicata 10 1 3 6 9 5 24 Lithocarpus sundaicus 3 3 2 6 1 12 Proteaceae 1 0 Bridelia sp. 1 1 1 Eria mononstacya Lithocarpus sp. 3 4 4 Schima wallichii 2 5 3 8 Pinus merkusii 2 1 3 4 Lithocarpus teysmannii 2 6 6 Engelhardia spicata 2 1 6 5 12 Lithocarpus sundaicus 1 3 3 Eria moluccana Lithocarpus sp. 1 1 1 Lithocarpus teysmannii 1 1 1 Schima wallichii 1 1 1 Pinus merkusii 2 2 2 Lithocarpus sundaicus 1 4 4 Eria sp. Lithocarpus sp. 1 1 1 Schima wallichii 1 4 4 Lithocarpus teysmannii 3 1 7 8 Nauclea sp. 1 2 2 Lithocarpus sundaicus 3 1 4 5 Engelhardia spicata 4 9 3 5 17 Eria javanica Lithocarpus sp. 1 3 3 Lithocarpus teysmannii 1 1 1 Lithocarpus sundaicus 1 1 1 Thrixspermum sp. Lithocarpus sp. 1 2 2 Schima wallichii 6 6 6 3 15 Engelhardia spicata 2 1 2 3 Calophyllum sp. 1 1 1 Thrixspermum subulatum Calophyllum sp. 1 2 2 Schima wallichii 1 9 9 Engelhardia spicata 1 2 2 Coelogyne speciosa Lithocarpus sp. 1 2 2 Appendicula sp. Schima wallichii 3 4 3 7 Engelhardia spicata 11 1 27 11 13 52 Lithocarpus teysmannii 1 1 1 Lithocarpus sundaicus 2 6 7 13 Eudia sp. 1 2 2 Litsea sp. 1 1 1 Bridelia sp. 1 2 2 Agrostophyllum majus Pinus merkusii 1 1 1 Bulbophyllum sp. Lithocarpus teysmannii 3 5 9 4 18 Lithocarpus sundaicus 3 2 6 8 Engelhardia spicata 2 1 1 2 Eudia sp. 1 2 2 Dendrobium sp. Lithocarpus teysmannii 1 1 1 Lithocarpus sundaicus 2 5 3 1 9 Dendrochilum sp. Lithocarpus sundaicus 3 2 3 5 Pinus merkusii 2 3 3 Flickingeria sp. Lithocarpus teysmannii 1 4 4 Lithocarpus sundaicus 2 15 15 Luisia zollingeri Lithocarpus sundaicus 1 1 1 Engelhardia spicata 3 1 1 4 6 Vanda limbata Tree stump 1 1 1 Bulbophyllum sp.4 Proteaceae 1 10 10 Lithocarpus sundaicus 2 3 3 6 Eria flavescens Proteaceae 1 1 1 Lithocarpus sundaicus 1 2 2 Engelhardia spicata 3 1 5 4 10 Eria hyacinthoides Lithocarpus sundaicus 4 5 7 8 3 23 Engelhardia spicata 4 3 4 15 22 Lithocarpus teysmannii 1 2 2 Bulbophyllum sp.3 Lithocarpus sundaicus 2 10 10 Engelhardia spicata 1 10 1 11 Eria oblitterata Lithocarpus sundaicus 1 1 1 Liparis condylobulbon Lithocarpus sundaicus 2 1 2 3 Engelhardia spicata 2 1 1 1 3 Lithocarpus teysmannii 1 3 3 Liparis sp. Lithocarpus sundaicus 1 3 2 5 Lithocarpus teysmannii 1 2 2 Agrostophyllum sp. Engelhardia spicata 1 1 1 Coelogyne longifolia Lithocarpus sundaicus 1 1 1 Bridelia sp. 1 1 1 Trichoglottis sp. Engelhardia spicata 1 2 2 Trichotosia annulata Engelhardia spicata 1 1 1 Dendrobium linearifolium Engelhardia spicata 1 1 1 Sum of individual 17 164 281 201 52 715

YULIA & BUDIHARTA – Orchid diversity and its host tree in Wilis Mountain 27

ACKNOWLEDGEMENTS Martin CE, Lin TC, Hsu CC, Lin SH (2007) No effect of host tree species on the physiology of the epiphytic orchid Bulbophyllum japonicum in subtropical rainforest in Northeastern Taiwan. J For Sci 22(3): 245- This research is funded by ‘Insentif Ristek Peneliti dan 251. Prekayasa 2010’ on project entitled ‘Evaluation of orchid Muñoz AA, Chacon P, Perez F, Barnert ES, Armesto JJ (2003) Diversity in southern part of East Java’. We acknowledge the and host tree preferences of vascular epiphytes and vines in a contributions of exploration team members (Pa’i, temperate rainforest in southern Chile. Austral J Bot 51: 381 – 391. O’Malley K (2009) Patterns of abundance and diversity in epiphytic Suhadinoto and Totok Hartoyo) and Perhutani’s forest orchid on Parashorea malaanonan tress in Danum valley, Sabah. rangers (Narlan and Sukardi) during fieldwork. Plymouth Stud Sci 2 (2): 38-58. Parnata AS (2005) Guidance on propagation and treatment of orchid. Agromedia Pustaka, Jakarta. 23-39. [Indonesia] Puspitaningtyas DM, Fatimah E (1999) Orchids inventory in Kersik Luway Wildlife Sanctuary, East Kalimantan. Bull Kebun Raya REFERENCES Indonesia 9 (1): 18-25. [Indonesia] Puspitaningtyas DM, Mursidawati S, Sutrisno, Asikin D (2003) Wild orchid in conservation areas in Java Island. Bogor Botanic Garden- Bergstrom BJ, Carter R (2008) Host tree selection by an epiphytic orchid, LIPI, Bogor. [Indonesia] Epidendrum magnoliae Muhl., in an inland hardwood hammock in Puspitaningtyas DM (2005) Study on orchid diversity in Gunung Simpang Georgia. Southeastern Naturalist 7:571-580. Wildlife Sanctuary, West Jawa. Biodiversitas 6 (2): 103-107. Cardelus CL, Mack MC (2010) The nutrient status of epiphytes and their [Indonesia] host trees along an elevational gradient in Costa Rica. Plant Ecol. 207 Puspitaningtyas DM (2007) Inventory of orchids and their host trees in (1): 25-37. Meru Betiri National Park, East Java. Biodiversitas 8 (3): 210-214. Comber JB (1990) Orchids of Java. Royal Botanic Gardens, Kew. [Indonesia] Comber JB (2001) Orchids of Sumatra. Royal Botanic Gardens, Kew. Seitske K, Wanggai K, Husodo BB (2001) The diversity of epiphytic Dressler RL (1990) The Orchid: natural history and classification. Harvard orchid in North Biak Wildlife Sanctuary. Buletin Beccariana 3 (1): 6- University Press, USA. 10. [Indonesia] Flores-Palacios A, Ortiz-Pulido O (2005). Epiphyte orchid establishment Tyas KN, Hadiah JT, Soejono (1999) A study on medicinal plants at on termite carton trails. Biotropica 37 (3): 457-461. Parang Village, Grogol, District of Kediri, East Java. Proceeding Gravendeel B, Smithson A, Silk FJW, Schuiteman A (2004) Epiphytism Seminary Perhiba. Pharmacy Department, FMIPA, University of and pollinator specialization: drivers for orchid diversity? Phil Trans Indonesia, Jakarta. [Indonesia] R Soc Lond B 359: 1523-1535. Yulia ND, Ruseani N (2008) Habitat study and inventory of Dendrobium Laube S, Zotz G (2006) Neither host-specific nor random: vascular capra J.J. Smith in Madiun and Bojonegoro. Biodiversitas 9 (3): 190- epiphytes on three tree species in a Panamanian lowland forest. Ann 193. [Indonesia] Bot 97 (6): 1103-1114. Yulia ND, Yanti RM (2010) Epiphytic orchids and their host trees in Lugrayasa IN, Mudiana D, Meiningsih D, Pendra IK (2004) Orchids Penanggungan Mountain, Pasuruan, East Java. Berkala Penelitian collection of Eka Karya Bali Botanic Garden. Eka Karya Bali Botanic Hayati Edisi Khusus 4A: 37-40. [Indonesia] Garden, LIPI, Bali. [Indonesia] Zotz G, Hietz P (2001) The physiological ecology of vascular epiphytes: Mahyar UW, Sadili A (2003) Orchid of Gunung Halimun National Park. current knowledge, open question. J Ex Bot 52 (364): 2067-2078. Biodiversity Conservation Project LIPI-JICA-PHKA, Bogor. [Indonesia]

BIODIVERSITAS ISSN: 1412-033X (printed edition) Volume 12, Number 1, January 2011 ISSN: 2085-4722 (electronic) Pages: 28-33 DOI: 10.13057/biodiv/d120106

Inventory and habitat study of orchids species in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi

DEWI AYU LESTARI♥, WIDJI SANTOSO Purwodadi Botanic Garden-Indonesian Institute of Sciences (LIPI), Jl. Raya Surabaya-Malang Km. 65, Purwodadi, Pasuruan 67163, East Java, Indonesia. Tel.: +62 341 426046; Fax.: +62 341 426046; email: [email protected]

Manuscript received: 3 June 2010. Revision accepted: 1 August 2010.

ABSTRACT

Lestari DA, Santoso W (2011) Inventory and habitat study of orchids species in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi. Biodiversitas 12: 28-33. Orchid is one of the ornamental plants which have been high commercial value. Therefore, orchid often has been over exploitation. Finally, some of orchid species are becoming threatened or even endangered. Purwodadi Botanical Garden as an institute of ex-situ conservation play role with it. The aim of this research is to inventory orchid’s species in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi by explorative method. Observation for habitat study was focused on some ecological factors supported to orchids growth like host tree, zone growth on host tree, abundance of sunlight, thickness of substrate (moss), orchid species and number of individual species. The result showed that there were 27 orchids species, consist of, 25 species (16 genera) epiphytic orchid and 2 species terrestrial orchid such as Eulophia keithii var. celebica and Goodyera rubicunda (Blume) Lindl. The host preference for the epiphytic orchid is the group of Myrtaceae family like Syzygium sp., Metrosideros vera Niederen and Metrosideros sp. They mostly grow on the main stem of the tree zone 1 on thick substrate (moss) and get a little abundance of sunlight (calm).

Key words: orchid, inventory, explorative, Lamedai Nature Reserve.

INTRODUCTION which led to the extinction of certain orchids. The rate of destruction of this orchid natural habitat accelerates the Lamedai stated as nature reserve according to existence of such threats. Data from the World KepMenHut No. 209/Kpts-II/1994 on April 30, 1994 Conservation Monitoring Centre (1995) showed that when covers of 635,16 hectare landmass, where habitat of kayu compared with other species plants native to Indonesia with kuku (Pericopsis mooniana Thwaites). Geographically, the status of other threatened the orchid is a plant that Lamedai Nature Reserve range between 3°57’-3°59’ LS receives the highest extinction of 203 species (by 39%). and 122°48’-122°50’ BT, located in Lamedai Village, Not even a possibility when it many orchids, which became Watubangga Subdistrict, Kolaka District, Southeast extinct before he described or documented (Puspitaningtyas Sulawesi Province. The altitude is from sea level up to 50- 2005); and 253 species (± 80%) of the total orchid species 200 m asl., the topography is flat and hilly with slope of endemic to Indonesia in Sulawesi (Peneng et al. 2004). In- 15-30°. Soil type is generally alluvial. Climate type is C situ or ex-situ conservation and preservation of natural with dry season on July-December and rainy season on habits of orchid is the most suitable way for sustaining January-July, with rain fall is 2815 mm/year. Humidity is these endangered species. about 80,3% with temperature of 20-34°C (Bugiono 2006). Orchid is one of the ornamental plants which have been Lamedai Nature Reserve has been damaged by high commercial value. Therefore, it has been often over deforestation or nickel mining activities. It else abuts with exploitation. Finally, several of orchid’s species are road which connects Kolaka – Kendari and transmigrate becoming threatened or even endangered. Conservation of village. This condition will change flora composition in the them must be done, because they have a good prospect as area; effect to the reduction of a particular species of host commodity for trading such as parent stock, medicinal trees, so that the number of orchid species decline in the plant and material for cosmetic or perfume. Therefore, it’s nature. Park et al. (2000) said that many Asian orchids are necessary to conserve it through both in situ and ex situ threatened by extinction because of over-collection and conservation (Siregar et al. 2005). The aim of this research habitat destruction. Moreover, destruction of habitat due to was to inventory orchid’s species in Lamedai Nature narrowness of the land, plantation (Djuita et al. 2004), Reserve, Kolaka, Southeast Sulawesi, to gain information forest fires, logging wild, natural disasters and transfer of about orchid species in this area. Furthermore, the species forest functions settlements also encourage the extinction of orchids collected can be revealed by its potential for the of orchids (Yulia and Ruseani 2008). Added to the capture benefit of education, conservation, display, reintroduction of wild orchids especially without consider sustainability, and others. LESTARI & SANTOSO – Inventory of Lamedai orchids species 29

MATERIALS AND METHODS and number of individual species. Number of individual species for sympodial orchid such as Bulbophyllum, Inventory was done in Lamedai Nature Reserve, Acriopsis, Cymbidium, Dendrobium, etc. are counted per Kolaka, Southeast Sulawesi, Indonesia (Figure 1) on July clump. 21th to August 5th 2009. Identification species were based Determinations of zone used Johansson (1975) method, on orchid flower, and unidentified species were collected which divide host tree, into 5 zones, as follow: (i) Zone 1: as fresh material. basal parts of the trunk (⅓ part of the trunk), (ii) Zone 2: Explorative methods were used to inventory orchids the upper basal of the trunk to the first ramification (⅔ part species. Observation was focused on some ecological of the upper trunk), (iii) Zone 3: the basal part of the large factors supported to orchids growth like host tree (for branches (⅓ part of the total length of the branch), (iv) epiphytic orchid), zone growth on host tree, abundance of Zone 4: the middle part of the large branches (⅓ part in the sunlight and thickness of substrate (moss), orchid species

A

B

C

D

E

F

Figure 1. Lamedai Nature Reserve (circle) at Kolaka, Southeast Sulawesi, and some of orchid species at this area: (A). Dendrobium platygastrum Reichb.f., (B). Dendrobium section strongyle, (C). Grosourdya appendiculata (Blume) Reichb.f., (D). Thrixspermum sp., (E). Goodyera rubicunda (Blume) Lindl., and (F). Eulophia keithii var. celebica. 30 BIODIVERSITAS 12 (1): 28-33, January 2011 middle of the total length of the branch), and (v) Zone 5: Nature Reserve (Puspitaningtyas and Fatimah 1999). The outer part of the large branches (⅓ outer part of the Accordance by type of growth, know 18 species of total length of the branch) sympodial orchids and 9 species monopodial orchids in Determination of substrate thickness used measurement Lamedai Nature Reserve such as Grosourdya standard to measure thickness of substrate from orchid in appendiculata (Blume) Reichb.f., Phalaenopsis sp., their zone, as follow: (i) thick (>5 cm), medium (2-5 cm), Pteroceras emarginatum (Blume) Hollt, Schoenorchis and (iii) thin (<1 cm) (Yulistyarini et al. 2001). juncifolia Blume ex. Reinw., Taeniophyllum sp., T. Determination of sunlight abundance used measurement biocellatum J.J. Smith, Thrixspermum sp., T. arachnites standard for quality of light into the plant (Tirta et al. (Bl.) Reichb. and T. accuminatissimum (Blume) Reichb.f. 2010), as follow: Table 3. Orchid’s species in Lamedai Nature Reserve, Kolaka, Table 1. Criteria of sunlight abundance Sulawesi Tenggara

Sunlight Total of Criteria Species Habitat abundance individual Calm If substrate closed by trees, so that get a little sunlight Acriopsis sp. Epiphytic 1 Rather calm If substrate get an enough sunlight Agrostophyllum sp. Epiphytic 1 Bulbophyllum sp. Epiphytic 126 Open If substrate get more sunlight B. macranthum Lindl. Epiphytic 16 B. lepidum (Blume) J.J. Smith Epiphytic 44 B. odoratum (Blume) Lindl. Epiphytic 30 Cymbidium sp. Epiphytic 10 Table 2. Criteria of Light intensity C. finlaysonianum Lindl. Epiphytic 21 Dendrobium sp.1 Epiphytic 36 Light intensity Criteria Luxmeter Dendrobium sp.2 Epiphytic 5 D. crumenatum Sw. Epiphytic 12 Heavy shade Low light intensity <35 lux D. platygastrum Reichb.f. Epiphytic 1 Open shade Medium light intensity 35-70 lux Eulophia keithii var. celebica Terrestrial 3 Full sun High light intensity >70 lux Goodyera rubicunda (Blume) Lindl. Terrestrial 1 Grammatophyllum scriptum Blume Epiphytic 1 Grosourdya appendiculata (Blume) Reichb.f. Epiphytic 1 Luisia sp. Epiphytic 1 Phalaenopsis sp. Epiphytic 1 RESULTS AND DISCUSSION Pteroceras emarginatum (Blume) Holtt Epiphytic 1 Pomatocalpa sp. Epiphytic 7 More less 27 orchids species were found in Lamedai P. spicata Breda Epiphytic 13 Nature Reserve, consist of 25 epiphytic orchids (in 16 Schoenorchis juncifolia Blume ex. Reinw. Epiphytic 23 genera), and 2 terrestrial orchid species such as Eulophia Taeniophyllum sp. Epiphytic 1 keithii var. celebica and Goodyera rubicunda (Blume) T. biocellatum J.J. Smith Epiphytic 2 Lindl. (Table 3). Those orchids mostly grow at elevation Thrixspermum sp. Epiphytic 2 from sea level up to 500-600 m, evenly at 700 m T. arachnites (Bl.) Rchb. Epiphytic 5 T. accuminatissimum (Blume) Reichb.f. Epiphytic 1 (Puspitaningtyas 2005). From all the species, which are 11 orchids still unidentified species because they were not in flowering for species identification. According to Arditti (1992), epiphytic is one of the conspicuous characters in Host tree orchid comparison with terrestrial orchid in the way of Epiphytic orchid need host tree in association to live in suitable environment. Host trees provide the substrate for living. Approximately, ⅔ from total of orchid species were epiphyteon the stem of several plants (Koopowitz 2001). epiphytes, so establishment seems to be affected by host Mostly, total of orchid individual from each species are tree traits (Hirata et al. 2008). The result showed that there Bulbophyllum sp. (126 individual), Bulbophyllum lepidum were 32 species host trees for epiphytic orchid in this area. (Blume) J.J. Smith (44 individual) and Dendrobium sp.1 Table 4 showed that 5 species were the most preference (36 individual). host tree for epiphytic orchid such as Metrosideros vera Mostly, total of orchid species from 16 genera were Niederen, Syzygium sp., Cratoxylum formosum (Jack.) Dendrobium and Bulbophyllum (4 species). Dendrobium Dyer., Vitex sp. and Barringtonia sp. This result was also found dominant in the Mount Tinombala Natural supported by Tirta et al. (2010), that epiphytic orchid in Reserve, Tolitoli District, Central Sulawesi (Putri 2006). Senturan forest mostly grow on Syzygium racemosum, Then Thrixspermum (3 species), Cymbidium, Pomatocalpa Syzygium sp., Glochidion rubrum, Artocarpus sp., and Taeniophyllum (2 species). Grosourdya, Luisia, Baccaurea sp., Trema orientalis and Shorea sp. In the other Phalaenopsis, Pteroceras and Schoenorchis have one case, epiphytic orchid grow well on other species trees out species. In Lamedai, Grammatophyllum scriptum Blume group of Syzygium family such as Lagerstroemia speciosa, found in the forest line and epiphytic on the Castanopsis Tectona grandis (Yulia and Ruseani 2008; Puspitaningtyas buruana. But this species can be found on the terrestrial 2007), Clausena indica, Mangifera indica (Puspitaningtyas habitat such as G. speciosum Blume in the Kersik Luway 2007), Saraca declinata and Dipterocarpus sp. (Yulia LESTARI & SANTOSO – Inventory of Lamedai orchids species 31

