Investigating the Role of Salinity in the Thermotolerance of Corals

Dissertation by

Hagen M. Gegner

In Partial Fulfillment of the Requirements

For the Degree of

Doctor of Philosophy

King Abdullah University of Science and Technology, Thuwal,

Kingdom of Saudi Arabia

Hagen M. Gegner

EXAMINATION COMMITTEE PAGE

The dissertation of Hagen M. Gegner is approved by the examination committee.

Committee Chairperson: Prof. Christian R. Voolstra Committee Member: Prof. Manuel Aranda Lastra, Prof. Mark Tester, Prof. Philippe Schmitt-Kopplin 3

ABSTRACT

Investigating the Role of Salinity in the Thermotolerance of Corals

Hagen M. Gegner

Coral reefs are in global decline due to ocean warming and ocean acidification. While these stressors are commonly studied in climate change predictions, salinity, although being an important environmental factor, is not well understood. The response of the coral holobiont (the association of the coral host, its algal endosymbiont and a suit of other microbes) to changes in salinity and the contribution of each holobiont compartment underlying the necessary osmoadaptation remain especially elusive. Interestingly, we find some of the most thermotolerant corals in some of the most saline seas, e.g. the Red Sea and the Persian Arabian Gulf. This observation sparked the hypothesis of a link between osmoadaptation and coral thermotolerance. Here, we set out to elucidate the putative effects of high salinity on conveying thermotolerance and thereby a possible link to bleaching in the context of the coral holobiont. For this, we conducted a series of heat stress experiments at different salinities in the coral model Aiptasia and subsequently validated our findings in corals from the central Red Sea. We confirm a role of osmoadaptation in increased thermotolerance and reduced bleaching in Aiptasia and Red Sea corals. This salinity-conveyed thermotolerance was characterized by a reduction in algal endosymbiont loss, photosystem damage and leakage of damaging reactive oxygen species (ROS) in high salinity. Further analysis of the osmoadaptation response using targeted GC-MS uncovered high levels of the sugar floridoside at high salinity only in holobionts that show the salinity-conveyed thermotolerance. The increase of floridoside, an osmolyte capable of scavenging ROS, and the concurrent reduction of ROS argues for a mechanistic link of increased thermotolerance and reduced bleaching in 4 high salinities. In addition, the restructuring of the microbiome at high salinity that aligned with the difference in thermotolerance in Aiptasia may be indicative of a microbial contribution towards a more beneficial holobiont composition. Hence, emphasizing the potential cumulative contribution of each holobiont compartment during stress-resilience, as well as highlighting the overall role of osmoadaptation in the thermotolerance of corals. 5

ACKNOWLEDMENTS

Science is based on sharing knowledge, methods and ideas, as such; it never relies on a single person. Consequently, the list of people I would need to list will easily fill several pages. I will try to restrict myself.

First of all I would like to thank my advisor, Christian Voolstra, for providing me with mentorship, setting my course and always finding the narrative in things. I did feel welcomed and included in his working group from the beginning. I am grateful for everyone who was/is part of the Reef Genomics Lab and who I had the pleasure to meet over the years. Especially, Maren Ziegler, for her guidance and mentorship in the beginning, Nils Rädecker and Claudia Pogoreutz for their constant support and advice, as well as enduring me even after working hours. Carol Buitrago, Rúben Costa and Fabia Simona for their valued input and companionship in the laboratory and Pu Yin and Yi Zhang for their help with the anemones. At this point I could easily name every single person of our working group, because each of them helped me either professionally or privately during my PhD. Thank you for all of the commitment.

Further, I would like to thank Till Röthig for his help with osmoadaptation related questions and Michael Ochsenkühn for his expertise in metabolomics. I am happy to say that I learned a lot from you. Additionally, I would like to thank all core lab and sea lab facilities for their services, highlighting Luke Esau, Paul Muller and Zenon Batang with their support during my Aiptasia and coral experiments.

In conclusion, this dissertation is more than the sum of three years in Saudi Arabia. It is comprised of all the previous steps I had to take and all the support I received to reach this point. In this vein, I would like to thank my whole family, especially my mother, for her constant support, words of encouragement and an open door when I needed it. This extents to all of my friends, regardless of them being in-kingdom or abroad, for their countless hours of talks, millions of little coffee breaks and all types of adventures. Without all of them I would not be where I am today – Thank you. 6

TABLE OF CONTENT

EXAMINATION COMMITTEE PAGE ...... 2

ABSTRACT ...... 3

ACKNOWLEDMENTS ...... 5

LIST OF FIGURES ...... 11

LIST OF TABLES ...... 14

LIST OF ABBREVIATIONS ...... 15

1. INTRODUCTION ...... 16

1.1. References ...... 19

2. OBJECTIVES ...... 23

CHAPTER I ...... 25

3. High salinity conveys thermotolerance in the coral model Aiptasia ...... 25

3.1. Abstract ...... 26

3.2. Introduction ...... 27

3.3. Materials and Methods ...... 29

3.3.1. Aiptasia rearing, experimental setup, and sample processing ...... 29

3.3.2. Symbiodinium cell counts and normalization ...... 31

3.3.3. Photographic documentation and photosynthetic efficiency ...... 31

3.3.4. Statistical Analysis ...... 32

3.4. Results ...... 33 7

3.4.1. Higher salinities reduce bleaching during heat stress in Aiptasia H2

associated with SSB01 ...... 33

3.4.2. Higher salinities reduce photosynthetic impairment during heat stress in

Aiptasia H2 associated with SSB01 ...... 35

3.5. Discussion ...... 37

3.6. Conclusions ...... 40

3.6.1. Acknowledgements ...... 40

3.6.2. Funding ...... 40

3.7. References ...... 41

3.8. Supplementary Material ...... 48

CHAPTER II ...... 54

4. High levels of the osmolyte floridoside at high salinity link

osmoadaptation with bleaching susceptibility in the coral-algal

endosymbiosis ...... 54

4.1. Abstract ...... 55

4.2. Introduction ...... 56

4.3. Material and Methods ...... 58

4.3.1. Aiptasia experimental procedures ...... 58

4.3.1.1. Anemone rearing, experimental setup, and sample processing ...... 58

4.3.1.2. Photosynthetic efficiency over the course of the heat stress ...... 59

4.3.1.3. Algal endosymbiont counts ...... 59

4.3.1.4. ROS leakage measurement from algal endosymbionts ...... 59 8

4.3.1.5. Analysis and characterization of the carbohydrate and fatty acid fraction

using targeted GC-MS ...... 60

4.3.2. Coral experimental procedures ...... 62

4.3.2.1. Coral rearing, experimental setup, and sample processing ...... 62

4.3.2.2. Algal endosymbiont counts ...... 63

4.3.2.3. Determination of floridoside levels using targeted GC-MS ...... 63

4.3.3. Statistical analyses ...... 65

4.4. Results ...... 66

4.4.1. Decreased bleaching concomitant with reduced ROS levels at high salinities

suggest a role of osmoadaptation in conveyed thermotolerance ...... 66

4.4.2. High levels of the osmolyte floridoside at high salinity concomitant with

salinity-conveyed thermotolerance of the Aiptasia holobiont ...... 69

4.4.3. Red Sea coral screening confirms increased floridoside levels at high

salinity concomitant with increased thermotolerance and reduced bleaching ...... 72

4.5. Discussion ...... 74

4.5.1. The osmolyte floridoside links osmoadaptation with thermotolerance as a

broadly present mechanism ...... 75

4.5.2. A new perspective for corals in extreme environments ...... 77

4.6. Conclusion ...... 78

4.6.1. Acknowledgements ...... 78

4.7. References ...... 79

4.8. Supplementary Material ...... 85

4.8.1. Supplementary Figures ...... 85 9

4.8.2. Supplementary Tables ...... 89

CHAPTER III ...... 100

5. Insights into bacterial community changes following heat and

salinity treatments in Aiptasia ...... 100

5.1. Abstract ...... 101

5.2. Introduction ...... 102

5.3. Materials and Methods ...... 105

5.3.1. Animal rearing, experimental setup, and sample processing ...... 105

5.3.2. DNA Extraction and 16S rRNA Gene Sequencing ...... 106

5.3.3. Data analysis ...... 107

5.4. Results ...... 110

5.4.1. Distinct bacterial community compositions of seawater and Aiptasia

anemones ...... 110

5.4.2. Distinct bacterial community composition of H2-SSB01 and CC7-SSA01

anemones at ambient and heat stress temperatures across different salinities ...... 112

5.4.3. Contribution of bacterial taxa to differences between salinities at ambient and

heat stress temperatures ...... 114

5.4.4. Microbial functional profiles in high salinity change with heat stress in H2-

SSB01 ...... 117

5.5. Discussion ...... 119

5.5.1. Aiptasia bacterial microbiome changes with regard to salinity and

temperature ...... 119

5.5.2. Is salinity-conveyed thermotolerance facilitated by bacteria? ...... 122 10

5.6. References ...... 124

6. SYNTHESIS ...... 132

6.1. References ...... 137

7. APPENDIX ...... 142

LIST OF FIGURES

Figure 1. Similarities of the coral and Aiptasia holobiont. The cnidarian holobiont (Coral and Aiptasia) consists of several compartments: a cnidarian host (light blue), the algal endosymbiont, Symbiodiniacaea (light red), and a suit of other microbes (light green)...... 18

Figure 2 Experimental design and sampling scheme. Overview of the acclimation phase and heat stress treatment of the two host-symbiont combinations at three salinities (36, 39 and 42). Sampling points are indicated with t0 and t1...... 30

Figure 3 Effect of different salinities on heat-induced bleaching in the coral model Aiptasia. (A) Aiptasia H2 associated with Symbiodinium SSB01 showed reduced bleaching at increased salinities under heat stress. This pattern was not apparent in Aiptasia CC7 associated with SSA01. (B) Accompanied by the reduced bleaching at increased salinities, Aiptasia H2-SSB01 retained about three times more endosymbionts at increased salinities under heat stress. By comparison, Aiptasia CC7-SSA01 retained equal proportions of endosymbionts under heat stress ...... 34

Figure 4 Effect of different salinities on photosynthetic efficiency during heat stress in the coral model Aiptasia. Day 0 marks the end of a 10-day acclimation phase at 25 °C, after which the temperature was increased to 34 °C. Color key indicates salinity: blue (36), yellow (39), red (42). Data are shown as mean ± SE. (A) Aiptasia H2 associated with Symbiodinium SSB01 showed significantly reduced impairment of photosynthetic efficiencies at increased salinities under heat stress. The heat stress treatment was concluded on day 8 due to substantial bleaching and the fluorescent signal being too low to be measured by Pulse Amplitude Modulated (PAM) fluorometry at a salinity of 36. (B) Photosynthetic efficiency of Aiptasia CC7 associated with Symbiodinium SSA01 was significantly less impaired at a salinity of 39 in comparison to the salinities of 36 and 42. Heat stress continued until day 14, when the photosynthetic efficiency for one of the measurements dropped below 0.4...... 36

Figure 5. Overview of experimental procedures for anemones and corals. (A) Two Aiptasia host-endosymbiont pairings (H2-SSB01 and CC7-SSA01) in their symbiotic and aposymbiotic states were acclimated for 10 days to low (36), intermediate (39), and high (42) salinities at ambient temperature, before they were subjected to a 6-day long heat stress experiment. A control was kept at ambient temperature throughout the experiment. (B) Six coral species were collected from the central Red Sea, then fragmented and left for healing. Corals were then adjusted to the lowest salinity (36) for 7 days and subsequently acclimated to low (36) and high (42) salinity conditions for 7 days, before they were subjected to an 11-day long heat stress experiment...... 64 12

Figure 6. Effect of different salinities on heat stress-induced bleaching in the coral model Aiptasia. (A, B) Percentage of retained algal endosymbionts for H2-SSB01 and CC7-SSA01 at low (36), intermediate (39) and high (42) salinities after 6 days in relation to control temperatures. Different letters above bars indicate significant differences between groups (all p < 0.05). Number of replicates is indicated inside the bars. (C, D) Relative change of ROS leakage per endosymbiont cell for SSB01 and SSA01 at low (36), intermediate (39) and high (42) salinity after 2 days in relation to control temperatures. Different letters above bars indicate significant differences between groups (p < 0.05). Number of replicates is indicated inside the bars...... 68

Figure 7. Metabolite levels of Aiptasia H2-SSB01 and CC7-SSA01 host- endosymbiont pairings. (A) Heatmaps showing metabolites levels of H2-SSB01 and CC7-SSA01 at ambient (Control) and heat stress (Heat) temperatures at low (36), intermediate (39), and high (42) salinities. Significantly different metabolites are designated in bold (2-Way ANOVA, all p < 0.05), with symbols indicating significant differences between salinities (circle), temperature (square), and salinity x temperature interaction (cross). Number of replicates is indicated above the heatmaps (N). (B, C) Floridoside levels of H2-SSB01 and CC7-SSA01 at ambient (Control) and heat stress (Heat) temperatures at low (36), intermediate (39), and high (42) salinity. Different letters above bars indicate significant differences between groups (Kruskal-Wallis, p < 0.05). Number of replicates is indicated above/within bars. ND = not detected...... 71

Figure 8. Effect of high salinity on heat stress-induced bleaching and floridoside levels in Red Sea corals. (A) Algal endosymbiont cell counts after 11 days of heat stress under normal (36) and high (42) salinities, normalized to host protein. Algal endosymbiont cell counts are significantly higher at high salinity (Kruskal-Wallis, p = 0.02). (B) Floridoside levels, normalized to host protein. Floridoside concentrations are significantly higher at high salinity (Kruskal-Wallis, p = 0.045).73

Figure 9. Taxonomy bar chart of bacterial families (Greengenes database, bootstrap ≥60) of H2-SSB01, CC7-SSA01 and the seawater samples across temperatures and salinities. Each bar denotes the mean percentage of 16S rRNA sequences across replicates for each host and treatment (temperature and salinity). Each color represents one of the twenty most abundant families across samples. The “others” category groups the less abundant families...... 111

Figure 10. Clustering of H2-SSB01 and CC7-SSA01 samples across temperatures and salinities based on Bray-Curtis dissimilarity of microbial community in a principal coordinate analysis (PCoA). Blue = low, orange = intermediate and red = high salinity, open squares = ambient temperature, closed triangles = heat stress. Variation explained by the two coordinates are presented by percentages on the axes...... 113

Figure 11. Heat map displaying differently abundant bacterial taxa based on SIMPER analyses for H2-SSB01 and CC7-SSA01 across temperatures and salinities. Each cell represents the clustered OTU relative abundances averaged per treatment using Pearson correlation coefficient (n = 4-5). The asterisk denotes highly expressed OTUs at the high salinity irrespective of temperature. The Row Z-score bar indicates high abundance (+1 standard deviation above the mean, green) to low abundance of bacterial taxa (-1 standard deviation above the mean, black)...... 116

Figure 12. Taxonomy-based functional profiling of microbial community composition from H2-SSB01 and CC7-SSA01 across temperatures and salinities. Each boxplot displays the putative changes in microbial community function using the percentage of 16S rRNA reads across replicates. Data were analyzed for “metabolism by phenotype” with a Kruskal-Wallis sum test...... 118

Figure 13. Hypothesized illustration of holobiont response to salinity stress. Depicted are the compartments of the cnidarian holobiont (the cnidarian host (grey), its microbiome (brown) and its algal endosymbiont (light red)) during salinity stress. Each compartment provides its own osmoadaptation response, since corals are osmoconformers. This response may influence the collaborative mechanism of the holobiont osmoadaptation. Metabolites produced by one compartment may be catabolized/recycled by another, e.g. DMSP (see text)...... 135

LIST OF TABLES Table 1. Summary statistics of two-way crossed ANOSIM between the two host- endosymbiont pairings and the seawater samples based on Bray-Curtis distances of bacterial abundances……………………………………………….111

Table 2. Summary statistics of two-factorial PERMANOVA based on Bray-Curtis distances for each host-endosymbiont pairing with temperature, salinity and the interaction of the two……………………………………………………………..113 15

LIST OF ABBREVIATIONS

ΔF/Fm’ Effective quantum yield

ANOVA Analysis of variance

DNA Deoxyribonucleic acid

DMS Dimethyl sulfide

DMSO Dimethyl sulfoxide

DMSP Dimethylsulfoniopropionate

DO Dissolved oxygen

Fm’ Maximum light-adapted fluorescence

GLM Generalized linear model

GC-MS Gas chromatography–mass spectrometry

HBA Hydroxy benzylic acid

NIST-MS National Institute of Standards and

Technology Mass Spectral Library

PAG Persian Arabian Gulf

PAM Pulse amplitude modulated (fluorometer/fluorometry)

PBS Phosphate buffered saline

PCoA Principal Coordinate Analysis

PSII Photosystem II

RS Red Sea

ROS Reactive oxygen species

SST Sea surface temperature

SSS Sea Surface Salinity 16

1. INTRODUCTION

Climate change is affecting all marine ecosystems on a global scale, becoming ‘Future Oceans’ with substantial changes in temperature, pH and oxygen levels (Gruber, 2011). As a result, corals are increasingly threatened by elevated sea surface temperature (SST) and ocean acidification, which affect the symbiosis of the coral holobiont, the association of the coral host, its algal endosymbiont and a suit of microbial partners (Albright et al., 2016; Bosch and Miller, 2016; Grasis et al., 2014; Hoegh-Guldberg, 1999; Rohwer et al., 2002). Particularly, elevated SST is a major threat to corals that may ultimately cause the loss of function of the entire reef ecosystem (Baker and Cunning, 2015; Brown, 1997). During the El Niño events in 1982–1983, 1997–1998, and recently in 2014–2017 elevated SST was the driver for a global coral bleaching, the breakdown of the symbiosis that affected vast regions of formerly healthy reefs, as seen in the Great Barrier Reef (Hughes et al., 2017; van Woesik et al., 2016). In addition, higher frequencies of SST anomalies push corals to the limits of their adaptive capabilities and decrease the likelihood of recovery (Azim et al., 2018).

Bleaching - the loss of the algal endosymbionts, Symbiodiniaceae - and the consequential whitening of the coral holobiont (Weis, 2008) is a general stress response caused by a variety of stressors, i.e. high temperatures, but also other environmental stressors such as light, nutrients or low salinity (Hoegh-Guldberg and Smith, 1989; Kerswell and Jones, 2003; Vega Thurber et al., 2014). Although several bleaching triggers have been identified, the molecular underpinnings of the bleaching process remain elusive. Thus, corals that thrive in regions of extreme environmental conditions, e.g. in the Red Sea or the Persian Arabian Gulf, are of scientific interest and may be considered benchmarks of ‘Future Oceans’ to better understand coral bleaching and thermotolerance. However, unlike other coral-harboring water bodies, these regions are not only characterized by extreme temperatures but also display extremely high salinities (>42 Salinity) (Ngugi et al., 2012). Emerging from this observation is the intriguing hypothesis that high salinity conditions may play a role in the thermotolerance of corals. The majority of salinity studies have focused on the consequences of hypo-saline rather than hyper-saline stress, due to its strong effect on coastal coral reef distribution and bleaching during heavy 17 rainfalls (Kerswell and Jones, 2003; Seveso et al., 2013). As such, in-depth knowledge on the effects of salinity on the holobiont, along with the contribution of each holobiont compartment to the osmoadaptation are unclear. Corals, like most marine invertebrates and algae, are considered osmoconformer that depend on the production and degradation of osmolytes to adjust to their environment (Röthig et al., 2016; Yancey et al., 2010). This process will be referred to osmoadaptation (Reed, 1984) from here. Recently, studies started to characterize the key components of coral and symbiont osmoadaptation to high salinity (Ochsenkühn et al., 2017), but the response in combination with elevated temperatures and the disentanglement of the contributions of each holobiont compartment remains speculative. To better understand the osmoadaptation and stress-resilience capabilities in the context of a coral holobiont we have to turn to more tractable study subjects that allow the systematic investigation of each compartment.

Investigating the underlying mechanisms of the coral symbiosis and accounting for the contribution of all holobiont compartments is challenging, as well as time and resource intensive due to the amount of effort to facilitate aquaria and cater to the needs of corals. Hence, it is essential to use a simpler model organism that holds similar characteristics as corals. Model organisms are widely used to study similar or conserved pathways, to increase the basic understanding of cellular processes (genome basics, transcription, translation, metabolomics), organismal functions (cell – cell communications) and environmental interactions (stress responses) (Gasch et al., 2016). A variety of models are used across the fields of biology, including bacteria, fungi, insects and mammals (Gasch et al., 2016; Hasegawa et al., 2000; Hoang et al., 1996). In coral science, Aiptasia (sensu Exaiptasia pallida) is emerging as such a model organism. Aiptasia is a small anemone that harbors algal endosymbionts and a suite of other microbes (Bacteria, Archaea and Viruses), similar to corals, but with the benefits of being: easily to maintain, more accessible to researches around the world, faster growing and easier to reproduce than corals (Baumgarten et al., 2015; Weis et al., 2008) (Fig. 1.). This coral model can be used to tackle physiological questions, in combination with other –omic approaches (genomics, transcriptomics, proteomics and metabolomics) (Baumgarten et al., 2015; Hillyer et al., 2016; Oakley et al., 2016; Sunagawa et al., 2009) and address the overarching problem of a holobiont with its interacting compartments. Aiptasia, unlike 18 their coral counterpart, can be kept in an aposymbiotic state (without their algal endosymbiont), which allows the removal and reinfection of different endosymbiont types to analyze the influence of its identity on the holobiont methodically. Additionally, current efforts aim to establish protocols allowing the removal of the Aiptasia microbiome to functionally test for a bacterial contribution (Costa et al., 2017). This sets the basis for a tractable model organism to disentangle the contributions of each holobiont compartment during stress-resilience that can then be translated to corals. Thus, Aiptasia is a valuable tool to study coral symbiosis and the underlying mechanism of bleaching resistance. Consequently, while elucidating the role of salinity in the thermotolerance of corals, we have to acknowledge the putative cumulative capabilities of all holobiont compartments and utilize Aiptasia as a coral model in all subsequent experiments. We will concurrently use corals from the Red Sea to validate our findings in Aiptasia and evaluate the explanatory power of this model organism.

1.1. References Albright, R., Caldeira, L., Hosfelt, J., Kwiatkowski, L., Maclaren, J. K., Mason, B. M., Nebuchina, Y., Ninokawa, A., Pongratz, J., Ricke, K. L., et al. (2016). Reversal of ocean acidification enhances net coral reef calcification. Nature 531, 362–365.

Azim, N. H., Subki, A. and Yusof, Z. N. B. (2018). Abiotic stresses induce total phenolic, total flavonoid and antioxidant properties in Malaysian indigenous microalgae and cyanobacterium. Malays. J. Microbiol. 14, 25–33.

Baker, A. C. and Cunning, R. (2015). Coral “Bleaching” as a Generalized Stress Response to Environmental Disturbance. Dis. Coral 396–409.

Baumgarten, S., Simakov, O., Esherick, L. Y., Liew, Y. J., Lehnert, E. M., Michell, C. T., Li, Y., Hambleton, E. A., Guse, A., Oates, M. E., et al. (2015). The genome of Aiptasia , a sea anemone model for coral symbiosis. Proc. Natl. Acad. Sci. 112, 11893–11898.

Bosch, T. C. G. and Miller, D. J. (2016). The holobiont imperative: Perspectives from early emerging animals. Holobiont Imp. Perspect. From Early Emerg. Anim. 1–155.

Brown, B. E. (1997). Coral bleaching: causes and consequences. Coral Reefs 16, S129– S138.

Costa, R. M., Cardenás, A., Simona, F., Vidal A. F., Voolstra C. R. (December 2017). Disassembling a metaorganism: Expanding the coral model Aiptasia for functional microbiome studies. Presentation at the European Coral Reef Symposium (ECRS), Oxford, UK, 13th to Friday 15th December, 2017.

Gasch, A. P., Payseur, B. A. and Pool, J. E. (2016). The Power of Natural Variation for Model Organism Biology. Trends Genet. 32, 147–154.

Grasis, J. A., Lachnit, T., Anton-Erxleben, F., Lim, Y. W., Schmieder, R., Fraune, S., Franzenburg, S., Insua, S., Machado, G. M., Haynes, M., et al. (2014). 20

Species-specific viromes in the ancestral holobiont hydra. PloS One 9,.

Gruber, N. (2011). Warming up, turning sour, losing breath: Ocean biogeochemistry under global change. Philos. Trans. R. Soc. A Math. Phys. Eng. Sci. 369, 1980– 1996.

Hasegawa, P. M., Bressan, R. A., Zhu, J.-K. and Bohnert, H. J. (2000). Plant cellular and molecular responses to high salinityAnnu. Rev. Plant Physiol. Plant Mol. Biol. 51, 463–499.

Hillyer, K. E., Tumanov, S., Villas-Boas, S. and Davy, S. K. (2016). Metabolite profiling of symbiont and host during thermal stress and bleaching in a model cnidarian-dinoflagellate symbiosis. J. Exp. Biol. 219, 516–527.

Hoang, B., Moos, M., Vukicevic, S. and Luyten, F. P. (1996). Primary structure and tissue distribution of FRZB, a novel protein related to Drosophila frizzled, suggest a role in skeletal morphogenesis. J. Biol. Chem. 271, 26131–26137.

Hoegh-Guldberg, O. (1999). Climate change, coral bleaching and the future of the world’s coral reefs. Mar. Freshw. Res. 50, 839–866.

Hoegh-Guldberg, O. and Smith, G. J. (1989). The effect of sudden changes in temperature, light and salinity on the population density and export of zooxanthellae from the reef corals Stylophora pistillata Esper and Seriatopora hystrix Dana. J. Exp. Mar. Bio. Ecol. 129, 279–303.

Hughes, T. P., Barnes, M. L., Bellwood, D. R., Cinner, J. E., Cumming, G. S., Jackson, J. B. C., Kleypas, J., Van De Leemput, I. A., Lough, J. M., Morrison, T. H., et al. (2017). Coral reefs in the Anthropocene. Nature 546, 82–90.

Kerswell, A. P. and Jones, R. J. (2003). Effects of hypo-osmosis on the coral Stylophora pistillata: Nature and cause of “low-salinity bleaching.” Mar. Ecol. Prog. Ser. 253, 145–154.

Ngugi, D. K., Antunes, A., Brune, A. and Stingl, U. (2012). Biogeography of pelagic 21

bacterioplankton across an antagonistic temperature-salinity gradient in the Red Sea. Mol. Ecol. 21, 388–405.

