DOCSLIB.ORG

Quantitative and Qualitative Proteomic Investigations of the Α7 Nicotinic Acetylcholine Receptor by William J. Brucker, III

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Quantitative and Qualitative Proteomic Investigations of the Α7 Nicotinic Acetylcholine Receptor by William J. Brucker, III Quantitative and Qualitative Proteomic Investigations of the α7 Nicotinic Acetylcholine Receptor By William J. Brucker, III Sc.B., Brown University, 2004 Thesis Submitted in partial fulfillment of the requirements for the Degree of Doctor of Philosophy in the Department of Molecular Pharmacology, Physiology & Biotechnology at Brown University PROVIDENCE, RHODE ISLAND MAY 2013 © Copyright 2013 by William J. Brucker, III ii Signature Page This dissertation by William J. Brucker, III is accepted in its present form by the Department of Molecular Pharmacology, Physiology & Biotechnology as satisfying the dissertation requirement for the degree of Doctor of Philosophy. Date _____________ _________________________________ Edward Hawrot, Ph.D, Advisor Recommended to the Graduate Council Date _____________ _________________________________ Wayne Bowen, Ph.D, Reader Date _____________ _________________________________ James Clifton, Ph.D, Reader Date _____________ _________________________________ Nadine Kabbani, Ph.D, Reader Date _____________ _________________________________ Julie Kauer, Ph.D, Reader Approved by the Graduate Council Date _____________ _________________________________ Peter M. Weber, Dean of the Graduate School iii CURRICULUM VITA William J. Brucker, III Dr. Brucker was born in Bethel Park, Pennsylvania in May 1982. He graduated from Brown University in 2004 with a Bachelor of Science with Honors degree in Chemistry. He then matriculated to the MD/PhD program at Brown Medical School. Dr. Brucker also served as an adjunct professor of biology at Rhode Island College from 2007 to 2011. He founded a non-profit organization, Providence Alliance of Clinical Educators, dedicated to improving the quality and applicability of high school science curriculum for students across the country. Dr. Brucker’s distinguished honors include: 2001 Howard Hughes Medical Institute Fellowship, 2002 Brown University Royce Fellowship, 2003 Undergraduate Award for Excellence in Chemistry/ Rhode Island American Chemical Society, 2003 Barry M. Goldwater Scholarship and Excellence in Education Foundation Scholar Award, 2004 Sigma Xi National Scientific Research Honors Society, 2004 “Ivy 50” award for All-time Ivy League Scholar, 2011 Peterson Fund for Educational Enhancement Award. Dr. Brucker has co-authored several peer-reviewed publications as well as anthologies of science parables for educational use. Dr. Brucker is pursuing additional training in Pediatrics in the University of Connecticut Pediatric Residency program. iv ACKNOWLEDGEMENTS To my wife, Stacy, thank you for supporting me through the writing process To Joao Paulo, who aided greatly in the preparation of this dissertation To Dr. Hawrot, thank you for your constant support and guidance. To Dr. Clifton, thanks for being mass spec mentor all of these years. To members of the Hawrot lab past and present, thank you for your company and friendship. v TABLE OF CONTENTS CURRICULUM VITA ............................................................................................................ iv ACKNOWLEDGEMENTS ...................................................................................................... v LIST OF TABLES .................................................................................................................... x LIST OF FIGURES ................................................................................................................. xi LIST OF ABBREVIATIONS .............................................................................................. xiii CHAPTER 1: GENERAL INTRODUCTION ...................................................................... 1 Acetylcholine receptors .............................................................................................................. 2 Nicotinic acetylcholine receptors: subunit stoichiometry and assembly ................ 2 Nicotinic acetylcholine receptor subunit domains and properties ............................ 4 The cytoplasmic loop and signaling ....................................................................................... 5 Function of neuronal nicotinic acetylcholine receptors ................................................. 8 α7 Nicotinic Acetylcholine Receptors ................................................................................. 10 Role in the Hippocampus ................................................................................................................... 13 Intracellular Signaling ......................................................................................................................... 14 Knockout Observations: Cognition, Anxiety, Baroreceptor Response ............................ 17 Non-Neuronal Expression ................................................................................................................. 19 Nicotine and Nicotinic Acetylcholine Receptors............................................................. 20 Burden of Smoking ............................................................................................................................... 20 Nicotine Abuse and Psychiatric Disease ...................................................................................... 22 Pharmokinetics of Nicotine .............................................................................................................. 23 Sensitization and Up-regulation of nAChRs ............................................................................... 23 Nicotine and Reinforcement ............................................................................................................. 