2007). Epiphytic orchid in Sibolangit mostly grow on Antidesma sp. and Cleistanthus sp. Bulbophyllum sp. is Durio sp. (Hartini and Puspitaningtyas 2009), same with genera that have more diversity in Malesia area, beside of research orchid in Sintang District, West Kalimantan Dendrobium sp. (Comber 1990). Same with research of (Ariyanti and Pa’i 2008). Syzygium was not the most Yulia (2007) that found more Bulbophyllum sp. (15 preference host tree for orchid; depend on the type of species) in the natural forest at the Petarikan village, West vegetation in the area. Sanford (1974) said that habitat of Kotawaringin District, Central Kalimantan. Data orchid is has correlation with their environment. Pouteria recapitulation of orchid’s species on the 10 host trees in sp., Cratoxylum sp., Barringtonia sp., Lophopetalum sp. Lamedai Nature Reserve is represented at Figure 1. and Syzygium sp. are suitable host tree for orchid grow, that Metrosideros vera Niederen is the preference host tree indicated by the highest population of orchid. But Syzygium for orchid (Figure 1). Base on number of individual orchid sp., Metrosideros sp., Barringtonia sp., Cratoxylum sp. and on host tree, showed that many orchid species in Lamedai Lophopetalum sp. are suitable host trees for a number of prefer growing on Pouteria sp., then on Syzygium and orchid species. Host tree species determines traits, such as Sapotaceae family. M. vera synonims with Xanthostemon bark characteristics (Hirata et al. 2008). According to verus (Lindl.) Peter G. Wilson have bark surface smooth, Yulistyarini (2001), Host trees such as Cratoxylum sp., greyish, branches often low on the bole and slough (Sosef Vitex sp. and Syzygium sp. usually have specific character et al. 1998). Orchid preference choose host with rough bark like rough bark with mossy substrate. surface (Whitner 1974) because seed of orchid can be Bulbophyllum sp. can associate growing on some host drawee on the bark comparison with smooth bark surface trees like Metrosideros vera Niederen, Metrosideros sp., (Puspitaningtyas 2007). Mostly, orchid in Lamedai Nature Palaquium obovatum (Griff.) Engl., Eusideroxylon sp., Reserve found epiphytic on the smooth bark surface but Cratoxylum sp., Pouteria sp., Vitex sp., Maranthes sp., slough. So they can be grow on the bark. Cratoxylum formosum (Jack.) Dyer., Lophopetalum sp.,

Table 4. Relationship between host tree and orchid in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi

The frequency Orchid species/ Individual of Species of host tree Family ∑ orchid ∑ individual as host tree species of orchid host tree orchid/host tree Syzygium sp. Myrtaceae 7 7 27 1 3.86 Metrosideros vera Niederen Myrtaceae 14 10 52 0.72 3.71 Cratoxylum formosum (Jack.) Dyer. Clusiaceae 6 3 20 0.5 3.33 Vitex sp. Verbenaceae 5 4 12 0.8 2.4 Calophyllum sp. Clusiaceae 4 3 7 0.75 1.75 Pouteria sp. Sapotaceae 4 3 35 0.75 8.75 Metrosideros sp. Myrtaceae 4 4 14 1 3.5 Barringtonia sp. Lecythidaceae 5 5 31 1 6.2 Cratoxylum sp. Clusiaceae 4 4 33 1 8.25 Lophopetalum sp. Celastraceae 3 3 15 1 5

60

50

40

30

20

10

0 sp. sp. sp. sp. Vitexsp. sp. vera formosum Pouteriasp. Cratoxyllum Cratoxyllum Syzygiumsp. Calophyllum Metrosideros Metrosideros Barringtonia Lophopetalum

the frequency of host tree ∑ orchid species ∑ individual of orchid orchid spesies/host tree individual of orchid/host tree

Figure 1. Recapitulation of orchids spesies on the 10 host tree in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi 32 BIODIVERSITAS 12 (1): 28-33, January 2011

Height zone of tree crumenatum Sw., Schoenorchis juncifolia Blume ex. Epiphytic orchids always patch grow on the trunk or Reinw., Thrixspermum arachnites (Bl.) Rchb. and ramification of specific tree. Height of tree is divided into 5 Thrixspermum accuminatissimum (Blume) Reichb.f. and zone, there are zone 1, zone 2, zone 3, zone 4 and zone 5. usually found lichen on their habitat. Yulistyarini et al. Those zone were correlated with the way of epiphytic (2001) said that in Pleihari, Martapura, epiphytic orchid orchid to get sunlight. According to Solikin et al. (2010), mostly grew on medium to thick humus on zone 2. epiphytic orchids rarely grow on the basal trunk . Usually, According to Rahayu (2004), lichen supply water to epiphytic orchid like growing on the zone 3 because in this epiphytic orchid that influence to photosynthesis plant. zone get properly sunlight for orchid growth. Meanwhile Substrate thickness of epiphytic orchid in Lamedai Nature some specific orchid can grow on the zone 1 when they Reserve presented on Table 6. need high humidity and low intensity light. Epiphytic orchid in Lamedai Nature Reserve mostly grow on the zone Table 6. The correlation between substrate and the occurrence of 1. It is showed that they need high humidity and the epiphytic orchid conservation status is easy exploitation. Orchid will stay on the zone 3-5 when they need medium to high light Substrate thickness Frequency intensity. Result of zone observed for epiphytic orchid in Thick 51 Lamedai Nature Reserve as follow (Table 5): Medium 44 Thin 7 Table 5. Zone of epiphytic orchid in Lamedai Nature Reserve, Total 102 Kolaka, Southeast Sulawesi

Zone Frequency Whether orchids grow perched on the branches of trees in tropical forests, or barely holding their leaves above the Zone 1 49 Zone 2 28 water in temperate marshy meadows, they are well adapted Zone 3 16 to survive in their own particular environment (Rahayu Zone 4 8 2004). Epiphytics find themselves in an unusually harsh Zone 5 1 environment. High up in the canopy, water is only Total 102 abundant when it rains. Even though it may rain regularly, there are often times when precipitation is reduced. Nearly all exposed epiphytic orchids tend to have heavily waxed Dendrobium sp.1 grow on every zone and almost all of leaves or a thick cuticle, which helps to conserve moisture. orchid species in Lamedai Nature Reserve grow on the zone 1, except Agrostophyllum sp., Dendrobium Sunlight intensity platygastrum Reichb.f., Grammatophyllum scriptum Usually, orchids need sunlight with ratio 20-90% and Blume, Grosourdya appendiculata (Blume) Reichb.f., depend on species of orchid. Several of orchids can be Luisia sp., Phalaenopsis sp. and Thrixspermum sp. Only growing on the place with enough sunlight or not. once orchid found on zone 5, it means that epiphytic orchid Characteristic of epiphytic orchid is one of the adaptations cannot stand under full sunlight. Usually, epiphytic orchid to sunlight. Every orchid species need different sunlight, will choose appropriate zone of host tree to get light for lower or higher sunlight intensity from optimum growing. Based on the research of Tirta and Lugrayasa requirement cause obstacle growth (Harwati 2007). The (2006), epiphytic orchid mostly grow on zone 2 (36%) and result showed that species of epiphytic orchids in Lamedai only few orchids grow on zone 5 (6%). But Dendrobium Nature Reserve more founded in shady condition (Table 7). capra J.J. Smith in Madiun and Bojonegoro can found at Sunlight intensity are acceptance more and more little if th 5 zone because it needs to get a direct sunshine (Yulia and orchid reside in the forest, because had the hands tied with Ruseani 2008). Sometimes epiphytic orchid found on zone crown of tree and high humidity relatively. Frequency 3 and 4 (Tirta et al. 2010; Hirata et al. 2008). Dressler epiphytic orchid in heavy shady was 40 individual, open (1982) said that zone 2 and 3 are the most suitable zone for shade was 43 individual and full sun was 9 individual. This epiphytic orchid. condition show that epiphytic orchid in Lamedai commonly grow in high humidity, frequently on zone 1. Substrate Relatively same with research from (Tirta and Lugrayasa Category of substrate thickness on the habitat of 2006) in Malinau that epiphytic orchid oftenly grow in epiphytic orchid divided into thin, medium and thick. zone 2 and rarely grow in zone 5. Yulia and Ruseani Usually, thick or thin of substrate depend on physically (2008), stated that usually on zone 5, epiphytic orchid get condition of host tree. Thick substrate showed that high more sunlight intensity and low humidity relatively with humidity in their habitat. In Lamedai Nature Reserve, dry substrate condition. In Lamedai, Phalaenopsis sp. humidity was about 60-80% and temperature 22-32°C, this rarely grows under full sunlight. They generally grow in condition created thick humus deposits There were 51 shady condition. Phalaenopsis sp. and Paphiopedillum sp. orchid species growing on thick humus and 7 species on need low light intensity (Pridgeon and Morrisson 1992). thin humus, such as Bulbophyllum sp., Cymbidium But Dendrobium sp. Thrixspermum sp. and other orchid’s finlaysonianum Lindl., Dendrobium sp.1, Dendrobium species commonly grow under open shade area. From the LESTARI & SANTOSO – Inventory of Lamedai orchids species 33 result know that light intensity interfered with growth and Hartini S, Puspitaningtyas DM (2009) Plant diversity in Sumatra island. development of these orchids (Stancato et al. 2002). Bogor Botanic Garden, Bogor. [Indonesia] Harwati CT (2007) Influence of sunlight intensity to orchid growth. Innofarm: J Agric Innov 6 (1): 121-126 [Indonesia] Table 7. Abundance of sunlight for epiphytic orchid in Lamedai Hirata A, Kamijo T, Saito S (2008) Host trait preference and distribution Nature Reserve, Kolaka, Southeast Sulawesi. The correlation of vascular epiphytes in a warm-temperate forest. J Plant Ecol 201: between sunlight intensity and the occurrence of epiphytic orchid. 247-254. Johansson DR (1975) Ecology of epiphytic orchids in West African rain forests. Am Orchid Soc Bull 44: 125-136. Sunlight intensity Frequency Koopowitz H (2001) Orchids and their conservation. Timber press, Heavy shade 40 Oregon. Open shade 43 Park SY, Murthy HN, Paek KY (2000) In-vitro seed germination of Calanthe sieboldii, an endangered orchid species. J Plant Biol 43: Full sun 9 158-161. Total 102 Peneng IN, Pendit IMR, Tirta IG, Sukiada IM, Gede IDP, Sandi IK, Budiarsa IM (2004) Exploration and inventory of orchid in Batu Putih forest, Batu Putih subdistrict, South Kolaka District, Southeast Sulawesi. Technical report of “Eka Karya” Bali Botanical Garden. Bali. Pridgeon A, Marrisson A (1992) The illustrated encyclopedia of orchids. CONCLUSION Timber press, Oregon. Puspitaningtyas DM, Fatimah (1999) Inventory of orchids species in In Lamedai Nature Reserve, there were 27 orchids Kersik Luway Nature Reserve, East Kalimantan. Bul Kebun Raya 9: 18-25. [Indonesia] species, consist of 25 species (16 genera) epiphytic orchid Puspitaningtyas DM (2005) Study on orchid diversity in Gunung Simpang and 2 species terrestrial orchid such as Eulophia keithii var. Nature Reserve, West Java. Biodiversitas 6: 103-107. celebica and Goodyera rubicunda (Blume) Lindl. Member Puspitaningtyas DM (2007) Orchid inventory and the host in Meru Betiri of Myrtaceae such as Syzygium sp., Metrosideros vera National Park, East Java. Biodiversitas 8: 210-214. Putri DMS (2006) Inventory of orchids in Mount Tinombala Natural Niederen and Metrosideros sp. were the most preference Reserve, Tolitoli District, Central Sulawesi. Biodiversitas 7: 30-33. host tree for epiphytic orchid. They frequently grow on Rahayu S (2004) Species of orchid, Hoya and Aeschynanthus in Menoreh zone 1 with thick mossy substrate and low sunlight intensity. mountain range. Warta Kebun Raya 4: 31-36. [Indonesia] Sanford WW (1974) The ecology of orchids. John Wiley and Sons, New York. Siregar C, Listiawati A, Purwaningsih (2005) Orchids species of West ACKNOWLEDGEMENTS Kalimantan. Institute of Tourism Research and Development in West Kalimantan, Pontianak. [Indonesia] Solikin, Suhartono, Tarmudji (2010) Composition and dispersal of orchids We would like to thank to Head of Purwodadi Botanical species in Lejja, South Sulawesi; proceeding of national seminary on Garden who supported exploration in Lamedai Nature basic science. Brawijaya University, Malang, 21 February 2010. [Indonesia] Reserve, Kolaka, Southeast Sulawesi, Head of Natural Sosef MSM, Hons LT, Prawirohatmodjo S (1998) Plant resources of Resource Conservation Institute (BKSDA) Southeast Southeast Asia: No. 5 (3) timber trees – lesser known timbers. Prosea, Bogor. Sulawesi, Head of Area Section II Kolaka Kendari, Head Stancato GC, Mazzafera P, Buckeridge MS (2002) Effect of light stress on of Resort Tanggetada Watubangga, PEH BKSDA of the growth of the epiphytic orchid Cattleya forbesii Lindl. X Laelia Southeast Sulawesi and their staff, as well as exploration tenebrosa Rolfe. Rev Brasil Bot 25: 229-235. team Lamedai from Purwodadi Botanical Garden. Tirta IG, Lugrayasa IN (2006) Exploration and inventory of epiphytic orchid in mount Sidi, Malinau, East Kalimantan; proceeding of a day seminary conservation and efficiency of lowland plant diversity II. Purwodadi Botanic Garden, Purwodadi, 28 January 2006. [Indonesia] REFERENCES Tirta IG, Lugrayasa IN, Irawati (2010) A study on epiphytic orchids at three locations in Malinau District, East Kalimantan. Bul Kebun Raya 13: 35-39. [Indonesia] Arditti J (1992) Fundamentals of orchids biology. John Wiley and Sons, Whitner CL (1974) The orchids: scientific studies. John Wiley and Sons, New York. New York. Ariyanti EE, Pa’i (2008) Orchids inventory in Sintang District, West World Conservation Monitoring Centre (1995) Indonesian threatened Kalimantan. Biodiversitas 9: 21-24. plants. Eksplorasi 2: 8-9. Bugiono (2006) Information of conservation area in Southeast Sulawesi. Yulia ND (2007) The diversity of epiphytic orchids in the natural forest of Natural Resource Conservation Institute of Southeast Sulawesi, Petarikan, the district of West Kotawaringin, Central Kalimantan. Bul Kendari. [Indonesia] Kebun Raya 10: 46-50. [Indonesia] Comber JB (1990) Orchids of Java. Royal Botanic Garden, Kew England. Yulia ND, Ruseani NS (2008) Inventory and habitat study of Dendrobium Djuita NR, Sudarmiyati S, Candra H, Sarifah, Nurlaili S, Fathony R capra J.J. Smith in Madiun and Bojonegoro. Biodiversitas 9: 190-193. (2004) Orchids diversity of Situ Gunung, Sukabumi. Biodiversitas 5: Yulistyarini T, Ariyanti EE, Yulia ND (2001) Inventory of orchids species 77-80. in Pleihari, Martapura, South Kalimantan. Proceeding of Seminary on Dressler RL (1982) The orchids natural history and classification. Harvard Days of Flower Love and National Fauna. Bogor Botanic Garden, University press, Cambridge. Bogor. [Indonesia] BIODIVERSITAS ISSN: 1412-033X (printed edition) Volume 12, Number 1, January 2011 ISSN: 2085-4722 (electronic) Pages: 34-37 DOI: 10.13057/biodiv/d120107

Infection of Anisakis sp. larvae in some marine fishes from the southern coast of Kulon Progo, Yogyakarta

EKO SETYOBUDI♥, SOEPARNO, SENNY HELMIATI Department of Fisheries, Faculty of Agriculture, Gadjah Mada University (UGM), Jl. Flora, Gedung A-4 Bulaksumur, Yogyakarta 55281, Indonesia, ♥email: [email protected]

Manuscript received: 12 March 2010. Revision accepted: 28 July 2010.

ABSTRACT

Setyobudi E, Soeparno, Helmiati S (2011) Infection of Anisakis sp. larvae in some marine fishes from the southern coast of Kulon Progo, Yogyakarta. Biodiversitas 12: 34-37. The prevalence, intensity and distribution of Anisakis sp. larvae which infected some fishes at the southern coast of Kulon Progo District were investigated. Totally 95 fish specimens were collected during December 2007. Results of the present study indicated that the Anisakis sp. larvae infected various fish species i.e: Trichiurus lepturus, Parupeneus sp., Lutjanus malabaricus, Terapon jarbua and Caesio sp. Prevalence and mean intensity of infection showed the differences between fish species. The highest mean intensity of infection was found in L. malabaricus (7.71 larvae/infected host) and T. Lepturus (3.18 larvae/infected host), while the lowest intensity of infection was found in Parupeneus sp., T. jarbua and Caesio sp. (1 larvae/infected host). Infected host organs were body cavities (peritoneum), digestive tract, gonads, and liver. Presence of this parasite may be harmful for consumer; however it can be used for several ecological studies as biological tags.

Key words: Anisakis sp., infection, southern coast of Kulon Progo District.

INTRODUCTION (Pampillon et al. 2002), herring (Clupea sp.) (Horbowy and Podolska 2001; Podolska and Horbowy 2003; Tolonen and Anisakis sp. (Nematode: Anisakidae) is a common Karlsbakk 2003; Podolska et al. 2006), and also walleye parasite of marine organisms world-wide. Their life cycles pollock (Theragra chalcogramma) (Konisi and Sakurai involve crustaceans, fishes, cephalopods and marine 2002). mammals. These organisms act as intermediate, paratenic There were limited studies related to Anisakis sp. larvae or transport host and definitive host. Numerous species of infection in Indonesian water especially in the southern fish (Hutomo et al. 1978; Chao 1985; Strømnes and coast of Java Island. The aims of this research were to Andersen 1998; Wharton et al. 1999; Manfredi et al. 2000; know the prevalence and mean intensity of Anisakis sp. Margarena 2002; Shih 2004; Nuchjangreed 2006; Jacob larvae which infected some fishes at the southern coast of and Palm 2006; Setyobudi et al. 2007; Suadi et al. 2007; Kulon Progo District. This data provide some information Palm et al. 2008) and cephalopods especially belonging to of the infection levels on each fish species which can guide the family of Sepiidae and Ommastrephidae (Abollo et al. for fish handling and processing, as well as possibility for 2001) have been reported to be infected by Anisakis sp. biological indicator. The fishes with high prevalence of larvae. Occurrence of Anisakis sp. larvae in the fish may be Anisakis sp. larvae infection should be avoid to be reducing the quality and be harmful for consumer. These consumed as raw or undercooked. However, understanding nematode cause human health implication and reduce the of the parasites distribution and specific site of infection may commercial value of fish. Human can act as incidental host be used as biological indicator for several ecological studies. by ingestion of raw or undercooked infected fish. Several symptoms in humans caused by Anisakis infection are: stomach pain, nausea, vomiting (Smith and Wooten 1978), MATERIALS AND METHODS allergic reaction (Ancillo et al. 1997; Audicana et al. 2002) and gingivostomatitis (Eguia et al. 2003). However, its Sample collection occurrence can be used as biological tags for many Samples were collected from fish landing-places in (i) purposes of ecological studies and applied fishery science Glagah (Temon Subdistrict), (ii) Bugel (Panjatan e.g. fish stock discrimination, migration and feeding habits. Subdistrict), and (iii) Trisik (Banaran Village, Galur Marcogliese et al. (2003) has been used parasite to identify Subdistrict), Kulon Progo District (7°54’-7°58’ S, 110°03’- marine fish stock and its movement pattern. Using Anisakis 110°11’E), Yogyakarta, Indonesia (Figure 1). A total of 95 sp. larvae as biological tags have been conducted for some individuals fish were randomly collected as samples during fish species, for example Chilean hake (Merluccius gayi December 2007. The number of sample for each species gayi) (Oliva and Ballon 2002), swordfish (Xiphias gladius) was taken proportionally to the total fish caught by SETYOBUDI et al. – Infection of Anisakis in Kulon Progo marine fishes 35 fisherman. The fish was transported to the laboratory and were conducted on body cavity, digestive tract, liver, gonad, immediately frozen until the parasites examination or and muscle. Parasites collected were preserved in 70% identification. ethanol for morphological analysis under microscope Anisakis sp. identification was based on morphological Samples examination feature. Population descriptor are prevalence (a number of Each fish sample was thawed, measured the total length host infected with parasites divided by the number of host (nearest 0.1 cm) and body weight (nearest 0.1 g) and examined, expressed as percentage) and mean intensity examined for the parasites. External examination was (average of infection of parasite among the infected fish, conducted on body surface and gill, internal examination expressed as larvae/infected host) (Bush et al. 1997).

