Accumulation and Degradation of Polyphosphate in Ac1netobacter Sp. 0000 0284 4245
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
Polyphosphate-Dependent Synthesis of ATP and ADP by the Family-2 Polyphosphate Kinases in Bacteria
Polyphosphate-dependent synthesis of ATP and ADP by the family-2 polyphosphate kinases in bacteria Boguslaw Noceka, Samvel Kochinyanb, Michael Proudfootb, Greg Brownb, Elena Evdokimovaa,b, Jerzy Osipiuka, Aled M. Edwardsa,b, Alexei Savchenkoa,b, Andrzej Joachimiaka,c,1, and Alexander F. Yakuninb,1 aMidwest Center for Structural Genomics and Structural Biology Center, Department of Biosciences, Argonne National Laboratory, 9700 South Cass Avenue, Building 202, Argonne, IL 60439; bBanting and Best Department of Medical Research, University of Toronto, Toronto, ON, Canada M5G 1L6; and cDepartment of Biochemistry and Molecular Biology, University of Chicago, 920 East 58th Street, Chicago, IL 60637 Edited by Robert Haselkorn, University of Chicago, Chicago, IL, and approved September 30, 2008 (received for review August 1, 2008) Inorganic polyphosphate (polyP) is a linear polymer of tens or hun- exopolysaccharide essential for the virulence of P. aeruginosa (12). dreds of phosphate residues linked by high-energy bonds. It is found In the social slime mold Dictyostelium discoideum, a different PPK in all organisms and has been proposed to serve as an energy source was found (DdPPK2) with sequence and properties similar to that in a pre-ATP world. This ubiquitous and abundant biopolymer plays of actin-related proteins (Arps) (14). DdPPK2 is a complex of 3 numerous and vital roles in metabolism and regulation in prokaryotes Arps (Arp1, Arp2, and Arpx) and resembles the actin family in and eukaryotes, but the underlying molecular mechanisms for most molecular weight, sequence, and filamentous structure. Remark- activities of polyP remain unknown. In prokaryotes, the synthesis and ably, DdPPK2 can polymerize into an actin-like filament concurrent utilization of polyP are catalyzed by 2 families of polyP kinases, PPK1 with the synthesis of polyP (14). -
Inferring Microbial Interaction Networks Based on Consensus Similarity Network Fusion
SCIENCE CHINA Life Sciences THEMATIC ISSUE: Computational life sciences November 2014 Vol.57 No.11: 1115–1120 • RESEARCH PAPER • doi: 10.1007/s11427-014-4735-x Inferring microbial interaction networks based on consensus similarity network fusion JIANG XingPeng1,2 & HU XiaoHua2* 1College of Computing and Informatics, Drexel University, Philadelphia, PA 19104, USA; 2School of Computer, Central China Normal University, Wuhan 430079, China Received May 15, 2014; accepted July 21, 2014; published online October 17, 2014 With the rapid accumulation of high-throughput metagenomic sequencing data, it is possible to infer microbial species rela- tions in a microbial community systematically. In recent years, some approaches have been proposed for identifying microbial interaction network. These methods often focus on one dataset without considering the advantage of data integration. In this study, we propose to use a similarity network fusion (SNF) method to infer microbial relations. The SNF efficiently integrates the similarities of species derived from different datasets by a cross-network diffusion process. We also introduce consensus k-nearest neighborhood (Ck-NN) method instead of k-NN in the original SNF (we call the approach CSNF). The final network represents the augmented species relationships with aggregated evidence from various datasets, taking advantage of comple- mentarity in the data. We apply the method on genus profiles derived from three microbiome datasets and we find that CSNF can discover the modular structure of microbial interaction network which cannot be identified by analyzing a single dataset. species interaction, metagenome, diffusion process, biological network, modularity Citation: Jiang XP, Hu XH. Inferring microbial interaction networks based on consensus similarity network fusion. -
Bioaugmentation of Chlorinated Solvents
BIOAUGMENTATION FOR REMEDIATION OF CHLORINATED SOLVENTS: TECHNOLOGY DEVELOPMENT, STATUS, AND RESEARCH NEEDS October 2005 GeoSyntec Consultants TABLE OF CONTENTS LIST OF TABLES ...........................................................................................................................................III LIST OF FIGURES .........................................................................................................................................III ACRONYMNS AND ABBREVIATIONS........................................................................................................V FOREWORD...................................................................................................................................................VII EXECUTIVE