24 α7 nAChRs and Nicotine Reinforcement Pathways ................................................................ 25 Withdrawal .............................................................................................................................................. 27 Withdrawal Phenotypes and nAChR Subunits ......................................................................... 27 Oral Nicotine Exposure in a Mouse Model .................................................................................. 28 Metabolism of Nicotine ....................................................................................................................... 29 α7 nAChR targeted smoking cessation therapies .................................................................... 30 Nicotine, Proliferation, and Malignancy ...................................................................................... 30 Nicotine, Arteriogenesis, and Vasculature ....................................................................... 31 Nicotine, α7 nAChRS and Pathologic Vasculogenesis ............................................................ 32 α7 nAChR and Inflammation ................................................................................................. 35 Studies with α7 Specific Agonists and Positive Allosteric Modulators (PAMS)... 37 Effects on Cognition ............................................................................................................................. 38 Effects on Sensory Gating .................................................................................................................. 39 Effects on Nociception ........................................................................................................................ 41 Neuropathic Pain .................................................................................................................................. 41 vi Visceral Pain ............................................................................................................................................ 42 α7 nAChR and Development .................................................................................................. 43 Consequences of Prenatal Nicotine Exposure........................................................................... 43 Nicotinic AChRs and Development ................................................................................................ 44 α7 nAChR Effects on Glutaminergic Synapse Formation ..................................................... 44 α7 nAChR Effect on Chloride Gradient ......................................................................................... 45 α7 nAChR and Neuropathology............................................................................................. 46 Nicotine, α7 nAChR and Anxiety ..................................................................................................... 46 Alzheimer’s Disease ............................................................................................................................. 48 α7 and Schizophrenia .......................................................................................................................... 50 Proteomics ................................................................................................................................... 51 Mass Spectrometry Based Proteomics ............................................................................... 53 Peptide Ionization Techniques ........................................................................................................ 57 Tandem Mass Spectrometry ............................................................................................................. 59 Mass Analyzers ..........................................................................................................................
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Computational Genome-Wide Identification of Heat Shock Protein Genes in the Bovine Genome [Version 1; Peer Review: 2 Approved, 1 Approved with Reservations]
    F1000Research 2018, 7:1504 Last updated: 08 AUG 2021 RESEARCH ARTICLE Computational genome-wide identification of heat shock protein genes in the bovine genome [version 1; peer review: 2 approved, 1 approved with reservations] Oyeyemi O. Ajayi1,2, Sunday O. Peters3, Marcos De Donato2,4, Sunday O. Sowande5, Fidalis D.N. Mujibi6, Olanrewaju B. Morenikeji2,7, Bolaji N. Thomas 8, Matthew A. Adeleke 9, Ikhide G. Imumorin2,10,11 1Department of Animal Breeding and Genetics, Federal University of Agriculture, Abeokuta, Nigeria 2International Programs, College of Agriculture and Life Sciences, Cornell University, Ithaca, NY, 14853, USA 3Department of Animal Science, Berry College, Mount Berry, GA, 30149, USA 4Departamento Regional de Bioingenierias, Tecnologico de Monterrey, Escuela de Ingenieria y Ciencias, Queretaro, Mexico 5Department of Animal Production and Health, Federal University of Agriculture, Abeokuta, Nigeria 6Usomi Limited, Nairobi, Kenya 7Department of Animal Production and Health, Federal University of Technology, Akure, Nigeria 8Department of Biomedical Sciences, Rochester Institute of Technology, Rochester, NY, 14623, USA 9School of Life Sciences, University of KwaZulu-Natal, Durban, 4000, South Africa 10School of Biological Sciences, Georgia Institute of Technology, Atlanta, GA, 30032, USA 11African Institute of Bioscience Research and Training, Ibadan, Nigeria v1 First published: 20 Sep 2018, 7:1504 Open Peer Review https://doi.org/10.12688/f1000research.16058.1 Latest published: 20 Sep 2018, 7:1504 https://doi.org/10.12688/f1000research.16058.1 Reviewer Status Invited Reviewers Abstract Background: Heat shock proteins (HSPs) are molecular chaperones 1 2 3 known to bind and sequester client proteins under stress. Methods: To identify and better understand some of these proteins, version 1 we carried out a computational genome-wide survey of the bovine 20 Sep 2018 report report report genome.