Magelang ADMINISTRATIVE MAP OF

KULON PROGO DISTRICT

LEGEND: Purworejo Subdistrict border Village border River Rail road National road Provincial road District road

Bantul

1

2

3

Figure 1. Fish sampling site of southern coast of Kulon Progo District, Yogyakarta. Note: 1. Glagah, 2. Bugel, and 3. Trisik beaches.

36 BIODIVERSITAS 12 (1): 34-37, January 2010

RESULTS AND DISCUSSION and mean intensity 14.2 larvae/infected host. The high mean intensity was achieved in Evynnis cardinalis and Many commercially important fish species were Nemipterus virgatus, 80.3 and 76.2 larvae/infected host, captured at Indian Ocean, southern coast of Kulon Progo respectively. Several studies of Anisakis sp. larvae District. This dominantly by economic important fish e.g. infection in some marine fishes from Indonesian waters Pampus argenteus, Trichiurus lepturus, Lutjanus have been conducted, and showed different prevalence and malabaricus, Terapon jarbua, Caesio sp. and Arius mean intensity for each fish species. Fishes belonging maculatus. Anisakis sp. larvae infection showed the Gempylidae family (Gempylus serpens, Thyrsitoides difference of prevalence and mean intensity between fish marleyi) exhibited high prevalence and mean intensity of species. Species, total number of individuals and size of Anisakis sp. infection (Tabel 4). Many studies shown the fish samples and the infection of Anisakis sp. larvae were infection was more often found in feeding area than given in Table 1. There were only 5 of 11 observed fish nursery area. Prevalence in the feeding area reached 83- species infected by Anisakis sp. larvae. The presence of 100% with mean intensity 6.0±4.7-9.9±15 larvae/infected Anisakis sp. larvae in marine organisms have been host, whereas in nursery area the prevalence reached 7- investigated in several previous studies and a great number 54% with mean intensity 1-3.7±2.9 larvae/infected host of fish species and cephalopods have been found and (Tolonen and Karlsbakk 2003). reported to be receptive to anisakid infection (Smith and The distribution and locality of infections by Anisakis Wooten 1978; Abollo et al. 2001). sp. showed that the majority of nematodes were found in This study showed the highest mean intensity observed digestive tract, peritoneum and gonad (Table 2). Mostly on L. malabaricus (7.71 larvae/infected host), following T. Anisakis sp. larvae was found in peritoneum than other lepturus (3.18 larvae/infected host), whereas in Parupeneus organs, for example in Trichiurus lepturus (Margarena sp., T. jarbua and Caesio sp. just a few (around 1 2002), some commercial flatfish (Alvarez et al. 2002) and larvae/infected host) were obtained. Reports on the Merluccius gayi gayi (Oliva and Ballon 2002). Wharton et distribution of Anisakis sp. larvae on some fish species al. (1999) found that the majority of larvae were associated from different area shown a great variation of prevalence, with the visceral organs, mesenteries, and peritoneum. Due intensity and distribution. Margarena (2002) reported the to the infection and distribution of Anisakis sp. occur differences of prevalence and intensity of Anisakis sp. through food web by predator-prey relationship, factors infection in Trichiurus lepturus from different regions in like the feeding habits of the host or time period of larvae southern coast of Bantul District. The higher prevalence the within the host have been used to explain the (49.23%) were observed in Pandansimo fish landing place preferences of larvae to muscles or visceral organs. than Depok fish landing place (42.90%), conversely, the Strømnes and Andersen (1998) revealed the distribution higher intensity were obtained in Depok fish landing place patterns of A. simplex L3 between muscle and viscera were (7.46 larvae/infected host) compared to Pandansimo (5.35 not significantly affected by host size but might be larvae/infected host). Similar prevalence, ranged 31.26- governed by the conditions encountered within host tissues, 53.33% was obtained in Trichiurus spp. landed in Cilacap and are possibly related to the availability of nutrients. (Suadi et al. 2007). In contrast, the higher prevalence were These parasites seem to be capable of living for several showed Anisakis sp. infecting Trichiurus sp. in southern years. The larvae will penetrate the digestive tract and coast of Purworejo District, that is 62.68% but only has entered to the abdomen. In contrast, Valero et al. (2006) lower intensity (3.30 larvae/infected host) (Setyobudi et al. reported the clearly higher prevalence of larvae in viscera 2007). than in the muscle tissue of Merluccius merluccius and an Chao (1985) reported the Anisakis sp. larvae infection increase in parasitization with increasing host length. in some marine fish, with mean prevalence reached 37.7% Presence of Anisakis sp. larvae in the mouth cavity of the host as shown in T. lepturus in this study was rarely case and Table 1. Species, total numbers, size of fish sampled and the infection of Anisakis sp. unusual. The possibly the larvae was larvae move toward of digestive tract, from stomach to the mouth after previous No. of Infection Total Length host has been ingested. Species (local and scientific name, family) indivi- (prevalence (%), (cm) duals mean intensity) Occurrence of Anisakis sp. in Layur (Trichiurus lepturus; Trichiuridae) 24 48.0-85.0 45.83 % (3.18) some marine fishes has been Kuniran (Parupeneus sp.; Mullidae) 36 15.4-20.6 33.33% (1.08) investigated for health and ecological Tombol (Lutjanus malabaricus; Lutjanidae) 13 16.3-26.1 53.85% (7.71) reason. Indonesia has thousands fish Manyung (Arius maculatus; Ariidae) 4 21.0-25.1 0 (0) species but only little amount have Kerong-kerong (Terapon jarbua; Terapontidae) 3 17.9-21.4 66.67% (1.00) been studied for Anisakis sp. Bawal (Pampus argenteus; Stromateidae) 2 19.6-20.6 0 (0) (Anisakidae) infestation. In the future, Ikan kelelawar (Platax orbicularis; Ephippidae) 1 36.1 0 (0) a long term survey and more detailed Kakap (Gymnocranius microdon; Lethrinidae) 3 17.9-22.0 0 (0) studies about its eco-biology in large- Ketang-ketang (Drepane punctata; Drepaneidae) 5 14.5-35.3 0 (0) Ekor kuning (Caesio sp.; Caesionidae) 2 18.0-20.3 50.00% (1.00) scale area are necessary for providing Peperek (Leiognathus fasciatus; Leiognathidae) 2 20.0-21.0 0 (0) useful information of anisakids infection in Indonesian waters.

SETYOBUDI et al. – Infection of Anisakis in Kulon Progo marine fishes 37

Table 2. Distribution of Anisakis sp. larvae on each organ in some Bush AO, Lafferty KD, Lotz JM, Shostak A W (1997) Parasitology meets marine species from southern coast of Kulon Progo District ecology on its own terms: Margolis et al. revisited. J Parasitol 83: 575-583. Chao D (1985) Survey of Anisakis larvae in marine fish of Taiwan. Int J Locality Zoonoses 3: 233-237. Fish species Digestive Mouth Peritoneum Liver Gonad Eguia A, Aguirre JM, Echevarria MA, Conde RM, Ponton J (2003) tract Gingivostomatitis after eating parasitized by Anisakis simplex: Case T. lepturus 2.9% 14.3% 57.1% 14.3% 11.4% report. Oral Surg Oral Med Pathol Oral Radiol Endod 96: 437-440. Parupeneus sp. - 53.8% 30.8% - 15.4% Horbowy J, Podolska M (2001) Modelling infection of Baltic herring L. malabaricus - 59.3% 25.7% - 15.0% (Clupea harengus) by larval Anisakis simplex. ICES J Mar Sci 58: T. jarbua* - 100.% - - - 321-330. Caesio sp.* - - - - 100.% Hutomo M, Burhanuddin, Hadidjaja P (1978) Observations on the incidence and intensity of infection of nematode larvae (Fam. * = 1 fish sample Anisakidae) in certain marine fishes of waters around Panggang Island, Seribu Islands. Mar Res Indonesia 21: 49-60.

Table 3. Related studies of Anisakis sp. larvae infection in some Jacob E, Palm HW (2006) Parasites of commercially important fish species from the southern Java coast, Indonesia, including the marine fishes from Indonesian waters distribution pattern of trypanorhynch cestodes. Verhandlungen der Gesellschaft für Ichthyologie 5: 165-191. Prevalence Fish species Intensity References Konisi K, Sakurai Y (2002) Geographic variations in infection by larval (%) Anisakis simplex and Contracaecum osculatum (Nematoda, Decapterus russelli 15-83.94 1-15.06 Hutomo et al. 1978 Anisakidae) in walleye pollock Theragra chalcogramma stocks off 2.9-28.6 1-1.9 Palm et al. 2008 Hokkaido, Japan. Fish Sci 68: 532-542. Rastrelliger kanagurta 4-87.72 1.5-13 Hutomo et al. 1978 Manfredi MT, Crosa G, Galli P, Ganduglia S (2000) Distribution of Sardinella sirm 16.98-78 1.22-3.77 Hutomo et al.1978 Anisakis simplex in fish caught in the Ligurian Sea. Parasitol Res 86: 551-553. Auxis rochei rochei 20-74.3 2.9-4.6 Palm et al. 2008 Marcogliese DJ, Albert E, Gagnon F, Sevigny JM (2003) Use of parasites Trichiurus lepturus 62.68 3.30 Setyobudi et al. 2007 in stock identification of Deepwater Redfish (Sebastes mentella) in 97.1 1-70 Jacob and Palm 2006 the Nortwest atlantic. Fish Bull 101: 1883-1888. 46.07 6.41 Margarena 2002 Margarena R (2002) The prevalence, intensity, and distribution of Brama dussumieri 10.5 1-2 Jacob and Palm 2006 Anisakis simplex in hairtail (Trichiurus lepturus) landed at Bantul Gempylus serpens 97.1 1-32 Jacob and Palm 2006 District. [Thesis]. Gadjah Mada University, Yogyakarta. [Indonesia] Thyrsitoides marleyi 100 9-25 Jacob and Palm 2006 Nuchjangreed C, Hamzah Z, Sunthornthiticharoen P, Nuntawarasilp PS (2006) Anisakids in marine fish from the coast of Chon Buri Province, Thailand. Southeast Asian J Trop Med Public Health 37: 35-39. Oliva ME, Ballon I (2002) Metazoan parasites of the Chilean hake Merluccius gayi gayi as a tool for stock discrimination. Fish Res 56: CONCLUSION 313-320. Palm HW, Damriyasa IM, Linda and Oka IBM (2008) Molecular Anisakis sp. larvae infecting various fish species i.e.: T. genotyping of Anisakis Dujardin, 1845 (Nematoda: Ascaridoidea: Anisakidae) larvae from marine fish of Balinese and Javanese waters, lepturus, Parupeneus sp., L. malabaricus, T. jarbua and Indonesia. Helminthologia 45: 3-12. Caesio sp. Prevalence and intensity of infection showed the Pampillon JAC, Bua MS, Dominguez HR, Garcia JM, Fernadez CA, differences between fish species. The high intensity of Estevez JMG (2002) Selecting parasites for use in biological tagging infection was found in L. malabaricus and T. lepturus. of the Atlantic swordfish (Xiphias gladius). Fish Res 59: 259-262. Podolska M, Horbowy J (2003) Infection of Baltic herring (Clupea These larvae mostly found in body cavities (peritoneum) harengus) with Anisakis simplex larva, 1993-1999: a statistical and digestive tract. Presence of this parasite may be analysis using generalized linear models. ICES J Mar Sci 60: 85-93. harmful for consumer; however it can used for several Podolska M, Horbowy J, Wyszynski M (2006) Discrimination of Baltic ecological studies as biological tags. herring populations with respect to Anisakis simplex larvae infection. J Fish Biol 68: 1241-1256. Setyobudi E, Senny H, Soeparno (2007) Infection of Anisakis sp. in Hairtail (Trichiurus sp.) in Southern coast of Purworejo Regency. J ACKOWLEDGEMENTS Fish Sci IX (1): 142-147. Shih HH (2004) Parasitic helminth fauna of the cutlass fish, Trichiurus lepturus L., and the differentiation of four anisakid nematode third-stage This research was financed by a grant that provided by larvae by nuclear ribosomal DNA sequences. Parasitol Res 93: 188-195. Faculty of Agriculture, Gadjah Mada University, Yogyakarta. Smith JW, Wooten R (1978) Anisakis and anisakiasis. Adv Parasit 16: 93-163. Strømnes E, Andersen K (1998) Distribution of whale worm (Anisakis simplex, Nematoda, Ascaridoidea) L3 larvae in three species of marine fish; saithe (Pollachius virens L.), cod (Gadus morhua L.) REFERENCES and red fish (Sebastes marinus L.) from Norwegian waters. Parasitol Res 84: 281-285. Abollo E, Gestal C, Pascual S (2001) Anisakis infestation in marine fish Suadi, Helmiati S, Widaningroem R (2007) Population and parasite and cephalopods in Galician waters: an update perspective. Parasitol parameter in hairtail (Trichiurus spp.) landed at PPS Cilacap. J Fish Res 87: 492-499. Sci 9 (2): 226-232. Alvarez, Iglesias R, Parama AI, Leiro J, Sanmartın M (2002) Abdominal Tolonen A, Karslbakk E (2003) The parasite fauna of the Norwegian macroparasites of commercially important flatfishes (Teleostei: spring spawning herring (Clupea harengus L.). ICES J Mar Sci 60: 77-84. Scophthalmidae, Pleuronectidae, Soleidae) in northwest Spain (ICES Valero A, Lopez-Cuello AM, Benítez R, Adroher FJ. (2006) Anisakis spp. IXa). Aquaculture 213: 31-53. in European hake, Merluccius merluccius (L.) from the Atlantic off Ancillo M, Cabalerro MT, Cabanas R, Contreras J, Baroso JAM, Barranco north-west Africa and the Mediterranean off southern Spain. Acta P, Serrano MCL (1997) Allergic reactions to Anisakis simplex Parasitol 51: 209-212. parasitizing seafood. Ann Allerg Asthma Im 79: 246-250. Wharton DA, Hassal ML, Aalders O (1999) Anisakis (Nematoda) in some Audicana MT, Ansotegui IJ, Corres LF, Kennedy MW (2002) Anisakis New Zealand inshore fish. NZ J Mar Freshw Res 33: 643-648. simplex: dangerous-dead and alive? Trends Parasitol 18: 20-25.

BIODIVERSITAS ISSN: 1412-033X (printed edition) Volume 12, Number 1, January 2011 ISSN: 2085-4722 (electronic) Pages: 38-44 DOI: 10.13057/biodiv/d120108

Herpetofaunal community structure and habitat associations in Gunung Ciremai National Park, West Java, Indonesia

AWAL RIYANTO♥ Zoology Division, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Widyasatwaloka Building, Jl. Raya Jakarta-Bogor Km. 46, Cibinong, West Java, Indonesia. Tel.: 021-8765056 Fax.: 021-8765068 email: [email protected]

Manuscript received: 1 March 2010. Revision accepted: 2 August 2010.

ABSTRACT

Riyanto A (2011) Herpetofaunal community structure and habitat associations in Gunung Ciremai National Park, West Java, Indonesia. Biodiversitas 12: 38-44. Community structure and habitat associations of amphibians and reptiles on both rainy and dry seasons of six habitat types of three sites in Gunung Ciremai National Park, West Java were investigated in March and October 2008. The data of herpetofauna was obtained by opportunistic searches. Herpetofaunal diversity for each habitat was determined by using Shannon Wiener index, the species abundance per unit area was calculated by using Margalef’s index, and the homogeneity of distribution of species in relation to other species in a sampled per unit area was evaluated using Evenness index. The similarity in herpetofauna communities among habitat types was determined using Sorensen’s coefficient, meanwhile the Jaccard’s index was used to estimate similarities in habitat utilization. Thus, both community similarities and habitat utilization displayed in cluster dendrogram. A total of 46 amphibian and reptile taxa were recorded, comprising 16 anurans, 22 lizards and 8 snakes. Of the total taxa, four anurans are endemic and unusual specimens probably new in sciences referred to the genus Cyrtodactylus and Eutropis. There were differed in sequential of biological indices among habitat types but not much different in their values. The result of cluster analysis showed different patterns on the community similarity among habitat type and habitat utilization during rainy and dry seasons.

Key words: community, habitat utilization, amphibians, reptiles, Gunung Ciremai, Indonesia.

INTRODUCTION diversity and abundance are needed and essential for planning effective conservation and resource management Mount Ciremai is the highest (3,078 m above sea level) strategies (Das 1997). Furthermore, documentation of the mountain in West Java and is one of the most important biodiversity of this area would enable better understanding assets for Kuningan and Majalengka Districts. The of its community organization and the impact of mountain has extensive natural resources including rich disturbance processes. The only available data on diversity agricultural land and a natural, spring-fed water supply. of herpetofauna come from the recent study of Riyanto However, the extinctions of forest dependent amphibians (2007, 2008a, b). and reptiles due to forest loss and degradation as well as This study intends to promote future conservation the isolation of once continuous populations are serious efforts in this area by providing biodiversity and ecological problems. Along with decree of the Ministry of Forestry data on the herpetofauna. The aimed of this study is to No.424/Menhut-II/2004, the area of approximately 15,500 investigate structure community and habitat associations of ha on mount Ciremai should be set aside as a national park. different species on rainy and dry seasons in Gunung However, very few data are available regarding the biota of Ciremai National Park, West Java, Indonesia. this region. Herpetofauna is not an exception despite the fact that amphibians and reptiles form an important part of the ecosystem as significant predators on invertebrates as MATERIALS AND METHODS well as smaller vertebrates, and are themselves important food items for birds and mammals (Howell 2002). Study area. Gunung Ciremai National Park is located Knowledge of biodiversity and organization of its in West Java and a proximally 200 km southeast of Jakarta communities is essential for the development of with altitude between 500 and 3,078 above sea level. conservation policies and a sustainable environmental Annually rain fall in this area is 2,000 to 4,500 mm. The management system. Given the limited conservation survey were focused on three sites, they are Palutungan, resources, such knowledge provides the basis for Linggarjati and Seda, Kuningan District, West Java (Figure 1). identifying important areas to be conserved and threats that Palutungan site is southern part of mount Ciremai and needs to be mitigated. This may only be achieved if sound begin from 1,400 m in elevation. The habitat types of this knowledge exists of systematic, taxon distributions and site are included agro-ecosystem, shrub-old pine forest, habitat associations (Gillespie et al. 2005). The data of their secondary and primary forest. Linggarjati site is eastern RIYANTO – Herpetofauna in Gunung Ciremai National Park 39

rocky substrate. Shrub-old pine forest was defined as old pine forest with full shrub, historically this habitat is pine plantation in the long time ago. Secondary forest was defined as regenerating forest historically cleared for coffee and pine plantation, 3 the canopy was semi covered. The secondary forest habitat also included a small stream with rocky substrate. Primary forest in this study included the forest area with canopy height 20 up to 50 m, full cover canopy and these areas have variety gentle ground 2 and also included small stream with rocky substrate. Field sampling. The surveys were conducted in March and October 2008. The March sampling period was represented rainy season, meanwhile the October sampling period was represented dry season. 1 All habitat types in every survey sites were surveyed by active opportunistic searches twice both of during days or during nights. The active opportunistic search is the researcher Figure 1. Map showing position of the study sites of (1) Palutungan, (2) Linggarjati and active looking for the herpetofauna on (iii) Seda at Gunung Ciremai National Park and around. all microhabitats such as under logs, debris, rocks etc. Night census was part on the mount and begin from 600 m in elevation with undertaken by four people wearing headlamp, slowly habitat type included agro-ecosystem, pine forest, walking across an area of broadly consistent habitat type secondary and primary forest. Meanwhile, Seda site is a with time duration. The time searching was consistently lowland area with elevation about 550 m asl., two habitat applied seven hours for day censuses and three hours for types was identified from this area, they are agro- night censuses. ecosystem and primary lowland forest. The lowland forest Species identification. The following literature was in Seda has been holy by the local society so this forest was consulted for identification, taxonomy and nomenclature protected and in good condition, composing by big trees. Rooij (1915, 1917), Brongersma (1942), Musters (1983), Canopy cover was classified into three categories based Manthey and Grossmann (1997), Stuebing and Inger on qualitative description: full cover, semi cover and open. (1999), Iskandar and Colijn (2000, 2001) and Mausfeld et A location were note as full cover if the canopy is dense al. (2002) for reptiles; and van Kampen (1923), Inger and enough to shade out the majority (>50%) of sunlight. Semi Stuebing (1989), Iskandar (1998, 2004), Manthey and cover was noted if the canopy broken where the sunlight Grossmann (1997) and Frost et al. (2006) for amphibians. penetrated to the forest floor, and open was noted if no Data analysis. All data collected was separated in wet canopy existed at all. The habitat were classified into six and dry periods to analysis. The species diversity for each types: (i) agro-ecosystem in low elevation (AE 1), 600-900 habitat was determined by using the Shannon Wiener Index m asl.; (ii) agro-ecosystem in high elevation (AE 2), 1100- (H’). The higher value of H’, the greater the diversity and 1500 m asl.; (iii) lowland forest (LF), 550-600 m asl.; (iv) supposedly the cleaner the environment (Ludwig and shrub-old pine forest (SOP); 1500-1600 m asl., (v) Reynolds 1988; Metcalfe 1989). secondary forest (SF), 1600-1700 m asl.; and (vi) primary forest (PF), 1700-2000 m asl. Agro-ecosystem included all H’ =-Σ [ (ni / N ) ln (ni / N ) ] areas under cultivation outside of villages but in the border of national park, including plantations (cabbages, potato, H’ = Shannon -Wiener index onions, banana, coffee and durian) and crop (young pine). N = Total individuals of population sampled Majority the canopies were open, except at durian and ni = Total individuals belonging to the i spesiec coffee plantations were semi covered. The agro-ecosystem habitat especially in Palutungan site includes a small water Richness Index that has been used was Margalef’s fall as a micro habitat (the water fall is named Curug Index (R). This index indicates the number of species in a Ciputri). Lowland forest was defined as forest area with sample or the abundance of the species per unit area canopy height 20 up to 30 m with large diameter up to 2.5 (Ludwig and Reynolds 1988; Metcalfe 1989). m, classified as full cover; include a small stream with 40 BIODIVERSITAS 12 (1): 38-44, January 2011