Oakley, C. A., Ameismeier, M. F., Peng, L., Weis, V. M., Grossman, A. R. and Davy, S. K. (2016). Symbiosis induces widespread changes in the proteome of the model cnidarian Aiptasia. Cell. Microbiol. 18, 1009–1023.

Ochsenkühn, M. A., Röthig, T., D’Angelo, C., Wiedenmann, J. and Voolstra, C. R. (2017). The role of floridoside in osmoadaptation of coral-associated algal endosymbionts to high-salinity conditions. Sci. Adv. 3, e1602047.

REED, R. H. (1984). Use and abuse of osmo‐terminology. Plant. Cell Environ. 7, 165– 170.

Rohwer, F., Seguritan, V., Azam, F. and Knowlton, N. (2002). Diversity and distribution of coral-associated bacteria. Mar. Ecol. Prog. Ser. 243, 1–10.

Röthig, T., Ochsenkühn, M. A., Roik, A., Van Der Merwe, R. and Voolstra, C. R. (2016). Long-term salinity tolerance is accompanied by major restructuring of the coral bacterial microbiome. Mol. Ecol. 25, 1308–1323.

Seveso, D., Montano, S., Strona, G., Orlandi, I., Galli, P. and Vai, M. (2013). Exploring the effect of salinity changes on the levels of Hsp60 in the tropical coral seriatopora caliendrum. Mar. Environ. Res. 90, 96–103.

Sunagawa, S., Wilson, E. C., Thaler, M., Smith, M. L., Caruso, C., Pringle, J. R., Weis, V. M., Medina, M. and Schwarz, J. A. (2009). Generation and analysis of transcriptomic resources for a model system on the rise: The sea anemone Aiptasia pallida and its dinoflagellate endosymbiont. BMC Genomics 10, 258.

Van Woesik, R., Cacciapaglia, C. and Randall, C. J. (2016). Thermal-Stress Response of Coral Communities to Climate Change. In The Cnidaria, Past, Present and Future (ed. Goffredo, S.) and Dubinsky, Z.), pp. 545–552. Cham: Springer International Publishing. 22

Vega Thurber, R. L., Burkepile, D. E., Fuchs, C., Shantz, A. A., Mcminds, R. and Zaneveld, J. R. (2014). Chronic nutrient enrichment increases prevalence and severity of coral disease and bleaching. Glob. Chang. Biol. 20, 544–554.

Weis, V. M. (2008). Cellular mechanisms of Cnidarian bleaching: stress causes the collapse of symbiosis. J. Exp. Biol. 211, 3059–3066.

Weis, V. M., Davy, S. K., Hoegh-Guldberg, O., Rodriguez-Lanetty, M. and Pringle, J. R. (2008). Cell biology in model systems as the key to understanding corals. Trends Ecol. Evol. 23, 369–376.

Yancey, P. H., Heppenstall, M., Ly, S., Andrell, R. M., Gates, R. D., Carter, V. L. and Hagedorn, M. (2010). Betaines and Dimethylsulfoniopropionate as Major Osmolytes in Cnidaria with Endosymbiotic Dinoflagellates. Physiol. Biochem. Zool. 83, 167–173.

2. OBJECTIVES

My PhD dissertation aims to assess the hypothetical link of osmoadaptation and thermotolerance in corals. This hypothesis emerges from observations in the Red Sea and the Persian Arabian Gulf, both extremely saline environments that harbor thermotolerant corals. To systematically test for an effect of salinity on thermotolerance and bleaching susceptibility a majority of the experiments presented here are conducted using the coral model Aiptasia. Aiptasia was used in all three chapters of the dissertation to disentangle the putative cumulative contributions of each compartment of the holobiont (cnidarian host, algal endosymbionts and bacterial community) to osmoadaptation and stress- resilience.

Chapter I.: The first chapter serves as a baseline for all subsequent experiments and investigates the effect of salinity on the Aiptasia holobiont during heat stress. Here, Aiptasia was subjected to three levels of salinity (36 low, 39 intermediate and 42 high salinity) at temperature conditions that induce bleaching. Endosymbiont density, photosynthetic efficiency and pictures were used to assess the extent of bleaching and overall holobiont health. After the characterization of the influence of salinity, follow-up experiments were conducted to study the metabolic responses of symbiotic and aposymbiotic holobionts (Chapter II), as well as changes in the Aiptasia-associated microbiome (Chapter III).

Chapter II.: The second chapter aims to analyze the underlying mechanisms salinity- conveyed thermotolerance of symbiotic and aposymbiotic anemones using targeted GC- MS and physiological measurements. It combines the quantification of known osmolytes in coral holobionts and the assessment of important bleaching hallmarks, e.g. ROS. The work addresses the applicability of findings from Aiptasia by assessing the responses of corals from the central Red Sea. Finally, the work discusses the findings from Aiptasia and corals in the light of high salinity regions such as the Red Sea and the Persian Arabian Gulf.

Chapter III.: The third chapter focuses on the bacterial community as a putative contributor to salinity-conveyed thermotolerance of the Aiptasia holobiont. The work characterizes changes in diversity and distribution of the microbiome of symbiotic anemones at different salinities under heat stress and uses samples from Chapter II. Based on the results, evidence is provided for a putative contribution of bacteria taxa to stress- resilience of the Aiptasia holobiont.

CHAPTER I

3. High salinity conveys Thermotolerance in the Coral Model Aiptasia

Hagen M. Gegner, Maren Ziegler, Nils Rädecker, Carol Buitrago-López, Manuel Aranda, Christian R. Voolstra *

Red Sea Research Center, Division of Biological and Environmental Science and Engineering (BESE), King Abdullah University of Science and Technology (KAUST), Thuwal 23955-6900, Saudi Arabia

This manuscript was published in Biology Open (BiO). It was also featured as the journal cover and by a first-author interview of BiO, a PDF version can be found in the Supplementary files (see Supplementary File S6, in 7. APPENDIX): Gegner, H. M., Ziegler, M., Rädecker, N., Buitrago-López, C., Aranda, M. and Voolstra, C. R. (2017). High salinity conveys thermotolerance in the coral model Aiptasia. Biol. Open 6, 1943– 1948. DOI: 10.1242/bio.028878.

Author contribution: HMG, MZ, CRV conceived the study and designed the experiment; HMG, CB performed experiments; HMG, MZ, NR, CRV analyzed the data; HMG, CRV wrote the manuscript with contributions from NR, MZ. MA contributed material/reagents/tools. All authors read and approved the manuscript.

3.1. Abstract The endosymbiosis between dinoflagellate algae of the genus Symbiodinium and stony corals provides the foundation of coral reef ecosystems. Coral bleaching, the expulsion of endosymbionts from the coral host tissue as a consequence of heat or light stress, poses a threat to reef ecosystem functioning on a global scale. Hence, a better understanding of the factors contributing to heat stress susceptibility and tolerance is needed. In this regard, some of the most thermotolerant corals also live in particularly saline habitats, but possible effects of high salinity on thermotolerance in corals are anecdotal. Here we test the hypothesis that high salinity may lead to increased thermotolerance. We conducted a heat stress experiment at low, intermediate, and high salinities using a set of host- endosymbiont combinations of the coral model Aiptasia. As expected, all host- endosymbiont combinations showed reduced photosynthetic efficiency and endosymbiont loss during heat stress, but the severity of bleaching was significantly reduced with increasing salinities for one of the host-endosymbiont combinations. Our results show that higher salinities can convey increased thermotolerance in Aiptasia, although this effect seems to be dependent on the particular host strain and/or associated symbiont type. This finding may help explain the extraordinarily high thermotolerance of corals in high salinity environments such as the Red Sea and the Persian/Arabian Gulf and provides novel insight regarding factors that contribute to thermotolerance. Since our results are based on a salinity effect in symbiotic sea anemones, it remains to be determined whether this salinity effect can also be observed in stony corals.

3.2. Introduction Coral reefs are declining globally due to the direct and indirect effects of climate change (Albright et al., 2016; Anthony et al., 2008; Hoegh-Guldberg, 1999; Hughes et al., 2017a). In particular, ocean warming has eroded the functional basis of these ecosystems, by disrupting the endosymbiosis between corals and photosynthetic algae of the genus Symbiodinum (Wild et al., 2011). Elevated sea surface temperatures (SSTs) have caused and continue to cause coral bleaching, the loss of Symbiodinium as evidenced by the visible whitening of the coral host, on global scales, resulting in the loss of coral cover and destruction of reef ecosystem (Hoegh-Guldberg, 1999; Hoegh-Guldberg and Smith, 1989b; Hughes et al., 2017b). While the mechanisms of coral bleaching are still not completely understood(Baird et al., 2009; Pogoreutz et al., 2017; Weis, 2008), the production and accumulation of reactive oxygen species (ROS) and associated oxidative stress is likely playing a major role in heat-induced coral bleaching (Dubinsky and Stambler, 2011; Lesser, 1997). In comparison to the well-documented detrimental effects of elevated SSTs, much less is known about other environmental drivers and their effect on coral and reef ecosystem functioning. In this context, salinity is commonly regarded as a structuring factor of marine ecosystems, influencing the distribution of plankton, mollusks, fish, and corals (Barletta, 2004; Hoegh-Guldberg, 1999; Rosenberg et al., 1992). Further, salinity is predicted to change as a result of an intensification of the global water cycle driven by climate change (Durack et al., 2012). For corals, the majority of studies report detrimental effects of hyposaline and hypersaline stress as shown by decreased photosynthetic performance, bleaching, and increase of coral mortality (Ferrier-Pagès et al., 1999; Gardner et al., 2016; Kerswell and Jones, 2003; Porter et al., 1999). However, corals thrive in naturally highly saline environments such as the Red Sea or the Persian/Arabian Gulf (Glynn and Wellington, 1983; Riegl et al., 2012). In addition, these environments are characterized by periodically high SSTs highlighting a remarkably high thermal tolerance of corals under these conditions (Coles and Jokiel, 1978; D’Angelo et al., 2015; Howells et al., 2016). Previous studies attributed this temperature tolerance to associations with specialized algal partners (Howells et al., 2016; Hume et al., 2016) or adaptation to extreme 28 temperature and saline environments (D’Angelo et al., 2015), but a direct influence of increased salinity to thermotolerance was not considered. Here we tested the compelling hypothesis that high salinities increase thermotolerance in the coral model Aiptasia (sensu Exaiptasia pallida (Baumgarten et al., 2015; Grajales et al., 2016; Weis et al., 2008). To do this, we investigated the effect of three different salinities on two Aiptasia strains (H2 and CC7) associated with their native endosymbionts (Symbiodinium type B1, strain SSB01, and Symbiodinium type A4, strain SSA01, respectively) during a heat stress experiment.

3.3. Materials and Methods

3.3.1. Aiptasia rearing, experimental setup, and sample processing

Anemones of the clonal Aiptasia strains H2 (Xiang et al., 2013) and CC7 (Sunagawa et al., 2009) were kept at a 12 h:12 h light/dark cycle at 30-40 µmol m-2 s-1 at 25 °C in small tanks (225 ml) in an incubator (I-36LLVL, Percival Scientific Inc., US) and fed twice weekly with freshly hatched Artemia (brine shrimp larvae). Water was exchanged 24 hs after each feeding. We used two strains (representing two genotypes) of two putative genetically distinct Aiptasia lineages (Thornhill et al., 2013). These two lineages associate with different dominant Symbiodinium types and differ in their degree of symbiont diversity and specificity (Thornhill et al., 2013). H2 anemones associated with their native endosymbionts Symbiodinium type B1 (strain SSB01, species Symbiodinium minutum (Baumgarten et al., 2015; Xiang et al., 2013)), henceforth referred to as H2- SSB01, and CC7 anemones associated with their native endosymbionts Symbiodinium type A4 (strain SSA01, species S. linucheae (Bieri et al., 2016)), henceforth referred to as CC7-SSA01. Animals of both host-endosymbiont combinations were acclimated for 10 days at 25˚C to the 3 experimental salinities (36 – low salinity, 39 – intermediate salinity, and 42 – high salinity) (Fig. 1). For this, 60 animals (30 per host-endosymbiont combination) were distributed over 12 tanks of 225 ml volume (2 tanks per salinity) and feeding was ceased (n = 5 animals per tank x 2 tanks x 3 salinities x 2 host-symbiont combinations = 60 anemones). Different salinities were achieved by diluting autoclaved seawater (obtained from the Red Sea) with ddH20 to a salinity of 36 and subsequent adjustment to experimental salinities with NaCl. After the acclimation phase, 5 anemones were randomly selected from each salinity treatment for each host-endosymbiont combination

(n = 30 anemones) and each transferred into a single cryotube (time point t0). Anemones in cryotubes were immediately shock frozen in liquid nitrogen and stored at -80 °C until further processing. The remaining 5 anemones of each host-endosymbiont combination at each of the three salinities (n = 30) were subjected to a heat stress experiment. Temperature was ramped from 25 °C to 34 °C over the course of 10 hs (1 °C/h increment) and remained at this level during the course of the heat stress experiment (for 30

CC7-SSA01, 1 anemone at salinity 42 was lost during water exchange). The experiment was terminated for each host-endosymbiont combination, when at least one of the following conditions was met: (1) Aiptasia anemones appeared completely bleached visually, i.e. translucent, or (2) the photosynthetic efficiency dropped below 0.4 (see below). Following these criteria, the long-term heat stress experiment for H2-SSB01 was terminated after 8 days and for CC7-SSA01 after 14 days, respectively (Fig. 2). Replicate anemones were each transferred into single cryotubes and immediately shock frozen in liquid nitrogen and stored at -80 °C until further processing (time point t1). During the course of both experiments, salinity levels were monitored twice a day with a refractometer (Aqua Medic GmbH, Germany). Tanks were cleaned every three days and water was exchanged. Further, to rule out a direct effect of salinity on symbiont density in Aiptasia, we conducted a control experiment in the absence of a heat stress treatment (12 animals per strain and salinity) over the length of 16 days. For Symbiodinium counts, samples were processed as described above.

3.3.2. Symbiodinium cell counts and normalization

Frozen anemones (see above) were thawed on ice and homogenized for 9 s in 400 µl of sterile saline water (salinity of 36) using a MicroDisTec homogenizer 125 (Fisher Scientific) following the protocol by (Krediet et al., 2015). Symbiodinium cell counts (three technical replicates per sample) were obtained via flow cytometry (Guava EasyCyte HT, Millipore, USA) using 25 µl of homogenate diluted in 225 µl of 0.1 % SDS on 96-well round-bottom plates (Corning Life Sciences, NY, USA) with automatic mixing of each well for 7 s at high speed before quantification. InCyte v2.2 software (Millipore, USA) was used for discrimination of Symbiodinium cells from anemone host cells and debris using a combination of side scatter and chlorophyll fluorescence (Krediet et al., 2015). For the control experiment, Symbiodinium cell counts were processed in the same way, but measured by flow cytometry using the BD LSRFortess cell analyser (BD Biosciences). For all measurements, technical error rates were < 1 % as determined by internal standards. Symbiodinium cell counts were normalized to total protein content (heat stress experiment) or total host protein (control experiment) of the corresponding anemone homogenates (see above) using the Pierce BCA assay (Fisher Scientific) according to manufacturer’s instructions. Retained Symbiodinium cells (t1) were calculated in relation to Symbiodinium cell counts before the start of the experiment (t0) for each respective salinity.

3.3.3. Photographic documentation and photosynthetic efficiency

Differences in tissue coloration of symbiotic anemones indicating endosymbiont loss were recorded at the beginning and end of the heat stress experiment for H2-SSB01 and CC7-SSA01 using a Nikon Coolpix AW 130. Light-adapted photosynthetic efficiencies (ΔF/Fm’) of photosystem II (PSII) for each anemone were measured daily for the duration of the long-term heat stress experiment using a diving Pulse Amplitude Modulated (PAM) fluorometer (Walz, Germany).

3.3.4. Statistical Analysis

All statistical analyses were conducted in R v3.3.1 (R Core Team, 2016). For the heat stress experiment, the effects of salinity (36, 39, 42) and time (t0 and t1) on symbiont density and photosynthetic efficiency were tested using generalized linear models (GLMs) for H2-SSB01 and CC7-SSA01, respectively. Models were fitted to the data using gamma distribution and the best fitting link function. All models started as two- factorial models accounting for interactive as well as additive effects of salinity and time. This was followed by a step-wise deletion of insignificant response parameters based on the Akaike information criterion (AIC). This resulted in 2-factorial interactive models of salinity and time with an ‘identity’ link function in the case of symbiont density and 2- factorial non-interactive models of salinity and time with an ‘identity’ link function for photosynthetic efficiency data for H2-SSB01 and CC7-SSA01, respectively. Following model optimization, comparisons between individual salinities and time points were conducted using the Tukey post-hoc test, as implemented in the ‘multcomp’ package (Hothorn et al., 2008). For the control experiment, a non-parametric Kruskal-Wallis test was used to test whether salinity had an effect on Symbiodinium cell densities of the two host combinations (H2-SSB01 and CC7-SSA01) in the absence of heat stress.

3.4. Results

3.4.1. Higher salinities reduce bleaching during heat stress in Aiptasia H2 associated with SSB01

To test a possible effect of salinity on thermotolerance and bleaching in the sea anemone Aiptasia, we conducted a long-term heat stress experiment using Aiptasia of the host- symbiont combinations H2-SSB01 and CC7-SSA01 (Fig. 2, Fig. 3, see Supplementary Materials). We measured Symbiodinium counts at low (36), intermediate (39), and high

(42) salinities at the beginning of the experiment (t0) and after anemones were either visually bleached or the photosynthetic apparatus was impaired (t1) (see Methods). At the end of the heat stress experiment, differential effects of salinity on thermotolerance of different host-endosymbiont combinations were evident visually: H2-SSB01 anemones were clearly bleached (translucent) at a low salinity, while clearly pigmented at intermediate and high salinities (Fig. 3). In contrast, CC7-SSA01 displayed a consistently higher pigmentation (as apparent by a uniform brown coloration), regardless of salinity (Fig. 3). Notably, long-term rearing (16 days) of Aiptasia H2-SSB01 and CC7-SSA01 under different salinities at ambient temperature (25 °C) did not affect symbiont densities 2 2 (H2-SSB01 X (15, 2) = 1.46, P > 0.1; CC7-SSA01 X (12, 2) = 2.9231, P > 0.1) (see Supplementary Material). Visual differences were corroborated by changes in endosymbiont densities during the experiment. Both host-endosymbiont combinations exhibited significant loss of Symbiodinium during the heat stress experiment at all salinity levels (Fig. 3 and see Supplementary Material). However, the severity of bleaching (i.e., loss of Symbiodinium) of H2-SSB01 showed a highly significant interaction effect with salinity over time over the course of the heat stress experiment: at intermediate (39) and high (42) salinities significantly more Symbiodinium were retained (30.5% and 37.2%, respectively) in 2 comparison to at low (36) salinity (13.6% retention) (X (30, 2) = 15.88 , P < 0.001). Conversely, we did not find a significant interaction of salinity over time for CC7- SSA01, since Symbiodinium counts did not significantly differ between salinities during 2 heat stress (X (29, 2) = 0.20, P = 0.90323). Rather, CC7-SSA01 retained a similar number 34 of Symbiodinium cells, irrespective of salinity: 37.4%, 39.7%, and 39.9% of Symbiodinium cells were retained at salinities of 36, 39, and 42, respectively (Fig. 3). Further, we found no significant differences in Symbiodinium density for H2-SSB01 between any salinity for t0, but significant differences for intermediate and high salinities in comparison to low salinities for t1 (see Supplementary Material). Also, endosymbiont densities were highly significantly different between t0 and t1 (see Supplementary Material). For CC7-SSA01, no significant differences in symbiont densities across salinities for either time point were found. However, densities between t0 and t1 were significantly different, denoting the overall loss of Symbiodinium (i.e., bleaching) as a result of heat stress.

A B

Salinity A 36 B 39 B 42 H2-SSB01

H2-SSB01

0 0

A A

S S

S A

7 C

C A

C C

36 39 42 10 20 30 40 50 % Salinity % of Symbiodinium retained

3.4.2. Higher salinities reduce photosynthetic impairment during heat stress in Aiptasia H2 associated with SSB01

We assessed photosynthetic efficiency of H2-SSB01 and CC7-SSA01 at the different salinities during the heat stress experiment (Figure 4 and see Supplementary Material). Before the start of the heat stress, all host-symbiont combinations displayed common photosynthetic efficiencies (ΔF/Fm’) of around 0.52-0.61 at ambient temperature (25°C), regardless of salinity. As expected and in line with an impairment of photosynthesis under heat stress (Lesser, 1996; Warner et al., 1999), we found declining photosynthetic efficiencies for H2-SSB01 and CC7-SSA01 over time at all salinities. Accordingly, we found highly significant 2 differences over time for both host-symbiont combinations (H2-SSB01 X (30, 2) = 40.93, P 2 < 0.001; CC7-SSA01 X (29, 2) = 105.68, P < 0.001), but also between salinities (H2- 2 2 SSB01 X (30, 2) = 51.796, P < 0.001; CC7-SSA01 X (29, 2) = 20.11, P < 0.001). In addition to an overall decrease of photosynthetic efficiencies over time, this suggests that different salinities exert differential effects on photosynthetic efficiency under heat. In particular, H2-SSB01 was significantly more impaired at low salinity (36) than at intermediate (39) and high (42) salinities (Fig. 4). This was further corroborated by significant differences in photosynthetic efficiencies between the low salinity in comparison to intermediate and high salinities, but not between the latter two (see Supplementary Material). On day 8 of the long-term heat stress experiment, H2-SSB01 at a salinity of 36 was substantially bleached and the fluorescent signal was too low to be measured by PAM (see Methods, Figure 4). For CC7-SSA01, by contrast, at both low and high salinities, photosynthetic efficiency was significantly more impaired than at the intermediate salinity (Fig. 4, Supplementary Material), arguing that the highest photosynthetic efficiency was retained at the intermediate salinity. In comparison to H2-SSB01, heat stress for CC7-SSA01 continued until day 14, when the photosynthetic efficiency for one of the measurements dropped below 0.4 (see Methods, Fig. 4).

3.5. Discussion Coral reefs worldwide are threatened by the effects of climate change, in particular ocean warming, as reflected by the most recent mass bleaching of corals (Hughes et al., 2017b). Despite the projected increase and severity of recurrent mass bleaching events, we have a comparatively limited understanding as to the detailed underlying mechanisms and environmental influences that cause bleaching or how bleaching might be mitigated (e.g., (Pogoreutz et al., 2017; Ziegler et al., 2017)). Prompted by the notion that the world’s most thermotolerant corals also live in the most saline water bodies of the world and individual studies reporting on high tolerance of corals under high salinity (Coles and Jokiel, 1978; D’Angelo et al., 2015; Howells et al., 2016; Hume et al., 2015), we tested whether increased/high salinity affects thermotolerance using the Aiptasia model system.

Our results show that conditions of high salinity can reduce the severity of bleaching in Aiptasia, as reflected in higher symbiont densities and higher photosynthetic efficiency during heat stress under high salinity conditions. Importantly, this effect was only evident in Aiptasia H2-SSB01, but not in CC7-SSA01. Of note, the host-symbiont combination CC7-SSA01 seemed overall more thermotolerant as indicated by retaining a similar percentage of symbionts and slower impairment of PSII across salinities. This does not necessarily imply that salinity does not affect thermotolerance in CC7-SSA01. Rather, the effects of salinity-conveyed thermotolerance may be dwarfed by other buffering and regulatory mechanisms by host and endosymbiont. In this regard, it will also be interesting to determine the contribution of the associated Symbiodinium type (and any potential contribution of genetic variability within Symbiodinium types or species) to a given host. Aiptasia will provide a powerful platform to address these questions, due to its ability to associate with different symbiont types/species (Voolstra, 2013; Wolfowicz et al., 2016; Xiang et al., 2013). Future work should establish whether the observed salinity conveyed thermotolerance of the Aiptasia-Symbiodinium symbiosis is directly transferable to other symbiotic cnidarian systems such as scleractinian corals. At present, we cannot disentangle the individual contribution of the host and endosymbiont to thermotolerance in this study. Nonetheless, our results confirm that increased/high 38 salinity can convey thermotolerance concomitant with reduced bleaching at least for some host-endosymbiont combinations.

Indications for the influence of salinity on coral thermal tolerance date back more than 30 years, but were only observed rather anecdotally. For instance, Jokes & Jokiel (1978) found that an increase in salinity (40) above ambient seawater levels (35) led to an increase in resistance to thermal stress. Porter et al. (1999) tested the single and combined effects of temperature and salinity on the coral Orbicella annularis in the Florida Keys. The authors found a short-term mitigating effect of high salinity (40) on elevated temperatures (33 °C). In contrast to the temperature mitigating effects of high salinity treatments, hyposaline conditions were linked to bleaching effects and reduction in photosynthetic efficiency of Symbiodinium (Kerswell and Jones, 2003). Although it remains to be shown in how far results obtained from Aiptasia hold true for corals, these studies argue that corals may show increased thermotolerance at increased salinities. In this regard, our results do not account for the contribution of host genetic variability, since we used clonal Aiptasia strains. At current, it therefore remains to be determined to what extent host genetic variability influences the observed salinity effect. A repetition of the experiment with sea anemone individuals from natural populations, would allow assessing the role of host genetic variability in this type of experiment. Importantly, our results already suggest that the observed salinity effect is not universally applicable. Thus, it will be interesting to determine whether our findings can be extrapolated to diverse coral populations and different coral species at large.

The underlying mechanisms that could potentially convey increased thermotolerance in corals at higher salinities are unknown at present. Very recent work studying osmoadaptation in Symbiodinium and coral, however, may begin to provide an answer. Ochsenkühn et al. (2017) showed that the osmolyte floridoside is present at high levels in corals and Symbiodinium under high salinity conditions and may serve a dual function as a compatible organic osmolyte and a reactive oxygen species scavenger. As such, floridoside adjusts osmotic pressure and at the same time counters oxidative stress produced as a consequence of salinity and heat stress, thereby contributing to stress 39 resilience. In this regard, it is interesting to note that a study by D’Angelo et al. (2015) found that corals from the Persian/Arabian Gulf show strong local adaptation, not only to high temperatures, but also to the exceptionally high salinity of their habitat. Importantly, the authors could show that the superior heat tolerance is lost when these corals are exposed to reduced salinity levels. An existing relationship between salinity and stress resilience could also explain the higher heat tolerance of corals in the northern Red Sea (Osman et al., 2017) and the Gulf of Aqaba (Fine et al., 2013) in comparison to their central and southern counterparts, given the higher salinity in the northern Red Sea. The comparison to other systems reveals that studies from plants grown at high salinities have repeatedly shown an increased temperature tolerance (Lu et al., 2003; Rivero et al., 2014). Interestingly, Rivero et al. (2014) attributed the higher temperature tolerance at high salinities in tomato to an increased production of osmolytes with secondary reactive oxygen species (ROS)-scavenging abilities, such as glycine, betaine, or trehalose. These osmolytes therefore serve a dual function: first, they alter and adjust osmotic concentrations, and secondly, as antioxidant molecules that can counter the increased ROS produced as a result of high salinity and high temperature (Bose et al., 2014; Hasegawa et al., 2000; Mittler, 2002; Murata et al., 2007). Thus, plants and corals might show the same increased temperature tolerance under high salinity because of similarity in the underlying mechanism. Besides a ROS-scavenging abilities of certain osmolytes, it was shown that betaine and trehalose can act as a ‘chemical chaperones’ regulating the activity of molecular chaperones (Diamant et al., 2001). Encouraged by these findings, experiments are currently underway to assess osmolyte production and levels in symbiotic Aiptasia and corals under conditions of high salinity and temperature stress.