    [Show full text]
  • Gene Targeting Therapies (Roy Alcalay)
    Recent Developments in Gene - Targeted Therapies for Parkinson’s Disease Roy Alcalay, MD, MS Alfred and Minnie Bressler Associate Professor of Neurology Division of Movement Disorders Columbia University Medical Center Disclosures Funding: Dr. Alcalay is funded by the National Institutes of Health, the DOD, the Michael J. Fox Foundation and the Parkinson’s Foundation. Dr. Alcalay receives consultation fees from Genzyme/Sanofi, Restorbio, Janssen, and Roche. Gene Localizations Identified in PD Gene Symbol Protein Transmission Chromosome PARK1 SNCA α-synuclein AD 4q22.1 PARK2 PRKN parkin (ubiquitin ligase) AR 6q26 PARK3 ? ? AD 2p13 PARK4 SNCA triplication α-synuclein AD 4q22.1 PARK5 UCH-L1 ubiquitin C-terminal AD 4p13 hydrolase-L1 PARK6 PINK1 PTEN-induced kinase 1 AR 1p36.12 PARK7 DJ-1 DJ-1 AR 1p36.23 PARK8 LRRK2 leucine rich repeat kinase 2 AD 12q12 PARK9 ATP13A2 lysosomal ATPase AR 1p36.13 PARK10 ? ? (Iceland) AR 1p32 PARK11 GIGYF2 GRB10-interacting GYF protein 2 AD 2q37.1 PARK12 ? ? X-R Xq21-q25 PARK13 HTRA2 serine protease AD 2p13.1 PARK14 PLA2G6 phospholipase A2 (INAD) AR 22q13.1 PARK15 FBXO7 F-box only protein 7 AR 22q12.3 PARK16 ? Discovered by GWAS ? 1q32 PARK17 VPS35 vacuolar protein sorting 35 AD 16q11.2 PARK18 EIF4G1 initiation of protein synth AD 3q27.1 PARK19 DNAJC6 auxilin AR 1p31.3 PARK20 SYNJ1 synaptojanin 1 AR 21q22.11 PARK21 DNAJC13 8/RME-8 AD 3q22.1 PARK22 CHCHD2 AD 7p11.2 PARK23 VPS13C AR 15q22 Gene Localizations Identified in PD Disorder Symbol Protein Transmission Chromosome PD GBA β-glucocerebrosidase AD 1q21 SCA2
    [Show full text]
  • Irina Nicoleta Cimalla Algan/Gan Sensors for Direct Monitoring Of
    Irina Nicoleta Cimalla AlGaN/GaN sensors for direct monitoring of fluids and bioreactions AlGaN/GaN sensors for direct monitoring of fluids and bioreactions Irina Nicoleta Cimalla Universitätsverlag Ilmenau 2011 Impressum Bibliografische Information der Deutschen Nationalbibliothek Die Deutsche Nationalbibliothek verzeichnet diese Publikation in der Deutschen Nationalbibliografie; detaillierte bibliografische Angaben sind im Internet über http://dnb.d-nb.de abrufbar. Diese Arbeit hat der Fakultät für Elektrotechnik und Informationstechnik der Technischen Universität Ilmenau als Dissertation vorgelegen. Tag der Einreichung: 23. November 2009 1. Gutachter: PD Dr. rer. nat. habil. Andreas Schober (Technische Universität Ilmenau) 2. Gutachter: Univ.-Prof. Dr. rer. nat. habil. Oliver Ambacher (Fraunhofer Institut für Angewandte Festkörperphysik Freiburg) 3. Gutachter: PD Dr.-Ing. habil. Frank Schwierz (Technische Universität Ilmenau) Tag der Verteidigung: 15. Juli 2010 Technische Universität Ilmenau/Universitätsbibliothek Universitätsverlag Ilmenau Postfach 10 05 65 98684 Ilmenau www.tu-ilmenau.de/universitaetsverlag Herstellung und Auslieferung Verlagshaus Monsenstein und Vannerdat OHG Am Hawerkamp 31 48155 Münster www.mv-verlag.de ISBN 978-3-86360-003-7 (Druckausgabe) URN urn:nbn:de:gbv:ilm1-2010000519 Titelfoto: photocase.com | AlexFlint „Unde dragoste nu e, nimic nu e” „Wo Liebe nicht ist, ist gar nichts“ Marin Preda: „Cel mai iubit dintre pamanteni“ 5 6 Abstract In this thesis, AlGaN/GaN heterostructures, which have shown to be reliable pH sensors, have been characterized and further developed for the in situ monitoring of cell reactions. For this reason, NG108-15 nerve cells were cultivated on sensor surfaces and their response on different neuroinhibitors was clearly monitored. First, a measurement setup for extracellular recording was designed in connection with an improved chip design and sensor technology.