R = S -1 / ln (N) leucomystax), three lizards (Dasia olivacea, Draco volans and Eutropis sp.A), and four snakes (Ahaetulla prasina, R = Margalef richness index Dendrelaphis pictus, Oligodon bitorquatus and S = Total of species Xenodermus javanicus). Meanwhile, only one species was N = Total of individuals sampled restricted to high land agro-ecosystem (H. masonii). Six species were restricted to both of low and high land agro- Homogeneity or pattern of distribution of species in ecosystem consisted by three anurans (Duttaphrynus relation to other species in a sampled per unit area was melanostictus, Phrynoidis aspera and Rhacophorus calculated using Evenness Index (E) (Southwood 1971). reinwardtii) and three lizards (Cosymbotus platyurus, Gehyra mutilata and Eutropis multifasciata). E = H’ / ln S In the lowland forest, ten species were found consisted by three anurans (Rana chalconota, Limnonectes kuhlii and E = Evenness index Occidozyga sumatrana), six lizards (Gonocephalus H’ = Shannon -Wiener diversity index chamaeleontinus, Cyrtodactylus fumosus, Hemidactylus S= Total of species frenatus, Eutropis sp.B, Sphenomorphus sanctus and Sphenomorphus temminckii) and one snake (P. reticulatus). To assess degree of similarity in herpetofauna Four of them were countered restrict to lowland forest communities among habitat types surveyed, Sorensen (Eutropis sp.B, G. chamaeleontinus, P. reticulatus and O. coefficient were used. Meanwhile, the Jaccard’s index was sumatrana). Eight species were encountered in shrub old used to estimate similarities in habitat utilization based on pine forest comprising three anurans (M. montana, Rana presence/absence of each taxon in each habitat types. Thus, hosii and Philautus aurifasciatus), four lizards both of community similarities and habitat utilization (Gonocephalus kuhlii, Pseudocalotes tympanistriga, C. displayed in cluster dendrogram were produced by using fumosus and S. temminckii) and one snake (Calamaria unweighted pair group methods using arithmetic averages virgulata). R. hosii was recorded restrict to this habitat (UPGMA) (Gillespie et al. 2005) using NTSYSpc 2.1. type. Two species of anurans associated with the secondary (Rohlf 2000). forest include M. montana and P. aurifasciatus; meanwhile the reptiles represented by seven species, include six lizards (B. jubata, B. cristatella, G. kuhlii, Pseudocalotes RESULTS AND DISCUSSION tympanistriga, C. fumosus and S. temminckii) and one snake (C. virgulata). B. cristatella was restricted to Species composition secondary forest. In the primary forest, only one anuran A total of 46 amphibian and reptile species were was encountered that is P. aurifasciatus, three lizards (G. recorded during both of rainy and dry season in 2008 kuhlii, P. tympanistriga and S. temminckii) and one snake (Table 1) comprising 16 anurans, 22 lizards and 8 snakes. (C. virgulata). Of the 46 species recorded, four anurans are endemic to Java (Huia masonii, Megophrys montana, Microhyla Dry season achatina and Rhacophorus margaritifer) and two reptiles In the dry season, a total of 14 amphibians and 23 are listed in CITES app. II (Varanus salvator and Python reptiles were recorded; comprising 14 anurans, 19 lizards reticulatus). Unidentified and possibly undescribed lizards and 4 snakes. The Rhacophoridae was dominated the frog species of unusual specimen referred to the genus fauna (four species, 28.57%), followed by Ranidae (three Cyrtodactylus and Eutropis. species, 21.43%), Bufonidae, Dicroglossidae and Megophryidae (each two species, 14.26%) and Rainy season Microhylidae (one species, 7.14%). Meanwhile for lizards, In the rainy season, a total of 15 amphibians and 22 Agamidae was dominant with represented by eight species reptiles were recorded that comprising 15 anurans, 16 (42.1%), followed by Gekkonidae (six species, 31.58%), lizards and 6 snakes. The Dicroglossidae was dominated Scincidae (three species, 19.79), Lacertidae and Varanidae the frog fauna (four species, 26.67%), followed by Ranidae (each one species, 5.26). Snake species was represented by and Rhacophoridae (each three species, 20%), Bufonidae two families, Colubridae (three species, 75%) and Elapidae and Megophryidae (each two species, 13.33%), and (one species, 25%). Microhylidae (one species, 6.67%). Meanwhile for lizards, A total of 25 species were associated with the agro- Agamidae and Scincidae were dominant with each ecosystem comprising 10 anurans, 12 lizards and 3 snakes. represented six species (37.5%), and followed by Eleven species were restricted to lowland agro-ecosystem Gekkonidae (four species, 25%). Snake species was (D. melanostictus, Microhyla achatina, L. hasseltii, H. represented by two families, Colubridae (five species, masonii, F. cancrivora, Polypedates leucomystax, R. 83.33%) and Pythonidae (one species, 16.67%). reinwardtii, B. jubata, Draco fimbriatus, D. volans, C. A total of 26 species were associated with agro- platyurus, G. mutilata, E. multifasciata, Taxidromus ecosystem (non forest habitation) comprising 11 anurans, sexlineatus, V. salvator, A. prasina, Calamaria schlegeli 11 lizards and 4 snakes. Twelve species were restricted to and Bungarus fasciatus). Two species were only found on lowland agro-ecosystem consisted by five anurans highland agro-ecosystem (H. masonii and Calamaria (Fejervarya cancrivora, Leptobrachium hasseltii, schlegeli). Five species were associated both of high and Limnonectes macrodon, M. achatina and Polypedates RIYANTO – Herpetofauna in Gunung Ciremai National Park 41

Table 1. Species of amphibians and reptiles recorded on six different habitat types during rainy and dry season 2008 in Gunung Ciremai National Park, West Java. Habitat Types and elevation AE1 LF AE2 SOP SF PF Taxa (600-900) (550-600) (1,100-1500) (1500-1600) (1600-1700) (1700-2000) R D R D R D R D R D R D Bufonidae Duttaphrynus melanostictus 8 6 0 0 7 6 0 0 0 0 0 0 Phrynoidis aspera 13 7 0 0 10 3 0 5 0 0 0 0 Microhylidae Microhyla achatina 13 15 0 0 0 0 0 0 0 0 0 0 Megophryidae Leptobrachium hasseltii 7 3 0 0 0 0 0 0 0 0 0 0 Megophrys montana 0 0 0 0 0 0 1 0 7 5 0 0 Ranidae Huia masonii 0 0 0 0 13 15 0 0 0 0 0 0 Rana chalconota 15 20 23 15 8 5 0 5 0 0 0 0 Rana hosii 0 0 0 0 0 0 12 8 0 0 0 0 Dicroglossidae Limnonectes macrodon 1 0 0 0 0 0 0 0 0 0 0 0 Limnonectes kuhlii 20 16 8 3 9 7 0 7 0 0 0 0 Fejervarya cancrivora 15 13 0 0 0 0 0 0 0 0 0 0 Occidozyga sumatrana 0 0 14 0 0 0 0 0 0 0 0 0 Rhacophoridae Philautus aurifasciatus 0 0 0 0 0 0 5 23 16 13 16 13 Polypedates leucomystax 7 3 0 0 0 0 0 0 0 0 0 0 Rhacophorus margaritifer 0 0 0 0 0 0 0 1 0 0 0 0 Rhacophorus reinwardtii 6 4 0 0 4 0 0 0 0 0 0 0 Agamidae Bronchocela jubata 19 16 0 0 3 2 0 0 3 0 0 0 Bronchocela cristatella 0 0 0 0 0 1 0 0 1 1 0 0 Draco fimbriatus 0 1 0 0 0 0 0 0 0 0 0 0 Draco haematopogon 0 0 0 0 0 0 0 3 0 0 0 0 Draco volans 20 12 0 0 0 0 0 0 0 0 0 0 Gonocephalus kuhlii 0 0 0 0 0 0 2 2 10 7 3 4 Gonocephalus chamaeleontinus 0 0 5 6 0 0 0 0 0 0 0 0 Pseudocalotes tympanistriga 0 0 0 0 0 0 31 21 57 29 28 7 Gekkonidae Cosymbotus platyurus 6 4 0 0 5 3 0 0 0 0 0 0 Cyrtodactylus fumosus 0 0 8 5 4 3 2 1 4 3 0 0 Cyrtodactylus sp.A 0 0 0 2 0 0 0 1 0 5 0 0 Cyrtodactylus sp.B 0 0 0 0 0 0 0 2 0 0 0 0 Gehyra mutilata 3 2 0 0 1 1 0 0 0 0 0 0 Hemidactylus frenatus 3 2 2 1 2 2 0 0 0 0 0 0 Scincidae Dasia olivacea 2 0 0 0 0 0 0 0 0 0 0 0 Eutropis multifasciata 19 12 0 0 19 11 0 0 0 0 0 0 Eutropis sp.A 1 0 0 0 0 0 0 0 0 0 0 0 Eutropis sp.B 0 0 1 0 0 0 0 0 0 0 0 0 Sphenomorphus sanctus 2 1 24 21 0 0 0 0 0 0 0 0 Sphenomorphus temminckii 8 0 2 3 0 0 5 0 30 23 9 1 Lacertidae Taxidromus sexlineatus 0 3 0 0 0 0 0 0 0 0 0 0 Varanidae Varanus salvator 0 1 0 0 0 0 0 0 0 0 0 0 Colubridae Ahaetulla prasina 1 1 0 0 0 0 0 0 0 0 0 0 Calamaria schlegeli 0 0 0 0 0 1 0 0 0 0 0 0 Calamaria virgulata 0 0 0 0 0 0 1 0 2 2 2 0 Dendrelaphis pictus 1 0 0 0 0 0 0 0 0 0 0 0 Oligodon bitorquatus 1 0 0 0 0 0 0 0 0 0 0 0 Xenodermus javanicus 1 0 0 0 0 0 0 0 0 0 0 0 Elapidae Bungarus fasciatus 0 1 0 0 0 0 0 0 0 0 0 0 Pythonidae Python reticulatus 0 0 1 0 0 0 0 0 0 0 0 0 Number of species 24 21 10 8 12 13 8 12 9 9 5 4 Number of Individuals 192 143 88 56 85 60 59 79 130 88 58 25 Shannon (H’) 2.804 2.653 1.870 1.680 2.252 2.226 1.448 1.984 1.608 1.778 1.265 1.118 Pielou (E) 0.882 0.871 0,812 0.808 0.906 0.868 0.696 0.798 0.732 0.809 0.786 0.807 Margalef (R) 4.375 4.030 2.010 1.739 2.476 2.931 1.717 2.517 1.644 1.787 0.955 0.932 Note: AE1-agro-ecosystem in low elevation, LF-lowland forest, AE2-agro-ecosystem in high elevation, SOP-shrub old pine forest, SF- secondary forest, PF-primary forest, R-rainy season and D-dry season. 42 BIODIVERSITAS 12 (1): 38-44, January 2011 lowland agro-ecosystem (D. melanostictus, Bronchocela homogeny was demonstrated by agro-ecosystem in low jubata, C. platyurus, G. mutilata and E. multifasciata). elevation (E= 0.871), followed by agro-ecosystem in high Eight species were associated with lowland forest elevation (E= 0.868), secondary forest (E= 0.809), lowland comprising two anurans (R. chalconota and L. kuhlii) and forest (E= 0.808), primary forest (E= 0.807), and shrub old six lizards (G. chamaeleontinus, C. fumosus, Cyrtodactylus pine forest (E= 0.798). Like as richness and diversity spA., H. frenatus, S. sanctus and S. temminckii). G. indices, the evenness index also showed same phenomena. chamaeleontinus was restricted to lowland forest. Twelve Although change in sequential, the value of index was not species were encountered in shrub old pine forest consisted much different in both of rainy and dry season. of six anurans (P. aspera, R. chalconota, R. hosii, L. kuhlii, P. aurifasciatus and R. margaritifer), and six lizards Community similarities and habitat utilization (Draco haematopogon, G. kuhlii, P. tympanistriga, C. The cluster of the herpetofaunal community among fumosus, Cyrtodactylus sp.A and Cyrtodactylus sp.B). Four habitat types based on Sorensen index presented in Figure of them were found restrict to this habitat type (R. hosii, R. 2. With respect to Sorensen’s coefficient at the point 60.00 margaritifer, D. haematopogon and Cyrtodactylus sp.B). that was shown a difference cluster between during dry and Nine species were recorded associated to secondary forest rainy seasons. During dry season the habitat types were comprising two anurans (M. montana and P. aurifasciatus), pooled in five main groups with secondary and primary six lizards (Bronchocela cristatella, G. kuhlii, P. forest pooled in one group at point 62.00 meanwhile there tympanistriga, C. fumosus, Cyrtodactylus spA., and S. was only consisted four main groups during rainy season temminckii) and one snake (C. virgulata). Two of them with three habitat types (shrub old pine, secondary and were restrict to secondary forest (M. montana and C. primary forest) pooled in one group. The differences of virgulata). Four species were encountered associated to clustering between dry and rainy seasons probably were primary forest, comprising one anuran (P. aurifasciatus) caused by distribution changes of the herpetofauna as the and three lizards (G. kuhlii, P. tympanistriga and S. response of climate difference in two seasons. temminckii). The cluster of habitat utilization displayed in Figure 3. This cluster was also shown changes in habitat utilization Biological indices between dry and rainy season, except for G. Calculations of biological indices presented in Table 1. chamaeleontinus. This lizard is specialist low land forest. During rainy season, the agro-ecosystem in low elevation demonstrated the highest value of richness index (R) which was 4.375 followed by agro-ecosystem in high elevation (R = 2.476), lowland forest (R=2.010), shrub old pine forest A (R=1.717), secondary forest (R=1.644), and primary forest (R=0.955). Meanwhile in the dry season, the highest value of richness index was demonstrated by lowland agro- ecosystem (R= 4.030), followed by highland agro- ecosystem (R=2.931), shrub old pine forest (R= 2.517), secondary forest (R=1.787), lowland forest (R= 1.739), and primary forest (R= 0.932). These values showed that between rainy and dry season the distribution changes of the species was not much influenced on species richness. During rainy season in this study, the highest diversity was recorded in lowland agro-ecosystem (H’=2.804), agro- ecosystem in high elevation (H’= 2.252), lowland forest (H’= 1.870), secondary forest (H’= 1.608), shrub old pine B forest (H’= 1.448), and primary forest (H’= 1.265). Meanwhile in the dry season, the agro-ecosystem in low elevation was demonstrated the highest diversity (H’= 2.653), followed by agro-ecosystem in high elevation (H’= 2.226), shrub old pine forest (H’= 1.984), secondary forest (H’= 1.778), lowland forest (H’= 1.680), and primary forest (H’= 1.118). Sequentially any difference of diversity between rainy and dry season, but in the value was not much different. For the homogeneities among habitat types based on species distribution during rainy season, the agro- ecosystem in high elevation was demonstrated highest Figure 2. Dendrogram of the similarity of herpetofaunal homogeny (E= 0.906), followed by agro-ecosystem in low community among habitat types based on Sorensen coefficient elevation (E= 0.882), lowland forest (E= 0.812), primary during dry (A) and rainy (B) season. AE1-lowland agro- forest (E= 0.786), secondary forest (E= 0.732), and shrub ecosystem, LF-lowland forest, AE2-highland agro-ecosystem, SOP-shrub old pine forest, SF-secondary forest, and PF-primary forest. old pine forest (E= 0.696). In dry season, the most RIYANTO – Herpetofauna in Gunung Ciremai National Park 43

A

B

Figure 3. Dendrogram of the similarities in habitat use among taxa based on Jaccard’s coefficient during dry season (A) and (B) during rainy season. AE1-lowland agro-ecosystem, LF-lowland forest, AE2-highland agro-ecosystem, SOP-shrub old pine forest, SF-secondary forest, PF-primary forest, R-rainy season and D-dry season. 44 BIODIVERSITAS 12 (1): 38-44, January 2011