3.6. Conclusions Using the coral model Aiptasia, in this study we show that higher salinities can lead to increased thermotolerance accompanied by less bleaching in a cnidarian-dinoflagellate symbiosis. This salinity effect, however, is not universal, but seems to be dependent on the host, symbiont, or both. At this point, it remains to be determined whether such a salinity effect increases the thermotolerance of stony corals in high salinity environments and whether all coral species respond to it. In this regard, it will be important to better understand the contribution of genetic variation of host and symbiont as well as the role that distinct symbiont types play in salinity-conveyed thermotolerance. Future studies should address the underlying mechanism(s) of salinity-induced thermotolerance in corals from naturally saline regions, such as the Red Sea and Persian/Arabian Gulf, and the implications this may have for corals under altered environmental conditions on a global scale.

3.6.1. Acknowledgements

The authors would like to acknowledge Gabriela Perna for method establishment regarding algal endosymbiont counts.

3.6.2. Funding

HMG and CRV acknowledge funding from the KAUST Center Competitive Fund (CCF) program (award number: FCC/1/1973-22-01). Additional funding was provided by baseline funds from KAUST to CRV.

3.7. References Ainsworth, T. D., Heron, S. F., Ortiz, J. C., Mumby, P. J., Grech, A., Ogawa, D., Eakin, C. M. and Leggat, W. (2016). Climate change disables coral bleaching protection on the Great Barrier Reef. Science (80-. ). 352, 338–342. Albright, R., Caldeira, L., Hosfelt, J., Kwiatkowski, L., Maclaren, J. K., Mason, B. M., Nebuchina, Y., Ninokawa, A., Pongratz, J., Ricke, K. L., et al. (2016). Reversal of ocean acidification enhances net coral reef calcification. Nature 531, 362–365. Anthony, K. R. N., Kline, D. I., Diaz-Pulido, G., Dove, S. and Hoegh-Guldberg, O. (2008). Ocean acidification causes bleaching and productivity loss in coral reef builders. Proc. Natl. Acad. Sci. 105, 17442–17446. Baird, A. H., Bhagooli, R., Ralph, P. J. and Takahashi, S. (2009). Coral bleaching: the role of the host. Trends Ecol. Evol. 24, 16–20. Baker, A. C. and Cunning, R. (2015). Coral “Bleaching” as a Generalized Stress Response to Environmental Disturbance. Dis. Coral 396–409. Barletta, M. (2004). The role of salinity in structuring the fish assemblages in a tropical estuary. J. Fish Biol. 1–28. Baumgarten, S., Simakov, O., Esherick, L. Y., Liew, Y. J., Lehnert, E. M., Michell, C. T., Li, Y., Hambleton, E. A., Guse, A., Oates, M. E., et al. (2015). The genome of Aiptasia , a sea anemone model for coral symbiosis. Proc. Natl. Acad. Sci. 112, 11893–11898. Bieri, T., Onishi, M., Xiang, T., Grossman, A. R. and Pringle, J. R. (2016). Relative contributions of various cellular mechanisms to loss of algae during cnidarian bleaching. PLoS One 11, e0152693. Bosch, T. C. G. and Miller, D. J. (2016). The Holobiont Imperative. 113–125. Bose, J., Rodrigo-Moreno, A. and Shabala, S. (2014). ROS homeostasis in halophytes in the context of salinity stress tolerance. J. Exp. Bot. 65, 1241–1257. Brown, B. E. (1997). Coral bleaching: causes and consequences. Coral Reefs 16, 129– 138. Coles, S. L. and Jokiel, P. L. (1978). Synergistic effects of temperature, salinity and light on the hermatypic coral Montipora verrucosa. Mar. Biol. 49, 187–195. 42

Cziesielski, M. J., Liew, Y. J., Cui, G., Schmidt-roach, S., Campana, S., Marondedze, C. and Aranda, M. (2018). Multi-omics analysis of thermal stress response in a zooxanthellate cnidarian reveals the importance of associating with thermotolerant symbionts. D’Angelo, C., Hume, B. C. C., Burt, J., Smith, E. G., Achterberg, E. P. and Wiedenmann, J. (2015). Local adaptation constrains the distribution potential of heat-tolerant Symbiodinium from the Persian/Arabian Gulf. ISME J. 9, 2551–2560. Diamant, S., Eliahu, N., Rosenthal, D. and Goloubinoff, P. (2001). Chemical Chaperones Regulate Molecular Chaperones in Vitro and in Cells under Combined Salt and Heat Stresses. J. Biol. Chem. 276, 39586–39591. Dubinsky, Z. and Stambler, N. (2011). Coral reefs: An ecosystem in transition. Coral Reefs An Ecosyst. Transit. 1–552. Durack, P. J., Wijffels, S. E. and Matear, R. J. (2012). Ocean Salinities Reveal Strong Global Water Cycle Intensification During 1950 to 2000. Science (80-. ). 336, 455– 458. Ferrier-Pagès, C., Gattuso, J. P. and Jaubert, J. (1999). Effect of small variations in salinity on the rates of photosynthesis and respiration of the zooxanthellate coral Stylophora pistillata. Mar. Ecol. Prog. Ser. 181, 309–314. Fine, M., Gildor, H. and Genin, A. (2013). A coral reef refuge in the Red Sea. Glob. Chang. Biol. 19, 3640–3647. Gardner, S. G., Nielsen, D. A., Laczka, O., Shimmon, R., Beltran, V. H., Ralph, P. J. and Petrou, K. (2016). Dimethylsulfoniopropionate, superoxide dismutase and glutathione as stress response indicators in three corals under short-term hyposalinity stress. Proc. R. Soc. London B Biol. Sci. 283, 1–9. Gasch, A. P., Payseur, B. A. and Pool, J. E. (2016). The Power of Natural Variation for Model Organism Biology. Trends Genet. 32, 147–154. Glynn, P. W. and Wellington, G. M. (1983). Corals and coral reefs of the Galapagos Islands. In Red Sea, p. 94143. Grajales, A., Rodríguez, E. and Thornhill, D. J. (2016). Patterns of Symbiodinium spp. associations within the family Aiptasiidae, a monophyletic lineage of symbiotic of sea anemones (Cnidaria, Actiniaria). Coral Reefs 35, 345–355. 43

Grasis, J. A., Lachnit, T., Anton-Erxleben, F., Lim, Y. W., Schmieder, R., Fraune, S., Franzenburg, S., Insua, S., Machado, G., Haynes, M., et al. (2014). Species- specific viromes in the ancestral holobiont hydra. PLoS One 9,. Gruber, N. (2011). Warming up, turning sour, losing breath: Ocean biogeochemistry under global change. Philos. Trans. R. Soc. A Math. Phys. Eng. Sci. 369, 1980– 1996. Hasegawa, P. M., Bressan, R. A., Zhu, J. K. and Bohnert, H. J. (2000). Plant Cellular and Molecular Responses to High Salinity. Annu Rev Plant Physiol Plant Mol Biol 51, 463–499. Hillyer, K. E., Tumanov, S., Villas-Boas, S. and Davy, S. K. (2016). Metabolite profiling of symbiont and host during thermal stress and bleaching in a model cnidarian-dinoflagellate symbiosis. J. Exp. Biol. 219, 516–527. Hoang, B., Moos, M., Vukicevic, S., Luyten, F. P. and Chem, M. J. B. (1996). Primary Structure and Tissue Distribution of FRZB , a Novel Protein Related to Drosophila Frizzled , Suggest a Role in Skeletal Morphogenesis *. 271, 26131–26137. Hoegh-Guldberg, O. (1999). Climate change, coral bleaching and the future of the world’s coral reefs. Mar. Freshw. Res. 50, 839. Hoegh-Guldberg, O. and Smith, G. J. (1989a). The effect of sudden changes in temperature, light and salinity on the population density and export of zooxanthellae from the reef corals Stylophora pistillata Esper and Seriatopora hystrix Dana. J. Exp. Mar. Bio. Ecol. 129, 279–303. Hoegh-Guldberg, O. and Smith, G. J. J. (1989b). The effect of sudden changes in temperature, light and salinity on the population density and export of zooxanthellae from the reef corals Stylophora pistillata Esper and Seriatopora hystrix Dana. J. Exp. Mar. Bio. Ecol. 129, 279–303. Hothorn, T., Bretz, F. and Westfall, P. (2008). Multcomp: simultaneous inference in general parametric models. R package version 1.0-0. Biometrical J. 50, 346–363. Howells, E. J., Abrego, D., Meyer, E., Kirk, N. L. and Burt, J. A. (2016). Host adaptation and unexpected symbiont partners enable reef-building corals to tolerate extreme temperatures. Glob. Chang. Biol. 22, 2702–2714. Hughes, T. P., Barnes, M. L., Bellwood, D. R., Cinner, J. E., Cumming, G. S., 44

Jackson, J. B. C., Kleypas, J., Leemput, I. A. van de, Lough, J. M., Morrison, T. H., et al. (2017a). Coral reefs in the Anthropocene. Nature in press. Hughes, T. P., Kerry, J. T., Álvarez-Noriega, M., Álvarez-Romero, J. G., Anderson, K. D., Baird, A. H., Babcock, R. C., Beger, M., Bellwood, D. R., Berkelmans, R., et al. (2017b). Global warming and recurrent mass bleaching of corals. Nature 543, 373–377. Hume, B. C. C., D’Angelo, C., Smith, E. G., Stevens, J. R., Burt, J. and Wiedenmann, J. (2015). Symbiodinium thermophilum sp. nov., a thermotolerant symbiotic alga prevalent in corals of the world’s hottest sea, the Persian/Arabian Gulf. Sci. Rep. 5, 8562. Hume, B. C. C., Voolstra, C. R., Arif, C., D’Angelo, C., Burt, J. A., Eyal, G., Loya, Y. and Wiedenmann, J. (2016). Ancestral genetic diversity associated with the rapid spread of stress-tolerant coral symbionts in response to Holocene climate change. Proc. Natl. Acad. Sci. 113, 4416–4421. Kerswell, A. P. and Jones, R. J. (2003). Effects of hypo-osmosis on the coral Stylophora pistillata: Nature and cause of “low-salinity bleaching.” Mar. Ecol. Prog. Ser. 253, 145–154. Krediet, C. J., DeNofrio, J. C., Caruso, C., Burriesci, M. S., Cella, K. and Pringle, J. R. (2015). Rapid, precise, and accurate counts of symbiodinium cells using the guava flow cytometer, and a comparison to other methods. PLoS One 10, 1–19. Lesser, M. P. (1996). Elevated temperatures and ultraviolet radiation cause oxidative stress and inhibit photosynthesis in ymbiotic dinoflagellates. Limnol. Oceanogr. 41, 271–283. Lesser, M. P. (1997). Oxidative stress causes coral bleaching during exposure to elevated temperatures. Coral Reefs 16, 187–192. Lu, C., Qiu, N., Wang, B. and Zhang, J. (2003). Salinity treatment shows no effects on photosystem II photochemistry, but increases the resistance of photosystem II to heat stress in halophyte Suaeda salsa. J. Exp. Bot. 54, 851–860. Mayfield, A. B. and Gates, R. D. (2007). Osmoregulation in anthozoan-dinoflagellate symbiosis. Comp. Biochem. Physiol. - A Mol. Integr. Physiol. 147, 1–10. Mittler, R. (2002). Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 45

7, 405–410. Murata, N., Takahashi, S., Nishiyama, Y. and Allakhverdiev, S. I. (2007). Photoinhibition of photosystem II under environmental stress. Biochim. Biophys. Acta - Bioenerg. 1767, 414–421. Oakley, C. A., Ameismeier, M. F., Peng, L., Weis, V. M., Grossman, A. R. and Davy, S. K. (2015). Symbiosis induces widespread changes in the proteome of the model cnidarian Aiptasia. Cell. Microbiol. n/a-n/a. Ochsenkühn, M. A., Röthig, T., D’Angelo, C., Wiedenmann, J. and Voolstra, C. R. (2017). The role of floridoside in osmoadaptation of coral-associated algal endosymbionts to high-salinity conditions. Sci. Adv. 3, e1602047. Osman, E. O., Smith, D. J., Ziegler, M., Kürten, B., Conrad, C., El-Haddad, K. M., Voolstra, ; Christian R., Suggett, D. J. and ; David J. Suggett1, 6 5 1 (2017). Thermal refugia against coral bleaching throughout the northern Red Sea. Glob. Chang. Biol. in press, 1–11. Pogoreutz, C., Rädecker, N., Cárdenas, A., Gärdes, A., Voolstra, C. R. and Wild, C. (2017). Sugar enrichment provides evidence for a role of nitrogen fixation in coral bleaching. Glob. Chang. Biol. Porter, J. W., Lewis, S. K. and Porter, K. G. (1999). The effect of multiple stressors on the Florida Keys coral reef ecosystem: A landscape hypothesis and a physiological test. Limnol. Oceanogr. 44, 941–949. R Core Team (2016). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna. Raina, J. B., Tapiolas, D., Willis, B. L. and Bourne, D. G. (2009). Coral-associated bacteria and their role in the biogeochemical cycling of sulfur. Appl. Environ. Microbiol. 75, 3492–3501. Riegl, B. M., Benzoni, F., Samimi-Namin, K. and Sheppard, C. (2012). Coral Reefs of the Gulf. In Coral Reefs of the World, pp. 187–224. Springer Netherlands. Rivero, R. M., Mestre, T. C., Mittler, R., Rubio, F., Garcia-Sanchez, F. and Martinez, V. (2014). The combined effect of salinity and heat reveals a specific physiological, biochemical and molecular response in tomato plants. Plant, Cell Environ. 37, 1059–1073. 46

Rohwer, F., Seguritan, V., Azam, F. and Knowlton, N. (2002). Diversity and distribution of coral-associated bacteria. Mar. Ecol. Prog. Ser. 243, 1–10. Rosenberg, R., Loo, L. O. and Möller, P. (1992). Hypoxia, salinity and temperature as structuring factors for marine benthic communities in a eutrophic area. Netherlands J. Sea Res. 30, 121–129. Röthig, T., Ochsenkühn, M. A., Roik, A., Van Der Merwe, R. and Voolstra, C. R. (2016). Long-term salinity tolerance is accompanied by major restructuring of the coral bacterial microbiome. Mol. Ecol. 25, 1308–1323. Seveso, D., Montano, S., Strona, G., Orlandi, I., Galli, P. and Vai, M. (2013). Exploring the effect of salinity changes on the levels of Hsp60 in the tropical coral seriatopora caliendrum. Mar. Environ. Res. 90, 96–103. Sunagawa, S., Wilson, E. C., Thaler, M., Smith, M. L., Caruso, C., Pringle, J. R., Weis, V. M., Medina, M. and Schwarz, J. A. (2009). Generation and analysis of transcriptomic resources for a model system on the rise: the sea anemone Aiptasia pallida and its dinoflagellate endosymbiont. BMC Genomics 10, 258. Thornhill, D. J., Xiang, Y., Pettay, D. T., Zhong, M. and Santos, S. R. (2013). Population genetic data of a model symbiotic cnidarian system reveal remarkable symbiotic specificity and vectored introductions across ocean basins. Mol. Ecol. 22, 4499–4515. Tolleter, D., Seneca, F. O., Denofrio, J. C., Krediet, C. J., Palumbi, S. R., Pringle, J. R. and Grossman, A. R. (2013). Coral bleaching independent of photosynthetic activity. Curr. Biol. 23, 1782–1786. van Woesik, R., Cacciapaglia, C. and Randall, C. J. (2016). Thermal-Stress Response of Coral Communities to Climate Change. In The Cnidaria, Past, Present and Future: The world of Medusa and her sisters (ed. Goffredo, S.) and Dubinsky, Z.), pp. 545–552. Cham: Springer International Publishing. Vega Thurber, R. L., Burkepile, D. E., Fuchs, C., Shantz, A. A., McMinds, R. and Zaneveld, J. R. (2014). Chronic nutrient enrichment increases prevalence and severity of coral disease and bleaching. Glob. Chang. Biol. 20, 544–554. Voolstra, C. R. (2013). A journey into the wild of the cnidarian model system Aiptasia and its symbionts. Mol. Ecol. 22, 4366–4368. 47

Warner, M. E., Fitt, W. K. and Schmidt, G. W. (1999). Damage to photosystem II in symbiotic dinoflagellates: A determinant of coral bleaching. Proc. Natl. Acad. Sci. 96, 8007–8012. Weis, V. M. (2008). Cellular mechanisms of Cnidarian bleaching: stress causes the collapse of symbiosis. J. Exp. Biol. 211, 3059–3066. Weis, V. M., Davy, S. K., Hoegh-Guldberg, O., Rodriguez-Lanetty, M. and Pringle, J. R. (2008). Cell biology in model systems as the key to understanding corals. Trends Ecol. Evol. 23, 369–376. Wild, C., Hoegh-Guldberg, O., Naumann, M. S., Colombo-Pallotta, M. F., Ateweberhan, M., Fitt, W. K., Iglesias-Prieto, R., Palmer, C., Bythell, J. C., Ortiz, J. C., et al. (2011). Climate change impedes scleractinian corals as primary reef ecosystem engineers. Mar. Freshw. Res. 62, 205–215. Wolfowicz, I., Baumgarten, S., Voss, P. A., Hambleton, E. A., Voolstra, C. R., Hatta, M. and Guse, A. (2016). Aiptasia sp. larvae as a model to reveal mechanisms of symbiont selection in cnidarians. Sci. Rep. 6, 32366. Xiang, T., Hambleton, E. A., Denofrio, J. C., Pringle, J. R. and Grossman, A. R. (2013). Isolation of clonal axenic strains of the symbiotic dinoflagellate Symbiodinium and their growth and host specificity1. J. Phycol. 49, 447–458. Yancey, P. H. (2005). Organic osmolytes as compatible, metabolic and counteracting cytoprotectants in high osmolarity and other stresses. J. Exp. Biol. 208, 2819–2830. Yancey, P. H., Heppenstall, M., Ly, S., Andrell, R. M., Gates, R. D., Carter, V. L. and Hagedorn, M. (2010). Betaines and dimethylsulfoniopropionate as major osmolytes in cnidaria with endosymbiotic dinoflagellates. Physiol. Biochem. Zool. 83, 167–73. Ziegler, M., Seneca, F. O., Yum, L. K., Palumbi, S. R. and Voolstra, C. R. (2017). Bacterial community dynamics are linked to patterns of coral heat tolerance. Nat. Commun. 8, 1–8.

3.8. Supplementary Material

Figure S1. Aiptasia H2-SSB01 and CC7-SSA01 in low (36), intermediate (39) and high (42) salinity before start of the long-term heat stress experiment (t0).

Figure S2. Symbiodinium densities after long-term rearing (16 days) of Aiptasia under different salinities at ambient temperature (25 °C). (A) H2-SSB01. (B) CC7- SSA01. Total host protein was used for normalization. Color key indicates salinity: blue (36), yellow (39), red (42). Data are shown as means ± SE. Letters indicate no significant differences between groups (Kruskal-Wallis, H2-SSB01 P > 0.1; CC7-SSA01 P > 0.1).

Figure S3. Symbiodinium cell densities of Aiptasia. (A) Before the heat stress experiment (t0). (B) After the heat stress experiment (t1). Total protein was used for normalization. Color key indicates salinity: blue (36), yellow (39), red (42). Data are shown as means ± SE. Different letters indicate significant differences between groups (Tukey's HSD post-hoc, P < 0.05). 50

Table S1. Analysis of two-factorial generalized linear models (GLMs) on Symbiodinium cell counts with salinity and time as individual and interactive explanatory variables for Aiptasia (A) H2-SSB01 and (A) CC7-SSA01. All models are based on gamma distribution and best fitting link function. Bold values indicate P < 0.05.

(A) H2-SSB01 X2 Df P Time 145.77 1 < 0.001 Salinity 8.88 2 0.012 Time:Salinity 15.88 2 < 0.001

(B) CC7-SSA01 X2 Df P Time 80.67 1 < 0.001 Salinity 7.56 2 0.023 Time:Salinity 0.20 2 0.903

Table S2. Tukey’s HSD post-hoc comparison of Symbiodinium cell counts between time points and salinities for Aiptasia (A) H2-SSB01 and (B) CC7-SSA01. Pairwise comparisons are denoted as Salinity (36,39.42). Timepoint (T0, T1). Bold values indicate P < 0.05; SE = standard error.

(A) H2-SSB01 Pairwise comparison Estimated SE z value P 36.T0 - 39.T0 0.03 0.19 0.18 0.999 36.T0 - 42.T0 -0.19 0.188 -1.03 0.908 39.T0 - 42.T0 -0.23 0.188 -1.21 0.833025 36.T1 - 36.T0 -2.00 0.188 -10.60 < 0.001 39.T1 - 36.T0 -1.15 0.188 -6.13 < 0.001 42.T1 - 36.T0 -1.18 0.188 -6.28 < 0.001 36.T1 - 39.T0 -2.03 0.188 -10.78 < 0.001 39.T1 - 39.T0 -1.19 0.188 -6.31 < 0.001 42.T1 - 39.T0 -1.22 0.188 -6.46 < 0.001 36.T1 - 42.T0 -1.80 0.188 -9.57 < 0.001 39.T1 - 42.T0 -0.96 0.188 -5.10 < 0.001 42.T1 - 42.T0 -0.99 0.188 -5.25 < 0.001 36.T1 - 39.T1 0.84 0.188 4.48 < 0.001 36.T1 - 42.T1 0.81 0.188 4.32 < 0.001 39.T1 - 42.T1 -0.03 0.188 -0.15 1.000

(B) CC7-SSA01 Pairwise comparison Estimated SE z value P 36.T0 - 39.T0 0.30 0.174 1.74 0.503 36.T0 - 42.T0 0.08 0.174 0.46 0.998 39.T0 - 42.T0 -0.22 0.174 -1.29 0.792 36.T1 - 36.T0 -0.98 0.174 -5.64 < 0.001 39.T1 - 36.T0 -0.62 0.174 -3.56 0.005 42.T1 - 36.T0 -0.84 0.174 -4.54 < 0.001 36.T1 - 39.T0 -1.29 0.174 -7.39 < 0.001 39.T1 - 39.T0 -0.92 0.174 -5.30 < 0.001 42.T1 - 39.T0 -1.14 0.185 -6.18 < 0.001 36.T1 - 42.T0 -1.06 0.174 -6.10 < 0.001 39.T1 - 42.T0 -0.70 0.174 -4.01 < 0.001 42.T1 - 42.T0 -0.92 0.185 -4.97 < 0.001 36.T1 - 39.T1 0.36 0.174 2.09 0.294 36.T1 - 42.T1 0.15 0.185 0.79 0.970 39.T1 - 42.T1 -0.22 0.185 -1.18 0.846

Table S3. Analysis of two-factorial generalized linear model (GLM) for photosynthetic efficiency analysis with salinity and time as individual explanatory variables for Aiptasia (A) H2-SSB01 and (B) CC7-SSA01. All models based on gamma distribution and best fitting link function. Bold values indicate P < 0.05.

(A) H2-SSB01 X2 Df P Time 40.93 1 < 0.001 Salinity 51.80 2 < 0.001

(B) CC7-SSA01 X2 Df P Time 105.68 1 < 0.001 Salinity 20.11 2 < 0.001

Table S4. Tukey’s HSD post-hoc comparison of photosynthetic efficiencies between salinities over the course of the long-term heat stress experiment for Aiptasia (A) H2-SSB01 and (B) CC7-SSA01. Pairwise comparisons are denoted as Salinity(36,39,42) – Salinity(36,39,42). Bold values indicate P < 0.05; SE = standard error.

(A) H2-SSB01 Pairwise comparison Estimated SE z value P 39 - 36 0.07 0.011 6.26 < 0.001 42 - 36 0.07 0.011 6.26 < 0.001 42 - 39 0.00 0.012 0.15 0.987

(B) CC7-SSA01 Pairwise comparison Estimated SE z value P 39 - 36 0.02 0.008 3.00 0.009 42 - 36 -0.01 0.008 -1.53 0.276 42 - 39 -0.03 0.008 -4.38 < 0.001

CHAPTER II

4. High levels of the Osmolyte Floridoside at high Salinity link Osmoadaptation with Bleaching Susceptibility in the Coral-Algal Endosymbiosis

Author list: Hagen M Gegner1, Nils Rädecker1, Michael Ochsenkühn2, Marcelle Barreto1, Maren Ziegler1,3, Jessica Reichert3, Patrick Schubert3, Thomas Wilke3, Christian R Voolstra1*

1Red Sea Research Center, Division of Biological and Environmental Science and Engineering (BESE), King Abdullah University of Science and Technology (KAUST), Saudi Arabia

2Division of Science and Engineering, New York University Abu Dhabi (NYUAD), Abu Dhabi, United Arab Emirates

3Department of Animal Ecology & Systematics, Justus-Liebig-University, Giessen, Germany

Submitted for publication. A pdf version can be found in the Supporting Material (see Supplementary File S7, in 7. APPENDIX). The accompanying developed protocol is published online on protocols.io (dx.doi.org/10.17504/protocols.io.s7fehjn).

Author contributions: Conceived and designed the experiments: HMG, NR, MZ, CRV; contributed reagents/materials/tools: JR PS, TW, CRV; generated data: HMG, NR, MO, MB; analyzed data: HMG, NR, MO, CRV; wrote the manuscript: CRV, HMG, NR.