SUMMARY ............................................................................................................................... IX 1. INTRODUCTION ..........................................................................................................................................1 2. EARLY DEVELOPMENT OF BIOAUGMENTATION.............................................................................5 3. RECENT PROGRESS IN CHLORINATED SOLVENT BIOREMEDIATION .....................................13 4. DEHALORESPIRATION: THE KEY PROCESS UNDERLYING CURRENT BIOAUGMENTATION PRACTICES..............................................................................................................................................................19 4.1 THE UBIQUITY CONCEPT REVISITED -
Understanding the Interaction Between Anabaena Sp. and a Heterocyst-Specific Epibiont
Understanding the interaction between Anabaena sp. and a heterocyst-specific epibiont Iglika V. Pavlova MBL Microbial Diversity course 2005 Abstract Anabaena sp. and an associated heterocyst-specific epibiontic bacterium were isolated from School Street Marsh in Woods Hole, MA in 1997 during the Microbial Diversity course. A two-member culture of the cyanobacterium and the epibiont have been maintained at WHOI by John Waterbury. Anabaena species with similar heterocyst-specific epibionts have also been isolated from other locations (7, 8, 9). Successful culture of the epibiont separately from the School Street Marsh cyanobacterium was achieved on two occasions (1, 10), but the isolates were not preserved. The epibiont was identified to be an α-proteobacterium within the Rhizobiaceae group (10). The close and specific association between the cyanobacterium and the epibiont strongly suggests there might be a physiological benefit or benefits to the cyanobacterium, the epibiont, or to both partners. This study was designed to understand the potential benefits of the interaction for the epibiontic bacterium. Several approaches were used to isolate the epibiont in pure culture, unsuccessfully. This report describes the rationale for undertaking the project and the approaches used to isolate the epibiont, in the hopes that this will be useful information for the future isolation of an axenic epibiont culture. Rationale Cyanobacterial associations with heterotrophic bacteria from environmental isolates have been described before and have been implicated in increasing the growth of the cyanobacterium (5, 6, 7). Benefit to the cyanobacterium may be derived from a range of associations, including the presence of heterotrophic bacteria in the culture medium, attraction of such bacteria to cyanobacterial secretions (either along the whole filament, or secretions stemming from the heterocyst in filamentous bacteria), or the attachment of the bacterium to the cyanobacterium outer surface (5, 6, 7, 9). -
Escherichia Coli
log bio y: O ro p c e i n M A l c Clinical Microbiology: Open a c c i e n s i l s Delmas et al., Clin Microbiol 2015, 4:2 C Access ISSN: 2327-5073 DOI:10.4172/2327-5073.1000195 Commentary Open Access Escherichia coli: The Good, the Bad and the Ugly Julien Delmas*, Guillaume Dalmasso and Richard Bonnet Microbes, Intestine, Inflammation and Host Susceptibility, INSERM U1071, INRA USC2018, Université Clermont Auvergne, Clermont-Ferrand, France *Corresponding author: Julien Delmas, Microbes, Intestine, Inflammation and Host Susceptibility, INSERM U1071, INRA USC2018, Université Clermont Auvergne, Clermont-Ferrand, France, Tel: +334731779; E-mail; [email protected] Received date: March 11, 2015, Accepted date: April 21, 2015, Published date: Aptil 28, 2015 Copyright: © 2015 Delmas J, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract The species Escherichia coli comprises non-pathogenic commensal strains that form part of the normal flora of humans and virulent strains responsible for acute infections inside and outside the intestine. In addition to these pathotypes, various strains of E. coli are suspected of promoting the development or exacerbation of chronic diseases of the intestine such as Crohn’s disease and colorectal cancer. Description replicate within both intestinal epithelial cells and macrophages. These properties were used to define a new pathotype of E. coli designated Escherichia coli is a non-sporeforming, facultatively anaerobic adherent-invasive E. -
Stouthamer1973