CONCLUSION Campbell LA, Blotto BL, Moler P, Drewes RC, Nussbaum RA, Lynch JD, Green DM, Wheeler WC (2006) The amphibian tree of life. Bull Am Mus Nat Hist 297: 1-370. A total of 46 amphibian and reptile taxa were recorded, Gillespie G, Howard S, Lockie D, Scroggie M, Boeadi (2005) comprising 16 anurans, 22 lizards and 8 snakes. Of the total Herpetofaunal richness and community structure of offshore islands taxa, four anurans are endemic and unusual specimens of Sulawesi, Indonesia. Biotropica 37: 279-290. probably new in sciences referred to the genus Howell K (2002) Amphibians and reptiles: the reptiles. In: Davies G, Hoffmann M (eds) African forest biodiversity: a field survey manual Cyrtodactylus and Eutropis. This finding can be used as for vertebrates. Earthwatch Institute, London. baseline data for further researches and manage on the Inger RF, Stuebing RB (1989) Frogs of Sabah. Sabah Park Publication fauna of the Gunung Ciremai National Park. There were No.10, Kota Kinabalu. differed in sequential of biological indices among habitat Iskandar DT (1998) The amphibians of Java and Bali. Research and Development Centre for Biology -LIPI -GEF -Biodiversity Collection types but not much different in their values between rainy Project, Bogor. and dry seasons. It means all habitat types in Gunung Iskandar DT (2004) The amphibians and reptiles of Malinau region, Ciremai National Park are important for herpetofaunal life Bulungan research forest, East Kalimantan: annotated checklist with both in rainy and dry seasons. The distribution change of notes on ecological preferences of the species and local utilization. Center for International Forestry Research, Bogor. the herpetofauna is the consequence of the climate change Iskandar DT, Colijn E (2000) Preliminary checklist of Southeast Asian between rainy and dry season. This distribution change was and New Guinean herpetofauna. I. Amphibians. Treubia 31 (3): 1- reflected in difference of cluster patterns of the community 133. similarity among habitat types. It seems that in order Iskandar DT, Colijn E (2001) A checklist of Southeast Asian and New Guinean reptiles Part I: Serpentes. The Gibbon Foundation, Jakarta. considered the seasonal variation and to understand on Ludwig JA, Reynolds JF (1988) Statistical ecology: a primer on methods herpetofauna distribution patterns as reflection of and computing. John Willey and Sons, New York. biological adaptations of thermal requirements, the study Manthey U, Grossmann W (1997) Amphibien and reptilien Sudostasiens. should be continued or done monitoring seasonally year to Natur & Tier-Verlag, Berlin. Mausfeld P, Schmitz A, Bohme W, Misof B, Vricradic D, Rocha CFD year. (2002) Phylogenetic affinities of Mabouya atlantica Schmidt, 1945, endemic to the Atlantic ocean archipelago of Fernando de Noronha (Brazil): necessity of partitioning the genus Mabuya Fritzinger, 1826 (Scincidae: Lygosoma). Zoologischer Anzeiger 241: 281-293. ACKNOWLEDGEMENTS Metcalfe JL (1989) Biological water quality assessment of running waters based on microinvertebrates communities: history and present status in Europe. Environ Poll 60: 101-139. I thank to the Head of Gunung Ciremai National Park Musters CJM (1983) Taxonomy of the genus Draco L. (Agamidae, Lacertilia, Reptilia). Zoologische Verhandelingen No. 199. EJ Brill, and staffs for the permit, facilities and supporting of this Leiden. study. I also thank to Mulyadi and Wahyu Trilaksono de Rooij N (1915) The reptiles of the Indo-Australian archipelago I (technician on Herpetology laboratory, MZB, Cibinong- (Lacertilia, Chelonia, Emydosauria). EJ Brill, Leiden. Bogor, West Java) and Arif Mulyanto (Faculty of Biology, de Rooij N (1917) The reptiles of the Indo-Australian archipelago II (Ophidia). EJ Brill, Leiden. Jenderal Soedirman University, Purwokerto, Central Java) Stuebing RB, Inger RF (1999) A field guide to the snakes of Borneo. for the assistance during field-work. The fieldwork was Natural History Publication, Kota Kinabalu. funded by Nagao Natural Environment Foundation, Japan. Riyanto A (2008a) Herpetofaunal community in Gunung Ciremai National Park, West Java. J Biologi Indonesia 4 (5): 349-358 [Indonesia] Riyanto A (2008b) Herpetofauna diversity patterns along disturbance gradients in Gunung Ciremai National Park, West Java: implications REFERENCES for effective conservation. An annual report to Nagao Natural Environment Foundation, Japan. Brongersma LD (1942) Notes on scincid lizards. Zool Meded 24 (1-2): Riyanto A (2007) The amphibians and reptiles of Gunung Ciremai 153-158. National Park. An annual report to Nagao Natural Environment Foundation, Japan. Das I (1997) Conservation problem of tropical Asia’s most threatened turtle. In: Van Abbema J (ed.). Proceedings: Conservation, Rohlf FJ (2000) NTSYS-pc: Numerical taxonomy and multivariate restoration, and management of tortoises and turtles. New York Turtle analysis system, v. 2.1. Exeter Software, New York. Southwood TRE (1971) Ecological methods. Chapman and Hall, London. and Tortoise Society and WCS Turtle Recovery Program, New York. Frost DR, Grant T, Faivovich J, Bain RH, Haas A, Haddad CFB, de Sá van Kampen PN (1923) The amphibians of the Indo-Australian RO, Channing A, Wilkinson M, Donnellan SC, Raxworthy CJ, archipelago. EJ Brill, Leiden. BIODIVERSITAS ISSN: 1412-033X (printed edition) Volume 12, Number 1, January 2011 ISSN: 2085-4722 (electronic) Pages: 45-51 DOI: 10.13057/biodiv/d120109

A model of relationship between climate and soil factors related to oxalate content in porang (Amorphophallus muelleri Blume) corm

SERAFINAH INDRIYANI1,2,♥, ENDANG ARISOESILANINGSIH2, TATIK WARDIYATI3, HERY PURNOBASUKI4 1Post-graduate program, Study Program of Mathematics and Natural Sciences, Airlangga University (UNAIR), Surabaya 60115, East Java, Indonesia ² Biology Department, Faculty of Mathematics and Natural Sciences, Brawijaya University (UNIBRAW), Jl. Veteran, Malang 65145, East Java, Indonesia. Tel. & Fax.: +62-341-575841. e-mail: [email protected] 3 Agronomy Department, Faculty of Agriculture, Brawijaya University (UNIBRAW), Malang 65145, East Java, Indonesia 4 Biology Department, Faculty of Science and Technology, Airlangga University (UNAIR), Surabaya 60115, East Java, Indonesia

Manuscript received: 6 July 2010. Revision accepted: 27 July 2010.

ABSTRACT

Indriyani S, Arisoesilaningsih E, Wardiyati T, Purnobasuki H (2011) A model of relationship between climate and soil factors related to oxalate content in porang (Amorphophallus muelleri Blume) corm. Biodiversitas 12: 45-51. The abiotic environment as well as the biotic environment, involved climate and soil affect directly or indirectly to plant growth as well as plant substance. The objective of the research was to obtain a model of relationship between climate and soil factors related to oxalate content in porang corm. Porang corms were collected from five locations of porang agroforestry in East Java. The locations were (i) Klangon Village, Saradan Subdistrict, Madiun District; (ii) Klino Villlage, Sekar Subdistrict, Bojonegoro District; (iii) Bendoasri Village, Rejoso Subdistrict, Nganjuk District; (iv) Sugihwaras Village, Nggluyu Subdistrict, Nganjuk District and (v) Kalirejo Village, Kalipare Subdistrict, Malang District. Geography variable consist of altitude. Climate variables consist of percentage of radiation, temperature and rainfall. Soil variables consist of electrical conductivity, pH, soil specific gravity, soil organic matter, available of calcium, and cation exchange capacity (CEC). Vegetation variables consist of species of plant tree and percentage of coverage. Porang vegetative growth variables consist of plant height, number of bulbil, canopy diameter, and petiole diameter. Corm variables consist of corm diameter, corm weight, and corm specific gravity. Oxalate variables consist of total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crystal. Oxalate contents were measured based on AOAC method. All of variables were collected from first to fourth growth period of porang. Data were analyzed by smartPLS (Partial Least Square) software. The results showed that there were significantly direct effect between altitude and temperature, altitude and CEC of soil, temperature and CEC of soil, altitude and percentage of coverage, temperature and percentage of coverage, CEC of soil and percentage of coverage, CEC of soil and petiole diameter, petiole diameter and corm diameter, and petiole diameter and corm oxalate content. There were no significantly direct effect among altitude, temperature, percentage of coverage and petiole diameter; and among corm total oxalate, soluble oxalate, insoluble oxalate, and density of calcium oxalate crystal and corm diameter. The value of Goodness of Fit of the developing model was R²=0.99.

Key words: corm, climate, model, oxalate, smartPLS, porang, soil.

INTRODUCTION Processing of porang corm produces noodle, tofu, rangginang, some Japanese food such as konyaku and Porang is a seasonal herb and perennial plant that shirataki, industrial material, etc. Porang corm produces produces corm, grouped in Araceae. Porang stem is erect, glucomannan that can used as a waterproof material if it is smooth, green color with pale spots. Actually, stem of mixed with sodium hydroxide; beside that it can utilized to porang is a petiole that known as false stem. Petiole is purify water and floating colloid in beer, sugar, and oil divided to three and then divided again to support leaves industry. Pharmacy industries utilize glucomannan in blade. At the junction between false stem and petiole is porang corm for tablet glue and capsule coat. The product produced bulbil with dark brown color and it used as of porang corms are exported to Japan, Taiwan, Korea, and vegetative reproduction (Yuzammi 2000). The height of some countries in Europe. The economic value of porang porang can reach 1.5 m depend on the fertile soil. Porang corm is very high especially in Japan (Sulaeman 2004; tolerant to shading, it need 40-60% light intensity. Lase 2007). Appropriate shading plants for porang planting are Tectona The cultivation of porang is conducted in some grandis, Swietenia mahagoni, and Pterocarpus sp. Porang agroforestry in East Java. The plantation area consist of six can grow until 700 m above sea level. Planting of porang KPH (Kesatuan Pemangkuan Hutan), there are (i) the area need pH of soil 6-7. Porang corms consist of high fiber in KPH Jember is 121.3 ha, (ii) the area in KPH Nganjuk is without cholesterol, and 20-65% glucomannan as a healthy 759.8 ha, (iii) the area in KPH Padangan is 3.9 ha, (iv) the food for diet (Jansen et al. 1996; Sulaeman 2004; Lase area in KPH Saradan is 615.0 ha, (v) the area in KPH 2007). Bojonegoro is 35.3 ha, and (vi) the area in KPH Madiun is 46 BIODIVERSITAS 12 (1): 45-51, January 2011

70.0 ha. In the early of porang plantation, it was developed crystal in Araceae are raphide and druse (Prychid and in 1975 in KPH Blitar with 100 ha for cultivation, and in Rudall 1999; Prychid et al. 2008). Hagler and Herman KPH Saradan in 1990 with 20 ha. Porang cultivation in (1973) reported that the formation of calcium oxalate via KPH Nganjuk was done since 2003 by farmers in cleavage of respiratory carbohydrate or from protein Sugihwaras Village (Lase 2007). metabolism. While, Franceschi and Nakata (2005) reported Porang production in Bogor (rainfall > 3000 mm.year-1) that the formation of calcium oxalate via glycolate, but higher than in Blitar or Blora, whereas the climate of each others stated via L-ascorbic acid precursor. location based on Schmidth-Ferguson involved B and C Actually, climate and soil influence plant growth and (Afriyol 1993). The rainfall and climate type correlate with development, as well as plant substance. Research in this porang corm production. Production of porang corm field, usually was conducted partially or univariately. In depends on life cycle phase during 38-43 months. fact, in the environment, climate and soil influence directly Sumarwoto (2005) explained scheduling of life cycle: time or indirectly to plant growth as well as plant substance. The of seedling was 1.5-2 months, time of growth of seedling information of climate and soil factors related to oxalate was 1.5-2 months, time of each of vegetative phase in year content in porang corm that are analyzed simultaneously one to three was 5-6 months, time of each of dormancy in and multivariately in a model has not been intensively year one to three was 4 months, time of flowering to fruit studied yet. Based on this argument, research was maturing was 8-9 months. Flowering occurs in corm conducted using model simulation with smartPLS software weight more than 500 g and minimally two times of life to obtain a model of relationship between climate and soil cycle or growth period. Then the plant growth predicted factors related to corm oxalate content in porang. alternately between vegetative and generative phase. Monoculture cultivation in Bogor resulted the information that planting distance for first growth period MATERIALS AND METHODS was 37.5x37.5 cm²; second growth period was 57.5x57.5 cm²; and third growth period was 100x100 cm² (Sumarwoto 2005). Whereas, Jansen et al. (1996) reported Porang exploration was conducted on March to May that planting distance for Amorphophallus vary with the 2009 in five agroforestries in East Java, Indonesia involved plant material used, e.g. seeds at 10 cm, bulbils at 35-70 (i) Klangon Village, Saradan Subdistrict, Madiun District; cm, and tubers at 35-90 cm. Normally, tubers become (ii) Klino Village, Sekar Subdistrict, Bojonegoro District; larger at wider spacing, but tuber growth is also influenced (iii) Bendoasri Village, Rejoso Subdistrict, Nganjuk by the size of planting material, water availability and soil District; (iv) Sugihwaras Village, Ngluyu Subdistrict, fertility. Harvesting was done when corm age minimally Nganjuk District and (v) Kalirejo Village, Kalipare reach second growth period with glucomannan 41.8%. Subdistrict, Malang District. The number of total samples Wider canopy diameter accompanied with higher corm was 107 plants as many as soil samples. Geography glucomannan (Sumarwoto 2005). variable consists of altitude (g1) was measured by Global Although porang corm has multifunction for human Positioning System (GPS). Climate variables consist of being, as an Araceae plants, there are very high calcium percentage of radiation (i1) was measured by solarimeter, oxalate in all plant organs. Oxalate in food causes temperature (i2) was measured by thermometer, and unavailability of calcium in human body, and toxic to rainfall (i3) was obtained from Meteorology, Climatology, animal (Nakata 2003). In high content, oxalic acid affects and Geophysics Agency at Karangploso Malang. Soil mechanical aberration in digestive tract and smooth tubules variables consist of electrical conductivity (s1), pH (s2), in kidney. Chemically, oxalic acid absorbs calcium that soil specific gravity (s3), soil organic matter (s4), available important for nerve and muscle fiber function. In an of calcium (s5), and cation exchange capacity / CEC (s6). extreme condition, absorption of calcium affects Soil electrical conductivity was measured by hypocalcaemia and paralysis (Brown 2000). Although conductivitymeter, soil pH (H2O) was measured by many factors affect kidney problems, it is recommended to pHmeter, soil specific gravity was measured by cylindrical limit consumption of food that consists of high oxalate, method, soil organic matter was measured by volumetry, especially for kidney stone risk people (Noonan and available of calcium was measured by EDTA titration, and Savage 1999). CEC was measured by flame photometry. Soil variables Plants produce oxalate 3-80% from dry weight, 90% of were measured at Soil Department, Faculty of Agriculture, total calcium found in oxalate salt involved calcium Brawijaya University. Vegetation variables consist of oxalate. Calcium oxalate crystals found in many kind of species of plant tree (v1) and percentage of coverage (v2). plant tissue, but the highest content of calcium oxalate Porang vegetative growth variables consist of plant height found in specialized vacuoles named crystal idioblast. (t1), number of bulbil (t2), canopy diameter (t3), and Oxalate in plant found as soluble (oxalic acid) such as petiole diameter (t4). Corm variables consist of corm potassium oxalate, sodium oxalate, and ammonium oxalate diameter (u1), corm weight (u2), and corm specific gravity and insoluble as calcium oxalate (Holloway et al. 1989). (u3). Oxalate variables consist of total oxalate (o1), soluble Plants produce calcium oxalate crystal in various shape and oxalate (o2), insoluble oxalate (o3), and density of calcium size. Based on the shape, there are five categories of oxalate crystal (o4). Oxalate contents were measured based crystal, e.g. sand, raphide (needle), druse, stiloid, and on AOAC (1990) and calcium oxalate crystal density were prismatic (Nakata 2003). The types of calcium oxalate counted based on Cao (2003). All of variables were collected from first to fourth growth period of porang. The INDRIYANI et al. – Relationship between climate and soil to oxalate content of porang 47

2 2 2 determination of growth period of porang was referred to R1 , R2 , … Rp were R-square value of endogen Sumarwoto (2005). Oxalate measurement was done at variable in model. The interpretation of Q² was equal with Biology and Chemistry Department, Faculty of the total determination coefficient in path analysis Mathematics and Natural Sciences, Brawijaya University, (resemble with R² in regression). Malang, East Java, Indonesia. The relationship between climate and soil factors that influence oxalate content of porang corm was simulated by RESULTS AND DISCUSSION smartPLS software (Ghozali 2008; Solimun and Fernandes 2008; Sarmanu et al. 2009). Pairing data were obtained Proposed model was very useful to explain the from all variables that compelled in MS Excel table. Data phenomenon of the relationship between abiotic and biotic were analyzed multivariately to examine a designed factors that influence plant growth and plant substance. structural equation model with smartPLS software. Figure 1 revealed a model (structural model) of relationship Sequentially stage were: (i) Designing Structural Model between climate and soil factors related to oxalate content (inner model), (ii) Designing Measuring Model (outer in porang corm based on empirical study. model), (iii) Constructing Path Diagram, (iv) Converting Path Diagram to Equation System, (v) Estimation: Path The result of examination of Measurement Model Coefficient, Loading, and Weight, (vi) Evaluation of Measurement model (outer weight) will be examined Goodness of Fit, and (vii) Hypothesis Examination whether the weight of each formative indicator (Resampling Bootstrapping). Statistically examination with significantly composes the latent variables. Outer weight t-test α=5%. If p-value ≤ 0.05 means a real model. Real value reveals the weight of each indicator as measurement outer model shows that indicator is valid, real inner model of each latent variable. The examination of signification of shows the real effect of measurable variable. The outer weight can revealed in p-value, if p-value < 5% or examination of Goodness of Fit of structural model in inner 0.05 the indicator significantly composes latent variables. model was measured by predictive-relevance (Q²) value as The highest value of outer weight of indicator indicates that the follow formula: this indicator as a strong measurement of variable 2 2 2 2 (dominant). Q = 1-( 1-R1 ) ( 1-R2 ) ... ( 1- Rp )

Figure 1. A model of relationship between climate and soil factors related to oxalate content in porang corm. Note: g1: altitude, i1: percentage of radiation, i2: temperature, i3: rainfall, s1: electrical conductivity, s2: pH, s3: soil specific gravity, s4: soil organic matter, s5: available of calcium, s6: cation exchange capacity (CEC), v1: species of plant tree, v2: percentage of coverage, t1: plant height, t2: number of bulbil, t3: canopy diameter, t4: petiole diameter, u1: corm diameter, u2: corm weight, u3: corm specific gravity, o1: total oxalate, o2: soluble oxalate, o3: insoluble oxalate, and o4: density of calcium oxalate crystal. 48 BIODIVERSITAS 12 (1): 45-51, January 2011

Table 1. The result of the examination of indicators that compose latent variables Based on Table 1, it was recognized that there were two Outer Standard T- Indicator p-value climate indicators, five soil weight deviation Statistic indicators, one vegetation indicator, Geography three vegetative growth indicators, . Altitude (g1) 1 and two corm size indicators were not Climate significantly to compose each latent . Percentage of radiation (i1) 0.076 0.329 0.231 0.817 variables, so it was necessary to . Temperature (i2) 0.803 0.237 3.39 0.001* evaluate the early PLS model. Next, . Rainfall (i3) 0.338 0.304 1.113 0.266 Table 2 revealed the result of Soil measurement model without no . Electrical conductivity (s1) -0.092 0.147 0.624 0.533 significant indicators that compose . pH (s2) -0.049 0.214 0.227 0.820 latent variables. Based on Table 2, it . Soil specific gravity (s3) 0.226 0.273 0.828 0.408 was revealed that all of indicators . Soil organic matter (s4) 0.143 0.179 0.8 0.424 significantly to compose latent . Available of calcium (s5) -0.506 0.348 1.455 0.146 variables. . Cation exchange capacity (s6) 1.392 0.313 4.45 0.000* Vegetation . Species of plant tree (v1) 0.48 0.346 1.388 0.165 The examination of Goodness of Fit . Percentage of coverage (v2) 0.774 0.416 1.86 0.063* Model Vegetative growth The examination of Goodness of . Plant height (t1) 0.019 0.549 0.035 0.972 Fit of structural model in inner model . Number of bulbil (t2) -0.091 0.5 0.183 0.855 utilizes predictive-relevance value . Canopy diameter (t3) -0.22 0.474 0.464 0.643 (Q²). R² value of each endogen . Petiole diameter (t4) 1.229 0.431 2.849 0.004* variables in this research as follow: Corm size The meaning of table 3 was . Corm diameter (u1) 1.018 0.215 4.73 0.000* explained as follow: first column . Corm weight (u2) 0.033 0.233 0.14 0.889 showed latent variables that used in . Corm specific gravity (u3) 0.094 0.112 0.842 0.400 this model; second column showed R² Corm oxalate content value of each variable, third column . Total oxalate (o1) -6.342 2.035 3.116 0.002* showed the value of one minus R², . Soluble oxalate (o2) 6.504 2.074 3.136 0.002* and the fourth column showed the . Insoluble oxalate (o3) 2.126 0.801 2.654 0.008* multiplication of each row in the third . Density of calcium oxalate crystal (o4) 0.742 0.2 3.703 0.000* column with the value of sequence Note: * = significant (p-value < 0.05) previous row in fourth column. Counting of the values were: geography = 1 because only one indicator (altitude) that used in the Table 2. The result of repeat examination of indicators that compose latent variables model; climate = 0.157x1 = 0.1570; soil = 470x0.157 = 0.07379; Outer Standard T- Indicator p-value vegetation = 0.572x0.07379 = weight deviation Statistic 0.042208; vegetative growth = Geography 0.572x0.042208 = 0.039296; corm . Altitude (g1) 1 size = 0.141x0.039296 = 0.005541; Climate and corm oxalate content = . Temperature (i2) 1 0 0.771x0.005541 = 0.004272. Soil Beside that, the explanation of 2 . Cation exchange capacity (s6) 1 0 Table 3 is as follow: (i) R = 0.843 Vegetation for climate variable. The meaning of the value, 84.3% climate was . Percentage of coverage (v2) 1 0 influenced by geography; (ii) R2 = Vegetative growth 0.530 for soil variable. The meaning . Petiole diameter (t4) 1 0 of the value, 53.0% soil was Corm size influenced by climate and geography; . Corm diameter (u1) 1 0 (iii) R2 = 0.428 for vegetation Corm oxalate content variable. The meaning of the value, . Total oxalate (o1) -6.125 2.218 2.761 0.006* 42.8% vegetation was influenced by 2 . Soluble oxalate (o2) 6.274 2.352 2.668 0.008* geography, climate, and soil; (iv) R . Insoluble oxalate (o3) 2.09 0.535 3.904 0.000* = 0.069 for vegetative growth variable. The meaning of the value, . Density of calcium oxalate crystal (o4) 0.771 0.099 7.825 0.000* Note: * = significant (p-value < 0.05) 6.90% porang vegetative growth was INDRIYANI et al. – Relationship between climate and soil to oxalate content of porang 49 influenced by geography, climate, soil, and vegetation; (v) information in the data 99% could be explained by this PLS R2 = 0.859 for corm size variable. The meaning of the model. The residue 1% was explained by other variables value, 85.9% corm size was influenced by vegetative that not involved in the model yet. growth; and (vi) R2 = 0.229 for corm oxalate content variable. The meaning of the value, 22.9% corm oxalate Table 3. The relationship between R² and Q² value for the content was influenced by vegetative growth. The examination of Goodness of Fit predictive-relevance value was obtained with the equation as follow: Multiplication of 1- R- 1-(R- (R-square) with the 2 2 2 2 square square) value of sequence Q = 1-( 1-R1 ) ( 1-R2 ) ... ( 1- Rp ) previous row Q2 = 1-(1-0,843) (1-0,530) (1-0,428) (1-0,069) (1-0,859)(1-0,229) Geography 1 Climate 0.843 0.157 0.157 2 Q = 99,45% or 0,99 Soil 0.530 0.470 0.07379 Vegetation 0.428 0.572 0.042208 The result revealed that the predictive-relevance value Vegetative growth 0.069 0.931 0.039296 Q2 was 99% or 0.99 and above 80%, so the model Corm size 0.859 0.141 0.005541 reasonable to possess a relevant predictive value. The Corm oxalate content 0.229 0.771 0.004272 predictive relevance value 99% indicated that the