4.1. Abstract

Coral reefs are in global decline due to increasing sea surface temperatures triggering coral bleaching. Deciphering the underlying causes of this breakdown of the coral-algal endosymbiosis is important to conceive strategies to mitigate loss of coral reef cover. Recently, high salinity has been linked to increased thermotolerance and decreased bleaching in the sea anemone coral model Aiptasia. However, the underlying processes remain elusive. Using two Aiptasia host-endosymbiont pairings, we induced bleaching at different salinities and show reduced reactive oxygen species (ROS) release at high salinities, confirming a role of osmoadaptation in the increased thermotolerance. A subsequent screening of osmolytes revealed that this effect was only observed in algal endosymbionts that produce 2-O-glycerol-α-D-galactopyranoside (floridoside), an osmolyte capable of scavenging ROS. To explore whether this constitutes a more universal mechanism, we confirmed increased levels of floridoside at high salinities, concomitant with reduced bleaching and increased thermotolerance, across six coral species. Our results argue for a mechanistic link between decreased bleaching and increased thermotolerance at high salinities. As such, they highlight the putative importance of osmoadaptation to environmental resilience of the coral-algal endosymbiosis, and may shed new light on the mechanisms underlying the remarkable thermotolerance of corals from saline water bodies such as the Red Sea or Persian/Arabian Gulf.

4.2. Introduction

Climate change leads to ocean warming and ocean acidification, which are threatening coral reefs on a global scale (Hughes et al., 2017a). While ocean warming is identified as the main driver of coral bleaching (Hughes et al 2017), the effects of ocean acidification are less clear, although ocean acidification presumably leads to increased energy demands for coral calcification, less dense skeletons, and reduced reef calcification and growth (Albright et al., 2016; Liew et al., 2018; Tambutté et al., 2015). Coral bleaching describes the loss of their micro-algal photosynthetic endosymbionts in the family Symbiodiniaceae (LaJeunesse et al., 2018). As such, corals loose the provision of photosynthates, which covers the main energy needs for corals to build and maintain their skeletons that in turn provide the structural foundation of reef ecosystems (Muscatine and Porter, 1977). For these reasons, it is becoming increasingly important to better understand the mechanisms and drivers of coral bleaching and what determines stress resilience and thermotolerance of corals (Torda et al., 2017).

As a rough estimate, corals start to bleach at about 1-2°C above their annual average summer temperatures (Hoegh-Guldberg, 1999), suggesting that corals are adapted to their prevailing environmental conditions and thermotolerance differs between regions (Hughes et al., 2017b; Osman et al., 2018). To date, we are missing a detailed understanding of what contributes to such geographical differences of bleaching susceptibility and the cellular mechanisms of bleaching are not completely understood. While the production and accumulation of reactive oxygen species (ROS) as a consequence of increased temperatures, i.e. heat stress, certainly play a role (Lesser, 1997; Lesser, 2011; Weis, 2008), recent studies have shown bleaching without heat stress (Pogoreutz et al., 2017), bleaching without light (Tolleter et al., 2013), and bleaching decoupled from oxidative stress (Nielsen et al., 2018). Further, Gegner et al. (2017) showed increased thermotolerance and reduced bleaching at high salinities in the coral model Aiptasia, suggesting a possible role of osmoadaptation in stress resilience (Ochsenkühn et al., 2017; Osman et al., 2018), but the underlying mechanism remained elusive.

With regard to the putative importance of salinity in contributing to thermotolerance, it is important to note that some of the most thermotolerant corals can be found in some of the hottest and most saline bodies of water where corals live successfully, i.e. the Persian/Arabian Gulf (D’Angelo et al., 2015; Hume et al., 2013; Hume et al., 2015) and the northern Red Sea (Bellworthy and Fine, 2017; Krueger et al., 2017; Osman et al., 2018). To gain insight into the potential mechanisms underlying salinity-conveyed thermotolerance of symbiotic cnidarians, we set up a series of bleaching experiments at different salinities. Using the coral model Aiptasia (sensu Exaiptasia pallida), we first assessed the conveyed thermotolerance of two host–endosymbiont pairings at different salinity and temperature conditions. Subsequent linking of the heat stress response to ROS and osmolyte levels allowed us to pinpoint potential processes that play a role in the increased thermotolerance and the decreased bleaching at high salinities in Aiptasia. We then confirmed the wider applicability of the putative mechanism across a broad range of coral species from the Red Sea.

4.3. Material and Methods

4.3.1. Aiptasia experimental procedures

4.3.1.1. Anemone rearing, experimental setup, and sample processing

We used symbiotic and aposymbiotic anemones of the clonal Aiptasia strains H2 and CC7 as previously described (Gegner et al., 2017). H2 anemones were associated with their native endosymbionts type B1 [strain SSB01, species Breviolum minutum (Baumgarten et al., 2015; Xiang et al., 2013)], referred to as H2-SSB01, and CC7 anemones were associated with their native endosymbionts type A4 [strain SSA01, species Symbiodinium linucheae (Bieri et al., 2016)], referred to as CC7-SSA01. A subset of anemones from these host-endosymbiont pairings were rendered aposymbiotic following the menthol bleaching method by Matthews et al., (2016) and treated as their symbiotic counterparts. All anemones were kept at a 12 h:12 h light/dark cycle at 30-40 µmol m−2 s−1.

For the experiment, anemones were kept at ambient temperature (25 °C) at three salinities: low (36), intermediate (39), and high (42) for 10 days to acclimate (Fig. 5A). A total of 252 anemones were used (symbiotic: 18 animals x 2 host-endosymbiont pairings x 3 salinities x 2 temperatures = 216; aposymbiotic: 3 animals x 2 hosts x 3 salinities x 2 temperatures = 36). Symbiotic and aposymbiotic animals were transferred to individual wells of 6-well plates (water volume of 7ml), wrapped in a see-through plastic bag containing wet wipes to minimize evaporation. Salinities were monitored throughout the entire experiment using a refractometer (Aqua Medic GmbH, Germany). Wells were cleaned every second day with a cotton-swap and the water was exchanged. Feeding was ceased with the beginning of the acclimation. The experimental salinities were achieved by using autoclaved Red Sea seawater diluted with ddH2O to the lowest salinity (36) and subsequent adjustment adjusted with NaCl to the desired salinities.

After the acclimation phase half of the symbiotic and aposymbiotic anemones were subjected to heat stress and the remaining half was kept at ambient temperatures. For the heat stress, anemones were moved to another incubator with identical settings where the temperature was ramped from 25 °C to 34 °C over the course of 10 h (1 °C h−1 increment) 59 and was hold for the remainder of the experiment. The experiment was terminated after 6 days when H2-SSB01 anemones in the lowest salinity (36) appeared completely bleached visually, i.e. translucent. At the same time, anemones from the control were collected.

Individual Aiptasia were rinsed twice with ddH2O, briefly drained of excess water, transferred into single cryotubes and immediately snap frozen in liquid nitrogen and stored at -80 °C until further processing.

4.3.1.2. Photosynthetic efficiency over the course of the heat stress

Light-adapted photosynthetic efficiency (ΔF/Fm’) of photosystem II (PSII) for each symbiotic anemone (N = 12 per experimental condition and host-endosymbiont pairing, total of N = 144) was measured daily (5 hours into the light phase) for the period of the experiment using a diving Pulse Amplitude Modulated (PAM) fluorometer (Walz, Germany) (see Supplementary Material).

4.3.1.3. Algal endosymbiont counts

Snap frozen anemones (see above) were thawed on ice and homogenized as previously described (Gegner et al., 2017; Krediet et al., 2015). Algal endosymbiont cell counts with three technical replicates per sample were obtained using a BD LSR Fortessa cell analyzer (BD Biosciences). Algal endosymbionts were discriminated from anemone host cells and debris using a combination of forward/side scatter as well as chlorophyll fluorescence. Counts were then normalized to the host protein of each anemone using the PierceBCAassay (Thermo Fisher Scientific, Waltham, MA, USA) according to manufacturer’s instructions.

4.3.1.4. ROS leakage measurement from algal endosymbionts

This protocol was adapted from Cziesielski et al., (2018): shorter incubation times were used and antibiotic treatments were omitted. Symbiotic Aiptasia, i.e. H2-SSB01 and CC7-SSA01 (N=6 per experimental condition and host-endosymbiont pairing) were subjected to the same experimental conditions as described above. After 2 days at ambient and heat stress temperatures anemones were homogenized in seawater that was adjusted to their respective salinity (i.e., 36, 39, and 42). The algal endosymbiont fraction 60 was isolated by centrifugation for 5min at 3000 x g and washed twice with 1X PBS. The endosymbiont pellet was then re-suspended in seawater that was adjusted to the respective salinity (36, 39, 42) and further incubated for 2h at the respective temperature (25 °C or 34 °C). Next, CellROX Orange Reagent was added to a final concentration of 5 µM, vortexed, then centrifuged. Supernatant was finally transferred to a black 96 well plate, which was incubated for 30min at 37 °C in the dark following the manufacturer’s protocol. Fluorescence was measured in a spectrophotometer (SpectraMax Paradigm) at 545/565nm to quantify the amount of leaked ROS to the medium. Recorded fluorescence intensity was normalized to the number of endosymbiont cells, determined using a BD LSR Fortessa cell analyzer (BD Biosciences, and per cell fluorescence was determined (Supplementary Material).

4.3.1.5. Analysis and characterization of the carbohydrate and fatty acid fraction using targeted GC-MS

The step-by-step protocol for the sample preparation, metabolite extraction, and derivatization based on Ochsenkühn et al. (2017) and used here is available online at protocols.io (dx.doi.org/10.17504/protocols.io.s7fehjn). Briefly, snap frozen Aiptasia anemones were resuspended in 5ml ddH2O and disrupted by tip sonication at 7 watts for 2 min on ice in a cold room. Homogenates were then centrifuged at 4000 x g for 20 min at 4 °C to remove cell debris. After that, nine parts of -20 °C ethanol were added to one part supernatant to precipitate all proteins, DNA, and RNA. The mixture was then centrifuged using a centrifuge at 20,000 x g for 20 min at 4 °C. The precipitated pellet was saved for protein quantification and later analyzed using the PierceBCAassay (ThermoFisher Scientific, USA) according to manufacturer’s instructions. The supernatant was transferred to a new falcon tube, stored at -80 °C overnight, and subsequently lyophilized using a FreezeDryer (Ultradry, USA). The dried samples were then dissolved in 500 µl ddH2O, spiked with 10 µl internal standard [HBA in ddH2O (1 µg µ l-1)] transferred into GC vials, and dried again using a concentrator system (Labconco Centrivap Complete, USA). For derivatization of the samples, 50µl of MOX reagent (2 % methoxamine HCL in pyridine) were added, and the solution heated to 75 °C for 1 hour. After that, 100µl of MSTFA [N-methyl-N- (trimethylsilyl)trifluoroacetamide, 1 % trimethylchlorosilane; Thermo Fisher Scientific] 61 was added to each vial, heated again to 75 °C for 1 h, and filtered. The extracted metabolites were then analyzed by a GC-MS system [GC (Agilent 7890A) and MS (Agilent 5975C)], and quantified using a set of determined standard curves for glucose (99.5 %; Sigma, USA), sucrose (99.5 %; Sigma, USA), glycerol (≥99.5 %, ACS Reagent–grade; Sigma, USA) and glycine (ACS reagent, ≥98.5%; Sigma, USA). All GC- MS data were processed (background subtraction, peak picking, and integration) using OpenChrom 1.1.0 (Diels) and identified using MS ionization spectra (NISTMS Software 2.0, Agilent Technologies, USA). Metabolite levels were normalized to the GC-MS internal standard hydroxy benzylic acid (HBA), then to mg of host protein, followed by conversion to pmol using molar masses, which yielded metabolite levels in pmol mg-1 host protein (Data File S4).

4.3.2. Coral experimental procedures

4.3.2.1. Coral rearing, experimental setup, and sample processing

Colony fragments from the coral species Acropora hemprichii, Ctenactis crassa, Echinopora fruticulosa, Pleuractis granulosa, Pocillopora verrucosa and Porites lutea were collected off the coast of the central Red Sea (July 2017, Abu Shosha reef 22°18'16.3"N 39°02'57.7"E). Corals were kept in a temperature-controlled (27 °C) flow- through tank (150L) at the Coastal and Marine Resources Core Lab (CMOR) at KAUST for 4 months.

Pleuractis granulosa and Ctenactis crassa were kept whole, whereas Acropora hemprichii, Pocillopora verrucosa, Echinopora fruticulosa, and Porites lutea were further divided using a rotary saw (DREMEL) and subsequently attached to 3x3cm plastic tiles using coral glue (Corafix, Grotech, UK). After a healing phase of several weeks corals were transferred to a closed recirculation system (300L) for salinity manipulation, including a protein skimmer, a freshwater top-off system, and a filter system. Salinities were monitored throughout the experiment using a refractometer (Aqua Medic GmbH, Germany). The salinity was then lowered over the course of 3 days from central Red Sea salinity (39, intermediate) to the lowest experimental salinity (36, low) (Fig. 5B). All corals were kept at this salinity for 7 days to acclimate. Afterwards, fragments from each coral colony were distributed into two tanks (300L), each of which was connected to an individual recirculation system with a salinity of 36. One of the two tanks was kept at 36 and used as the control tank, the other was adjusted to 42 (see below) and used as the high salinity treatment tank. For this tank, salinity was increased by 1 per day, by adding NaCL, to reach a salinity of 42. After the salinity adjustment, corals were again acclimated in their respective salinities for additional 7 days. Finally, both tanks were subjected to a heat stress. To do this, the temperature was increased 1 °C per day until 32 °C was reached. This temperature was kept for 4 days until a final increase to 34 °C (overnight) for additional 2 days to trigger bleaching. The experiment was then terminated by snap-freezing all corals in liquid nitrogen and storing them at -80 °C. Snap frozen corals were fragmented and processed for algal endosymbiont counts and metabolite analysis (see below). 63

4.3.2.2. Algal endosymbiont counts

For algal endosymbiont counts, pieces of coral colonies (N = 1 per coral species and experimental condition for a total of 12 samples) were thawed on ice and airbrushed as described in Ziegler et al., (2014). The resulting homogenate was then centrifuged at 3000 x g for 5min and the resulting supernatant containing the coral host protein was saved for normalization of algal endosymbiont counts. The pellet containing the endosymbiont cells was suspended in 10ml filtered seawater (0.02 µm) and passed through a 40µm cell strainer for cell counts. Cell counts with three technical replicates per sample were obtained using a BD LSR Fortessa cell analyzer (BD Biosciences). Algal endosymbionts counts were then processed as described for anemones (see above).

4.3.2.3. Determination of floridoside levels using targeted GC-MS

Pieces of the same colony fragments that were used for algal endosymbiont counts were kept on ice and processed to extract the metabolites as described above for Aiptasia. Briefly, fragments (N = 1 per species and treatment for a total of 12 samples) were washed with ddH2O, crushed in liquid nitrogen using a mortar and pestle, re-suspended in ddH2O, and disrupted by tip sonication at 7 watts for 2min on ice in a cold room. The same extraction method, derivatization process, GC-MS measurement, and data processing as applied as described for Aiptasia (see above). A step-by-step protocol is provided online at protocols.io (dx.doi.org/10.17504/protocols.io.s7fehjn). Floridoside levels were normalized to the GC-MS internal standard hydroxy benzylic acid (HBA), then to mg of host protein, followed by the conversion to pmol using its molar mass, which yielded floridoside levels in pmol mg-1 host protein (Data File S5).

4.3.3. Statistical analyses

The effect of ambient and heat stress temperatures (25 and 34 °C) at low (36), intermediate (39), and high (42) salinities on endosymbiont densities and ROS leakage was tested using 2-Way Analysis of Variance (ANOVA) followed by pairwise Tukey post-hoc tests using JMP Pro 13.1.0 (SAS Campus Drive, Cary, NC, USA).

To analyze differences between PAM measurement at ambient and heat stress temperatures (25 and 34 °C) and across salinities (36, 39, 42), the non-parametric Steel- Dwass test was used using JMP Pro 13.1.0 (SAS Campus Drive, Cary, NC, USA).

To analyze differences between metabolite levels determined via a targeted GC-MS approach, we used PRIMER-E (Clarke and Gorley, 2015) to test for differences between host-endosymbiont pairings using a PERMANOVA with the factors host (H2 and CC7) and symbiotic state (symbiotic and aposymbiotic) at the two temperatures (25 and 34 °C) at low (36), intermediate (39), and high (42) salinities. Subsequent analyses of each Aiptasia host-endosymbiont pairing were conducted using MetaboAnalyst 4.0 (Chong et al., 2018). To test for significant metabolite level differences across salinities and temperatures, we used 2-Way ANOVAs with false discovery rate (FDR)-adjusted p values (p < 0.05) using the factors temperature (25 and 34 °C) and salinity (36, 39, 42) for each host pairing. To subsequently determine the specific salinity at which floridoside levels in H2-SSB01 were significantly different for each temperature (25 and 34 °C), we applied non-parametric Kruskal-Wallis (p < 0.05) using JMP Pro 13.1.0 (SAS Campus Drive, Cary, NC, USA).

Differences in endosymbiont densities and floridoside levels between the two salinities (36 and 42) under heat stress across coral species were tested using a non-parametric Kruskal-Wallis test. The analysis was conducted between the two salinities (36 and 42) over all coral species using JMP Pro 13.1.0 (SAS Campus Drive, Cary, NC, USA).

4.4. Results

4.4.1. Decreased bleaching concomitant with reduced ROS levels at high salinities suggest a role of osmoadaptation in conveyed thermotolerance

To elucidate potential mechanisms underlying salinity-conveyed thermotolerance of symbiotic cnidarians, we assessed physiological and metabolic responses of symbiotic and aposymbiotic anemones of Aiptasia from two host-endosymbiont pairings (H2- SSB01 and CC7-SSA01) under ambient (25°C) and heat stress (34°C) conditions at low (36), intermediate (39), and high (42) salinities. Briefly, we acclimated anemones to the respective salinities for 10 days. After that, half of the anemones remained at the ambient temperature as a control and the other half was subjected to heat stress for 6 days.

At ambient temperature (control), salinities had no effect on symbiont densities (ANOVA, H2-SSB01, F = 2.689, p = 0.088; CC7-SSA01, F = 1.467, p = 0.257; Fig. S4A, Tab. S5 and S7, Data file S1) and photosynthetic efficiency (Steel-Dwass, all p > 0.05; Fig. S4B, Tab. S7, Data file S2) of symbiotic Aiptasia (H2-SSB01 and CC7- SSA01), respectively. Heat stress, on the other hand, caused the loss of endosymbionts in Aiptasia in both host-endosymbiont pairings. In H2-SSB01 the extent of symbiont loss, however, was significantly different at different salinities, with animals at high salinity retaining significantly more algal endosymbionts than animals at low salinity (ANOVA, F = 5.188, p = 0.024; Fig. 6A, Tab. S5A). By comparison, CC7-SSA01 showed overall lower levels of endosymbiont loss compared to H2-SSB01 and retained about the same amount of algal endosymbionts independent of salinity (ANOVA, F = 2.708, p = 0.120; Fig. 6B, Tab. S5B). Relative changes in symbiont densities were corroborated by visual bleaching (paling) of anemones (Fig. S4C) and a concomitant decrease of photosynthetic efficiency (Fig. S4B, Tab. S6), as reported previously (Gegner et al., 2017). Aposymbiotic anemones, by comparison, did not show any difference in appearance regardless of temperature or salinity (Fig. S4C).

To confirm that decreased bleaching and increased thermotolerance of H2-SSB01 is indeed related to an increase in salinity, we subsequently measured ROS release from freshly isolated algal endosymbionts from symbiotic anemones after 2 days in the respective temperature and salinity treatments. We found that algal endosymbiont types 67

SSB01 and SSA01 (isolated from H2 and CC7, respectively) showed differences in ROS leakage across temperatures and salinities that aligned with the severity of bleaching. While relative ROS leakage decreased for SSB01 at higher salinities (ANOVA, F = 12.056, p < 0.001, Fig. 6C, Tab. S8, Data file S3), it was overall lower and unaffected by salinity for SSA01 under heat stress (ANOVA, F = 0.801, p = 0.468, Fig. 6D). Thus, despite the fact that more endosymbionts were retained at high salinity for H2-SSB01 anemones (Fig. 6A), the relative ROS leakage per endosymbiont cell actually decreased during heat stress.

4.4.2. High levels of the osmolyte floridoside at high salinity concomitant with salinity-conveyed thermotolerance of the Aiptasia holobiont

Given that we found decreased ROS leakage at high salinities, we reasoned that the process of osmoadaptation might be mechanistically linked to the increased thermotolerance at high salinities. For this reason, we screened for osmolytes that are altered in response to increased salinities. One osmolyte that was recently implicated to be pivotal for osmoadaptation of coral holobionts to high-salinity conditions is floridoside, i.e. 2-O-glycerol-α-D-galactopyranoside (Ochsenkühn et al., 2017), produced by the algal endosymbionts. Thus, we characterized carbohydrates and fatty acid metabolites of Aiptasia holobionts, including floridoside among other important osmolytes, antioxidants, and energy carriers.

We identified a total of 34 metabolites from aposymbiotic and symbiotic Aiptasia anemones across temperatures and salinities (Data file S4). Metabolic profiles were significantly different between anemone hosts (H2 and CC7) and symbiotic states (H2- SSB01 vs. H2-aposymbiotic and CC7-SSA01 vs. CC7-aposymbiotic) (Fig. S2, Tab. S5). Thus, we analyzed metabolic profiles for H2-SSB01 and CC7-SSA01 separately, as our primary interest was on metabolites that were altered in response to salinity and temperature differences in symbiotic cnidarians.

For H2-SSB01 that increase their thermotolerance at high salinity (see above and Gegner et al. 2017), most metabolites showed decreased levels at high salinity (42) at ambient and heat stress temperatures (Fig. 2A). In line with this overall pattern, seven metabolites (L-threitol, oleic acid, palmitelaidic acid, 1-O-hexadecylglycerol, hexadecanoic acid, furanone, and floridoside) showed significantly different abundance levels across salinity treatments. Notably, only two metabolites were significantly reduced at heat stress (D- glucose and L-threitol) (2-Way ANOVA, p < 0.05, Fig. 2A, Tab. S6A), and floridoside was the only measured carbohydrate with increased levels at increasing salinity at ambient and heat stress temperatures, further confirming its important role as an osmolyte in the cnidarian-dinoflagellate symbiosis (Gegner et al., 2017; Ochsenkühn et al., 2017) (Fig. 2 B). 70

In comparison to the pronounced metabolic shifts in H2-SSB01, only three metabolites (D-glucose, L-threonic acid, arachidonic acid) were significantly differentially abundant across temperatures and/or salinities in CC7-SSA01 (2-Way ANOVA, p < 0.05, Tab. S6B). Similar to H2-SSB01, D-glucose decreased significantly at heat stress temperature. CC7-SSA01 anemones showed the highest abundance for most metabolites at ambient temperature and normal salinity (36). At heat stress temperature, this pattern shifted and the highest levels for the majority of metabolites were at intermediate salinity (Fig. 2A). Notably, floridoside was not measured (below detection levels) in CC7-SSA01 (Fig. 2C), and we did not find any other osmolyte that showed increased abundance with increasing salinity. As such, only floridoside in H2-SSB01 featured increased levels over increased salinities, consistent with the increase in thermotolerance observed for this host-endosymbiont pairing. Conversely, CC7-SSA01, which is not amenable to a salinity-conveyed thermotolerance, also did not harbor any measured osmolytes that responded with increased abundance at high salinity.

Figure 7. Metabolite levels of Aiptasia H2-SSB01 and CC7-SSA01 host-endosymbiont pairings. (A) Heatmaps showing metabolites levels of H2-SSB01 and CC7-SSA01 at ambient (Control) and heat stress (Heat) temperatures at low (36), intermediate (39), and high (42) salinity. Significantly different metabolites are designated in bold (2-Way ANOVA, all p < 0.05), with symbols indicating significant differences between salinities (circle), temperature (square), and salinity x temperature interaction (cross). Number of replicates is indicated above the heatmaps (N). (B, C) Floridoside levels of H2-SSB01 and CC7-SSA01 at ambient (Control) and heat stress (Heat) temperatures at low (36), intermediate (39), and high (42) salinity. Different letters above bars indicate significant differences between groups (Kruskal-Wallis, p < 0.05). Number of replicates is indicated above/within bars. ND = not detected.

4.4.3. Red Sea coral screening confirms increased floridoside levels at high salinity concomitant with increased thermotolerance and reduced bleaching

Our results show a clear effect of salinity on bleaching susceptibility, with abundance of the osmolyte floridoside aligning with the increased thermotolerance. Yet, this effect was restricted to symbiotic anemones of the host-endosymbiont pairing H2-SSB01. CC7- SSA01 animals, by comparison, seemingly did not produce floridoside and did not show increased thermotolerance at high salinity. This prompted us to conduct a broad taxonomic screening encompassing six coral species (Acropora hemprichii, Ctenactis crassa, Echinopora fruticulosa, Pleuractis granulosa, Pocillopora verrucosa, and Porites lutea) from the Red Sea under heat stress (34 °C) at low (36) and high (42) salinity in order to assess whether increased floridoside levels at high salinity align with reduced bleaching and increased thermotolerance. To do this, we exposed coral colony fragments of each coral species to heat stress (Fig. 5) at low (36) and high (42) salinity for 11 days. Strikingly, all of the six tested coral species displayed a highly similar response that resembled the pattern observed in H2-SSB01. Corals under heat stress at high salinity showed reduced bleaching, retained significantly more algal endosymbionts (Kruskal- Wallis, p = 0.020; Fig. 8A; Tab. S12A, Data file S5), and showed increased floridoside levels (Kruskal-Wallis Test, p = 0.045; Fig. 8B; Tab. S12B, Data file S5) compared to fragments of the same coral colony at low salinity. Interestingly, the coral with the highest floridoside levels also had the highest number of algal endosymbionts cells retained (Acorpora hemprichii, Fig. 8). For the other coral species, we did not observe a clear correlation between algal endosymbiont cell counts and floridoside levels, suggesting that other factors besides floridoside abundance contribute to bleaching resilience.

Figure 8. Effect of high salinity on heat stress-induced bleaching and floridoside levels in Red Sea corals. (A) Algal endosymbiont cell counts after 11 days of heat stress under normal (36) and high (42) salinities, normalized to host protein. Algal endosymbiont cell counts are significantly higher at high salinity (Kruskal-Wallis, p = 0.020). (B) Floridoside levels, normalized to host protein. Floridoside concentrations are significantly higher at high salinity (Kruskal-Wallis, p = 0.045). For each coral species, fragments from the same coral colony were exposed to different salinities for measurements (N = 1 per species and condition).