Antonie van Leeuwenhoek 39 (1973) 545-565 545 A theoretical study on the amount of ATP required for synthesis of microbial cell material A. H. STOUTHAMER Biological Laboratory, Free University, de Boelelaan 1087, Amsterdam, the Netherlands STOUTHAMER, A.H. 1973. A theoretical study on the amount of ATP required for synthesis of microbial cell material. Antonie van Leeuwenhoek 39: 545-565. The amount of ATP required for the formation of microbial cells growing under various conditions was calculated. It was assumed that the chemical com position of the cell was the same under all these conditions. The analysis of the chemical composition of microbial cells of Morowitz ( 1968) was taken as a base. It was assumed that 4 moles of ATP are required for the incorporation of one mole of amino acid into protein. The amount of ATP required on account of the instability and frequent regeneration of messenger RNA was calculated from data in the literature pertaining to the relative rates of synthesis of the various classes of RNA molecules in the cell. An estimate is given of the amount of ATP required for transport processes. For this purpose it was assumed that 0.5 mole of ATP is necessary for the uptake of 1 g-ion of potassium or ammo nium, and 1 mole of ATP for the uptake of 1 mole of phosphate, amino acid, acetate, malate etc. The results of the calculations show that from preformed monomers (glucose, amino acids and nucleic acid bases) 31.9 g cells can be formed per g-mole of ATP when acetyl-CoA is formed from glucose. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Aerobic Microorganism' William B
THE RELATION OF OXIDATION-REDUCTION POTENTIAL TO THE GROWTH OF AN .AEROBIC MICROORGANISM' WILLIAM B. WOOD, JR., MARY LEE WOOD AND I. L. BALDWIN University of Wisconsin Received for publication August 2, 1935 INTRODUCTION The possible relationship between the oxidation-reduction po- tentials of culture media and the ability of micro6rganisms to initiate growth has recently interested bacteriologists. The work of Aubel and Aubertin (1927), Dubos (1929a), Fildes (1929), Knight and Fildes (1930), Plotz and Geloso (1930), and others, has established the fact that the growth of certain anaerobes is greatly influenced by the oxidation-reduction potential of the medium. In the case of aerobic bacteria, however, conflicting results have been reported. Allyn and Baldwin (1930, 1932) demonstrated that the potential of the medium was of consider- able importance in determining whether or not small inocula of Rhizobium, an aerobic organism, could initiate growth. Knaysi and Dutky (1934), on the other hand, finding that Bacillus mega- therium would not grow in the absence of dissolved oxygen, even when the potential of the mediuim was varied over a considerable range, concluded that "the limiting factor in the growth of Bacil- lus megatherium in vacuum is the oxygen content and not the oxidation-reduction potential of the culture medium." Their experiments offer no information, however, as to whether or not the potential of the medium affects the growth of this organism under aerobic conditions. The purpose of this paper is to report: (a) experimental evi- 1 Published with the approval of the Director of the Wisconsin Agricultural Experiment Station. 593 594 W. -
Hypothesis Paper Why O2 Is Required by Complex Life on Habitable Planets and the Concept of Planetary “Oxygenation Time”
5703_06_p415-438 5/27/05 1:30 PM Page 415 ASTROBIOLOGY Volume 5, Number 3, 2005 © Mary Ann Liebert, Inc. Hypothesis Paper Why O2 Is Required by Complex Life on Habitable Planets and the Concept of Planetary “Oxygenation Time” DAVID C. CATLING,1 CHRISTOPHER R. GLEIN,1 KEVIN J. ZAHNLE,2 and CHRISTOPHER P. MCKAY2 ABSTRACT Life is constructed from a limited toolkit: the Periodic Table. The reduction of oxygen provides the largest free energy release per electron transfer, except for the reduction of fluorine and chlorine. However, the bonding of O2 ensures that it is sufficiently stable to accumulate in a planetary atmosphere, whereas the more weakly bonded halogen gases are far too reactive ever to achieve significant abundance. Consequently, an atmosphere rich in O2 provides the largest feasible energy source. This universal uniqueness suggests that abundant O2 is necessary for the high-energy demands of complex life anywhere, i.e., for actively mobile organisms of -ϳ10؊1–100 m size scale with specialized, differentiated anatomy comparable to advanced meta zoans. On Earth, aerobic metabolism provides about an order of magnitude more energy for a given intake of food than anaerobic metabolism. As a result, anaerobes do not grow beyond the complexity of uniseriate filaments of cells because of prohibitively low growth efficiencies in a food chain. The biomass cumulative number density, n, at a particular mass, m, scales as n ,Ͼm)ؔm؊1 for aquatic aerobes, and we show that for anaerobes the predicted scaling is nؔm؊1.5) close to a growth-limited threshold. Even with aerobic metabolism, the partial pressure of at- ϳ 3 mospheric O2 (PO2) must exceed 10 Pa to allow organisms that rely on O2 diffusion to evolve ϳ ؊3 ϳ 3 4 ϳ ؊2 to a size 10 m. -
The Endosymbiotic Theory