    [Show full text]
  • University of Groningen the Human HSP70/HSP40 Chaperone Family
    University of Groningen The human HSP70/HSP40 chaperone family Hageman, Jurre IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2008 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Hageman, J. (2008). The human HSP70/HSP40 chaperone family: a study on its capacity to combat proteotoxic stress. s.n. Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license. More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne- amendment. Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum. Download date: 30-09-2021 CHAPTER 1 Introduction - Structural and functional diversities between members of the human HSPH, HSPA and DNAJ chaperone families Jurre Hageman and Harm H.
    [Show full text]
  • Families and the Structural Relatedness Among Globular Proteins
    Protein Science (1993), 2, 884-899. Cambridge University Press. Printed in the USA. Copyright 0 1993 The Protein Society -~~ ~~~~ ~ Families and the structural relatedness among globular proteins DAVID P. YEE AND KEN A. DILL Department of Pharmaceutical Chemistry, University of California, San Francisco, California94143-1204 (RECEIVEDJanuary 6, 1993; REVISEDMANUSCRIPT RECEIVED February 18, 1993) Abstract Protein structures come in families. Are families “closely knit” or “loosely knit” entities? We describe a mea- sure of relatedness among polymer conformations. Based on weighted distance maps, this measure differs from existing measures mainly in two respects: (1) it is computationally fast, and (2) it can compare any two proteins, regardless of their relative chain lengths or degree of similarity. It does not require finding relative alignments. The measure is used here to determine the dissimilarities between all 12,403 possible pairs of 158 diverse protein structures from the Brookhaven Protein Data Bank (PDB). Combined with minimal spanning trees and hier- archical clustering methods,this measure is used to define structural families. It is also useful for rapidly searching a dataset of protein structures for specific substructural motifs.By using an analogy to distributions of Euclid- ean distances, we find that protein families are not tightly knit entities. Keywords: protein family; relatedness; structural comparison; substructure searches Pioneering work over the past 20 years has shown that positions after superposition. RMS is a useful distance proteins fall into families of related structures (Levitt & metric for comparingstructures that arenearly identical: Chothia, 1976; Richardson, 1981; Richardson & Richard- for example, when refining or comparing structures ob- son, 1989; Chothia & Finkelstein, 1990).