4.5. Discussion Prompted by previously published work that high salinity conveys thermotolerance in the coral model Aiptasia (Gegner et al., 2017) and that the osmolyte floridoside is highly abundant in coral holobionts at high salinity, putatively increasing their capacity to cope with the effects of osmotic stress and oxidative stress in extreme environments (Ochsenkühn et al., 2017), we here wanted to assessed the presence of a mechanistic link between osmoadaptation and thermotolerance in the coral-algal endosymbiosis. Using different host-endosymbiont pairings of Aiptasia anemones, we could show that for H2- SSB01 increased thermotolerance and reduced bleaching under heat stress at high salinity resulted in reduced ROS leakage concomitant with increased floridoside levels. This is lending further support to the proposed dual function of floridoside as an osmolyte and ROS scavenger (Ochsenkühn et al., 2017), due to its antioxidative capabilities (Li et al., 2010; Pade et al., 2015). In particular, since floridoside is the only measured carbohydrate osmolyte that increased abundance levels with increasing salinity, it is one of the prime candidates to reduce ROS levels, thereby conveying thermotolerance at high salinity. Nevertheless, a direct functional link remains to be established, e.g. via knock down or overexpression of the underlying genes, but such techniques are currently absent or only beginning to be developed (Cleves et al., 2018). Importantly, however, we confirmed increased abundance levels of floridoside at high salinity, concomitant with reduced bleaching and increased thermotolerance across six coral species, covering a broad taxonomic spectrum. This argues for a broadly pertinent link between osmoadaptation and thermotolerance in the cnidarian-dinoflagellate symbiosis with implications for the importance of osmoadaptation to environmental resilience and the mechanisms underlying the remarkable thermotolerance of corals from saline water bodies such as the Red Sea or Persian/Arabian Gulf, as discussed in the following.

4.5.1. The osmolyte floridoside links osmoadaptation with thermotolerance as a broadly present mechanism

Our results revealed a differential response of the two Aiptasia strains to heat stress under different salinities. Symbiotic H2-SSB01 anemones exhibited higher symbiont loss and reduction in photosynthetic efficiency during heat stress than CC7-SSA01 Aiptasia. Further, reduced abundance of most of the carbohydrates points towards increased metabolism and energy consumption during heat stress in H2-SSB01. By comparison, carbohydrate levels in CC7-SSA01 were more stable under heat stress. Interestingly, however, H2-SSB01 became more thermotolerant with increasing salinities, whereas CC7-SSA01 did not seem to respond to an increase in salinity. This makes these Aiptasia strains a good model system to study differences in osmoadaptation-related thermotolerance. At this point, the underlying cause of the difference in salinity- conveyed thermotolerance remains unclear. In a recent study by Cziesielski et al., (2018), the authors showed that different Aiptasia strains harbor similar antioxidant capacities, but that observed differences of ROS levels in hospite were endosymbiont-driven. Indeed, bleaching susceptibility in our experiments directly aligned with changes in ROS leakage of the endosymbionts during heat stress. Whereas CC7-SSA01 showed overall low ROS leakage across salinities, supporting a high inherent thermotolerance, H2- SSB01 showed reduced ROS leakage at increasing salinities. Thus, endosymbiont identity seems to, at least partially, determine thermotolerance of holobionts. Further, differences in symbiotic ROS leakage are likely not only underlying the differential bleaching susceptibility between host-endosymbiont pairings, but also play a role in the salinity-conveyed thermotolerance. In the case of H2-SSB01, the decrease of ROS leakage at increasing salinities aligns with increased levels of the osmolyte floridoside, which was previously suggested to be an osmolyte of coral algal endosymbionts (Ochsenkühn et al., 2017). Ochsenkühn et al., (2017) further hypothesized that floridoside might play an important role in countering ROS arising from salinity and heat stress, given that it is also a potent antioxidant in many marine algae (Li et al., 2010; Martinez-Garcia and van der Maarel, 2016). Our results corroborate this notion and mechanistically link osmoadaptation with thermotolerance via increased floridoside levels at high salinities, whereby floridoside plays a dual role as an osmolyte and ROS 76 scavenger. Importantly, floridoside was only measured in H2-SSB01 and showed increased levels at increased salinities, in line with reduced ROS leakage of the algal endosymbionts. By contrast, CC7-SSA01 did neither exhibit reduced ROS leakage nor increased thermotolerance at high salinities and they also did not seem to produce floridoside.

Future experiments could test for the presence of salinity-conveyed thermotolerance, reduced ROS leakage of the algal endosymbionts, and floridoside abundance levels in reversed host-endosymbiont pairings, i.e. H2-SSA01 and CC7-SSA01. This would also clarify the relative contribution of host and endosymbiont, respectively the importance of host and endosymbiont identity. While the Aiptasia system explicitly allows to test the same host with different endosymbionts and vice versa (Voolstra, 2013), one must acknowledge that the performance of native host endosymbiont associations are optimized and often exceed non-native host endosymbiont associations (Rädecker et al., 2018). Therefore, results from such experiments may still be ambiguous. Here we chose a more radical approach to test for the universal applicability of our findings and tested whether we find evidence for increased thermotolerance at increased salinity levels across a broad taxonomic range of Red Sea corals.

Compellingly, all six coral species showed reduced bleaching at high salinity concomitant with the increase of floridoside levels. This suggests that salinity-conveyed thermotolerance is a broadly present phenomenon, arguing for a rather ubiquitous mechanism. Indeed, studies from plants grown at high salinities have shown an increased temperature tolerance and this was attributed to an increased production of osmolytes (Lu et al., 2003; Rivero et al., 2014). These osmolytes serve a dual function to adjust osmoadaptation and to counter ROS produced as a result of high salinity and high temperature (Bose et al., 2014; Hasegawa et al., 2000; Mittler, 2002; Murata et al., 2007), just as we argue the case for floridoside. It is important to note that floridoside might be one of many molecules that link osmoadaptation with thermotolerance in symbiotic cnidarians. As such, we rather argue here for the importance of the mechanistic link between osmoadaptation and thermotolerance, possibly mediated by a number of osmolytes, such as dimethylsulphoniopropionate (DMSP) or amino acids (Mayfield and 77

Gates, 2007; Ochsenkühn et al., 2017; Yancey et al., 2010), rather than for floridoside being unique in its properties.

4.5.2. A new perspective for corals in extreme environments

The extraordinary thermotolerance of corals from the Red Sea and Persian/Arabian Gulf has been demonstrated in a number of studies (Hume et al., 2016; Krueger et al., 2017; Osman et al., 2018). Importantly, D’Angelo et al (2015) showed that superior heat tolerance is lost when corals from the Persian/Arabian Gulf are exposed to reduced salinity levels. While this may argue for strong local adaptation to high temperature and the exceptionally high salinity in the PAG, it may also, at least partially, relate to the here demonstrated link between salinity and thermotolerance. This is further supported by the higher heat tolerance of corals in the northern Red Sea (Osman et al., 2018) and the Gulf of Aqaba (Fine et al., 2013), in comparison to their central and southern Red Sea counterparts, in line with the northern Red Sea harboring much higher salinity levels (≥ 41) than the central and southern counterparts (36) (Ngugi et al., 2012). As such, it remains to be determined whether salinity levels may affect the stress resilience of corals on a global scale. Notably, our results highlight the complexity of interactions underlying holobiont resilience. Besides algal endosymbionts, other microbiome members such as bacteria and archaea should also be taken into account, as they may rapidly respond to salinity (Röthig et al., 2016) and may contribute to the thermotolerance of the coral holobiont (Ziegler et al., 2017).

4.6. Conclusion

Recent work showing reduced bleaching at high salinities and high levels of floridoside, an osmolyte with antioxidative capabilities, at high salinities, encouraged us to assess a link between osmoadaptation and thermotolerance in symbiotic cnidarians. Exposing the coral model Aiptasia to heat at different salinities confirms increased thermotolerance and reduced bleaching at high salinity, manifested by reduced ROS leakage. The decrease of ROS leakage followed increased levels of the ROS-scavenging osmolyte floridoside under increasing salinities, thus, arguing for a mechanistic link between osmoadaptation and thermotolerance in the cnidarian-dinoflagellate endosymbiosis. We could corroborate increased thermotolerance and floridoside levels at high salinity across a broad taxonomic range of Red Sea corals. Our results may thus help explain the extraordinarily high thermotolerance of corals from the Arabian Seas and may hold implications about the response of corals to rising sea surface temperatures considering salinity as a contributing factor. Future studies should assess whether salinity-conveyed thermotolerance is a universally present mechanism in corals worldwide and whether or which other osmolytes may be important and play a role in salinity-conveyed thermotolerance.

4.6.1. Acknowledgements

Research reported in this publication was funded by the King Abdullah University of Science and Technology and the Colombian-German Center of Excellence in Marine Sciences (CEMarin). We thank the CMOR, ACL, BCL core labs for assistance with aquaria experiments, GC-MS measurements, and flow cytometry. In particular, we would like to thank Zenon Batang, Paul Muller, and Nabeel Alikunhi for their expertise in closed aquarium systems; Najeh Kharbatia for his technical advice at the GC-MS system; Luke Esau for his support with the cell analyzer. 79

4.7. References

Albright, R., Caldeira, L., Hosfelt, J., Kwiatkowski, L., Maclaren, J. K., Mason, B. M., Nebuchina, Y., Ninokawa, A., Pongratz, J., Ricke, K. L., et al. (2016). Reversal of ocean acidification enhances net coral reef calcification. Nature 531, 362–365.

Bellworthy, J. and Fine, M. (2017). Beyond peak summer temperatures, branching corals in the Gulf of Aqaba are resilient to thermal stress but sensitive to high light. Coral Reefs 36, 1071–1082.

Bieri, T., Onishi, M., Xiang, T., Grossman, A. R. and Pringle, J. R. (2016). Relative contributions of various cellular mechanisms to loss of algae during cnidarian bleaching. PLoS One 11, e0152693.

Bose, J., Rodrigo-Moreno, A. and Shabala, S. (2014). ROS homeostasis in halophytes in the context of salinity stress tolerance. J. Exp. Bot. 65, 1241–1257.

Chong, J., Soufan, O., Li, C., Caraus, I., Li, S., Bourque, G., Wishart, D. S. and Xia, J. (2018). MetaboAnalyst 4.0: towards more transparent and integrative metabolomics analysis. Nucleic Acids Res. 46, W486–W494.

Clarke, K. and Gorley, R. (2015). User Manual/Tutorial. PRIMER-E.

Cleves, P. A., Strader, M. E., Bay, L. K., Pringle, J. R. and Matz, M. V. (2018). CRISPR/Cas9-mediated genome editing in a reef-building coral. Proc. Natl. Acad. Sci. 115, 5235–5240.

Cziesielski, M. J., Liew, Y. J., Cui, G., Schmidt-Roach, S., Campana, S., Marondedze, C. and Aranda, M. (2018). Multi-omics analysis of thermal stress 80

response in a zooxanthellate cnidarian reveals the importance of associating with thermotolerant symbionts. Proc. R. Soc. B Biol. Sci. 285,.

D’Angelo, C., Hume, B. C. C., Burt, J., Smith, E. G., Achterberg, E. P. and Wiedenmann, J. (2015). Local adaptation constrains the distribution potential of heat-tolerant Symbiodinium from the Persian/Arabian Gulf. ISME J. 9, 2551–2560.

Fine, M., Gildor, H. and Genin, A. (2013). A coral reef refuge in the Red Sea. Glob. Chang. Biol. 19, 3640–3647.

Gegner, H. M., Ziegler, M., Rädecker, N., Buitrago-López, C., Aranda, M. and Voolstra, C. R. (2017). High salinity conveys thermotolerance in the coral model Aiptasia. Biol. Open 6, 1943–1948.

Hasegawa, P. M., Bressan, R. A., Zhu, J.-K. and Bohnert, H. J. (2000). Plant cellular and molecular responses to high salinity. Annu. Rev. Plant Physiol. Plant Mol. Biol. 51, 463–499.

Hoegh-Guldberg, O. (1999). Climate change, coral bleaching and the future of the world’s coral reefs. Mar. Freshw. Res. 50, 839–866.

Hughes, T. P., Barnes, M. L., Bellwood, D. R., Cinner, J. E., Cumming, G. S., Jackson, J. B. C., Kleypas, J., Van De Leemput, I. A., Lough, J. M., Morrison, T. H., et al. (2017a). Coral reefs in the Anthropocene. Nature 546, 82–90.

Hughes, T. P., Kerry, J. T., Álvarez-Noriega, M., Álvarez-Romero, J. G., Anderson, K. D., Baird, A. H., Babcock, R. C., Beger, M., Bellwood, D. R., Berkelmans, R., et al. (2017b). Global warming and recurrent mass bleaching of corals. Nature 543, 373–377.

Hume, B., D’Angelo, C., Burt, J., Baker, A. C., Riegl, B. and Wiedenmann, J. (2013). Corals from the Persian/Arabian Gulf as models for thermotolerant reef- builders: Prevalence of clade C3 Symbiodinium, host fluorescence and ex situ temperature tolerance. Mar. Pollut. Bull. 72, 313–322. 81

Hume, B. C. C., D’Angelo, C., Smith, E. G., Stevens, J. R., Burt, J. and Wiedenmann, J. (2015). Symbiodinium thermophilum sp. nov., a thermotolerant symbiotic alga prevalent in corals of the world’s hottest sea, the Persian/Arabian Gulf. Sci. Rep. 5, 8562.

Hume, B. C. C., Voolstra, C. R., Arif, C., D’Angelo, C., Burt, J. A., Eyal, G., Loya, Y. and Wiedenmann, J. (2016). Ancestral genetic diversity associated with the rapid spread of stress-tolerant coral symbionts in response to Holocene climate change. Proc. Natl. Acad. Sci. 113, 4416–4421.

Krediet, C. J., DeNofrio, J. C., Caruso, C., Burriesci, M. S., Cella, K. and Pringle, J. R. (2015). Rapid, precise, and accurate counts of symbiodinium cells using the guava flow cytometer, and a comparison to other methods. PLoS One 10, 1–19.

Krueger, T., Horwitz, N., Bodin, J., Giovani, M. E., Escrig, S., Meibom, A. and Fine, M. (2017). Common reef-building coral in the northern red sea resistant to elevated temperature and acidification. R. Soc. Open Sci. 4, 170038.

LaJeunesse, T. C., Parkinson, J. E., Gabrielson, P. W., Jeong, H. J., Reimer, J. D., Voolstra, C. R. and Santos, S. R. (2018). Systematic Revision of Symbiodiniaceae Highlights the Antiquity and Diversity of Coral Endosymbionts. Curr. Biol. 1–11.

Lesser, M. P. (1997). Oxidative stress causes coral bleaching during exposure to elevated temperatures. Coral Reefs 16, 187–192.

Lesser, M. P. (2011). Coral bleaching: Causes and mechanisms. In Coral Reefs: An Ecosystem in Transition, pp. 405–419. Dordrecht: Springer Netherlands.

Li, Y. X., Li, Y., Lee, S. H., Qian, Z. J. I. and Kim, S. E. K. (2010). Inhibitors of oxidation and matrix metalloproteinases, floridoside, and D-Lsofloridoslde from marine red alga laurencia undulata. J. Agric. Food Chem. 58, 578–586.

Liew, Y. J., Zoccola, D., Li, Y., Tambutte, E., Venn, A. A., Michell, C. T., Cui, G., Deutekom, E. S., Kaandorp, J. A., Voolstra, C. R., et al. (2018). Epigenome- associated phenotypic acclimatization to ocean acidification in a reef-building coral. 82

Sci. Adv. 4,.

Lu, C., Qiu, N., Wang, B. and Zhang, J. (2003). Salinity treatment shows no effects on photosystem II photochemistry, but increases the resistance of photosystem II to heat stress in halophyte Suaeda salsa. J. Exp. Bot. 54, 851–860.

Martinez-Garcia, M. and van der Maarel, M. J. E. C. (2016). Floridoside production by the red microalga Galdieria sulphuraria under different conditions of growth and osmotic stress. AMB Express 6, 0–7.

Matthews, J. L., Sproles, A. E., Oakley, C. A., Grossman, A. R., Weis, V. M. and Davy, S. K. (2016). Menthol-induced bleaching rapidly and effectively provides experimental aposymbiotic sea anemones (Aiptasia sp.) for symbiosis investigations. J. Exp. Biol. 219, 306–310.

Mayfield, A. B. and Gates, R. D. (2007). Osmoregulation in anthozoan-dinoflagellate symbiosis. Comp. Biochem. Physiol. - A Mol. Integr. Physiol. 147, 1–10.

Mittler, R. (2002). Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7, 405–410.

Murata, N., Takahashi, S., Nishiyama, Y. and Allakhverdiev, S. I. (2007). Photoinhibition of photosystem II under environmental stress. Biochim. Biophys. Acta - Bioenerg. 1767, 414–421.

Muscatine, L. and Porter, J. W. (1977). Reef Corals: Mutualistic Symbioses Adapted to Nutrient-Poor Environments. Bioscience 27, 454–460.

Ngugi, D. K., Antunes, A., Brune, A. and Stingl, U. (2012). Biogeography of pelagic bacterioplankton across an antagonistic temperature-salinity gradient in the Red Sea. Mol. Ecol. 21, 388–405.

Nielsen, D. A., Petrou, K. and Gates, R. D. (2018). Coral bleaching from a single cell perspective. ISME J. 12, 1558–1567. 83

Osman, E. O., Smith, D. J., Ziegler, M., Kürten, B., Conrad, C., El-Haddad, K. M., Voolstra, C. R. and Suggett, D. J. (2018). Thermal refugia against coral bleaching throughout the northern Red Sea. Glob. Chang. Biol. 24, e474–e484.

Pade, N., Linka, N., Ruth, W., Weber, A. P. M. and Hagemann, M. (2015). Floridoside and isofloridoside are synthesized by trehalose 6-phosphate synthase- like enzymes in the red alga Galdieria sulphuraria. New Phytol. 205, 1227–1238.

Pogoreutz, C., Rädecker, N., Cárdenas, A., Gärdes, A., Voolstra, C. R. and Wild, C. (2017). Sugar enrichment provides evidence for a role of nitrogen fixation in coral bleaching. Glob. Chang. Biol. 23, 3838–3848.

Rädecker, N., Raina, J. B., Pernice, M., Perna, G., Guagliardo, P., Kilburn, M. R., Aranda, M. and Voolstra, C. R. (2018). Using Aiptasia as a model to study metabolic interactions in Cnidarian-Symbiodinium symbioses. Front. Physiol. 9,.

Rivero, R. M., Mestre, T. C., Mittler, R., Rubio, F., Garcia-Sanchez, F. and Martinez, V. (2014). The combined effect of salinity and heat reveals a specific physiological, biochemical and molecular response in tomato plants. Plant, Cell Environ. 37, 1059–1073.

Tambutté, E., Venn, A. A., Holcomb, M., Segonds, N., Techer, N., Zoccola, D., Allemand, D. and Tambutté, S. (2015). Morphological plasticity of the coral

skeleton under CO2 driven seawater acidification. Nat. Commun. 6,.

Tolleter, D., Seneca, F. O., Denofrio, J. C., Krediet, C. J., Palumbi, S. R., Pringle, J. R. and Grossman, A. R. (2013). Coral bleaching independent of photosynthetic 84

activity. Curr. Biol. 23, 1782–1786.

Torda, G., Donelson, J. M., Aranda, M., Barshis, D. J., Bay, L., Berumen, M. L., Bourne, D. G., Cantin, N., Foret, S., Matz, M., et al. (2017). Rapid adaptive responses to climate change in corals. Nat. Clim. Chang. 7, 627–636.

Voolstra, C. R. (2013). A journey into the wild of the cnidarian model system Aiptasia and its symbionts. Mol. Ecol. 22, 4366–4368.

Weis, V. M. (2008). Cellular mechanisms of Cnidarian bleaching: stress causes the collapse of symbiosis. J. Exp. Biol. 211, 3059–3066.

Xiang, T., Hambleton, E. A., Denofrio, J. C., Pringle, J. R. and Grossman, A. R. (2013). Isolation of clonal axenic strains of the symbiotic dinoflagellate Symbiodinium and their growth and host specificity1. J. Phycol. 49, 447–458.

Ziegler, M., Roder, C. M., Büchel, C. and Voolstra, C. R. (2014). Limits to physiological plasticity of the coral Pocillopora verrucosa from the central Red Sea. Coral Reefs 33, 1115–1129.

Ziegler, M., Seneca, F. O., Yum, L. K., Palumbi, S. R. and Voolstra, C. R. (2017). Bacterial community dynamics are linked to patterns of coral heat tolerance. Nat. Commun. 8, 1–8.

4.8. Supplementary Material

4.8.1. Supplementary Figures

Figure S4. Effect of different salinities on heat stress-induced bleaching of H2 and CC7 Aiptasia anemones. (A) Algal endosymbiont densities of host-endosymbiont pairings at ambient (dashed bars) and heat stress (solid bars) temperatures at low (36), intermediate (39), and high (42) salinity. Different letters above bars indicate significant differences between groups (Tukey post-hoc, p < 0.05). (B) Light-adapted photosynthetic efficiency over the period of the experiment. Dashed lines depict animals at ambient (control) temperature (25 °C); solid lines depict animals under heat stress (34 °C). The faded blue line indicates the days for which a robust measurement could only be retrieved from 2 of 12 animals. Different letters indicate significant differences between salinity and temperature treatments after 6 days of experiment (non- parametric, Steel-Dwass, p < 0.05). (C) Pictures of representative symbiotic and aposymbiotic anemones at ambient (Control) and heat stress temperature (Heat) across different salinities after 6 days of the experiment. 87

Figure S5. Multidimensional scaling (MDS) plots of H2 and CC7 Aiptasia anemones at ambient (Control) and heat stress (Heat) temperatures at low (36), intermediate (39), and high (42) salinity. PERMANOVA was used to test for significant difference between anemone hosts (H2 and CC7), symbiotic states (H2-SSB01 vs. H2-aposymbiotic and CC7-SSA01 vs. CC7- aposymbiotic), and interactions thereof (Host x State); p-values are provided in bottom-right of each panel.

Figure S6. Metabolite levels of aposymbiotic H2 and CC7 Aiptasia anemones. Heatmaps show metabolites levels at ambient (Control) and heat stress (Heat) temperatures at low (36), intermediate (39), and high (42) salinities. Levels of metabolites were not significantly different across salinities and temperatures for each host anemone (2-Way ANOVAs, all p > 0.05). 89

4.8.2. Supplementary Tables

Table S5. Statistical test results on retained algal endosymbionts normalized to host protein (1-Way ANOVA). The purpose was to test for a significant effect of low (36), intermediate (39), and high (42) salinities in (A) H2-SSB01 and (B) CC7-SSA01. To elucidate significant differences, a pairwise Tukey post-hoc test was conducted for H2-SSB01. Bold values indicate p < 0.05.

(A) H2-SSB01

Source of variation DF Sum of squares F p-Value Between groups 2 10308.850 5.188 0.024 Within groups 12 11922.239 Total 14 22231.090

Tukey post-hoc

Comparison Score Mean Difference p-Value Sal39 Sal36 26.482 0.407 Sal42 Sal36 63.904 0.019 Sal42 Sal39 37.421 0.188

(B) CC7-SSA01

Source of variation DF Sum of squares F p-Value Between groups 2 539.124 2.708 0.120 Within groups 9 895.740 Total 11 1434.864

Table S6. Statistical test results on algal endosymbiont density (2-Way ANOVA). The purpose was to test for a significant difference between ambient (25 °C) and heat stress (34 °C) temperatures at low (36), intermediate (39), and high (42) salinities in (A) H2-SSB01 and (B) CC7-SSA01. To elucidate significant differences, a pairwise Tukey post-hoc test was conducted for H2-SSB01. Bold values indicate p < 0.05.

(A) H2-SSB01

Source of variation DF Sum of squares F p-Value Salinity (Sal) 2 4.011e+12 2.689 0.088 Temperature (Temp) 1 2.920e+13 39.139 <0.001 Sal x Temp 2 5469e+12 3.665 0.041

Tukey post-hoc

Comparison Score Mean Difference p-Value Sal39, Temp25 Sal36, Temp34 3283344 <0.001 Sal36, Temp25 Sal36, Temp34 2810596 <0.001 Sal42, Temp25 Sal36, Temp34 2624302 <0.001 Sal39, Temp25 Sal39, Temp34 2307722 0.004 Sal36, Temp25 Sal39, Temp34 1834974 0.028 Sal42, Temp34 Sal36, Temp34 1823430 0.029 Sal42, Temp25 Sal39, Temp34 1648680 0.059 Sal39, Temp25 Sal42, Temp34 1459914 0.118 Sal36, Temp25 Sal42, Temp34 987166 0.480 Sal39, Temp34 Sal36, Temp34 975622 0.493 Sal42, Temp34 Sal39, Temp34 847808 0.636 Sal42, Temp25 Sal42, Temp34 800872 0.688 Sal39, Temp25 Sal42, Temp25 659042 0.829 Sal39, Temp25 Sal36, Temp25 472748 0.951 Sal36, Temp25 Sal42, Temp25 186294 0.999

(B) CC7-SSA01

Source of variation DF Sum of squares F p-Value Salinity (Sal) 2 7.876e+11 1.467 0.257 Temperature (Temp) 1 9.322e+12 34.719 <0.001 Sal x Temp 2 6.535e+11 1.217 0.319

Table S7. Statistical test results on light-adapted photosynthetic efficiency (∆Fv/Fm’) (non- parametric Steel-Dwass). The purpose was to test for a significant difference between ambient (25 °Ç) and heat stress (34 °C) temperatures at low (36), intermediate (39), and high (42) salinities on the last day of the experiment in (A) H2-SSB01 and (B) CC7-SSA01. Bold values indicate p < 0.05.