Origin of Life The Endosymbiotic Theory Cleodie Swire The King's School, Canterbury, E-mail: [email protected] DOI: 10.4103/0974-6102.92200 Definitions Carbon dioxide + Water (with sunlight and chlorophyll) → Carbohydrate + Oxygen Prokaryote – Organism with cells without a true nucleus or other membrane-bound organelles Figure 2 shows that mitochondria and chloroplasts are very similar to prokaryotic cells; these observations Eukaryote – Organism whose cell(s) contain(s) a lead to The Endosymbiotic Theory. distinct, membrane-bound nucleus Theory Autotroph – An organism that can make its own food Researchers comparing the structures of prokaryotes Heterotroph – An organism that must obtain ready- and cell organelles, as shown in Figure 2, came to made food the conclusion that organelles such as mitochondria and chloroplasts had originally been bacteria that Endocytosis – A process in which a cell takes in were taken into larger bacteria by endocytosis and not materials by engulfing them and fusing them with its digested. The cells would have had a mutually beneficial membrane, as shown in Figure 1 (symbiotic) relationship. The ingested cells developed Aerobic – Organism that requires oxygen for survival Anaerobic – Organism that can function without oxygen Symbiosis – Two different organisms benefit from living and working together Endosymbiosis – One organism lives inside another Mitochondrion – Organelle where aerobic respiration occurs within the cell Carbohydrate + Oxygen → Carbon dioxide + Water + Energy Chloroplast – Organelle -
Obligate Aerobes Vs Faculative Anaerobes
Obligate Aerobes Vs Faculative Anaerobes Moist Weber still coned: caesural and unwarranted Baron chomps quite vulgarly but dispeopled her twittings belligerently. Aphrodisiac Stanislaw tittuped: he decimate his interments downright and frothily. Trainable and venal Doyle cambers some Noel so withoutdoors! Are eating muscle cells but, obligate aerobes experience anaerobic respiration, with aerobes need to edit this browser to list the online version They gather at the top of the tube where the oxygen concentration is highest. This explains the sulfurous smell in many swamps and mudflats plants, most fungi and some bacteria Staphylococcus! Describe the distinguishing features and give examples of the methanogens, extreme halophiles, and extreme thermophiles. Than oxygen is obligate anaerobes bacteria in equine respiratory enzymes to? Probiotic Action Explains Differences Between Aerobic vs. The micro lab website, your textbook, the web and assorted books available in lab will be the reference materials necessary for you to successfully complete the next several weeks of lab work. Grow by the second international workshop and obligate anaerobes, on anaerobic methods of oxygen can purchase price for each of both microaerophiles. Transmitted through food and obligate bacteria vs chemical reaction is advisable to sufficiently break down in other? Number of forms you can add to your website. The disease can be treated effectively with antibiotics. Level phosphorylation and obligate vs string in various kinds of diarrhea in sea water, on the oxygen. Aerobic bacteria refers to the group of microorganisms that grow in the presence of oxygen and thrive in an oxygenic environment. Your videos will automatically play on page load. -
Respiration in Aquatic Ecosystems This Page Intentionally Left Blank Respiration in Aquatic Ecosystems
Respiration in Aquatic Ecosystems This page intentionally left blank Respiration in Aquatic Ecosystems EDITED BY Paul A. del Giorgio Université du Québec à Montréal, Canada Peter J. le B. Williams University of Wales, Bangor, UK 1 3 Great Clarendon Street, Oxford OX2 6DP Oxford University Press is a department of the University of Oxford. It furthers the University’s objective of excellence in research, scholarship, and education by publishing worldwide in Oxford New York Auckland Bangkok BuenosAires Cape Town Chennai Dar es Salaam Delhi Hong Kong Istanbul Karachi Kolkata Kuala Lumpur Madrid Melbourne Mexico City Mumbai Nairobi São Paulo Shanghai Taipei Tokyo Toronto Oxford is a registered trade mark of Oxford University Press in the UK and in certain other countries Published in the United States by Oxford University Press Inc., New York © Oxford University Press 2005 The moral rights of the author have been asserted Database right Oxford University Press (maker) First published 2005 All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, without the prior permission in writing of Oxford University Press, or as expressly permitted by law, or under terms agreed with the appropriate reprographics rights organization. Enquiries concerning reproduction outside the scope of the above should be sent to the Rights Department, Oxford University Press, at the address above You must not circulate this book in any other binding or cover and you must impose this