The result of examination of Inner Table 4. The result of direct effect examination Model Independent Dependent Inner T- p- Basically, the examination of Note variables variables weight statistics value inner model (structural model) is to Geography Climate -0.918 63.864 0.000 Significant examine the research hypothesis. The Geography Soil 0.363 2.299 0.022 Significant hypothesis examination was done Climate Soil 1.047 7.807 0.000 Significant through t-test of each path that Geography Vegetation 1.466 9.1 0.000 Significant influence directly and partially. The Climate Vegetation 1.033 4.625 0.000 Significant result of analysis completely involved Soil Vegetation 0.249 2.206 0.027 Significant in PLS analysis. Table 4 revealed the result of the examination of direct Geography Vegetative growth 0.357 1.241 0.215 No significant effect hypothesis. The paths of Climate Vegetative growth 0.417 1.331 0.183 No significant hypothesis examination were revealed Soil Vegetative growth -0.306 2.304 0.021 Significant as follow (Figure 2). Vegetation Vegetative growth -0.063 0.543 0.587 No significant Beside that, it was obtained the Growth Corm Size 0.892 31.979 0.000 Significant examination result of indirect effect. Corm oxalate content Corm Size 0.069 1.555 0.120 No significant The coefficient of indirect effect was Growth Corm oxalate content 0.478 7.089 0.000 Significant obtained from the multiplication result of two or more direct effect. If there were two or more direct effect that composes indirect effect significantly, so indirect effect also significant. The result of direct effect examination (Table 4) was explained as follow: (i) There was significantly direct effect (p-value 0.00 < 0.05) and negative (inner weight-0.918) between altitude and temperature. The meaning was higher altitude condition affects lower temperature condition; (ii) There was significantly direct effect (p-value 0.022 < 0.05) and positive (inner weight 0.363) between altitude and CEC of soil. The meaning was higher altitude condition affects higher CEC of soil condition; (iii) There was significantly direct effect (p-value 0.000 < 0.05) and positive (inner weight 1.047) between temperature Figure 2. Path diagram of the result of the examination of direct effect hypothesis. Note: and CEC of soil. The meaning was Dot line indicates indirect effect, straight line indicates direct effect 50 BIODIVERSITAS 12 (1): 45-51, January 2011 higher temperature condition affects higher CEC of soil (2003) reported that environmental factors such as condition; (iv) There was significantly direct effect (p- rhizospheric nutrition concentrations and light intensity value 0.000 < 0.05) and positive (inner weight 1.466) were affected calcium oxalate crystals in an ornamental between altitude and percentage of coverage. The meaning plant Dieffenbachia. Both of these previous research results was higher altitude condition affects higher percentage of support the results. The altitude, temperature, and coverage condition; (v) There was significantly direct percentage of coverage were indirectly affected to petiole effect (p-value 0.000 < 0.05) and positive (inner weight diameter. The CEC of soil was directly affected to petiole 1.033) between temperature and percentage of coverage. diameter. The petiole diameter was directly affected to The meaning was higher temperature condition affects corm oxalate content and corm size, while corm oxalate higher percentage of coverage condition; (vi) There was content was not directly affected to corm size. significantly direct effect (p-value 0.027 < 0.05) and Based on plant physiology experts, oxalate synthesis in positive (inner weight 0.249) between CEC of soil and plant presumed via some precursors for example oxidation percentage of coverage. The meaning was higher CEC of and dismutation of glyoxylate, cleavage of oxaloacetate, soil condition affects higher percentage of coverage and cleavage of ascorbate (Libert and Franceschi 1987; condition; (vii) There was not significantly direct effect (p- Franceschi and Nakata 2005), while Hagler and Herman value 0.215 > 0.05) or there was indirect effect between (1973) reported that the formation of calcium oxalate via altitude and petiole diameter condition; (viii) There was not cleavage of respiratory carbohydrate or from protein significantly direct effect (p-value 0.183 > 0.05) or there metabolism. Based on the results, oxalate synthesis in plant was indirect effect between temperature and petiole was not directly influenced by temperature and CEC of soil, diameter condition; (ix) There was significantly indirect but it was 89.2% directly influenced by petiole diameter. effect between temperature and petiole diameter. The Whereas, petiole diameter was 30.6% directly influenced coefficient of indirect effect was 1.047x-0.306 =-0.320. by CEC of soil, but negative value. The meaning was The meaning was higher temperature condition affects higher CEC of soil affects lower petiole diameter of porang. lower petiole diameter condition if the condition of CEC of The petiole diameter was 47.8% directly affected to corm soil was lower too; (x) There was significantly direct effect diameter; and 89.2% directly affected to corm total oxalate, (p-value 0.021 < 0.05) and negative (inner weight-0.306) soluble oxalate, insoluble oxalate, and density of calcium between CEC of soil and petiole diameter. The meaning oxalate crystal. The corm total oxalate, soluble oxalate, was higher CEC of soil condition affects lower petiole insoluble oxalate, and density of calcium oxalate crystal diameter condition; (xi) There was not significantly direct were not directly affected to corm diameter. effect (p-value 0.587 > 0.05) or there was indirect effect The information of the correlation between the between percentage of coverage and petiole diameter environment and plant oxalate content also obtained from condition; (xii) There was significantly direct effect (p- Singh (1974) who explained that vegetable plant value 0.000 < 0.05) and positive (inner weight 0.892) Chenopodium album L. and C. amaranticolor L. which between petiole diameter and corm diameter. The meaning treated with light (climate), fertilizers and salinity (soil was higher petiole diameter condition affects higher corm mineral) revealed that oxalic acid synthesized in leaves as a diameter condition; (xiii) There was not significantly direct metabolite from both photosynthesis and non- effect (p-value 0.120 > 0.05) or there was indirect effect photosynthesis pathway. The meaning was light directly among corm total oxalate, soluble oxalate, insoluble influenced to photosynthesis and indirectly influenced to oxalate, and density of calcium oxalate crystal and corm oxalate synthesis. However, in this research revealed that diameter condition; (xiv) There was significantly direct light was not influenced to corm oxalate content but effect (p-value 0.000 < 0.05) and positive (inner weight temperature indirectly influenced to petiole diameter. 0.478) among petiole diameter and corm total oxalate, Therefore, temperature also indirectly influenced to porang soluble oxalate, insoluble oxalate, and density of calcium corm oxalate content. The difference of this results oxalate crystal condition. The meaning was higher petiole presumed due to the former design and data analysis were diameter condition affects higher corm total oxalate, analyzed partially or univariately. soluble oxalate, insoluble oxalate, and density of calcium Some researchers reported that oxalate content different oxalate crystal condition. for any kind of plant species depend on age, physiology, Many scientific information explain the correlation environment, and genetic (Libert and Franceschi 1987). between environmental factors and plant growth. The Palaniswamy et al. (2002, 2004) explained that oxalic acid interaction between environmental factors and genetic was influenced by nitrogen (soil mineral) and the age of factors will influence plant production (Sugito 1999). leaves in hydroponic vegetable plant Portulaca oleraceae Environmental factors also affect plant growth as well as L. Sumarwoto (2008) explained that P and K fertilizer (soil plant substance in this case plant oxalate content. Although mineral) influenced corm size (diameter, thickness, and oxalate is not a secondary metabolite compound, plant weight of corm) of Amorphophallus muelleri, but no oxalate content is affected by environmental factors. information about corm oxalate content. Rahman et al. (2006) reported that oxalate content in Ambarwati and Murti (2001) reported that corm napiergrass (Pennisetum purpureum Schumach) was diameter and weight of Amorphophallus variabilis significantly affected by the season with the highest value positively and significantly correlated with glucomannan (3.77%) being associated with early summer samples and and starch, and negatively correlated with corm oxalate the lowest value (1.76%) with late autumn samples. Cao content. However, the increasing of corm size was not INDRIYANI et al. – Relationship between climate and soil to oxalate content of porang 51 always followed by the decreasing of corm oxalate content Cao H (2003) The distribution of calcium oxalate crystals in genus and vice versa. This fact was appropriate with the report of Dieffenbachia Schott, and the relationship between environmental factors and crystal quantity and quality. [M.Sc. Thesis]. University of Indriyani et al. (2010a,b) that mentioned there was Florida, Miami. FL. difference of oxalate content based on corm size, but its Franceschi VR, Nakata PA (2005) Calcium oxalate in plants: formation correlation was not linear. Soil factors were seemly more and function. Ann Rev Plant Biol 56: 41-71. dominantly affected corm oxalate content than climate Ghozali I (2008) Structural Equation Modeling: alternative method with Partial Least Square (PLS). 2nd ed. Diponegoro University, Semarang. factors. Hagler L, Herman RH (1973) Oxalate metabolism. Comments in biochemistry. Edited by Herman RH. Amer J Clin Nutr 26: 758-765. Holloway WD, Argall ME, Jealous WT, Lee JA, Bradburry JH (1989) Organic acids and calcium oxalate in tropical root crops. J Agric Food CONCLUSION Chem 37 (2): 337-341. Indriyani S, Arisoesilaningsih E, Wardiyati T, Purnobasuki H (2010a). The result revealed that predictive-relevance Q2 value The relationship of the environmental factors of porang or the Goodness of Fit model R2 was 99.45%, so the model (Amorphophallus muelleri Blume) habitat at five agroforestry in East Java related to corm oxalate content. Proceeding Book Volume 1. 7th reasonable to possess a relevant predictive value. The Basic Science National Seminar. Faculty Mathematics and Natural developing model to determine the relationship between Sciences. Brawijaya University. [Indonesia]. climate and soil factors related to oxalate content in porang Indriyani S, Mastuti R, Roosdiana A (2010b) Oxalate content in porang corm revealed that temperature and CEC of soil possessed (Amorphophallus muelleri Blume syn. A. oncophyllus Prain) corm. J Biol Res 4A: 99-102. indirect effect to corm total oxalate, soluble oxalate, Jansen PCM, van der Wilk C, Hetterscheid WLA (1996) Amorphophallus insoluble oxalate, and density of calcium oxalate crystal. In Blume ex Decaisne. In: Flach M Rumawas F (eds.). Plant Resources this developing model only porang petiole diameter was of South-East Asia 9: Plants yielding non-seed carbohydrates. Prosea influenced indirectly by altitude, temperature, percentage Bogor. Lase E (2007). Cultivation of the jungle corm (porang). Koran Nias 3 of coverage, and it was influenced directly by CEC of soil. September 2007. Porang petiole diameter was influenced positively, directly Libert B, Franceschi VR (1987) Oxalate in crop plants. J Agric Food and significantly to corm total oxalate, soluble oxalate, Chem 35: 926-938. insoluble oxalate, and density of calcium oxalate crystal Nakata PA (2003) Advances in our understanding of calcium oxalate crystal formation and function in plants. Plant Sci 164: 901-909. and corm diameter. The correlation among corm total Noonan SC, Savage GP (1999) Oxalic acid content of foods and its effect oxalate, soluble oxalate, insoluble oxalate, and density of on human. Asia Pacific J Clin Nutr 8: 64-74. calcium oxalate crystal and corm diameter oxalate content Palaniswamy UR, Bible BB, McAvoy RJ (2002) Effect of was negative, but the increasing of corm diameter was not nitrate:ammonium nitrogen ratio on oxalate levels of purslane. In: Janick J, Whipkey A (eds.). Trends in new crops and new uses. ASHS always followed by the decreasing of corm total oxalate, Press. Alexandria, VA. soluble oxalate, insoluble oxalate, and density of calcium Palaniswamy UR, Bible BB, McAvoy RJ (2004) Oxalic acid oxalate crystal and vice versa. There was indirect effect concentrations in purslane (Portulaca oleraceae L.) is altered by the between corm total oxalate, soluble oxalate, insoluble stage of harvest and the nitrate to ammonium ratios in hydroponics Scientia Horticulture 102: 267-275. oxalate, and density of calcium oxalate crysta and corm Prychid CJ, Rudall PJ (1999) Calcium oxalate crystals in diameter. monocotyledons: a review of their structure and systematics. Ann Bot 84: 725-739. Prychid CJ, Jabaily RS, Rudall PJ (2008) Cellular ultrastructure and crystal development in Amorphophallus (Araceae). Ann Bot 101: ACKNOWLEDGEMENTS 983-995. Rahman MM, Niimi M, Ishii Y, Kawamura O (2006) Effects of season, This research was supported by DP2M, Directorate variety and botanical fractions on oxalate content of napiergrass (Pennisetum purpureum Schumach). Grassland Sci 52 (4): 161-166. General of High Education, Ministry of National Education Sarmanu, Kuntoro, Widjanarko B, Wibowo A, Notobroto HB (2009) through Post-graduate Program of Airlangga University Training material: Structural Equation Modeling and Partial Least through Doctorate Program Research Grant year 2009. We Square. Faculty of Animal Medice, Airlangga University, Surabaya. would like to thank to Rendra Aji Saputra and Evit Singh PP (1974) Influence of light intensity, fertilizers and salinity on Endriyeni for helpfully assistance at the laboratory. oxalate and mineral concentration of two vegetables (Chenopodium album L. and Chenopodium amaranthicolor L.). Qual Plant-PIF ds Hum Nutr 24: 115-125. Solimun, Fernandes AAR (2008) Structural equation modeling approach REFERENCES PLS and SEM: application of smartPLS and AMOS software. Laboratory of Statistics Faculty of Mathematics and Natural Sciences Brawijaya University Malang. Afriyol (1993) The observation of agroclimatology aspect of iles-iles plant Sugito Y (1999) Plant ecology. Faculty of Agriculture Publisher Amorphophallus oncophyllus. [Final Task]. Department of Brawijaya University Malang. Geophysics and Meteorology Faculty of Mathematics and Natural Sulaeman AR (2004) Porang, make prosperous community and conserve Sciences Bogor Agriculture Institute Bogor. [Indonesia]. Klangon jungle. Kompas, 19 January 2004. Ambarwati E, Murti RH (2001) Correlation analysis and path coefficient Sumarwoto (2005) Iles-iles (Amorphophallus muelleri Blume): of agronomy character to chemical composition of iles-iles Description and another characters. Biodiversitas 6(3) : 185-190. (Amorphophallus variabilis) corm. Agric Sci 8 (2): 55-61. Sumarwoto (2008) Growth and yield of elephant food yam AOAC (1990) Official methods of analysis. Association of Official (Amorphophallus muelleri Blume) in first growth period on various P Analytical Chemist. Food composition; additives, natural and K fertilizer dosage. Agrivita 30 (10): 67-74. th contaminants. 15 ed. Edited by Helrich K. AOAC, Virginia. Yuzammi (2000) A taxonomic revision of the terrestrial and aquatic nd Brown D (2000) Aroids: plants of the arum family. 2 ed. Timber Press, Aroids (Araceae) in Java. [Master Thesis]. School of Biological Portland. OR. Science, Faculty of Life Science, University of New South Wales, Sidney. BIODIVERSITAS ISSN: 1412-033X (printed edition) Volume 12, Number 1, January 2011 ISSN: 2085-4722 (electronic) Pages: 52-58 DOI: 10.13057/biodiv/d120110

Species identification and selection to develop agroforestry at Lake Toba Catchment Area (LTCA)

NURHENI WIJAYANTO♥ Department of Silviculture, Faculty of Forestry, Bogor Agricultural University (IPB), Bogor 16680, PO BOX 168-16001, West Java, Indonesia, Tel. +62- 251-8626806, Fax. +62-251-8626886, ♥email: [email protected]

Manuscript received: 25 April 2010. Revision accepted: 23 June 2010.

ABSTRACT

Wijayanto N (2011) Species identification and selection to develop agroforestry at Lake Toba Catchment Area (LTCA). Biodiversitas 12: 52-58. In order to improve land productivity surrounding the LTCA, the existing ITTO project tries to establish agroforestry system. The system will be designed to meet consideration of both sides. on one side is to generate the people awareness of the forest and land rehabilitation, and on the other side is to support the poverty reduction. The aims of this research are: species identification and selection to develop agroforestry at LTCA. Data collecting was carried out with: interview, group discussion, field observation, divining manual study, and PRA. The diversity of the available crop kind shows the number of choices to be developed by the farmer. The farmers generally have the economic objective to develop agroforestry, including increase in net income, risk reduction, increase in environmental service, and the wealth and savings accumulation. Various types of agricultural crops, plantations and forest trees were found in LTCA. They can be the basis for building a wide variety of agroforestry systems.

Key words: catchment area, agroforestry system, sequential, integrated.