(A) H2-SSB01

Comparison Score Mean Difference p-Value Temp34, Sal42 Temp34, Sal36 10.583 0.002 Temp34, Sal39 Temp34, Sal36 9.417 0.011 Temp25, Sal42 Temp25, Sal36 4.917 0.530 Temp34, Sal42 Temp34, Sal39 3.667 0.801 Temp25, Sal39 Temp25, Sal36 2.917 0.915 Temp25, Sal42 Temp25, Sal39 1.750 0.991 Temp34, Sal39 Temp25, Sal36 -11.750 <0.001 Temp34, Sal36 Temp25, Sal36 -11.917 <0.001 Temp34, Sal36 Temp25, Sal39 -11.917 <0.001 Temp34, Sal36 Temp25, Sal42 -11.917 <0.001 Temp34, Sal39 Temp25, Sal39 -11.917 <0.001 Temp34, Sal39 Temp25, Sal42 -11.917 <0.001 Temp34, Sal42 Temp25, Sal36 -11.917 <0.001 Temp34, Sal42 Temp25, Sal39 -11.917 <0.001 Temp34, Sal42 Temp25, Sal42 -11.917 <0.001

(B) CC7-SSA01

Comparison Score Mean Difference p-Value Temp34, Sal39 Temp34, Sal36 11.917 <0.001 Temp34, Sal42 Temp34, Sal36 11.917 <0.001 Temp25, Sal42 Temp25, Sal36 6.667 0.189 Temp25, Sal39 Temp25, Sal36 4.333 0.663 Temp34, Sal42 Temp34, Sal39 3.500 0.831 Temp25, Sal42 Temp25, Sal39 2.083 0.979 Temp34, Sal42 Temp25, Sal39 -6.417 0.225 Temp34, Sal39 Temp25, Sal36 -8.417 0.041 Temp34, Sal42 Temp25, Sal39 -10.000 0.007 Temp34, Sal39 Temp25, Sal39 -10.583 0.003 Temp34, Sal42 Temp25, Sal42 -11.000 0.002 Temp34, Sal36 Temp25, Sal36 -11.667 <0.001 Temp34, Sal36 Temp25, Sal39 -11.917 <0.001 Temp34, Sal36 Temp25, Sal42 -11.917 <0.001 Temp34, Sal39 Temp25, Sal42 -11.917 <0.001

Table S8. Statistical test results on the relative change of ROS leakage per algal endosymbiont cell (1-Way ANOVA). The purpose was to test for a significant difference across low (36), intermediate (39), and high (42) salinities for (A) SSB01 and (B) SSA01. To elucidate significant differences, a pairwise Tukey post-hoc test was conducted for SSB01. Bold values indicate p < 0.05.

(A) SSB01

Source of variation DF Sum of squares F p-Value Between groups 2 6.607 12.056 <0.001 Within groups 14 3.836 Total 16 10.443

Tukey post-hoc

Comparison Score Mean Difference p-Value Sal39 Sal36 -0.745 0.081 Sal42 Sal36 -1.552 <0.001 Sal42 Sal39 -0.807 0.045

(B) SSA01

Source of variation DF Sum of squares F p-Value Between groups 2 0.025 0.801 0.468 Within groups 14 0.218 Total 16 0.243

Table S9. Statistical test results on the composition of Aiptasia metabolite profiles (PERMANOVA). The purpose was to test for a significant difference between low (36), intermediate (39), and high (42) salinities at (A) ambient (25 °C) and (B) heat stress (34 °C) temperatures considering the factors host (H2 and CC7) and symbiotic state (symbiotic, aposymbiotic). Bray–Curtis dissimilarity and 999 permutations were used for this analysis. Bold values indicate p < 0.05.

(A) Ambient temperature (25°C)

Salinity 36 DF Sum of squares Pseudo-F p-Value Host 1 814.040 2.652 0.016 State 1 2558.700 8.337 0.002 Host x State 1 2099.500 6.801 0.001

Salinity 39 DF Sum of squares Pseudo-F p-Value Host 1 2676.900 7.589 0.001 State 1 3728.300 10.570 0.002 Host x State 1 1990.900 5.644 0.003

Salinity 42 DF Sum of squares Pseudo-F p-Value Host 1 1589.900 1.773 0.077 State 1 1504.200 1.678 0.096 Host x State 1 1926.600 2.149 0.039

(B) Heat stress (34°C)

Salinity 36 DF Sum of squares Pseudo-F p-Value Host 1 1649.500 3.137 0.004 State 1 1775.500 3.377 0.025 Host x State 1 669.120 1.273 0.281

Salinity 39 DF Sum of squares Pseudo-F p-Value Host 1 1158.000 2.131 0.045 State 1 3078.800 5.666 0.002 Host x State 1 988.550 1.819 0.110

Salinity 42 DF Sum of squares Pseudo-F p-Value Host 1 1903.600 2.460 0.034 State 1 3997.500 5.165 0.005 Host x State 1 1044.900 1.350 0.201 97

Table S10. Statistical test results on metabolite levels (2-Way ANOVA). The purpose was to test for a significant difference between ambient (25 °C) and heat stress (34 °C) temperatures at low (36), intermediate (39), and high (42) salinities in (A) H2-SSB01 and (B) CC7-SSA01. Reported are only significant metabolites. Bold values indicate FDR- corrected p < 0.05.

(A) H2-SSB01

Temperature Salinity Interaction Metabolite F p-Value F p-Value F p-Value D-Glucose 41.821 <0.001 2.754 0.171 4.913 0.147 L-Threitol 13.876 0.026 6.259 0.042 5.938 0.147 Oleic acid 7.245 0.085 7.539 0.042 4.117 0.151 Palmitelaidic acid 2.402 0.369 6.364 0.042 5.518 0.147 Floridoside 2.236 0.370 7.114 0.042 0.917 0.507 1-O-hexadecylglycerol 1.599 0.472 10.408 0.034 4.777 0.147 23H-Furanone 0.017 0.923 8.384 0.042 3.209 0.164 Hexadecanoic acid 0.010 0.923 6.437 0.042 3.19 0.164

(B) CC7-SSA01

Temperature Salinity Interaction Metabolite F p-Value F p-Value F p-Value D-Glucose 16.855 0.030 1.330 0.837 4.572 0.180 Arachidonic acid 8.383 0.122 5.047 0.337 13.057 0.008 L-Threonic acid 4.323 0.270 6.204 0.337 14.364 0.008

Table S11. Statistical test results on floridoside levels for H2 Aiptasia anemones (Kruskal- Wallis). The purpose was to test for a significant difference between low (36), intermediate (39), and high (42) salinities at (A) ambient (25 °C) and (B) heat stress (34 °C) temperatures. Bold values indicate p < 0.05.

(A) Ambient temperature (25°C)

Comparison Score Mean Difference p-Value Sal42 Sal36 3.750 0.029 Sal39 Sal36 3.250 0.059 Sal42 Sal39 1.250 0.471

(B) Heat stress (34°C)

Comparison Score Mean Difference p-Value Sal42 Sal36 3.750 0.021 Sal39 Sal36 3.750 0.021 Sal42 Sal39 3.250 0.061

Table S12. Statistical test results on (A) algal endosymbiont density and (B) floridoside level under heat stress (34°C) in corals (Kruskal-Wallis). The purpose was to test for a significant difference between low (36) and high (42) salinity at heat stress (34 °C) across coral species. Bold values indicate p < 0.05.

(A) Algal endosymbiont density

Comparison Score Mean Difference p-Value Sal42 Sal36 4.833 0.020

(B) Floridoside level

Comparison Score Mean Difference p-Value Sal42 Sal36 4.167 0.045

All supplementary data files are listed in 7. APPENDIX. 100

CHAPTER III

5. Insights into bacterial Community changes following Heat and Salinity Treatments in Aiptasia

Janna Randle1, Anny Cardenás1, Maren Ziegler2, Hagen M Gegner1, Christian R Voolstra1

1Red Sea Research Center, Division of Biological and Environmental Science and Engineering (BESE), King Abdullah University of Science and Technology (KAUST), Saudi Arabia

2Department of Animal Ecology & Systematics, Justus-Liebig-University, Giessen, Germany

This manuscript is currently in preparation, a pdf version can be found in the Supporting Material (see Supplementary File S8, in 7. APPENDIX).

Author contributions:

CRV and HMG conceived and designed the experiment; CRV, HMG and MZ contributed reagents/materials/tools; JR generated the data; JR, AC and CRV analyzed the data; JR and CRV wrote the manuscript. 101

5.1. Abstract

Background: Coral bleaching, i.e. the loss of photosynthetic algal symbionts, caused by ocean warming is now the main factor driving reef decline, but not all corals are affected equally. Thus, it becomes important to understand the factors that contribute to thermal tolerance. For instance, corals around the Arabian Seas harbor unusually high temperature thresholds, and recently studies implicated salinity as one of the contributing factors. In a heat stress experiment at different salinities using the model system Aiptasia and Red Sea corals, we could show that cnidaria at large bleach less at heat stress under high salinities and that this is associated with an increase of the osmolyte floridoside. Here we were interested to assess microbial community changes under heat stress at different salinity levels and whether this could help to explain the increase in thermal tolerance of the metaorganism at high salinities. Results: We determined microbial community composition via HiSeq 16S rRNA gene amplicon sequencing of two anemone strains that differ in their associated symbionts, namely H2-SSB01 (type B1) and CC7-SSA01 (type A4), after 6 days under ambient (25°C) and heat stress (34°C) temperatures at salinities of 36, 39, and 42. Both anemones harbored distinct microbial communities, irrespective of temperature or salinity, that were also different from the bacteria in surrounding seawater. Within both host-endosymbiont pairings, the bacterial community composition at low (36) and intermediate (39) salinities did not differ between ambient and heat stress, but was significantly different at high (42) salinities. Subsequent elucidation of bacterial indicator species revealed several taxa that could be associated with a response to salinity/temperature. Conclusions: Our results underline that microbial community composition adjusts under different environmental settings. Importantly, microbial community dynamics of H2 aligned with observed differences in bleaching susceptibility and thermal tolerance, whereas the pattern remains somewhat obscure for CC7, which harbors an intrinsically higher thermal tolerance. Such responses could argue for a contribution of the microbiome to the observed increase in temperature tolerance of the metaorganism at increased salinities. An alternative interpretation is that the microbiome changes denotes a parallel response to changing salinities.

102

5.2. Introduction

Corals are keystone species, which through the capacity of calcium carbonate production, provide the three-dimensional structures to form among the most biodiverse ecosystems on Earth (Knowlton et al., 2010). The importance of coral reefs is extensive, ranging from ecological importance by means of high productivity, to economic importance through supporting numerous ecosystem services to humankind (Costanza et al., 2014). Despite this knowledge, reef ecosystems are under global threat, with the predominant factor being ocean warming as influenced by anthropogenic induced climate change. Sea surface temperatures (SSTs) of 1°C above the average summer maxima can provoke coral bleaching i.e. the breakdown of the obligate coral-algal symbiosis and the expulsion of Symbiodiniacaea from the host (LaJeunesse et al., 2018; Muller-Parker, D’Elia, & Cook, 2015; Wild et al., 2011). This phenomenon as signified by the white appearance of the coral host, is a dominant driver of mass bleaching events and thus, the decline of coral reefs at a global scale (Bellwood, et al., 2004; Hughes et al., 2017).

However, this is not the case in all regions of the world, such as in the Red Sea and Persian/Arabian Gulf where corals possess the highest known bleaching thresholds (34- 36°C; Coles, 2003), despite summer maxima SST’s being 2-7°C higher than any other tropical reef globally (29-32°C; Coles & Riegl, 2013). The contrast in such thresholds places an importance in gaining a greater understanding of what factors contribute to thermal tolerance in corals. Previous research has identified adaptation of the coral host to extreme environmental stressors (D’Angelo et al., 2015) and symbiosis with the specialized alga Cladocopium thermophilum (formerly Symbiodinium thermophilum) (Howells et al., 2016; Hume et al., 2016) to be potential factors.

Given that reef corals in the Red Sea and Persian/Arabian Gulf are additionally exposed to the highest natural levels of salinity in any waterbody within the worlds ocean (41 and 50 PSU, respectively; Ngugi, et al., 2012; Riegl & Purkis, 2012), recent research has investigated the direct influence of increased salinity to thermotolerance. In a heat stress experiment at different salinities using the coral model Aiptasia and Red Sea corals, it was shown that higher salinities at large can lead to less bleaching in the cnidarian- dinoflagellate symbiosis (Gegner et al., 2017; Gegner et al., in prep.), and this can be 103 associated with an upregulation of the osmolyte, floridoside (Gegner et al., 2018, in prep.; Ochsenkühn et al., 2017).

Interestingly, the extent of the reduction in bleaching, and the upregulation of floridoside is dependent on host-algal identity. As such, other mechanisms by the host and endosymbionts effecting the direct influence of salinity on thermotolerance need to be considered (Gegner et al., 2017; Gegner et al., 2018, in prep.). In this regard, it is important to consider the coral as a holobiont; besides the cnidarian-animal host and its endosymbiont algae of the family Symbiodinaceae (LaJeunesse et al., 2018), bacteria (among other microbes) are shown to be important to coral holobiont function (Rohwer et al., 2002). Over the past decade there has been a shift in research, with a focus on the dependency of such associated microbes in providing functionality to the animal host, known as the metaorganism concept (McFall-Ngai et al., 2013). Bacteria have been shown to have a large functional capacity, playing important roles in coral health, pathogen defense, metabolism and nutrient cycling (Ainsworth et al., 2015; Bourne et al., 2016; Krediet et al., 2013; Rädecker et al., 2015; Rosenberg et al., 2007). Importantly, bacterial microbiome adaptation within the reproductive lifetime of the coral host may provide another potential mechanism to counteract the effects of environmental change (Torda et al., 2017).

Despite their putative importance, the role of bacteria in holobiont function is still limited, this being essential to determine if beneficial microorganisms for corals in a changing environment are to be identified (Ainsworth & Gates, 2016; Bourne & Webster, 2013; Mouchka et al., 2010; Peixoto et al., 2017; Torda et al., 2017). Bacterial microbiome restructuring has been suggested to play a role in the rapid acclimatization of Fungia granulosa after long-term exposure to high-salinity levels (Röthig et al., 2016), and the adaptation of Acropora hyacinthus to increased thermotolerance (Ziegler et al., 2017). This prompted our interest to assess whether coral-associated bacteria may also play a role in the salinity-conveyed thermotolerance (Fine et al., 2013; Gegner et al., 2017; Gegner et al., 2018, in prep; Osman et al., 2018). 104

Given the difficulties imposed when working with corals (Voolstra, 2013), to begin to assess a potential role of bacteria in salinity-conveyed thermotolerance, the current study utilizes the coral-model system, Aiptasia (sensu Exaiptasia pallida; Grajales & Rodríguez, 2014) (Baumgarten et al., 2015; Weis et al., 2008). Importantly, Aiptasia allows to test different endosymbionts in a common host or vice versa, helping to disentangle the relative contribution of host and symbionts (Grawunder et al., 2015; Rädecker et al., 2018; Voolstra, 2013; Xiang et al., 2013). Further, previous characterizations of Aiptasia associated bacterial communities (Herrera et al., 2017; Röthig et al., 2016) provide a basis to compare the bacterial community changes under temperature and salinity. By assessing the bacterial communities under heat stress at three different salinity treatments in two Aiptasia strains (H2, CC7) associated with their two distinct native endosymbionts (SSA01, SSB01), the current study aims to determine the putative contribution of bacteria to salinity-conveyed thermotolerance.

105

5.3. Materials and Methods

5.3.1. Animal rearing, experimental setup, and sample processing

Symbiotic anemones of the clonal Aiptasia strains H2 (Xiang et al., 2013) and CC7 (Sunagawa et al., 2009) were kept as previously described (Gegner et al., 2017). H2 anemones associated with their native endosymbionts of the family Symbiodiniaceae type B1 [strain SSB01, species Breviolum minutum (Baumgarten et al., 2015; Xiang et al., 2013;LaJeunesse et al., 2018)], referred to as H2-SSB01, and CC7 anemones associated with their native endosymbionts of the family Symbiodiniaceae type A4 [strain SSA01, species Symbiondinium linucheae (Bieri et al., 2016; LaJeunesse et al., 2018)], referred to as CC7-SSA01.

For the experiment, anemones were then kept at 25 °C in three experimental salinities: low (36), intermediate (39) and high (42) for 10 days to acclimate. A total of 54 anemones were used in this study that represent a subset of the experimental anemones from Gegner et al. 2018, (in prep.). (H2; 5 animals, *3 salinities, *2 temperatures = 30 anemones, CC7; 4 animals, *3 salinities, *2 temperatures = 24 anemones). Animals per host-pairing and salinity and temperature treatment were put in individual wells of 6-well plates (water volume of 7ml), wrapped in a see-through plastic bag containing wet wipes to minimize evaporation. Salinities were monitored throughout the entire experiment using a refractometer (Aqua Medic GmbH, Germany). Wells were cleaned every second day with a cotton-swap and the water was exchanged. Feeding was ceased with the beginning of the acclimation. The experimental salinities were achieved by using autoclaved Red Sea seawater diluted with ddH2O to the lowest salinity (36) and then subsequently adjusted with NaCl until the desired salinities were reached. For the water samples, 1L of each created salinity was filtered through a 0.22µm Durapore PVDF filter (Millipore, Billerica, MA, USA), and subsequently frozen at -80°C.

After the acclimation phase half of the anemones were subjected to a heat stress experiment. The anemones were moved to another incubator with identical settings and the temperature was ramped from 25 °C to 34 °C over the course of 10 h (1 °C h−1 increment). For the entire time of the heat stress the temperature remained at 34 °C. The 106 experiment was terminated for all host-pairings after 6 days when the anemones of H2- SSB01 in the lowest salinity (36) appeared completely bleached visually, i.e. translucent.

Individual Aiptasia were rinsed twice with ddH2O, briefly drained of excess water, transferred into 1.5mL microtubes containing 150µL PBS buffer, homogenized for 10s using a MicroDisTec homogenizer 125 (ThermoFisher Scientific), and stored in -80°C until further processing.

5.3.2. DNA Extraction and 16S rRNA Gene Sequencing

Each sample was thawed on ice, 400µL AP1 buffer was added and extractions were performed using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). For bacterial DNA isolation from the seawater, each PVDF filter was thawed, divided into three parts using sterile razorblades and transferred into 2mL microtubes. 400µL of AP1 buffer was added and the microtubes were incubated on a rotating wheel for 20 minutes. DNA was extracted following the manufacturer’s instructions (DNeasy Plant Mini Kit, Qiagen). For all samples, DNA concentrations were quantified on a NanoDrop 2000C spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). To generate 16S rRNA gene amplicons for sequencing on the Illumina HiSeq Platform, primers 784F [5′ - TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAGGATTAGATACCCTGGTA - ′3] and 1061R [5′ - GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCRRCACGAGCTGACGAC - ′3] were used to identify and amplify the variable region 5 and 6 of the 16S rRNA gene (Andersson et al., 2008). Primers contained Illumina (San Diego CA USA) adaptor overhangs (underlined above). Triplicate PCRs were performed using the Qiagen Multiplex PCR kit. For each sample, the final reaction volume was 10µL, comprising of 1µL of template DNA (3-10 ng) and a primer concentration of 0.5µM. In the last three wells of the PCR plate, no template DNA was added (i.e. negative controls) in order to test for unspecific amplification and reagents contamination. PCR conditions were as follows: One initial polymerase activation and denaturation cycle at 95°C for 15 minutes, 30 cycles each at 95°C for 30 seconds, 55°C for 90s, and 72°C for 30 seconds, 107 respectively, followed by final elongation step at 72°C for 10 minutes. The first of the triplicate PCRs was visually assessed via 1% agarose gel electrophoresis (5µL). Triplicate PCRs for each sample were pooled and subsequently cleaned with the ExoProStar 1-Step PCR followed by the Sequence Reaction Clean-up Kit (GE Healthcare, Buckinghamshire, UK). Next, indexing was performed using Nextera XT adapter sequences (Illumina) according to the manufacturer’s instructions. Indexed PCR products were purified using the Invitrogen SequalPrep Normalization Plate (96) Kit (Thermo Fisher Scientific, Carlsbad, CA, USA), involving elution in 20µl of buffer at normalized concentrations (~4nM), and pooling in equimolar ratios. Pooled PCR amplicons were quality checked on the BioAnalyzer (Agilent Technologies, Santa Clara, CA, USA) for presence of primer dimers. The library was sequenced at 8pM with 10% phiX on the Illumina HiSeq, 2 X 250 bp paired-end volume 3 chemistry according to the manufacture’s specifications.

5.3.3. Data analysis

The sequence data set comprised ~12 million paired sequence reads (200,000 per sample). For amplicon editing and analysis the software mothur (version 1.39.5; Schloss et al., 2009) was used. Sequences were demultiplexed according to barcodes and paired reads were assembled into contigs. Contigs were quality trimmed by removing any with a Q value > 30, and any with ambiguously called bases. 5,391,581 singletons (i.e. sequences that occurred only once over all samples) were discarded. Remaining sequences were aligned against the SILVA database (release 119; Pruesse et al., 2007). A pre-clustering step, allowing for a 3 base pair difference between sequences (Huse et al., 2010) was performed, and chimeras were detected, and subsequently removed using the UCHIME interface within mothur (Edgar et al., 2011). Additionally, sequences assigned to chloroplast, mitochondria, archaea, eukaryotes, unknown and other unwanted sequences were excluded. The remaining sequences (~6 million, 100,000 per sample) were classified against Greengenes database (release gg_13_5_99) using a 60% bootstrap cutoff (McDonald et al., 2012). For further analysis, sequences were clustered into Operational Taxonmic Units (OTU’s) using a <0.03 dissimilarity cutoff. 108

Sequence data determined in the negative controls was used to compute a ratio of SUM of the negative controls to the SUM of all in each sample for every given OTU. If the value was > 10%, the OTU’s were filtered and removed from the sequence data set (143 contaminants removed). From the remaining 2812 OTU’s, alpha diversity measures [i.e., Chao1 (Chao, 1984), Shannon diversity (Shannon 1948), Simpson’s diversity (D), Inverse Simpson and Simpson evenness (Simpson, 1949)] were implemented in Vegan (R package). Non-metric Multidimensional Scaling (nMDS) based on Bray-Curtis distances was conducted on standardized OTU abundance counts, using PRIMER v6 software (PRIMER-E Ltd, Ivybridge, UK; Clarke & Gorley, 2006), to visualize differences between “water samples” and “host-endosymbiont pairings” (2 levels: H2- SSB01, CC7-SSA01). Differences in microbial communities between water samples and the two host-endosymbiont pairings were tested using ANOSIM with 9,999 permutations. Stack column plots in R (R Core Team, 2014) were created to assess condition-specific differences in the bacterial community composition of samples at a family level. The effect of salinity and temperature on H2-SSB01 and CC7-SSA01 was visualized in a Principle Coordinate Analysis (PCoA) based on a Bray-Curtis dissimilarity matrix and Pearson correlation (PRIMER). For samples of each host-endosymbiont pairing, a two- factorial PERMANOVA was run with the factors “temperature” (2 levels: 25, 34),” salinity” (3 levels: 36, 39, 42), a possible interaction effect “temperature * salinity” (fully crossed) and followed by pair-wise tests to denote where significant differences occurred within each factor (PRIMER; Clarke & Gorley 2006).

To determine bacterial taxa that contribute to differences between salinities at the ambient temperature and heat stress for each host-endosymbiont pairing, a similarity percentages (SIMPER) analysis was performed using R (R Core Team, 2014). The analysis was conducted considering the OTU’s that contributed to 50% of the cumulative differences for all pairwise comparisons, and the corresponding resemblance matrix was based on Bray-Curtis dissimilarity. Data was Logx+1 transformed and normalized by sequencing depth (sums). Thereafter, the SIMPER output was visualized by creating heat maps using Pearson correlation coefficient to cluster OTU relative abundances averaged per treatment. The representative sequence of each significant OTU was then BLASTed 109 against NCBI’s GenBank nr database to identify identical or highly similar bacteria which had occurred previously.

Functional profiling based on the 16S community composition (OTU taxonomy and abundance) of the anemones was assessed with METAGENassist; automated taxonomic- to-phenotypic mapping (Arndt et al., 2012). The analysis was separated into four, considering the two host-endosymbiont pairings under the ambient and heat stress temperature. Input files were created using the ‘make.shared’ and ‘classify.otu’ commands in mothur. During the data processing, all distinct 2812 OTU’s were assigned, mapped, condensed into 1005 (± 18) functional taxa. After filtering based on the interquartile range (Hackstadt & Hess, 2009), the remaining 121 (±31) functional taxa were normalized across samples by sum. The dataset was analyzed for “metabolism by phenotype” using a Kruskal-Wallis rank sum test, and the subsequent matrices for significant functions (P < 0.05) were downloaded to construct boxplots in R (R Core Team, 2014). 110

5.4. Results

5.4.1. Distinct bacterial community compositions of seawater and Aiptasia anemones

As shown by Gegner et al. (2017), H2-SSB01 and CC7-SSA01 exhibited differential bleaching susceptibility under heat stress at different salinities; H2-SSB01 were notably bleached at the normal salinity, yet significantly retained more Symbiodinaceae at intermediate and high salinities, while CC7-SSA01 showed no changes in bleaching susceptibility (uniform Symbiodinaceae pigmentation) across all three salinities. Here we sought to investigate microbial community dynamics and the potential contribution of bacteria to the differences in the patterns observed. For this reason, we conduced 16S rRNA gene amplicon sequencing of H2-SSB01 and CC7-SSA01 anemones and their surrounding seawater at heat stress and ambient temperature at low, intermediate and high salinities (36, 39, 42, respectively). To assess overall bacterial community composition of seawater and anemones, sequences were classified to the family level and tested for significant differences. The stacked column plot further indicated how markedly different all water samples were from the two host-endosymbiont pairings (Fig. 9). Water samples were dominated by Others (~41-54%), i.e. those families which did not contribute to the top twenty. The bacterial community composition of H2-SSB01 and CC7-SSA01 were different from each other. H2-SSB01 was abundant in Rhodobacteraceae (~19-30%) and Flavobacteriaceae (~11-28%), yet in CC7-SSA01 the greater proportion of reads belonged to Alteromonadales (~10-27%). Interestingly, Spirobacillales was only present in the high salinity when under heat stress in H2-SSB01 (~10%) yet present in CC7-SSA01 regardless of the treatment (5-18%). Differences were confirmed by ANOSIM. Water-associated bacteria were highly significantly different from bacteria associated with both H2-SSB01 and CC7-SSA01 (ANOSIM, R= 0.968, P = 0.001 and R= 0.998, P = 0.002, respectively; Table 1). Microbial communities were also highly significantly different between both the host-endosymbiont pairings, i.e H2- SSB01 and CC7-SSA01 (ANOSIM, R= 0.631, P = 0.002; Table 1).

Following the notable differences between water samples and the two hosts, for further analyses, water was excluded and the two host-endosymbiont pairings were considered separately. 111

Table 1. Summary statistics of two-way crossed ANOSIM between the two host- endosymbiont pairings and the seawater samples based on Bray-Curtis distances of bacterial abundances.