    [Show full text]
  • Mitochondrial Quality Control in Neurodegenerative Diseases: Focus on Parkinson’S Disease and Huntington’S Disease
    ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda condicionat a lʼacceptació de les condicions dʼús establertes per la següent llicència Creative Commons: http://cat.creativecommons.org/?page_id=184 ADVERTENCIA. El acceso a los contenidos de esta tesis queda condicionado a la aceptación de las condiciones de uso establecidas por la siguiente licencia Creative Commons: http://es.creativecommons.org/blog/licencias/ WARNING. The access to the contents of this doctoral thesis it is limited to the acceptance of the use conditions set by the following Creative Commons license: https://creativecommons.org/licenses/?lang=en Mitochondrial quality control in neurodegenerative diseases: focus on Parkinson’s disease and Huntington’s disease TESI DOCTORAL 2018 Programa de Doctorat en Neurociències Institut de Neurociències Tesi realitzada al laboratori de Malalties Neurodegeenratives de l’Institut de Recerca de la Vall d’Hebron (VHIR) Doctorand Director Tutor Sandra Franco Iborra Miquel Vila Bover José Rodríguez Álvarez Co-directora Co-directora Celine Perier Marta Martínez Vicente i AGRAÏMENTS En primer lloc vull agraïr al Miquel Vila per l’oportunitat que em va donar de començar a fer la tesi doctoral al seu lab. Gràcies per tenir sempre la porta oberta del teu despatx, per la confiança dipositada en mi i per tot el que m’has ensenyat durant tots aquests anys. A més, he tingut la sort de tenir no només un director de tesis sinó tres! Celine muchas gracias por estar siempre ahí, por ensenyarme tu manera de hacer ciencia (que me encanta!) y por ser siempre tan positiva. En mi manera de trabajar hay un poquito de ti y espero ir pasando este conocimiento a los demás porque en todo laboratorio debería ser obligatorio que hubiera alguien como tu.
    [Show full text]
  • Structure of an Auxilin-Bound Clathrin Coat and Its Implications for The
    letters to nature common drug target27, suggesting that the spindle-associated 24. Chi, N. W. & Lodish, H. F. Tankyrase is a golgi-associated mitogen-activated protein kinase substrate A that interacts with IRAP in GLUT4 vesicles. J. Biol. Chem. 275, 38437–38444 (2000). PARPs are potential cancer drug targets. 25. Rouleau, M., Aubin, R. A. & Poirier, G. G. Poly(ADP-ribosyl)ated chromatin domains: access granted. J. Cell Sci. 117, 815–825 (2004). Methods 26. Pickett-Heaps, J. D., Forer, A. & Spurck, T. Traction fibre: toward a “tensegral” model of the spindle. Cell Motil. Cytoskel. 37, 1–6 (1997). Imaging and antibodies 27. Troll, W., Garte, S. & Frenkel, K. Suppression of tumor promotion by inhibitors of poly(ADP)ribose Cycled Xenopus egg extract spindles were assembled as described12 with or without formation. Basic Life Sci. 52, 225–232 (1990). X-rhodamine-labelled or Alexa-488-labelled tubulin, and isolated through 40% glycerol 28. Tirnauer, J. S., Salmon, E. D. & Mitchison, T. J. Microtubule plus-end dynamics in Xenopus egg extract BRB80. For staining of non-fixed spindles, isolated spindles were processed for spindles. Mol. Biol. Cell 15, 1776–1784 (2004). immunofluorescence in solutions containing 5% glycerol BRB80. For 29. Lin, W., Ame, J. C., Aboul-Ela, N., Jacobson, E. L. & Jacobson, M. K. Isolation and characterization of immunofluorescence and immunoblotting, polyclonal rabbit LP96-10 IgG was purchased the cDNA encoding bovine poly(ADP-ribose) glycohydrolase. J. Biol. Chem. 272, 11895–11901 from BD Biosciences, polyclonal chicken IgYanti-PAR antibodies from Tulip Biolabs, and (1997). monoclonal 10H from Trevigen. All anti-PAR antibodies were pre-adsorbed against BSA transferred to nitrocellulose.
