sign in sign up
<<
Home , Monoamine oxidase A, Tryptophan hydroxylase, Tyrosine hydroxylase

Examining Inhibitor Targets Using Caenorhabditis elegans

______

A Thesis Presented to

The College of Arts and Sciences

Ohio University

______

In Partial Fulfillment

of the Requirements for Graduation

with Honors in Biological Sciences

______

By

Matthew Vince

May 2020

This thesis has been approved by the

Department of Biological Sciences and the College of Arts and Sciences

______

Dr. Janet S. Duerr, Associate Professor of Biological Sciences

______

Dr. Florenz Plassmann, Dean, College of Arts and Sciences

1 Acknowledgments

I would first like to thank my thesis advisor, Dr. Janet Duerr. I would not be half the researcher I am today without her continued efforts. I will always remember the countless laughs and memories shared with Dr. Duerr along with the rest of the lab. I would also like to thank my lab group members for countless fun times in and out of lab. I would also like to thank my honors thesis coordinator, Dr. Christine

Griffin, for helping me all throughout my last two years of college as well as assisting me in my honors thesis. Lastly, I’d like to thank my mother and sister for their continual support in my academic career here at Ohio University.

“The aim of science is not to open the door to infinite wisdom,

but to set a limit to infinite error.”

-Bertolt Brecht, Life of Galileo

2 Table of contents:

ACKNOWLEDGMENTS…………………………………….……….………………2

LIST OF FIGURES AND TABLES…………...………………………………………5

ABSTRACT………………………………………………………………………...….7

I. INTRODUCTION………………………………………………………...…………9

Ia. Caenorhabditis elegans (C. elegans) ……………………..………..………9

Ib. and ……….……………………………………10

Ic. Monoamines……………………………………………………..……...…10

Id. Trafficking of Monoamines in and C. elegans……..………....…11

Id.i: Synthesis……………………………………..………………..…11

Id.ii: Storage and Release... …………………..…………….…...……13

Id.iii: Receptors and Activation…………...……..………………...…14

Id.iv: Degradation………………………………..………….……..…15

Ie. Monoamine Oxidase Inhibitors ……………….....………………..………15

If. Thrashing and Mechanical Sensation…………….....…………………..…17

Ig. Pharyngeal Pumping………………………..……………..………………18

Ih. Research Question…………………...….…………..……………….……20

Ii. Experimental Objective………………………..………………………..…20

II. MATERIALS AND METHODS……………………...…………………………..21

IIa. Strains and Mutants………………………………..………..……………21

IIb. PCR and Gel Electrophoresis …………………..………………..………21

IIc. Genetic Crosses………………………………..………..……………..…23

3 IId. Growth Plates…………………………………………………………….24

IIe. Thrashing ………………………………………...…..………………..…24

IIf. Pharyngeal Pumping……………………...………..…………..…………24

IIg. Data Collection and Evaluation……………..……..……………..………25

III. RESULTS…………………………………………..…………………………….26

IIIa. Previous Results…………………………..…………………..…………26

IIIb. Genetic Crosses………………………………………...………………..27

IIIc. Saline Control……………………………………….…...………………29

IIId. ………….………………...………...…………………30

IIIe. ………………………………………...…..…………………34

IV. DISCUSSION, CONCLUSIONS AND FUTURE DIRECTIONS…..…...... …40

V. REFERENCES………………………………………………………..………...…43

4 List of figures and tables:

Figure 1. Anatomy of Caenorhabditis elegans…………...……………………………9

Figure 2. Structures of the main MA in C. elegans ……...…………..……...….....…11

Figure 3. MA synthesis pathway in C. elegans …………...……..……………...……12

Figure 4. MA synthesis pathway in humans………………………………...………..12

Figure 5. MA signaling in neurons………………………………………...……...….14

Figure 6. MAOI examples…………………..…………………………………..……16

Figure 7. neurons in hermaphrodite C. elegans…………..…………..17

Figure 8. Serotonergic neurons in hermaphrodite C. elegans……………...…………19

Table 1: location of KO alleles…………………………………………...…………..22

Table 2. Product sizes ………………………………………………..…...... ………..22

Figure 9. PCR process.…………………………………………………………..……23

Figure 10. amx-2 mutant results………………………………………………………26

Figure 11. dop-3 PCR gel………………………………..……………….…..………28

Figure 12. Saline control for mutants………………………..…………….29

Figure 13. Saline control for -octopamine mutants…………………………29

Figure 14. Saline control for combinations of dopamine and tyramine-octopamine mutants…..………………………………………………..………………………..…30