Actual Groups R Statistic p-Value Permutations H2-SSB01, CC7-SSA01 0.631 0.001 999 H2-SSB01, SW 0.968 0.001 999 CC7-SSA01, SW 0.998 0.002 999

112

5.4.2. Distinct bacterial community composition of H2-SSB01 and CC7-SSA01 anemones at ambient and heat stress temperatures across different salinities

To assess bacterial community differences of H2-SSB01 and CC7-SSA01 between the ambient temperature and heat stress across different salinities, sequence data was clustered into OTU’s. There were no significant differences in the average Chao1 estimator of species richness, Shannon diversity, Simpson’s diversity, Inverse Simpson and Simpson’s evenness for both host-endosymbionts under any treatment. However, highly significant differences in bacterial community composition for both host- endosymbiont pairings were identified between temperatures (ambient and heat stress) and salinities (H2-SSB01; PPERMANOVA = 0.001, Pseudo-F = 3.2986, 999 unique permutations and PPERMANOVA = 0.001, Pseudo-F = 3.5567, 998 unique permutations, respectively; Table 2, Fig. 10 for H2) (CC7-SSA01; PPERMANOVA = 0.002, Pseudo-F =

3.4289, 998 unique permutations and PPERMANOVA = 0.002, Pseudo-F = 2.284, 998 unique permutations, respectively; Table 2, Fig. 10 for CC7). The interaction between temperature and salinity was not significant for both host-endosymbiont pairings (H2-

SSB01; PPERMANOVA = 0.139, Pseudo-F = 1.2805, 997 unique permutations) (CC7-

SSA01; PPERMANOVA = 0.192, Pseudo-F = 1.2277, 998 unique permutations; Table 2). Subsequent pair-wise PERMANOVA tests further identified significant differences between temperatures, along with the low and intermediate salinities to be significantly different from high salinity for both host-endosymbiont pairings (P = 0.001, P = 0.002, respectively). Interestingly, H2-SSB01 that shows a salinity-dependent thermotolerance (Gegner et al., 2017) also showed a clearer separation in the clustering of the PCoA plot, as further supported by the more significant P-values for H2-SSB01.

113

Table 2. Summary statistics of two-factorial PERMANOVA based on Bray-Curtis distances for each host-endosymbiont pairing with temperature, salinity and the interaction of the two.

Host- Pseudo- Unique endosymbion Factors p-Value F Permutations t H2-SSB01 temperature 3.2986 0.001 999 H2-SSB01 salinity 3.5567 0.001 998 H2-SSB01 temperature x salinity 1.2805 0.139 997 CC7-SSA01 temperature 3.4289 0.002 998 CC7-SSA01 salinity 2.284 0.002 998 CC7-SSA01 temperature x salinity 1.2277 0.192 998

114

5.4.3. Contribution of bacterial taxa to differences between salinities at ambient and heat stress temperatures

To determine bacterial taxa that contribute to differences between salinities at the ambient temperature and heat stress, we considered all OTUs that contributed up to 50% of the cumulative differences between treatments using SIMPER and subsequent pairwise testing (Fig. 11). For H2-SSB01, we identified a total of 13 OTUs at 25°C and 34°C that were different across salinities. The taxa were from the bacterial families Rhodobacteraceae (n = 5 OTUs), Rhizobiales_unclassified (n = 3 OTUs), Pirellulaceae (n = 2 OTUs), Flavobacteriaceae (n = 2 OTUs), Cohaesibacteraceae (n = 1 OTU), Alteromonadaceae (n = 1 OTU), Alteromonadales_unclassified (n = 1 OTU), Spirobacillales_unclassified (n = 1 OTU), Legionellales_unclassified (n = 1 OTU) and Hyphomicrobiaceae (n = 1 OTU). Similarly, for CC7-SSA01 we identified 14 and 17 OTUs that were different across salinities for the ambient temperature and heat stress, respectively. The taxa covered the bacterial families of Rhodobacteraceae (n = 7 OTUs), Flavobacteriaceae (n = 2 OTUs), Spirobacillales_unclassified (n = 2 OTUs), Alteromonadaceae (n = 2 OTUs), Alphaproteobacteria_unclassified (n = 2 OTUs), Cohaesibacteraceae (n = 1 OTU), Legionellales_unclassified (n = 1 OTU), Hyphomicrobiaceae (n = 1 OTU), Nannocystaceae (n = 1 OTU), Alteromonadales_unclassified (n = 1 OTU), Pirellulaceae (n = 1 OTU), Rhizobiales_unclassified (n = 1 OTU), Oceanospirillaceae (n = 1 OTU) and

Cryomorphaceae (n = 1 OTU).

Looking at the overall pattern, only few taxa were particularly abundant at a specific temperature and salinity (e.g., OTU0026 was highly abundant in H2-SSB01 at 25°C, at a salinity of 36). Rather, we found that OTU abundance at salinities of 36 and 39 were more similar to each other than to 42, as evidenced by the clustering across salinities (Fig 3). This being in line with the pairwise PERMANOVAs that found significant differences between salinities of 36 vs. 42 and 39 vs. 42, but not between 36 vs. 39 (see above).

Given that our primary interest was in elucidating whether certain bacterial taxa could potentially explain the increased thermotolerance at higher salinities, we had a more 115 detailed look at those taxa that were consistently increased at the high salinity, irrespective of temperature. We reasoned that these taxa can potentially contribute to functional differences of the holobiont, while not being just differentially abundant as a consequence of heat stress. For H2-SSB01 four OTUs were consistently highly abundant at high salinity irrespective of temperature, i.e. OTU0001, OTU0009, OTU0012, and OTU0017 (Fig. 11). The OTUs belonged to the orders, Alteromonadales and Rhizobiales. and the family, Rhodobacteraceae, respectively. Taxa were either previously associated with Exaiptasia pallida (OTU0001; Röthig et al., 2016; Table S3) or scleractinian coral, namely Acropora hyacinthus and Isopora palifera (OTU009; Ziegler et al., 2017, OTU0012, respectively).

Similarly, for CC7-SSA01 we identified three OTUs that were consistently abundant at the high salinity (OTU0003, OTU0005 and OTU0017), and as such may explain a functional difference at high salinities. The OTUs belonged to the families, Cohaesibacteraceae and Rhodobacteraceae, respectively, and were previously associated with Exaiptasia pallida (OTU0003; Röthig et al., 2016) or subsurface seawater (OTU0005).

116

117

5.4.4. Microbial functional profiles in high salinity change with heat stress in H2- SSB01

To predict putative functional changes associated with the bacterial community compositional differences in H2-SSB01 and CC7-SSA01 when exposed to the temperature and salinity treatments, METAGENassist was used. In the ambient temperature, H2-SSB01 showed a depletion in chitin degraders (P = 0.030; Fig 12), yet an enrichment in iron oxidizers (P = 0.011) under high salinity. When exposed to heat stress, no differences in the high salinity occurred between chitin degraders and iron oxidizers, however there was a significant enrichment in degraders of aromatic hydrocarbons (P = 0.042). Similarly, iron oxidizers were enriched in the high salinity under the ambient temperature in CC7-SSA01 (P = 0.018). Interestingly, the microbial changes in CC7-SSA01 were not associated with changes in the functional profile when exposed to high salinity and heat stress.

118

119

5.5. Discussion

Research has previously investigated salinity-conveyed thermotolerance in Aiptasia and Red Sea corals, alike. Results indicated that high salinity can reduce bleaching severity under heat stress conditions (Gegner et al., 2017, 2018 in prep.). A dependency on the host-algal identity was acknowledged, but a potential role of other members constituting the bacterial microbiome were not explored. The microbiome at large is becoming increasingly known to be of importance to holobiont function (Torda et al., 2017), and in particular the importance of bacteria (McFall-Ngai et al., 2013). Yet, the role of bacteria in salinity-conveyed thermotolerance is currently unknown. Here we conducted bacterial community analysis of a follow-up experiment from (Gegner et al., 2017), in which the effect of different salinities at a ambient and heat stress temperature on Aiptasia was evaluated. This allowed us to test for a putative contribution of bacteria to salinity- conveyed thermotolerance in the host-endosymbiont, H2-SSB01. To our knowledge, this is the first study to assess changes in the cnidarian-dinoflagellate bacterial community composition following exposure to different salinity treatments and how this may influence the response to heat stress.

5.5.1. Aiptasia bacterial microbiome changes with regard to salinity and temperature

The bacterial community compositions of both H2-SSB01 and CC7-SSA01 were distinct and markedly different from seawater (Table 1), as shown previously (Herrera et al., 2017; Röthig et al., 2016). While H2-SSB01 showed a greater abundance in Rhodobacteraceae and Flavobacteraceae, a greater proportion of reads in CC7-SSA01 belonged to Alteromonadales, and water samples were dominated by families not in the top twenty with regards to their relative abundance (Fig. 9). Looking at the bacterial microbiome at large, we identified highly significant differences in the bacterial community composition of both host-endosymbiont pairings between temperatures (ambient and heat stress) and salinities (Table 2, Fig. 10). Interestingly, a significant interaction between temperature and salinity was not identified for both host- endosymbiont pairings (Table 2), suggesting that bacterial taxa which contribute to the effects between different temperatures are different from those which contribute to the 120 differences between salinity. More specifically, we found highly significant changes in the bacterial microbiome of both H2-SSB01 and CC7-SSA01 at the ambient and heat stress temperature in the high salinity when compared to both the low and intermediate salinities. This being in line with Röthig et al. (2016) finding of a significant shift in the bacterial community associated with F. granulosa after long-term exposure to high salinity levels.

To further explore microbiome patterns, we next focused on the bacterial taxa that contributed to differences between treatments using a SIMPER analysis that targeted OTUs contributing up to 50% of these cumulative differences. Overall, bacterial communities for both temperatures at high salinity were distinct, suggesting that bacterial taxa which contribute to the effects between temperatures are different from those which contribute to the differences between salinities. Notably, the here employed experimental setup allowed us to disentangle bacterial taxa that were different as a consequence of salinity and bacterial taxa that were different as a consequence of temperature. As such, we focused on the bacterial taxa that increased at high salinity, irrespective of temperature, as our reasoning was that those might potentially contribute to the beneficial salinity-conveyed thermotolerance effect. In the SIMPER analysis targeting OTUs that contribute up to 50% of the cumulative differences between treatments, we found four OTUs (OTU0001; Alteromondales_unclassified, OTU0009; Rhizobiales_unclassified, OTU0012 and OTU0017; Rhodobacteraceae) in H2-SSB01 and three OTUs (OTU0003; Cohaesibacteraceae, OTU0005 and OTU0017; Rhodobacteraceae) in CC7-SSA01 which were highly abundant at high salinity, and thus will be discussed in the following.

In H2-SSB01, one of the distinct bacterial taxa identified (OTU0009) belonged to the order Rhizobiales. Rhizobiales are known to play putative functional roles in the nitrogen cycle, as indicated by nitrite reduction in hypersaline microbial mats (nirK gene; Abed et al., 2015) and nitrogen fixation in corals (Rädecker et al., 2015).The vertical transfer of Rhizobiales from Acropora millepora parental colonies to their larvae, has been suggested to be beneficial for overall holobiont functioning (nifH gene; Lema, et al., 2014; Rädecker et al., 2015). Interestingly, other bacterial strains identified from this 121 order are both mesophilic (optimum growth at 30-35°C) and halophilic (with optimal salinity ranges of 1-5% NaCl), and one of which has been previously isolated from the mucus of F. granulosa in the Northern Red Sea (Hiraishi et al., 1995; Yosef et al, 2008). Two bacterial taxa (OTU0012 and OTU0017) identified in H2-SSB01 belonged to the family Rhodobacteraceae. The genus Shimia (OTU0012) has previously been shown to have putative functional roles in the sulphur cycle through producing DMS by DMSO reduction and DMSP degradation, and in the nitrogen cycle via the denitrification pathway (Kanukollu et al., 2016). The genus Roseovarius been located in deep ocean sediments, playing a role in the degradation of aromatic hydrocarbons (OTU0017, Genus Roseovarius; Louvado et al., 2015). Generally, the majority of currently known phototrophic iron-oxidizing bacteria belong to Rhodobacteraceae (Hedrich et al., 2011), and degraders of chitin in prey crustaceans have also been identified (Neulinger et al., 2008). Shimia and Roseovarius species additionally show tolerance and adaptation to extreme temperature (optimal growth at 25-37°C, and 23-37°C, respectively) and saline (optimum 2-5% NaCl and 2-8% NaCl, respectively) conditions (Choi & Cho, 2006; Choi, Lee et al., 2013; Hameed et al., 2013; Kang et al., 2015; Kanukollu et al., 2016; Wang et al., 2010). In CC7-SSA01, one distinct bacterial taxa (OTU0005) identified belonged to Rhodobacteraceae. The genus Marivita contributes to nitrogen cycling via nitrate reduction (Yoon et al., 2013), and species are known to persist in high temperatures (10- 40°C) and salinities (3-5% NaCl) (Hwang et al., 2009; Yoon et al., 2013; Zhong et al., 2015). Roseovarius was also present in CC7-SSA01, and DMSP degradation is an additional function which has been associated with this taxa (González et al., 2003).

Taken together, two bacterial taxa in each host-endosymbiont pairing (H2-SSB01; OTU0009 and OTU0017, CC7-SSA01; OTU0005 and OTU0017) belonged to the family of Rhodobacteraceae. Bacteria of this family have previously been considered to be opportunistic pathogens due to their association with coral disease (Godwin et al., 2012; Roder et al., 2014; Séré et al., 2013; Sunagawa et al., 2009), however they have also been frequently identified in healthy corals (Bayer et al., 2013; Li et al., 2014; Morrow et al., 2012; Röthig et al., 2016). It is perhaps not surprising that all bacterial taxa identified 122 within Rhodobacteraceae belong to the Roseobacter clade, given their prevalence in the marine and hypersaline environment (Pujalte et al. 2014; Buchan & Moran, 2005). The ability of the Roseobacter clade to persist in varying environmental conditions, reflects their metabolic versatility, notably their important roles in the global carbon and sulfur cycle (Bosch & Miller, 2016; Luo & Moran, 2014; Wagner-Döbler & Biebl, 2006). Considering this, the presence of Rhodobacteraceae in both host-endosymbiont pairings may indicate overall importance to holobiont functioning in high salinities during heat stress, yet differential taxa identified between hosts may be contributing to functional differences.

5.5.2. Is salinity-conveyed thermotolerance facilitated by bacteria?

Our finding of distinct bacterial taxa in the high salinity that aligns with a putative contributory function to high salinity acclimation, allows us to argue that bacteria may play a role in salinity-conveyed thermotolerance. Moreover, findings suggest that salinity-conveyed thermotolerance may not only be through the interactions of bacteria with the host, but also through their interactions with Symbiodiniaceae (Roseobacter cross-reference), thus highlighting the importance of all member species in a holobiont framework and how they together contribute to the metaorganism phenotype.

At large, the notion that bacteria flexibly associate with host organisms and that the most advantageous microbiome is selected for in a given environment was formulated in the coral probiotic hypothesis (Reshef et al., 2006; Rosenberg et al., 2007). Pogoreutz et al., 2018 and Röthig et al., (2016) argued further that different levels of microbial flexibility exist, which determine how far microbial association can change. While Pocillopora verrucosa seems to harbor an invariant microbiome even under conditions of bleaching and severe tissue loss (Pogoreutz et al., 2018), the deep-sea coral Eguchipsammia fistula seems highly flexible with regard to its associated microbes. Accordingly, Pogoreutz argued that P. verrucosa might represent an “extreme” case of specialization to its habitat, whereas E. fistula might be more flexible, and this therefore may possibly contribute to its global distribution across a broad range of environmental conditions. In the future, it may be interesting to determine whether H2-SSB01 and CC7-SSA01 differ in their ability to associate with different microbes. From the data here, both anemone- 123 endosymbiont pairings change their microbiomes under salinity and temperature changes. However, the data does not allow to discern whether the changes constitute a parallel response of the bacterial community to environmental differences or whether the changes provide beneficial effects to the host. It is encouraging that we found comparatively few bacterial taxa that change, in line with the notion that not all associated bacteria are functionally important. This provides an avenue to specifically test function to those few via e.g. removal of distinct taxa or extra provisioning. Experimental manipulation of associated microbes in the coral model Aiptasia is a first step to probiotics, which may provide an avenue to assist corals exposed to climate change.

124

5.6. References

Abed, R. M. M., de Beer, D. and Stief, P. (2015). Functional-Structural Analysis of Nitrogen-Cycle Bacteria in a Hypersaline Mat from the Omani Desert. Geomicrobiol. J. 32, 119–129. Ainsworth, T. D. and Gates, R. D. (2016). Corals’ microbial sentinels: The coral microbiome will be key to future reef health. Science (80-. ). 352, 1518–1519. Ainsworth, T. D., Krause, L., Bridge, T., Torda, G., Raina, J. B., Zakrzewski, M., Gates, R. D., Padilla-Gamiño, J. L., Spalding, H. L., Smith, C., et al. (2015). The coral core microbiome identifies rare bacterial taxa as ubiquitous endosymbionts. ISME J. 9, 2261–2274. Andersson, A. F., Lindberg, M., Jakobsson, H., Bäckhed, F., Nyrén, P. and Engstrand, L. (2008). Comparative analysis of human gut microbiota by barcoded pyrosequencing. PLoS One 3,. Arndt, D., Xia, J., Liu, Y., Zhou, Y., Guo, A. C., Cruz, J. A., Sinelnikov, I., Budwill, K., Nesbø, C. L. and Wishart, D. S. (2012). METAGENassist: A comprehensive web server for comparative metagenomics. Nucleic Acids Res. 40, 88–95. Baumgarten, S., Simakov, O., Esherick, L. Y., Liew, Y. J., Lehnert, E. M., Michell, C. T., Li, Y., Hambleton, E. A., Guse, A., Oates, M. E., et al. (2015). The genome of Aiptasia , a sea anemone model for coral symbiosis. Proc. Natl. Acad. Sci. 112, 11893–11898. Bayer, T., Neave, M. J., Alsheikh-Hussain, A., Aranda, M., Yum, L. K., Mincer, T., Hughen, K., Apprill, A. and Voolstra, C. R. (2013). The microbiome of the red sea coral stylophora pistillata is dominated by tissue-associated endozoicomonas bacteria. Appl. Environ. Microbiol. 79, 4759–4762. Bellwood, D. R., Hughes, T. P., Folke, C. and Nyström, M. (2004). Confronting the coral reef crisis. Nature 429, 827–833. Bosch, T. C. G. and Miller, D. J. (2016). The holobiont imperative: Perspectives from early emerging animals. Bourne, D. G., Morrow, K. M. and Webster, N. S. (2016). Insights into the Coral Microbiome: Underpinning the Health and Resilience of Reef Ecosystems. Annu. 125

Rev. Microbiol. 70, 317–340. Buchan, A. and Moran, M. A. (2005). Overview of the Marine Roseobacter Lineage. Appl. Environ. Microbiol. 71, 5665–5677. Chao, A. (1984). Board of the Foundation of the Scandinavian Journal of Statistics Nonparametric Estimation of the Number of Classes in a Population Nonparametric Estimation of the Number of Classes in a Population. Scand. J. Stat. 11, 265–270. Choi, D. H. and Cho, B. C. (2006). Shimia marina gen. nov., sp. nov., a novel bacterium of the Roseobacter clade isolated from biofilm in a coastal fish farm. Int. J. Syst. Evol. Microbiol. 56, 1869–1873. Choi, E. J., Lee, H. J., Kim, J. M. and Jeon, C. O. (2013). Roseovarius lutimaris sp. nov., isolated from a marine tidal flat. Int. J. Syst. Evol. Microbiol. 63, 3835–3840. Coles, S. L. (2003). Coral species diversity and environmental factors in the Arabian Gulf and the Gulf of Oman: A comparison to the Indo-Pacific region. Atoll Res. Bull. 1–19. Coles, S. L. and Riegl, B. M. (2013). Thermal tolerances of reef corals in the Gulf: A review of the potential for increasing coral survival and adaptation to climate change through assisted translocation. Mar. Pollut. Bull. 72, 323–332. Costanza, R., de Groot, R., Sutton, P., van der Ploeg, S., Anderson, S. J., Kubiszewski, I., Farber, S. and Turner, R. K. (2014). Changes in the global value of ecosystem services. Glob. Environ. Chang. 26, 152–158. D’Angelo, C., Hume, B. C. C., Burt, J., Smith, E. G., Achterberg, E. P. and Wiedenmann, J. (2015). Local adaptation constrains the distribution potential of heat-tolerant Symbiodinium from the Persian/Arabian Gulf. ISME J. 9, 2551–2560. Edgar, R. C., Haas, B. J., Clemente, J. C., Quince, C. and Knight, R. (2011). UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27, 2194–2200. Fine, M., Gildor, H. and Genin, A. (2013). A coral reef refuge in the Red Sea. Glob. Chang. Biol. 19, 3640–3647. Gegner, H. M., Ziegler, M., Rädecker, N., Buitrago-López, C., Aranda, M. and Voolstra, C. R. (2017). High salinity conveys thermotolerance in the coral model Aiptasia. Biol. Open 6, 1943–1948. 126

Godwin, S., Bent, E., Borneman, J. and Pereg, L. (2012). The Role of Coral- Associated Bacterial Communities in Australian Subtropical White Syndrome of Turbinaria mesenterina. PLoS One 7,. González, J. M., Covert, J. S., Whitman, W. B., Henriksen, J. R., Mayer, F., Scharf, B., Schmitt, R., Buchan, A., Fuhrman, J. A., Kiene, R. P., et al. (2003). Silicibacter pomeroyi sp. nov. and Roseovarius nubinhibens sp. nov., dimethylsulfoniopropionate-demethylating bacteria from marine environments. Int. J. Syst. Evol. Microbiol. 53, 1261–1269. Grajales, A. and Rodríguez, E. (2014). Morphological revision of the genus Aiptasia and the family Aiptasiidae (Cnidaria, Actiniaria, etridioidea). Zootaxa 3826, 55–100. Grawunder, D., Hambleton, E. A., Bucher, M., Wolfowicz, I., Bechtoldt, N. and Guse, A. (2015). Induction of Gametogenesis in the Cnidarian Endosymbiosis Model Aiptasia sp. Sci. Rep. 5, 15677. Hackstadt, A. J. and Hess, A. M. (2009). Filtering for increased power for microarray data analysis. BMC Bioinformatics 10, 1–12. Hameed, A., Shahina, M., Lin, S. Y., Lai, W. A., Hsu, Y. H., Liu, Y. C., Huang, Y. M. and Young, C. C. (2013). Shimia biformata sp. nov., isolated from surface seawater, and emended description of the genus Shimia Choi and Cho 2006. Int. J. Syst. Evol. Microbiol. 63, 4533–4539. Hedrich, S., Schlömann, M. and Barrie Johnson, D. (2011). The iron-oxidizing proteobacteria. Microbiology 157, 1551–1564. Herrera, M., Ziegler, M., Voolstra, C. R. and Aranda, M. (2017). Laboratory- Cultured Strains of the Sea Anemone Exaiptasia Reveal Distinct Bacterial Communities. Front. Mar. Sci. 4,. Hiraishi, A., Urata, K. and Satoh, T. (1995). A new genus of marine budding phototrophic bacteria, Rhodobium gen. nov., which includes Rhodobium orientis sp. nov. and Rhodobium marinum comb. nov. Int. J. Syst. Bacteriol. 45, 226–234. Howells, E. J., Abrego, D., Meyer, E., Kirk, N. L. and Burt, J. A. (2016). Host adaptation and unexpected symbiont partners enable reef-building corals to tolerate extreme temperatures. Glob. Chang. Biol. 22, 2702–2714. Hughes, T. P., Kerry, J. T., Álvarez-Noriega, M., Álvarez-Romero, J. G., Anderson, 127

K. D., Baird, A. H., Babcock, R. C., Beger, M., Bellwood, D. R., Berkelmans, R., et al. (2017). Global warming and recurrent mass bleaching of corals. Nature 543, 373–377. Hume, B. C. C., Voolstra, C. R., Arif, C., D’Angelo, C., Burt, J. A., Eyal, G., Loya, Y. and Wiedenmann, J. (2016). Ancestral genetic diversity associated with the rapid spread of stress-tolerant coral symbionts in response to Holocene climate change. Proc. Natl. Acad. Sci. 113, 4416–4421. Huse, S. M., Welch, D. M., Morrison, H. G. and Sogin, M. L. (2010). Ironing out the wrinkles in the rare biosphere through improved OTU clustering. Environ. Microbiol. 12, 1889–1898. Hwang, C. Y., Bae, G. D., Yih, W. and Cho, B. C. (2009). Marivita cryptomonadis gen. nov., sp. nov. and Marivita litorea sp. nov., of the family Rhodobacteraceae, isolated from marine habitats. Int. J. Syst. Evol. Microbiol. 59, 1568–1575. Kang, H., Kim, J. H., Jeon, C. O., Yoon, J. H. and Kim, W. (2015). Roseovarius aquimarinus sp. nov a slightly halophilic bacterium isolated from seawater. Int. J. Syst. Evol. Microbiol. 65, 4514–4520. Kanukollu, S., Voget, S., Pohlner, M., Vandieken, V., Petersen, J., Kyrpides, N. C., Woyke, T., Shapiro, N., Shapiro, M., Klenk, H. P., et al. (2016). Genome sequence of Shimia str. SK013, a representative of the Roseobacter group isolated from marine sediment. Stand. Genomic Sci. 11,. Knowlton, N., Brainard, R. E., Fisher, R., Moews, M., Plaisance, L. and Caley, M. J. (2010). Coral Reef Biodiversity. Life World’s Ocean. Divers. Distrib. Abundance 65–78. Krediet, C. J., Ritchie, K. B., Paul, V. J. and Teplitski, M. (2013). Coral-associated micro-organisms and their roles in promoting coral health and thwarting diseases. Proc. R. Soc. B Biol. Sci. 280, 20122328–20122328. LaJeunesse, T. C., Parkinson, J. E., Gabrielson, P. W., Jeong, H. J., Reimer, J. D., Voolstra, C. R. and Santos, S. R. (2018). Systematic Revision of Symbiodiniaceae Highlights the Antiquity and Diversity of Coral Endosymbionts. Curr. Biol. 1–11. Lema, K. A., Bourne, D. G. and Willis, B. L. (2014). Onset and establishment of diazotrophs and other bacterial associates in the early life history stages of the coral 128