    [Show full text]
  • Report from the 26Th Meeting on Toxinology,“Bioengineering Of
    toxins Meeting Report Report from the 26th Meeting on Toxinology, “Bioengineering of Toxins”, Organized by the French Society of Toxinology (SFET) and Held in Paris, France, 4–5 December 2019 Pascale Marchot 1,* , Sylvie Diochot 2, Michel R. Popoff 3 and Evelyne Benoit 4 1 Laboratoire ‘Architecture et Fonction des Macromolécules Biologiques’, CNRS/Aix-Marseille Université, Faculté des Sciences-Campus Luminy, 13288 Marseille CEDEX 09, France 2 Institut de Pharmacologie Moléculaire et Cellulaire, Université Côte d’Azur, CNRS, Sophia Antipolis, 06550 Valbonne, France; [email protected] 3 Bacterial Toxins, Institut Pasteur, 75015 Paris, France; michel-robert.popoff@pasteur.fr 4 Service d’Ingénierie Moléculaire des Protéines (SIMOPRO), CEA de Saclay, Université Paris-Saclay, 91191 Gif-sur-Yvette, France; [email protected] * Correspondence: [email protected]; Tel.: +33-4-9182-5579 Received: 18 December 2019; Accepted: 27 December 2019; Published: 3 January 2020 1. Preface This 26th edition of the annual Meeting on Toxinology (RT26) of the SFET (http://sfet.asso.fr/ international) was held at the Institut Pasteur of Paris on 4–5 December 2019. The central theme selected for this meeting, “Bioengineering of Toxins”, gave rise to two thematic sessions: one on animal and plant toxins (one of our “core” themes), and a second one on bacterial toxins in honour of Dr. Michel R. Popoff (Institut Pasteur, Paris, France), both sessions being aimed at emphasizing the latest findings on their respective topics. Nine speakers from eight countries (Belgium, Denmark, France, Germany, Russia, Singapore, the United Kingdom, and the United States of America) were invited as international experts to present their work, and other researchers and students presented theirs through 23 shorter lectures and 27 posters.
    [Show full text]
  • World Journal of Biological Chemistry
    ISSN 1949-8454 (online) World Journal of Biological Chemistry World J Biol Chem 2019 January 7; 10(1): 1-27 Published by Baishideng Publishing Group Inc World Journal of W J B C Biological Chemistry Contents Continuous Volume 10 Number 1 January 7, 2019 EDITORIAL 1 New findings showing how DNA methylation influences diseases Sallustio F, Gesualdo L, Gallone A MINIREVIEWS 7 Autism and carnitine: A possible link Demarquoy C, Demarquoy J 17 Last decade update for three-finger toxins: Newly emerging structures and biological activities Utkin YN WJBC https://www.wjgnet.com I January 7, 2019 Volume 10 Issue 1 World Journal of Biological Chemistry Contents Volume 10 Number 1 January 7, 2019 ABOUT COVER Editor-in-Chief of World Journal of Biological Chemistry, Vsevolod V Gurevich, PhD, Professor, Department of Pharmacology, Vanderbilt University, Nashville, TN 37232, United States AIMS AND SCOPE World Journal of Biological Chemistry (World J Biol Chem, WJBC, online ISSN 1949-8454, DOI: 10.4331) is a peer-reviewed open access academic journal that aims to guide clinical practice and improve diagnostic and therapeutic skills of clinicians. WJBC is to rapidly report the most recent developments in the research by the close collaboration of biologists and chemists in area of biochemistry and molecular biology, including: general biochemistry, pathobiochemistry, molecular and cellular biology, molecular medicine, experimental methodologies and the diagnosis, therapy, and monitoring of human disease. We encourage authors to submit their manuscripts to WJBC. We will give priority to manuscripts that are supported by major national and international foundations and those that are of great basic and clinical significance.