INTRODUCTION traditional knowledge, as long as the traditional knowledge is not hampering the purpose of the program, which is to Forests are cleared mainly into agricultural land as a reduce the poverty. Hopefully, through agroforestry, land result of population growth, high dependability of productivity surrounding the LTCA will be improved and population to agriculture sector, and low awareness of income of community will be increased. forest functions on the environment. This condition Pattanayak et al. (2003) has reviewed 120 studies on together with slash-and-burn cultivation practices that use on-farm tree growing (agroforestry adoption). This review inappropriate cultivation system caused negative impact on revealed limited empirical attempts to study on-farm tree the environment, especially reducing land productivity. growing related to biophysical factors. The limited number Cash crops are often presented as an alternative to slash- of biophysical variables such as slope, soil quality and and-burn agriculture, assuming that this practice is in crisis irrigation are included in a very few studies. They found or doomed to fail in short term. These conditions lead into that only 27% of the studies contained biophysical a poverty increase which affects many farmers and damage variables. Notwithstanding, these variables were important the natural resources (deforestation, watershed degradation, predictors in a majority of studies (64%) where they were etc.) (Ducoirtieux et al. 2006). In order to improve land included. Thus, they emphasized a need of comprehensive productivity surrounding the LTCA, the existing empirical studies on on-farm growing to incorporate International Trade Timber Organization (ITTO) project biophysical factors. In most developing countries, rural tries to establish agroforestry system which combines the communities practice agriculture. These communities are techniques for reforestation and land rehabilitation with characterized by high socioeconomic inequalities. agricultural cultivation. The aims of this research are: species identification and Agroforestry is able to mitigate environmental problems selection to develop agroforestry at LTCA. through several mechanisms. In turn, practitioners have seen these ecological benefits turn into economic benefits through the increase of agricultural output (Hildreth 2008). MATERIALS AND METHODS Agroforestry serves multiple functions. It is a source of livelihood and it provides environmental service that The study was conducted from February until May consists of watershed functions, biodiversity and climate 2008. Agroforestry field survey was carried out on several change (Na’iem 2007). The system will be designed with studies and production demo plots. The locations were the aims to generate the people awareness to the forest and Samosir, Simalungun, and Karo District of North Sumatra land rehabilitation, and to support the poverty reduction. Province, Indonesia. Details of demo plots in each district Doing agroforestry means caring and adopting the were presented in Table 1. WIJAYANTO – Agroforestry at Lake Toba Catchment Area 53

Table 1. Location of demo plot in each district Information and data analysis that was carried out were: (i) managing data: collecting data, completing and District Sub District Village classifying it in accordance to concept or category, (ii) Samosir Sianjur Mula-mula Sianjur Mula-mula displaying data: organizing the result of data reduction that Simalungun Girsang Sipangan Bolon Sipangan Bolon organized and displaying completely, and (iii) verifying data. Karo Merek Sibolangit RESULTS AND DISCUSSION The primary data collected were soil type, climate, slope, local, and endemic species. The secondary data were Species diversity land productivity, land use change history, growth of The species of crop data divided into agriculture, agricultural sector surrounding the LTCA, agricultural plantation and forestry commodity are shown in Table 2. commodities, physical aspects surrounding the LTCA (soil, Agricultural sector plays a strategic role in Simalungun climate, and water), and prospective species on District, where the contribution from this sector amounts to agroforestry of the LTCA. Data collecting was carried out 54.77%, followed by industrial sector amounted to 18.86%, with: (i) interview (semi structured household interviews), services 10.4%, commerce 8.44%, as well as other sectors. (ii) focus group discussion (farmers and local community From these figures and in accordance with the potential and members, official research and development institution, characteristics of the region, the agricultural sector non government organizations, farmer organizations, becomes the main priority scale development in this area artisans and traders, and private enterprise). (iii) field (CBS Simalungun District 2007a). Agriculture sector is one observation (checking and inventorying plants that grow of Samosir District leading sectors which contribute about around the demo plot candidate, surveys such as crops 48.16% of Gross District Income (CBS Samosir District variety inventorying and land condition checking), and (iv) 2007a). Karo District is known as an agricultural center in PRA (tools are: transects, seasonal calendars, matrices, the North Sumatran Province. Agriculture sector gives the participatory diagramming); respondents: farmers and local biggest contribution for Gross District Income, which is community members (Sianjur Mula-mula 50 respondents, about 59.58% (CBS Karo District 2007a). Sipangan Bolon 13 respondents, and Sibolangit 10 The field observation results of demo plot site respondents). candidates villages are reported in Table 3. Based on the Secondary data such as commodity products were observation (at Sianjur Mula-mula Village), the results of collected from Indonesian Statistic Center of North the agriculture (crop) made by community are Allium cepa, Sumatra. The object of this research is the Sub District that Capsicum annuum, Zea mays, Oryza sativa, Coffea arabica, entered study territory, and the candidate of agroforestry Persea americana, Gliricidia sepium (Jacq.) Walp., and demo plot. The information about those locations was Erythrina subumbrans (Hassk.) Merr.. The wanted gathered from data of Central Bureau of Statistics (CBS) plantation are combined with second crops, such as C. Simalungun District (2007a, 2007b), CBS Samosir District arabica, MPTs (D. zibethinus, P speciosa, Archidendron (2007a, 2007b), and CBS Karo District (2007a, 2007b). pauciflorum (Benth.) Nielsen., A. heterophyllus, and P. americana. The forestry trees planted are Toona sureni (Bl.) Merr. and Tectona grandis L.f.

Table 2. Agriculture, plantation and forestry commodity

Commodity District Agriculture (crops) Plantation and Forestry (trees) Simalungun Oryza sativa L., Zea mays L., Manihot esculenta Crantz., Coffea arabica L., Cocos nucifera L., Eugenia Ipomoea batatas (L.) L., Arachis hypogaea L., Glycine aromatica O.K., Cinnamomum burmanii (C.G. & Th. max (L.) Merr., Capsicum annuum L., Pisonia grandis Nees) Bl., Aleurites moluccana (L.) Wild., Arenga R.Br., Allium cepa L. forma ascalonicum, Allium sativum pinnata (Wurmb.) Merr., Areca catechu L., Vanilla L., Solanum aculeatissimum Jacq., Solanum melongena L., mexicana Mill., Durio zibethinus Murr., Mangifera Lycopersicon esculentum Mill., Daucus carota L., indica L., Artocarpus heterophyllus Lam., Persea Brassica rugosa Prain., Vigna unguiculata (L.) Walp., americana Mill., and Citrus aurantium L. Cucumis sativus L., Ipomoea aquatica Forsk., Phaseolus vulgaris L., Musa paradisiaca L., Carica papaya L., and Ananas comosus (L.) Merr. Samosir O. sativa, Z. mays, M. esculenta, I. batatas, A. hypogaea, C. arabica, C. nucifera, E. aromatica, A. moluccana, G. max, and Curcuma longa L. Vanilla mexicana Mill., A. pinnata, A. catechu, Theobroma cacao L., Myristica fragrans Houtt., and Anacardium occidentale L. Karo L. esculentum, P. grandis, S. aculeatissimum, A. cepa, A. C. arabica, C. nucifera, E. aromatica, A. moluccana, sativum, C. annuum, P. vulgaris, and D. carota C. burmanii, and Parkia speciosa Hask. Source: CBS Simalungun District (2007b); CBS Samosir District (2007b); CBS Karo District (2007b) 54 BIODIVERSITAS 12 (1): 52-58, January 2011

Table 3. The field observation result of demo plot site candidates villages

Demo plot site Altitude, annual candidates villages and rainfall, and average Current vegetation, and soil types Problem geographic position temperature Sianjur Mula-mula . 900-2,100 m asl. with . Current vegetation: A. cepa, C. annuum, Z. mays, O. . There are many bare Village declivity between 0- sativa, C. arabica, P. americana, G. sepium, Pinus lands with hill and 98,47o-98,67o LE and >40 % or the average merkusii Jungh. & De Vr., and E. subumbrans undulate topography that 2,54o-2,55oPN gradient. . hapludults, dystropepts, humitropepts, troporthents are easy to burn. . 1,400-6.000 mm/year (Ultisol, Inceptisol, and Entisol) . 12˚-33˚C.

Sipangan Bolon Village . 900-1.800 m asl. with . Current vegetation: C. Arabica, E. aromatica, . The rate of land 2.60˚-2.67˚ PN and 8-25% of slope or Bambusoideae spp., D. zibethinus, A. moluccana, P. degradation was quite 98.96˚-99,04˚ LE with slightly and Americana, Psidium guajava L., P. merkusii, P. high which was seen steeply area. speciosa, A. heterophyllus, Sandoricum koetjape from domination of tall . 1.500-4.000 mm/year (Burm.f.) Merr., grass . 18˚-32˚C. . kecapi, M. indica, Macadamia hildebrandii Steenis, A. pinnata, C. Annum, Zingiber officinale Rosc., P. grandis, L. esculentum, Z. mays, and A. hypogaea . troporthents, dystropepts, humitropepts, hapludults, haplohumults, tropopsamments, and hapludox (Inceptisol, Entisol, Ultisol, and Oxisol)

Sibolangit Village . 900-1,200 m asl. with . Current vegetation: M. indica, P. americana, A. . The large number of 2.87˚-2.88˚ PN and the slope between 8- moluccana, G. sepium, E. deglupta, T. sureni, Melia critical land which was 98.54˚-98.56˚ LE 25% that was slight azedarach L., Cassia siamea Lamk., Gmelina dominated by sedge- until medium slope. arborea Roxb., A. muricata, A. heterophyllus, grass on that area . The rainfall in this Syzygium aqueum (Burm.f.) Alston, A. pinnata, Z. . Marketing of agriculture territory revolved mays, C. arabica, A. cepa, T. cacao, A. catechu, D. yield that is still between 1,500-5.700 zibethinus, Solanum torvum Sw., P. speciosa, A. difficult, fire disaster, mm/the year Pauciflorum. and the mango trees that . 17˚-32˚C. . tropudult (Ultisol) only have a few fruits.

Table 4. The Commodities that were really liked by the farmer

Demo plot site candidates Commodity villages and located Agriculture (crops) Plantation Forestry (trees) Sianjur Mula-mula Village C. annum, Z. mays, O. sativa, A. C. arabica, P. americana, D. G. sepium, P. merkusii, E. cepa zibethinus, P. speciosa, A. lithosperma, T. sureni and T. pauciflorum, A. Heterophyllus grandis

Sipangan Bolon Village C. annum, Z. mays, L. esculentum, C. arabica, T. cacao, P. T. sureni, S. macrophylla, and Z. officinale americana, D. Zibethinus Podocarpus imbricata Bl.

Sibolangit Village C. annum, Z. mays, M. esculenta, C. arabica, T. cacao, E. aromatic, E. deglupta, T. sureni, C. O. sativa, A. cepa, A. hypogaea M. Indica calothyrsus, A. mangium

The available crops in the community's land consist of stocktaking, it is known that available crops variety in A. cepa, C. annum, A. hypogaea, Z. mays, M. esculenta, demo plot land (the Sagala-resin Village), which serve as and O. sativa as the agricultural crop. The available an agricultural crops, were C. annum, Z. officinale, P. plantation crops in Sibolangit Village are C. arabica, T. grandis, L. esculentum, and Z. mays. The available cacao, and E. aromatica clove. The forestry crop planted plantation crops in the community's land are C. arabica by the Sibolangit Village community are M. indica, A. and E. Aromaticum, whereas for the forestry crops were moluccana, P. Americana, T. sureni, D. zibethinus, Bambusoideae spp., D. zibethinus, A. moluccana, P. Gmelina arborea Roxb., P. guajava, A. Pinnata, A. americana, P. guajava, P. merkusii, P. speciosa, A. muricata, A. catechu, S. torvum, P. speciosa, A. heterophyllus, S. koetjape, M. indica, M. hildebrandii, and Pauciflorum, E. deglupta, A. heterophyllus, M. azedarach, A. pinnata. G. sepium, and Cassia siamea Lamk. The community often does not know about the species The commodities really liked by farmer are reported in of crops that can be planted, nor do they know how the Table 4. Based on results of the interview with participants production technique of seedling cultivation of the forestry (Sipangan Bolon Village) in the meeting and results of crops (the tree) is. However, the most wanted second crop WIJAYANTO – Agroforestry at Lake Toba Catchment Area 55 species are the legumes, which are Z. mays, L. esculentum, basic ecosystem functions, at levels of complexity far Z. officinale, and C. annum. The most wanted species of below those of natural ecosystems (Van Noordwijk et al. the plantation crop are C. arabica, and T. cacao. P. 2004). americana is the most wanted species of MPTs followed Factors which should be considered for achieving by Solanum aculeatissimum Jacq. and D. zibethinus, success in agroforestry are among other things (Perum whereas for the community's trees, the most wanted species Perhutani 1993): (i) Environmental factors: species of is T. sureni in addition to Swietenia macrophylla King., and plants, topography, soil fertility, climate, pest and diseases; Podocarpus imbricata Bl.. Most of the group's members do (ii) Supporting factors: road condition, accessibility not like P. merkusii because of consideration that it will (distance), supporting facilities, capital support, and market drain the land. prospect; (iii) socio-cultural factors: planting techniques, Then, the plantation crops really liked by the farmer (at skill level, and types of needs. Patterns of agroforestry are Sibolangit Village) are C. arabica, P. americana, and T. determined by several factors, which are among other cacao. The forestry crops that they want are Eucalyptus things: (i) interaction between components within the deglupta Blume, T. sureni, Calliandra calothyrsus Meissn., agroforestry system, (ii) determination of planting distance D. zibethinus, A. mangium Willd., and M. indica. Actually (spacing) of main crops, (iii) management treatment, and A. mangium kind was not yet known by them, but they are (iv) efforts to seek multifunction of land and sustainability interested of planting the acacia after having been given the of yield. Regulation of plant components (Nair 1993) can explanation that A. mangium could be planted as the be conducted by among other things: (i) spatial regulation pioneer of fast growing crop before the bare land is planted (dense mixture, sparse mixture, strip and boundary); (ii) by C. arabica and T. cacao. temporal regulation (coinciding, in a row, overlapping, in In the determination of species, there are some sequence, interpolated). Imo (2009) showed that tree interesting information: (i) participants in the meeting want survival, growth and nutrient uptake, and maize growth and not only T. sureni, but also the combination of various yield were higher in the deep soil site than the shallow site. kinds of trees/crops, (ii) P. merkusii was not liked by the The planting technology which is needed to make the most because of belief in by the community that it will existing land use systems be functional in increasing land absorb water quite a lot, (iii) C. calothyrsus is known by productivity and supporting soil and water conservation the community as the fire barrier that grows faster than M. functions, are among other things: development of terrace hildebrandii. and the use of compost or organic fertilizer. Therefore, Considering the condition of the villages as mentioned development of forage crops in a land unit, for terrace above, plant varieties which were appropriate to be planted reinforcement, becomes a requirement which should be in the demo plot are: (i) For Sianjur Mula-mula Village: C. prioritized. In the study area, there is a great potential for arabica, P. americana, P. merkusii, and T. sureni; (ii) For development of compost or organic fertilizer. Development Sipangan Bolon Village: S. macrophylla, M. tinctoria of this kind of fertilizer should be emphasized, due to Roxb, T. sureni, C. calothyrsus, Jatropha curcas L., P. consideration that at present, as indicated by interview americana, C. arabica, T. cacao, and S. aculeatissimum; results, the dependence of farmers on chemical fertilizer is (iii) For Sibolangit Village: T. sureni, C. calothyrsus, E. very high. In long term, chemical fertilizer will have deglupta, C. arabica, T. cacao, M. indica, Caesalpinia negative impact toward Lake Toba ecosystem. sappan L. and P. americana. Calliandra plants are appropriate to be developed. The Trees play a crucial part in almost all terrestrial main objectives of calliandra plant developments are for ecosystems and provide a range of products and services to terrace reinforcement and for honey bee culture. However, rural and urban people. As natural vegetation is cleared for there is also other purpose of the bee culture, namely agriculture and other types of development, the benefits assisting the process of pollination of fruit crops (mango). provided by trees are the best sustained by integrating trees According to information from the farmers, the mangga into agriculturally productive landscapes (Kuswanto 2007). udang (a kind of mango) plants, at present become rare in producing fruit or sparse in the fruit production. The selection of agriculture plant species Sequential system and succession system which are The choice of crop species was very important, because managed properly could become the main alternative in the mistakes that might be happened will have a long developing forest with the agroforestry system in Toba impact and will be very damaging. The species being Lake area, because the system have the following potency: selected should not only suitable with the specific site, but (i) efficient in light utilization, (ii) maintaining the nutrient also have capacity to grow and develop ideally together availability, (iii) increasing soil organic matter, (iv) with other crop species being planted on the same land. increasing productivity, (v) having more self-maintenance features, (vi) having relatively less pest and diseases, (vii) Factors which determine the success of agroforestry having relatively less competition from weeds. A key to successful mixed cropping is selection of species with complementary root system behavior patterns Requirements of plant species for agroforestry as well as complementary shoot growth habits (Huck In conventional intercropping in agricultural tree crop 1983). Multispecies agro-ecosystems, with their potential plantations, certain criteria have been suggested for for synergy in terms of below-ground interactions, can choosing suitable ‘subsidiary’ crops. Thus, Allen (1955) offer improved farmer livelihoods and sustainability and stated that the second or subsidiary crop grown under or 56 BIODIVERSITAS 12 (1): 52-58, January 2011 between a tree crops should be tolerant of partial shade, real promise in alleviating poverty by contributing both and should not: (i) grow as tall as the main crop; its root products and important ecological services. For the many system should exploit different soil horizons; (ii) be more crop components and combinations possible, this system is susceptible than main crops to diseases they have in highly adaptable and applicable to a wide area and range of common; (iii) demand harvesting or other operations that physical and social conditions (Withrow-Robinson et al. would damage the main crop or induce soil erosion or 1999; Withrow-Robinson and Hibbs 2005). Fruit-based damage soil structure; and (iv) have an economic life agroforestry can potentially be developed from indigenous longer than that of the main crop. In addition to these, fruits that are now mostly found in the wild as much as Hartley (1977) adds that: (i) the soil shall be suitable for from exotic fruit sources. The contribution of indigenous both crops; (ii) the combine yield of the two crops shall be fruits to poverty reduction and their vital role in the greater in monetary terms than that of the main crop when livelihoods of many communities is getting good grown without the subsidiary crops; and (iii) if and when recognition (Garrity 2004; Schreckenberg et al. 2006). In the subsidiary crops comes to the end of its bearing life, the addition, as they are adapted to the local environment, yield of the main crop shall continue at an economic level indigenous fruits can grow easily with few requirements for unaffected by previous presence of subsidiary crop. external input and be integrated into sustainable farming Agroforestry can help prevent land degradation while systems. allowing continuing use of land to produced crops and An evaluation of farmers' experiences planting native livestock on sustainable basis (Cacho 2005). trees in rural Panama: implications for reforestation with Research Institutes of IPB (1986) reported plant species native species in agricultural landscapes (Garen et al. which are used for each form of agroforestry should fulfill 2009) reported all participants in the program considered the following requirements: (i) Ecological requirement: their experience to be positive, few had problems with their The plant species should (a) be suitable with the local plantations, and most were interested in planting more condition where the agroforestry will be developed; (b) not native trees. The program's frequent and ongoing technical create competition with food/forage or feed crops, either in support was an important factor for farmers. These results the form of root competition or crown competition (for this indicate widespread interest in, and success with, planting purpose, species being selected are trees with light crown, native species and underscore the need to systematically and deep rooting; or there should be proper regulation of examine farmers' interests and perceptions when planning, spacing of planting); (c) be able to increase and maintain implementing, and evaluating reforestation initiatives. soil fertility/soil productivity; (d) have slow regeneration Ecological and socio-economic sustainability is not just and narrow radius of seed dispersal to prevent expansion related to species diversity per se, but rather to more toward food crops which are combined with the tree crops; specific features such as presence of keystone species and (ii) Economic requirements: The plant species should (a) diversity in functional species groups. Socio-economic produce yield rapidly (in this case, fast growing species sustainability in terms of adjustment to socio-economic with high increment could be chosen) (b) have multiple change implies dynamics in species diversity (Abebe et al. benefits (such as in the form of carpentry wood, raw 2010). materials for pulp and paper, firewood, and others); (c) be easily marketed (the developed plant species should be How the plants utilize sun light? integrated with other sectors); (d) be as far as possible If light it is the main limiting environmental resource, produce intermediate yields (the obtained yield in the form then leaves become organs of aggression, and the dominant of wood is obtained not only in the end of the rotation, but crop will be that which is tallest. One of the most potent also during the whole period of the rotation, and for this ways of resource sharing is to plant crops so that they each purpose there could be efforts in the form of establishing become tallest in turn. Five ways of doing this spring to multistoried tree stands which are combined with mind (Cannel 1983): (i) by planting crops together which plantation of estate crops, feed/forage crops or food crops). attain similar heights but with different life cycles, (ii) by Any choice of species (Huxley 1999) is conditioned by planting crops together which attain different heights such a combination of the farmer’s objectives and constrains, the that the sorter ones mature before the taller ones, (iii) by biology of the species concerned, and the nature of the planting crops at different time, (iv) by planting crops system in which it is be grown – we have to get all of these which can climb up the stalks of crops that mature before right. Sometimes ascertaining the farmer needs thorough a them, and (v) by minimizing the shade by the tall crops, by consideration of the technical alternatives as it should. using erect-leaved crops (for example, maize), by pruning Assumptions about the benefits of agroforestry may, trees or by planting deciduous trees. . unwisely, be taken for granted. Keeping an open mind The findings of spatial arrangement, interview results about the whole spectrum of possibilities is crucial. Also, and literature review, revealed the following things. . The of course, in optimizing land use it is essential that, after villages around lake Toba has the following characteristics the social issues have been exposed and explored, all the (i) The farmer made efforts to maintain diversity of the technical alternatives are evaluated in economic terms. crops (ii) the farmer generally knows well the species of Agroforestry is one possible option to enhance the annual crops, estate crops, and forestry crops which they stability and productivity of agro-ecosystems (Kindt et al. cultivated (iii) the farmer generally practices the land use 2006) and alleviate environmental stresses (Leakey and system of agroforestry (iv) the women had important role Jaenicke 1995). Especially, fruit-based agroforestry has a in the land use system, (v) there were high dependence on WIJAYANTO – Agroforestry at Lake Toba Catchment Area 57 chemical fertilizer, (vi) the farmer generally knows crop seedlings. Farmer choice on tree species differs among species which have high economic value (vii) generally, ethnic background and associated resource base (Hairiah the farmer did not really practice the proper conservation 2006). technique for soil and water (viii) Farm land in the villages seldom received the attention of agricultural extension workers (ix) organic fertilizers were still rarely used. CONCLUSION The diversity of the existing crop species showed the number of choices to be developed by the farmer. The Various types of agricultural crops, plantations and farmer generally has the aims of economic gain in forest trees were found in LTCA. They have the potential developing agroforestry, such as risk reduction increase in to be developed in agroforestry systems. Based on the data net income, increase in environmental service and increase and information being collected, as well as the available in wealth and savings. The villagers would only receive literature references, the combination of the crops species and developed agroforestry, when they felt that it was which were potential to be developed were among other beneficial. Therefore, agroforestry was not only an art of things: (i) The agricultural crop: Z. mays, O. sativa, C. mixing woody plants, fruit tree, annual crops, and animal in annuum, B. rugosa, L. esculentum, S. tuberosum, P. skill full manner, but agroforestry was also in the long run, grandis, Phaseolus spp., A. cepa, C. papaya, M. an art to make life in rural areas more productive and paradisiaca, A. comosus, P. vulgaris, and M. esculenta; (ii) interesting. "Interesting" in this sense was related with the The plantation/estate crop: C. arabica, T. cacao, E. ability of agroforestry to maintain good cultural values, to aromatica, C. aurantium, S. aculeatissimum, P. americana, control the use of land, and to increase people’s income, as J. curcas, M. indica, C. burmanii, P. speciosa, S. aqueum, well as to reduce risk in farming works and to spread the A. occidentale, P. guajava, and E. lithosperma; (iii) The use of labors in the farm. forestry tree species: T. sureni, S. macrophylla, P. merkusii, The concepts, strategies and policies associated with P. falcataria, G. arborea, C. calothyrsus, E. deglupta, M. agroforestry are rapidly evolving towards the creation of hildebrandii, T. grandis, C. siamea, G. sepium, A. sustainable land uses that enhance farmers' livelihoods, moluccana, P. imbricata, M. tinctoria Roxb., A. provide commodities for global markets and mitigate heterophyllus, C. sappan L. Development of integrated global concerns about environmental degradation. In agriculture in the form of agroforestry system (livestocks, parallel, the techniques for the domestication of indigenous livestock feed, agriculture, plantation, forestry) are better to trees for the agroforestry production of NTFPs also are be prioritized, to create sustainable forest and prosperous evolving rapidly and should produce further benefits in community. Sequential system and succession system terms of income generation for agricultural inputs and which are managed properly, should become the basis of household welfare (Leakey and Tchoundjeu 2001). plant selection and combination for development of Moreover, the present study open vistas for using farmers’ agroforestry system to make the farmers happy and the experience and knowledge of adoption of agroforestry to forest sustainable. stimulate on-farm tree growing. The wider implication of the study is that biophysical as well as social variables should be considered together in designing suitable REFERENCES agroforestry systems in various parts of the world (Sood and Mitchell 2009). Abebe T, Wiersum KF, Bongers F (2010) Spatial and temporal variation Modern agriculture and forestry, without and agro- in crop diversity in agroforestry homegardens of Southern Ethiopia. ecological perspective, has gone a long way toward Agrofor Sys 78: 309 Allen EF (1955) Cultivation other crops with rubber. Planters Bulletin satisfying the demand for food, fiber, and other products. 16. Rubber Research Institute of Malaysia, Kuala Lumpur This has been accomplished in a world with rapidly Cacho O (2005) An analysis of externalities in agroforestry systems in the expanding population and a less stable land area presence of land degradation. Ecol Econom 39: 131-143 (Wojtkowski 2002). Wijayanto (2001) stated that Cannel MGR (1983) Plant management in agroforestry manipulation of trees, population densities and mixtures of trees and herbaceous management system for community based forest could be crops. In: Huxley PA (ed.) Plant research and agroforestry. ICRAF, done through maintaining and implementing dynamic Nairobi equilibrium condition, with implies that occurring growth CBS Karo District (2007b) Merek Sub-District in Figures 2007. in economy and business should be accompanied by Kabanjahe [Indonesia] CBS Karo District. (2007a) Karo District in Figures 2007. Kabanjahe ecological sustainability and socio-cultural stability. [Indonesia] Agroforestry is one options directly linked to the double CBS Samosir District (2007a) Samosir District in Figures 2007. goal of providing a good income to farmers and Pangururan [Indonesia] maintaining the environmental services that all of society CBS Samosir District (2007a) Simanindo Sub-District in Figures 2007. Pangururan [Indonesia] expects: no landslides that destroy houses, no flooding CBS Simalungun District (2007a) Girsang Sipangan Bolon Sub-District in beyond what is to the expected when there are is heavy Figures 2007. Pematangsiantar [Indonesia] rain, no pollution of the water sources by over use CBS Simalungun District (2007a) Simalungun District in Figures 2007. fertilizers and pesticides as we find in vegetable Pematangsiantar [Indonesia] Ducoirtieux O, Visonnavong P, Rossard J (2006) Introducing cash crops production. Farmers interested planting trees in their farm in shifting cultivation regions-the experience with cardamom in Laos. depending on land ownership, economic value, market Agrofor Sys 66: 65-76 access, low labor requirements and availability of good Garen EJ, Saltonstall K, Slusser JL, Mathias S (2009) An evaluation of farmers' experiences planting native trees in rural Panama: 58 BIODIVERSITAS 12 (1): 52-58, January 2011