Acropora millepora. Mol. Ecol. 23, 4682–4695. Li, J., Chen, Q., Long, L. J., Dong, J. De, Yang, J. and Zhang, S. (2014). Bacterial dynamics within the mucus, tissue and skeleton of the coral Porites lutea during different seasons. Sci. Rep. 4, 1–8. Louvado, A., Gomes, N. C. M., Simões, M. M. Q., Almeida, A., Cleary, D. F. R. and Cunha, A. (2015). Polycyclic aromatic hydrocarbons in deep sea sediments: Microbe-pollutant interactions in a remote environment. Sci. Total Environ. 526, 312–328. Luo, H. and Moran, M. A. (2014). Evolutionary Ecology of the Marine Roseobacter Clade. Microbiol. Mol. Biol. Rev. 78, 573–587. McDonald, D., Price, M. N., Goodrich, J., Nawrocki, E. P., Desantis, T. Z., Probst, A., Andersen, G. L., Knight, R. and Hugenholtz, P. (2012). An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. ISME J. 6, 610–618. McFall-Ngai, M., Hadfield, M. G., Bosch, T. C. G., Carey, H. V., Domazet-Lošo, T., Douglas, A. E., Dubilier, N., Eberl, G., Fukami, T., Gilbert, S. F., et al. (2013). Animals in a bacterial world, a new imperative for the life sciences. Proc. Natl. Acad. Sci. 110, 3229–3236. Morrow, K. M., Moss, A. G., Chadwick, N. E. and Liles, M. R. (2012). Bacterial associates of two caribbean coral species reveal species-specific distribution and geographic variability. Appl. Environ. Microbiol. 78, 6438–6449. Mouchka, M. E., Hewson, I. and Harvell, C. D. (2010). Coral-associated bacterial assemblages: Current knowledge and the potential for climate-driven impacts. Integr. Comp. Biol. 50, 662–674. Muller-Parker, G., D’Elia, C. F. and Cook, C. B. (2015). Interactions between corals and their symbiotic algae. Coral Reefs Anthr. 99–116. Neulinger, S. C., Järnegren, J., Ludvigsen, M., Lochte, K. and Dullo, W. C. (2008). Phenotype-specific bacterial communities in the cold-water coral Lophelia pertusa (Scleractinia) and their implications for the coral’s nutrition, health, and distribution. Appl. Environ. Microbiol. 74, 7272–7285. Ngugi, D. K., Antunes, A., Brune, A. and Stingl, U. (2012). Biogeography of pelagic 129

bacterioplankton across an antagonistic temperature-salinity gradient in the Red Sea. Mol. Ecol. 21, 388–405. Ochsenkühn, M. A., Röthig, T., D’Angelo, C., Wiedenmann, J. and Voolstra, C. R. (2017). The role of floridoside in osmoadaptation of coral-associated algal endosymbionts to high-salinity conditions. Sci. Adv. 3, e1602047. Osman, E. O., Smith, D. J., Ziegler, M., Kürten, B., Conrad, C., El-Haddad, K. M., Voolstra, C. R. and Suggett, D. J. (2018). Thermal refugia against coral bleaching throughout the northern Red Sea. Glob. Chang. Biol. Peixoto, R. S., Rosado, P. M., Leite, D. C. de A., Rosado, A. S. and Bourne, D. G. (2017). Beneficial Microorganisms for Corals (BMC): Proposed Mechanisms for Coral Health and Resilience. Front. Microbiol. 8, 341. Pogoreutz, C., Rädecker, N., Cárdenas, A., Gärdes, A., Wild, C. and Voolstra, C. R. (2018). Dominance of Endozoicomonas bacteria throughout coral bleaching and mortality suggests structural inflexibility of the Pocillopora verrucosa microbiome. Ecol. Evol. 8, 2240–2252. Pruesse, E., Quast, C., Knittel, K., Fuchs, B. M., Ludwig, W., Peplies, J. and Glöckner, F. O. (2007). SILVA: A comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res. 35, 7188–7196. Rädecker, N., Pogoreutz, C., Voolstra, C. R., Wiedenmann, J. and Wild, C. (2015). Nitrogen cycling in corals: The key to understanding holobiont functioning? Trends Microbiol. 23, 490–497. Rädecker, N., Raina, J. B., Pernice, M., Perna, G., Guagliardo, P., Kilburn, M. R., Aranda, M. and Voolstra, C. R. (2018). Using Aiptasia as a model to study metabolic interactions in Cnidarian-Symbiodinium symbioses. Front. Physiol. 9,. Reshef, L., Koren, O., Loya, Y., Zilber-Rosenberg, I. and Rosenberg, E. (2006). The Coral Probiotic Hypothesis. Environ. Microbiol. 8, 2068–2073. Riegl, B. M. and Purkis, S. J. (2012). Coral Reefs of the Gulf. Roder, C., Arif, C., Bayer, T., Aranda, M., Daniels, C., Shibl, A., Chavanich, S. and Voolstra, C. R. (2014). Bacterial profiling of White Plague Disease in a comparative coral species framework. ISME J. 8, 31–39. 130

Rohwer, F., Seguritan, V., Azam, F. and Knowlton, N. (2002). Diversity and distribution of coral-associated bacteria. Mar. Ecol. Prog. Ser. 243, 1–10. Rosenberg, E., Koren, O., Reshef, L., Efrony, R. and Zilber-Rosenberg, I. (2007). The role of microorganisms in coral health, disease and evolution. Nat. Rev. Microbiol. 5, 355–362. Rosenberg, E., DeLong, E. F., Lory, S., Stackebrandt, E. and Thompson, F. (2012). The prokaryotes: Prokaryotic communities and ecophysiology. Prokaryotes Prokaryotic Communities Ecophysiol. 1–528. Röthig, T., Ochsenkühn, M. A., Roik, A., Van Der Merwe, R. and Voolstra, C. R. (2016a). Long-term salinity tolerance is accompanied by major restructuring of the coral bacterial microbiome. Mol. Ecol. 25, 1308–1323. Röthig, T., Costa, R. M., Simona, F., Baumgarten, S., Torres, A. F., Radhakrishnan, A., Aranda, M. and Voolstra, C. R. (2016b). Distinct Bacterial Communities Associated with the Coral Model Aiptasia in Aposymbiotic and Symbiotic States with Symbiodinium. Front. Mar. Sci. 3,. Schloss, P. D., Westcott, S. L., Ryabin, T., Hall, J. R., Hartmann, M., Hollister, E. B., Lesniewski, R. A., Oakley, B. B., Parks, D. H., Robinson, C. J., et al. (2009). Introducing mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537–7541. Séré, M. G., Tortosa, P., Chabanet, P., Turquet, J., Quod, J. P. and Schleyer, M. H. (2013). Bacterial communities associated with Porites white patch syndrome (PWPS) on three western Indian Ocean (WIO) coral reefs. PLoS One 8,. Simpson, E. H. (1949). Measurement of diversity [16]. Nature 163, 688. Sunagawa, S., Desantis, T. Z., Piceno, Y. M., Brodie, E. L., Desalvo, M. K., Voolstra, C. R., Weil, E., Andersen, G. L. and Medina, M. (2009). Bacterial diversity and white Plague disease-associated community changes in the caribbean coral montastraea faveolata. ISME J. 3, 512–521. Torda, G., Donelson, J. M., Aranda, M., Barshis, D. J., Bay, L., Berumen, M. L., Bourne, D. G., Cantin, N., Foret, S., Matz, M., et al. (2017). Rapid adaptive responses to climate change in corals. Nat. Clim. Chang. 7, 627–636. 131

Voolstra, C. R. (2013). A journey into the wild of the cnidarian model system Aiptasia and its symbionts. Mol. Ecol. 22, 4366–4368. Wagner-Döbler, I. and Biebl, H. (2006). Environmental Biology of the Marine Roseobacter Lineage. Annu. Rev. Microbiol. 60, 255–280. Wang, B., Sun, F., Lai, Q., Du, Y., Liu, X., Li, G., Luo, J. and Shao, Z. (2010). Roseovarius nanhaiticus sp. nov., a member of the Roseobacter clade isolated from marine sediment. Int. J. Syst. Evol. Microbiol. 60, 1289–1295. Weis, V. M., Davy, S. K., Hoegh-Guldberg, O., Rodriguez-Lanetty, M. and Pringle, J. R. (2008). Cell biology in model systems as the key to understanding corals. Trends Ecol. Evol. 23, 369–376. Wild, C., Hoegh-Guldberg, O., Naumann, M. S., Colombo-Pallotta, M. F., Ateweberhan, M., Fitt, W. K., Iglesias-Prieto, R., Palmer, C., Bythell, J. C., Ortiz, J. C., et al. (2011). Climate change impedes scleractinian corals as primary reef ecosystem engineers. Mar. Freshw. Res. 62, 205–215. Xiang, T., Hambleton, E. A., Denofrio, J. C., Pringle, J. R. and Grossman, A. R. (2013). Isolation of clonal axenic strains of the symbiotic dinoflagellate Symbiodinium and their growth and host specificity1. J. Phycol. 49, 447–458. Yoon, J. H., Kang, S. J. and Lee, U. S. (2013). Marivita geojedonensis sp. nov., isolated from seawater. Int. J. Syst. Evol. Microbiol. 63, 423–427. Yosef, D. Z. Ben, Ben-Dov, E. and Kushmaro, A. (2008). Amorphus coralli gen. nov., sp. nov., a marine bacterium isolated from coral mucus, belonging to the order Rhizobiales. Int. J. Syst. Evol. Microbiol. 58, 2704–2709. Zhong, Z. P., Liu, Y., Hou, T. T., Liu, H. C., Zhou, Y. G., Wang, F. and Liu, Z. P. (2015). Marivita lacus sp. nov., isolated from a saline lake. Int. J. Syst. Evol. Microbiol. 65, 1889–1894. Ziegler, M., Seneca, F. O., Yum, L. K., Palumbi, S. R. and Voolstra, C. R. (2017). Bacterial community dynamics are linked to patterns of coral heat tolerance. Nat. Commun. 8, 1–8.

132

6. SYNTHESIS

Salinity is one of the major drivers of marine ecosystem structuring, influencing plankton, macro benthic fauna such as invertebrates and fish communities (Barletta, 2004; Rosenberg et al., 1992), as well as affecting the distribution of corals (Hoegh- Guldberg, 1999). Corals are considered osmoconformers that rely on constant intracellular osmoadaptation to adjust to the osmolarity of their environment (Coles, 1992; Röthig et al., 2016; Yancey et al., 2010). But the contribution of each compartment of the holobiont (i.e. the cnidarian host, its algal endosymbiont and a suite of other microbes) that experiences these salinity changes are not well understood. Especially the effects of high salinity on corals are only recently discussed (Ochsenkühn et al., 2017; Röthig et al., 2016; Seveso et al., 2013). Recent observations of high salinity environments that harbor some of the most thermotolerant corals (Fine et al., 2013; Osman et al., 2018), sparked the hypothesis that high salinity has a beneficial effect on the ability of corals to live in warm waters. Consequently, I aimed to better understand the importance of high salinity in the context of the coral holobiont to osmoadaptation and bleaching resilience. To do so, I conducted a series of heat stress experiments at different salinities using a combination of targeted GC-MS and physiological measurements in the coral model Aiptasia to understand whether salinity influences the bleaching susceptibility. Subsequently, I assessed the applicability of the main findings in scleractinian corals from the central Red Sea.

The work of my dissertation provides evidence that the thermotolerance and bleaching resilience of Aiptasia as well as of corals are positively affected by high salinity and likely tied mechanistically to the osmoadaptation of the algal endosymbiont. The observed salinity-conveyed thermotolerance aligned with a decrease in ROS leakage from the algal endosymbiont that links the increased abundance of osmolytes with antioxidative capabilities, i.e. floridoside, to the bleaching resilience of the coral holobiont. The production and accumulation of ROS, which are known to cause oxidative stress in cells, are understood as one of the hallmarks of the bleaching response in corals (Lesser, 2011; Weis, 2008). Given the surge of recent literature, it is becoming increasingly apparent that ROS may not be the sole cause for bleaching in corals (Nielsen 133 et al., 2018; Pogoreutz et al., 2017) and the molecular underpinnings of ROS appear much more complex than has been traditionally believed, e.g. in taking part in inter/intra cellular signaling (Mittler, 2017; Xia et al., 2015). Nevertheless, the reduction of ROS during stress conditions can certainly be beneficial to counter bleaching.

Despite a beneficial effect of high salinity on the coral holobionts tested, not all Aiptasia showed the same reaction. Only one of the two Aiptasia genotypes, H2-SSB01, showed positive effects of high salinity and the concomitant accumulation of floridoside. This suggests that the identity and accordingly, the characteristics of the endosymbiont may have a substantial influence on the holobiont bleaching resilience in relation to its osmoadaptation. Indeed, previous studies showed that some endosymbionts are more resistant to bleaching conditions than others (Cziesielski et al., 2018; Hume et al., 2015), and this may hold true for salinity changes and simultaneously osmoadaptation strategies. Hence, endosymbionts that rely on floridoside as osmolyte, i.e. SSB01 and the coral holobionts tested from the Red Sea, may be accidentally increasing their thermotolerance, while others, i.e. SSA01, may have other means of coping. In fact, all holobionts tested that showed a positive effect of salinity, harbored endosymbionts capable of producing floridoside in high salinity (42). Interestingly, Ochsenkuehn et al. (2017) showed that all endosymbiont cultures and corals measured in extremely high salinity (55) seemingly produce, although to varying degrees, floridoside. Thus, providing evidence that all endosymbionts may be able to produce floridoside but at different salinity thresholds and further, hinting towards a role of floridoside as a common osmolyte for endosymbionts.

Although we showed a link of floridoside and the concomitant increase in thermotolerance, we argue that a variety of osmolytes, besides floridoside, may in fact be able to convey the observed thermotolerance, given that the osmolyte hold similar antioxidative capabilities. It is in this vein that we propose a more universal mechanism, independent of floridoside. Alternative osmolytes, e.g. DMS/DMSP (Sunda et al., 2002; Yancey et al., 2010), sugars (trehalose, inositol, sorbitol, mannitol) (Iordachescu and Imai, 2008; Ochsenkühn et al., 2017; Stoop et al., 1996) and free amino acid pools (proline, taurine or glycine) (Shick, 1991; Yancey et al., 2010), share similar ROS scavenging properties and are known to be produced as osmolytes by corals and algae 134 and as such have the potential to be part of the holobiont osmoadaptation. The above- mentioned osmolytes may take part in the osmoadaptation response that further reduces the elevated levels of ROS during other stressors such as heat. Interestingly, osmolytes conveying thermotolerance by ROS scavenging/detoxification are found in plant systems, such as tomato, supporting the universality of the proposed mechanism (Martinez et al., 2018; Rivero et al., 2014). While this hypothesis builds on a direct detoxification of ROS in the cell, other osmolytes, e.g. glycine betaine that are found in corals, stabilize proteins by molecular chaperone activation (Diamant et al., 2001) thus supporting the enzymatic antioxidant response of the cell during stress, which may result in a similar but indirect detoxification of ROS.

Besides the osmoadaptation response of the host and its algal endosymbiont, we showed that distinct microbial communities were associated with Aiptasia at different salinities, and that functional profiling of the communities support a beneficial effect to stress resilience of the holobiont. Corresponding microbiome restructuring to high salinity are corroborated by long-term microbial community studies of corals in the Red Sea near desalination plant outlets (Röthig et al., 2016). Although a clear functional link remains elusive, a distinct restructuring may imply a contribution of the microbiome to holobiont osmoadaptation and more broadly, stress resilience. Research in line with this, links the microbial community dynamics to high temperatures and bleaching resilience in a short- term coral transplantation experiment, showing microbial community differences between two thermal regimes in a lagoon that is followed by a community restructuring after transplantation (Ziegler et al., 2017). While these results may be explained by parallel responses of the coral and the microbiome to environmental stressors, it is intriguing to hypothesize that all holobiont compartments produce, degrade and recycle metabolites in an intricate network that collaboratively defines the holobiont stress resilience (Fig. 13). The production of metabolites such as DMSP by the coral host (Raina et al., 2013) and their algal endosymbionts (Borell et al., 2016) as well as the tight involvement of bacteria in its metabolism (Raina et al., 2009) advocates for such a collaborative network. This is further strengthened by a recent study suggesting that bacteria are important for the sequestration of glycine betaine in the coral holobiont, hence, supporting the coral host and its endosymbiont metabolically, providing further 135 evidence for a collaborative osmoadaptation (Ngugi et al. 2018; in revision). However, to clarify the contribution of the holobiont compartments in conveying thermotolerance and ROS detoxification in high salinity or stress resilience in general, further studies separating the cnidarian host, the algal endosymbiont and the bacterial community are essential, e.g. gene knockdowns targeting the enzyme synthesizing floridoside in the algal endosymbiont (Pade et al., 2015) or coral microbiome manipulations to infer probiotic effects on holobiont health (Peixoto et al., 2017).

136

In conclusion, my work shows how the adjustment of algal endosymbionts to one environmental stressor (salinity) may result in resilience towards a seemingly disconnected stressor (temperature) in the coral holobiont. While these findings may provide a new angle on high salinity environments such as the Red Sea and Persian/Arabian Gulf that are known to harbor thermotolerant corals, it remains elusive how universal this mechanism is. This specifically gains importance in the light of climate change. Although, global predictions of sea surface salinity (SSS) are limited, it is likely that due to an intensification of the water cycle, SSS will be affected in future ocean scenarios, e.g. increases of the salinity in arid regions and decreases in regions with high precipitation (Curry et al., 2003; Durack et al., 2012). Hence, stressing the importance to elucidate the underlying mechanisms of coral holobiont osmoadaptation and bleaching resilience. In addition, we highlight the value of Aiptasia as a model organism for corals to understand molecular mechanisms of bleaching. Consequently, more studies should utilize Aiptasia as a model organism to disentangle the contributions of holobiont compartments. While reinfections with different types of algal endosymbionts are becoming common in Aiptasia (Cziesielski et al., 2018; Matthews et al., 2017; Sunagawa et al., 2009; Tolleter et al., 2013; Voolstra, 2013), protocols for the removal of the entire microbiome (Costa, et al., 2017) followed by manipulation of the microbiome (Peixoto et al., 2017) are presently explored. In the end, the utilization of Aiptasia as a coral model and the growth of the Aiptasia -omics toolbox will quickly advance the field of coral science and provide valuable insights into the cnidarian- dinoflagellate endosymbiosis.

137

6.1. References

Barletta, M. (2004). The role of salinity in structuring the fish assemblages in a tropical estuary. J. Fish Biol. 1–28.

Borell, E. M., Pettay, D. T., Steinke, M., Warner, M. and Fine, M. (2016). Symbiosis- specific changes in dimethylsulphoniopropionate concentrations in Stylophora pistillata along a depth gradient. Coral Reefs 35, 1383–1392.

Coles, S. L. (1992). Experimental comparison of salinity tolerances of reef corals from the Arabian Gulf and Hawaii: evidence for hyperhaline adaptation. Proc. 7th Int. Coral Reef Symp. 1, 227–234.

Curry, R., Dickson, B. and Yashayaev, I. (2003). A change in the freshwater balance of the Atlantic Ocean over the past four decades. Nature 426, 826–829.

Cziesielski, M. J., Liew, Y. J., Cui, G., Schmidt-Roach, S., Campana, S., Marondedze, C. and Aranda, M. (2018). Multi-omics analysis of thermal stress response in a zooxanthellate cnidarian reveals the importance of associating with thermotolerant symbionts. Proc. R. Soc. B Biol. Sci. 285,.

Diamant, S., Eliahu, N., Rosenthal, D. and Goloubinoff, P. (2001). Chemical Chaperones Regulate Molecular Chaperones in Vitro and in Cells under Combined Salt and Heat Stresses. J. Biol. Chem. 276, 39586–39591.

Durack, P. J., Wijffels, S. E. and Matear, R. J. (2012). Ocean salinities reveal strong global water cycle intensification during 1950 to 2000. Science (80-. ). 336, 455– 458.

Fine, M., Gildor, H. and Genin, A. (2013). A coral reef refuge in the Red Sea. Glob. 138

Chang. Biol. 19, 3640–3647.

Hoegh-Guldberg, O. (1999). Climate change, coral bleaching and the future of the world’s coral reefs. Mar. Freshw. Res. 50, 839–866.

Iordachescu, M. and Imai, R. (2008). Trehalose biosynthesis in response to abiotic stresses. J. Integr. Plant Biol. 50, 1223–1229.

Lesser, M. P. (2011). Coral bleaching: Causes and mechanisms. In Coral Reefs: An Ecosystem in Transition, pp. 405–419. Dordrecht: Springer Netherlands.

Matthews, J. L., Crowder, C. M., Oakley, C. A., Lutz, A., Roessner, U., Meyer, E., Grossman, A. R., Weis, V. M. and Davy, S. K. (2017). Optimal nutrient exchange and immune responses operate in partner specificity in the cnidarian-dinoflagellate symbiosis. Proc. Natl. Acad. Sci. 114, 201710733.

Martinez, V., Nieves-Cordones, M., Lopez-Delacalle, M., Rodenas, R., Mestre, T. C., Garcia-Sanchez, F., Rubio, F., Nortes, P. A., Mittler, R. and Rivero, R. M. (2018). Tolerance to stress combination in tomato plants: New insights in the protective role of melatonin. Molecules 23, 1–20.

Mittler, R. (2017). ROS Are Good. Trends Plant Sci. 22, 11–19.

Ngugi, D. K., Ziegler, M., Duarte, C. M., Voolstra, C. R., (under revision). Widespread adoption of a microbial transmembrane function links corals to betaine biogeochemistry.

Nielsen, D. A., Petrou, K. and Gates, R. D. (2018). Coral bleaching from a single cell perspective. ISME J. 12, 1558–1567. 139

Peixoto, R. S., Rosado, P. M., Leite, D. C. de A., Rosado, A. S. and Bourne, D. G. (2017). Beneficial Microorganisms for Corals (BMC): Proposed Mechanisms for Coral Health and Resilience. Front. Microbiol. 8, 341.

Raina, J. B., Tapiolas, D., Willis, B. L. and Bourne, D. G. (2009). Coral-associated bacteria and their role in the biogeochemical cycling of sulfur. Appl. Environ. Microbiol. 75, 3492–3501.

Raina, J.-B., Tapiolas, D. M., Forêt, S., Lutz, A., Abrego, D., Ceh, J., Seneca, F. O., Clode, P. L., Bourne, D. G., Willis, B. L., et al. (2013). DMSP biosynthesis by an animal and its role in coral thermal stress response. Nature 502, 677–680.

Rosenberg, R., Loo, L. O. and Möller, P. (1992). Hypoxia, salinity and temperature as structuring factors for marine benthic communities in a eutrophic area. Netherlands 140

J. Sea Res. 30, 121–129.

Shick, J. M. (1991). Overview of sea anemones. In A Functional Biology of Sea Anemones, pp. 1–35. Dordrecht: Springer Netherlands.

Stoop, J. M. H., Williamson, J. D. and Mason Pharr, D. (1996). Mannitol metabolism in plants: a method for coping with stress. Trends Plant Sci. 1, 139–144.

Sunda, W., Kieber, D. J., Kiene, R. P. and Huntsman, S. (2002). An antioxidant function for DMSP and DMS in marine algae. Nature 418, 317–320.

Tolleter, D., Seneca, F. O., Denofrio, J. C., Krediet, C. J., Palumbi, S. R., Pringle, J. R. and Grossman, A. R. (2013). Coral bleaching independent of photosynthetic activity. Curr. Biol. 23, 1782–1786.

Voolstra, C. R. (2013). A journey into the wild of the cnidarian model system Aiptasia and its symbionts. Mol. Ecol. 22, 4366–4368.

Weis, V. M. (2008). Cellular mechanisms of Cnidarian bleaching: stress causes the collapse of symbiosis. J. Exp. Biol. 211, 3059–3066.

Xia, X.-J., Zhou, Y.-H., Shi, K., Zhou, J., Foyer, C. H. and Yu, J.-Q. (2015). Interplay 141

between reactive oxygen species and hormones in the control of plant development and stress tolerance. J. Exp. Bot. 66, 2839–2856.

Ziegler, M., Seneca, F. O., Yum, L. K., Palumbi, S. R. and Voolstra, C. R. (2017). Bacterial community dynamics are linked to patterns of coral heat tolerance. Nat. Commun. 8, 1–8.

142

7. APPENDIX

Supplementary File S1. Data file. Algal endosymbiont cell counts determined by flow cytometry and normalized to host protein for Aiptasia host-endosymbiont pairings H2- SSB01 and CC7-SSA01. Each row depicts a replicate anemone.

Supplementary File S2. Data file. Photosynthetic efficiency measurements for Aiptasia host-endosymbiont pairings H2-SSB01 and CC7-SSA01. Each row depicts a replicate anemone.

Supplementary File S3. Data file. ROS leakage (CellROX fluorescence) measurements for algal endosymbiont fraction from Aiptasia host-endosymbiont pairings H2-SSB01 and CC7-SSA01. Each row depicts a replicate anemone.

Supplementary File S4. Data file. Targeted GC-MS metabolite levels of Aiptasia host- endosymbiont pairings H2-SSB01 and CC7-SSA01 in their symbiotic and aposymbiotic state. metabolite levels were normalized to the GC-MS internal standard hydroxy benzylic acid (HBA), then to mg of host protein, followed by conversion to pmol using molar masses, which yielded metabolite levels in pmol mg-1 host protein. Each row depicts a replicate anemone.

Supplementary File S5. Data file. Coral algal endosymbiont densities and floridoside levels each normalized to host protein. Each row depicts a distinct coral colony and measurement.

Supplementary File S6. Published manuscript. Gegner, H. M., Ziegler, M., Rädecker, N., Buitrago-López, C., Aranda, M. and Voolstra, C. R. (2017). High salinity conveys thermotolerance in the coral model Aiptasia. Biol. Open 6, 1943–1948. DOI: 10.1242/bio.028878

Supplementary File S7. Submitted manuscript. Hagen M Gegner1, Nils Rädecker1, Michael Ochsenkühn2, Marcelle Barreto1, Maren Ziegler1,3, Jessica Reichert3, Patrick Schubert3, Thomas Wilke3, Christian R Voolstra1*. High levels of the osmolyte 143 floridoside at high salinity link osmoadaptation with bleaching susceptibility in the coral- algal endosymbiosis

Supplementary File S8. Prepared manuscript. Janna Randle1, Anny Cardenás 1, Maren Ziegler2, Hagen M Gegner1, Christian R Voolstra1. Insights into bacterial community changes following heat and salinity treatments in Aiptasia.