    [Show full text]
  • Intensive Care Muscle Wasting and Weakness
    Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 862 Intensive care Muscle Wasting and Weakness Underlying Mechanisms, Muscle Specific Differences and a Specific Intervention Strategy GuiLLAumE RENAud ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6206 UPPSALA ISBN 978-91-554-8586-3 2013 urn:nbn:se:uu:diva-192531 Dissertation presented at Uppsala University to be publicly examined in Hedstrandsalen, Ingång 70, bv, Akademiska sjukhuset, Uppsala, Friday, March 8, 2013 at 13:15 for the degree of Doctor of Philosophy (Faculty of Medicine). The examination will be conducted in English. Abstract Renaud, G. 2013. Intensive care Muscle Wasting and Weakness: Underlying Mechanisms, Muscle Specific Differences and a Specific Intervention Strategy. Acta Universitatis Upsaliensis. Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 862. 57 pp. Uppsala. ISBN 978-91-554-8586-3. The intensive care unit (ICU) condition, i.e., immobilisation, sedation and mechanical ventilation, often results in severe muscle wasting and weakness as well as a specific acquired myopathy, i.e., Acute Quadriplegic Myopathy (AQM). The exact mechanisms underlying AQM remain incomplete, but this myopathy is characterised a preferential myosin loss and a decreased muscle membrane leading to a delayed recovery from the primary disease, increased mortality and morbidity and altered quality of life of survivors. This project aims at improving our understanding of the mechanisms underlying the muscle wasting and weakness associated with AQM and explore the effects of a specific intervention strategy. Time-resolved analyses have been undertaken using a unique experimental rodent ICU model and specifically studying the muscle wasting and weakness in limb and diaphragm muscles over a two week period.
    [Show full text]
  • The HSP70 Chaperone Machinery: J Proteins As Drivers of Functional Specificity
    REVIEWS The HSP70 chaperone machinery: J proteins as drivers of functional specificity Harm H. Kampinga* and Elizabeth A. Craig‡ Abstract | Heat shock 70 kDa proteins (HSP70s) are ubiquitous molecular chaperones that function in a myriad of biological processes, modulating polypeptide folding, degradation and translocation across membranes, and protein–protein interactions. This multitude of roles is not easily reconciled with the universality of the activity of HSP70s in ATP-dependent client protein-binding and release cycles. Much of the functional diversity of the HSP70s is driven by a diverse class of cofactors: J proteins. Often, multiple J proteins function with a single HSP70. Some target HSP70 activity to clients at precise locations in cells and others bind client proteins directly, thereby delivering specific clients to HSP70 and directly determining their fate. In their native cellular environment, polypeptides are participates in such diverse cellular functions. Their constantly at risk of attaining conformations that pre- functional diversity is remarkable considering that vent them from functioning properly and/or cause them within and across species, HSP70s have high sequence to aggregate into large, potentially cytotoxic complexes. identity. They share a single biochemical activity: an Molecular chaperones guide the conformation of proteins ATP-dependent client-binding and release cycle com- throughout their lifetime, preventing their aggregation bined with client protein recognition, which is typi- by protecting interactive surfaces against non-productive cally rather promiscuous. This apparent conundrum interactions. Through such inter actions, molecular chap- is resolved by the fact that HSP70s do not work alone, erones aid in the folding of nascent proteins as they are but rather as ‘HSP70 machines’, collaborating with synthesized by ribosomes, drive protein transport across and being regulated by several cofactors.
    [Show full text]