implications for reforestation with native species in agricultural University, SEANAFE, Department of Forestry, and Perum landscapes. Agrofor Sys 76: 219 Perhutani. Yogyakarta, 7-8 February 2006 Garrity DP (2004) Agroforestry and the achievement of the millennium Nair PKR (1993) An introduction to agroforestry. Kluwer Academic development goals. Agrofor Syst 61-62 (1-3): 5-17 Publishers in cooperation with ICRAF. Netherlands Hairiah K (2006) Can agroforestry improve the livehood of smallholder Pattanayak SK, Mercer DE, Sills E, Yang J (2003) Taking stock of farmers and environmental services on degraded soil? In: Sabarnurdin agroforestry adoption studies. Agrofor Syst 57:173-186 MS (ed.) The role of agroforestry education in revitalization of Perum Perhutani (1993) Guidelines for agroforestry in the social forestry. agriculture, fishery and forestry program; proceeding international Perum Perhutani, Jakarta [Indonesia] seminar. Gadjah Mada University, SEANAFE, Department of Research Institutes of IPB (1986) The draft plan of transmigration Forestry, and Perum Perhutani. Yogyakarta, 7-8 February 2006 settlement pattern with its main business agroforestry. Cooperation Hartley CWS (1977) The oil palm. 2nd ed. Longman, London between the Secretariat General of Transmigration Department with Hildreth LA (2008) The economic impacts of agroforestry in the Research Institutes of IPB, Bogor [Indonesia] Northern Plains of China. Agrofor Syst 72: 119-126 Schreckenberg K, Awono A, Degrande A, A., Mbosso, C., Ndoye, O. and Huck MG (1983) Root distribution, growth and activity with reference to Tchoundjeu, Z (2006) Domesticating indigenous fruit trees as a agroforestry. In: Huxley PA (ed.) Plant research and agroforestry. contribution to poverty reduction. Forests Trees Livelihoods 16: 35- ICRAF, Nairobi 51 Huxley P (1999) Tropical agroforestry. Blackwell Science Ltd. London. Sood KK, Mitchell ECP (2009) Identifying important biophysical and Imo M (2009) Interactions amongst trees and crops in taungya systems of social determinants of on-farm tree growing in subsistence-based western Kenya. Agrofor Sys 76: 265 traditional agroforestry system. Agrofor Syst 75:175-187 Kindt R, Van Damme P, Simons AJ (2006). Tree diversity in western van Noordwijk M, Cadisch G, Ong CK (2004) Challenges for the next Kenya: using diversity profiles to characterise richness and evenness. decade of research on below-ground interactions in tropical Biodiversity and Conservation 15: 1253-1270 agroecosystems: client-driven solutions at landscape scale. In: van Kuswanto KR (2007) Restructuring education in agriculture science. In: Noordwijk M, Cadisch G, Ong CK (eds) Below-ground interactions Sabarnurdin MS (ed.) The role of agroforestry education in in tropical agroecosystems: concepts and models with multiple plant revitalization of agriculture, fishery and forestry program; proceeding components. CABI, New York international seminar. Gadjah Mada University, SEANAFE, Wijayanto N (2001) Dominant factors on management system for Department of Forestry, and Perum Perhutani community based forest (Case study at Repong Damar, Pesisir Krui, Leakey RRB, Jaenicke H (1995) The domestication of indigenous fruit Lampung. [Dissertation]. Bogor Agricultural University, Bogor trees: opportunities and challenges for agroforestry. In: Suzuki K, [Indonesia] Sakurai S, Ishii K, Norisada M (eds) Proceedings of 4th International Withrow-Robinson B, Hibbs D, Gypmantasiri P, Thomas D (1999) BIO-REFOR Workshop. BIO-REFOR, 15-26. Tokyo, 7-11 October Preliminary classification of fruit-based agroforestry in a highland 2001 area of northern Thailand. Agrofor Syst 42:195-205 Leakey RRB, Tchoundjeu Z (2001) Diversification of tree crops: Withrow-Robinson B, Hibbs D (2005) Testing an ecologically based domestication of companion crops for poverty reduction and classification tool on fruit-based agroforestry in northern Thailand. environmental service. Expl Agric 37: 279-296 Agrofor Syst 65 (2): 123-135 Na’iem M (2007) Preface. In: Sabarnurdin MS (ed.) The role of Wojtkowski PA (2002) Agroecological perspectives in agronomy, agroforestry education in revitalization of agriculture, fishery and forestry, and agroforestry. Science Publishers, Inc. Enfield (NH) forestry program; proceeding international seminar. Gadjah Mada USA, Plymouth, UK GUIDANCE FOR AUTHORS

BIODIVERSITAS, the Journal of Biological Diversity publishes and pictures are preferably presented in a digital file. JPEG format should be scientific articles, i.e. original research and review in all biodiversity aspects sent in the final (accepted) article. Author could consign any picture or photo of plants, animals and microbes at the level of gene, species, and ecosystem. for front cover, although it does not print in the manuscript. There is no Scientific feedback (short communication) is only received for manuscript, appendix, all data or data analysis are incorporated into Results and which criticize published article before. Manuscripts will be reviewed by Discussions. For broad data, it can be displayed in website as Supplement. managing editor and invited peer review according to their disciplines. The Citation in manuscript is written in “name and year” system; and is only articles written in English (U.S. English) are accepted for publication. arranged from oldest to newest and from A to Z. The sentence sourced from This journal periodically publishes in January, April, July, and October. In many authors, should be structured based on the year of recently. In citing an order to support reduction of global warming as a consequence of article written by two authors, both of them should be mentioned, however, transportation vehicles emission and forest degradation for paper for three and more authors only the family (last) name of the first author is manufacturing, management of the journal prefer receiving manuscripts via mentioned followed by et al., for example: Saharjo and Nurhayati (2006) or e-mail rather than in hard copy. Manuscript and its communications can only (Boonkerd 2003a, b, c; Sugiyarto 2004; El-Bana and Nijs 2005; Balagadde et be addressed to the managing editor; better to forward to one of the al. 2008; Webb et al. 2008). Extent citation as shown with word “cit” should communicating editor for accelerating evaluation. A letter of statement be avoided, and suggested to refer an original reference. expressing that the author (s) is responsible for the original content of APA style in double space is used in the journal reference as follow: manuscript, the result of author(s)’s research and never been published must Journal: be attached. Carranza S, Arnold EN (2006) Systematics, biogeography and evolution of Manuscript is typed at one side of white paper of A4 (210x297 mm2) Hemidactylus geckos (Reptilia: Gekkonidae) elucidated using mitochondrial size, in a single column, double space, 12-point Times New Roman font, DNA sequences. Mol Phylogenet Evol 38: 531-545. with 2 cm distance step aside in all side. Smaller letter size and space can be Saharjo BH, Nurhayati AD (2006) Domination and composition structure applied in presenting table. Word processing program or additional software change at hemic peat natural regeneration following burning; a case can be used, however, it must be PC compatible and Microsoft Word based. study in Pelalawan, Riau Province. Biodiversitas 7: 154-158. Names of sub-species until phylum should be written in italic, except for Book: italic sentence. Scientific name (genera, species, author), and cultivar or Rai MK, Carpinella C (2006) Naturally occurring bioactive compounds. strain should be mentioned completely at the first time mentioning it, Elsevier, Amsterdam. especially for taxonomic manuscripts. Name of genera can be shortened after Chapter in book: first mentioning, except generating confusion. Name of author can be Webb CO, Cannon CH, Davies SJ (2008) Ecological organization, eliminated after first mentioning. For example, Rhizopus oryzae L. UICC biogeography, and the phylogenetic structure of rainforest tree 524, hereinafter can be written as R. oryzae UICC 524. Using trivial name communities. In: Carson W, Schnitzer S (eds) Tropical forest should be avoided, otherwise generating confusion. Mentioning of scientific community ecology. Wiley-Blackwell, New York. name completely can be repeated at Materials and Methods. Biochemical Abstract: and chemical nomenclature should follow the order of IUPAC-IUB, while th its translation to Indonesian-English refers to Glossarium Istilah Asing- Assaeed AM (2007) Seed production and dispersal of Rhazya stricta. 50 Indonesia (2006). For DNA sequence, it is better used Courier New font. annual symposium of the International Association for Vegetation Symbols of standard chemical and abbreviation of chemistry name can Science, Swansea, UK, 23-27 July 2007. be applied for common and clear used, for example, completely written Proceeding: butilic hydroxytoluene to be BHT hereinafter. Metric measurement use IS Alikodra HS (2000) Biodiversity for development of local autonomous denomination, usage other system should follow the value of equivalent with government. In: Setyawan AD, Sutarno (eds) Toward mount Lawu the denomination of IS first mentioning. Abbreviation set of, like g, mg, mL, national park; proceeding of national seminary and workshop on etc. do not follow by dot. Minus index (m-2, L-1, h-1) suggested to be used, biodiversity conservation to protect and save germplasm in Java island. except in things like “per-plant” or “per-plot”. Equation of mathematics Sebelas Maret University, Surakarta, 17-20 July 2000. [Indonesian] does not always can be written down in one column with text, for that case Thesis, Dissertation: can be written separately. Number one to ten are expressed with words, Sugiyarto (2004) Soil macro-invertebrates diversity and inter-cropping plants except if it relates to measurement, while values above them written in productivity in agroforestry system based on sengon. [Dissertation]. number, except in early sentence. Fraction should be expressed in decimal. Brawijaya University, Malang. [Indonesian] In text, it should be used “%” rather than “gratuity”. Avoid expressing idea Information from internet: with complicated sentence and verbiage, and used efficient and effective Balagadde FK, Song H, Ozaki J, Collins CH, Barnet M, Arnold FH, Quake sentence. Manuscript of original research should be written in no more than SR, You L (2008) A synthetic Escherichia coli predator-prey ecosystem. 25 pages (including tables and picture), each page contain 700-800 word, or Mol Syst Biol 4: 187. www.molecularsystemsbiology.com proportional with article in this publication number. Invited review articles will be accommodated. Publication manuscript “in press” can be cited and mentioned in Title of article should be written in compact, clear, and informative reference (bibliography); “personal communications” can be cited, but sentence preferably not more than 20 words. Name of author(s) should be cannot be mentioned in reference. Research which not be published or completely written. Running title is about five words. Name and “submitted” cannot be cited. institution address should be also completely written with street name and Some annotation. Manuscript typed without sign link (-) (except number (location), zip code, telephone number, facsimile number, and e-mail repeated word in Indonesian). Usage of letter “l” (el) to “1” (one) or “O” address. Manuscript written by a group, author for correspondence along (oh) to “0” (null) should be avoided. Symbols of α, β, χ, etc. included with address is required. First page of the manuscript is used for writing through facility of insert, non altering letter type. No space between words above information. and punctuation mark. Abstract should not be more than 200 words, written in English. Progress of manuscript. Notification of manuscript whether it is Keywords is about five words, covering scientific and local name (if any), accepted or refused will be notified in about three months since the research theme, and special methods which used. Introduction is about 400- manuscript received. Manuscript is refused if the content does not in line 600 words, covering background and aims of the research. Materials and with the journal mission, low quality, inappropriate format, complicated Methods should emphasize on the procedures and data analysis. Results language style, dishonesty of research authenticity, or no answer of and Discussion should be written as a series of connecting sentences, correspondence in a certain period. Author or first authors at a group however, for manuscript with long discussion should be divided into sub manuscript will get one original copy of journal containing manuscript titles. Thorough discussion represents the causal effect mainly explains for submitted not more than a month after publication. Offprint or reprint is only why and how the results of the research were taken place, and do not only re- available with special request. express the mentioned results in the form of sentences. Concluding sentence should preferably be given at the end of the discussion. Acknowledgments NOTE: Author(s) agree to transfer copy right of published paper to are expressed in a brief. BIODIVERSITAS, Journal of Biological Diversity. Authors shall no longer Figures and Tables of maximum of three pages should be clearly be allowed to publish manuscript completely without publisher permission. presented. Title of a picture is written down below the picture, while title of a Authors or others allowed multiplying article in this journal as long as not table is written in the above the table. Colored picture and photo can be for commercial purposes. For the new invention, authors suggested to accepted if information in manuscript can lose without those images. Photos manage its patent before publishing in this journal.

NOTIFICATION: All communications are strongly recommended to be undertaken through email. ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

GENETIC DIVERSTY Identification and characterization of Salmonella typhi isolates from Southwest Sumba 1-6 District, East Nusa Tenggara based on 16S rRNA gene sequences CHARIS AMARANTINI, LANGKAH SEMBIRING, HARIPURNOMO KUSHADIWIJAYA, WIDYA ASMARA Species diversity of Amorphophallus (Araceae) in Bali and Lombok with attention to 7-11 genetic study in A. paeoniifolius (Dennst.) Nicolson AGUNG KURNIAWAN, I PUTU AGUS HENDRA WIBAWA, BAYU ADJIE Pulsed Field Gel Electrophoresis (PFGE): a DNA finger printing technique to study the 12-16 genetic diversity of blood disease bacterium of banana HADIWIYONO, JAKA WIDADA, SITI SUBANDIYAH, MARK FEGAN

ECOSYSTEM DIVERSTY Diversity and phosphate solubilization by bacteria isolated from Laki Island coastal 17-21 ecosystem SRI WIDAWATI Epiphytic orchids and host trees diversity at Gunung Manyutan Forest Reserve, Wilis 22-27 Mountain, Ponorogo, East Java NINA DWI YULIA, SUGENG BUDIHARTA Inventory and habitat study of orchids species in Lamedai Nature Reserve, Kolaka, 28-33 Southeast Sulawesi DEWI AYU LESTARI, WIDJI SANTOSO Infection of Anisakis sp. larvae in some marine fishes from the southern coast of Kulon 34-37 Progo, Yogyakarta EKO SETYOBUDI, SOEPARNO, SENNY HELMIATI Herpetofaunal community structure and habitat associations in Gunung Ciremai National 38-44 Park, West Java, Indonesia AWAL RIYANTO A model of relationship between climate and soil factors related to oxalate content in 45-51 porang (Amorphophallus muelleri Blume) corm SERAFINAH INDRIYANI, ENDANG ARISOESILANINGSIH, TATIK WARDIYATI, HERY PURNOBASUKI

ETHNOBIOLOGY (CULTURAL DIVERSITY) Species identification and selection to develop agroforestry at Lake Toba Catchment Area 52-58 (LTCA) NURHENI WIJAYANTO

Front cover: Eria flavescens (PHOTO: NINA DWI YULIA)

Published four times in one year PRINTED IN INDONESIA

ISSN: 1412-033X (printed) ISSN: 2085-4722 (electronic)