Figure 15. Saline versus tranylcypromine for dopamine mutants…………...... …….31

Figure 16. Saline versus tranylcypromine for tyramine-octopamine mutants………………………………………………………………………..………32

5 Figure 17. Saline versus tranylcypromine for combinations of dopamine and tyramine- octopamine mutants……………………………………………..……………………33

Table 3. One trial of 1 mg/ml phenelzine using tdc-1 mutants………………..…...…34

Figure 18. Saline versus phenelzine for dopamine mutants………………...…...……35

Figure 19. Saline versus phenelzine for tyramine-octopamine mutants……………..……………………………………………..……….....……….35

Figure 20. Saline versus phenelzine for combinations of dopamine and tyramine- octopamine mutants…….………………………………..…………………………...36

Figure 21. Binning of tyramine-octopamine mutant worms from all 3 blind sets of 10 worms each after 5 minutes in 1 mg/ml phenelzine. ………………..………....……..37

Figure 22. Pre bleaching of 20 worms per strain of tyramine-octopamine related mutants after 5 minutes in 1 mg/ml phenelzine …………………………...... ….……38

Figure 23. Post bleaching of 20 worms per strain of tyramine-octopamine related mutants after 5 minutes in 1 mg/ml phenelzine ……………………………..…….…39

6 Abstract. Our lab focuses on studying monoamines (MA) and the effects of monoamine oxidase inhibitors (MAOI) in Caenorhabditis elegans (C. elegans).

Monoamines are a class of that are involved in ionotropic and metabotropic signaling in C. elegans and humans. Monoamine oxidases (MAO) degrade excess MA in presynaptic neurons. MAOI bind MAO and increase MA in the synaptic cleft, resulting in increased cell signaling. Monoamine oxidase inhibitors may be prescribed to people with neurological or psychological disorders. For example, people with depression are commonly prescribed selective reuptake inhibitors (SSRI) to help increase cell signaling of the MA serotonin. Sometimes

SSRI’s are ineffective for patients and then they may be administered MAOIs.

Parkinson’s disease patients have decreased dopamine signaling and are administered

L-DOPA to increase dopamine synthesis. They may also be prescribed the MAOI to reduce degradation of dopamine.

I am testing two MAOIs, tranylcypromine and phenelzine, for their effects on strains with combinations of mutations to determine whether MAOI have MA- independent effects on MA receptors in C. elegans. MA regulate , egg laying, pharyngeal pumping, locomotion, and learning in C. elegans. I am examining the effects of MAOI on locomotion (thrashing) in MA synthesis and/or MA receptor knockouts of C. elegans. In particular, I am studying MAOI sensitivity in 4 mutants with changes in cat-2 which encodes hydroxylase, used to make dopamine

(MA), tdc-1 which encodes tyrosine decarboxylase, used to make tyramine (MA) and

7 octopamine (MA), as well as lgc-55 which encodes a tyramine-gated chloride channel and dop-3 which encodes a dopamine type receptor.

8 I Introduction

Ia. Caenorhabditis elegans (C. elegans). C. elegans are small nematodes that are popular model organisms due to their simplicity (see figure 1). C. elegans can be hermaphrodite or male with an overwhelming majority being hermaphrodite.

Hermaphrodite C. elegans can self-fertilize and mate with males. C. elegans have short growing periods, and grow on Escherichia coli (E. coli). There are also many that encode proteins with functions similar to those in humans.

Figure 1: Anatomy of Caenorhabditis elegans (From Corsi et al. 2005)

Hermaphrodite C. elegans have 959 somatic cells while males have 1031 somatic cells (Corsi 2006). Hermaphrodite C. elegans have 302 neurons and are the first model organism to have its whole neuronal connectome described (Corsi 2006;

Toga et al. 2012). Neurons in C. elegans are constructed the same as they are in humans, and the signaling systems of C. elegans and humans have many similarities as well. For example, both organisms have electrical and chemical synapses in the body. C. elegans and humans use homologous metabotropic and ionotropic receptors

9 in their chemical signaling. They have similarities and differences in the molecules and neurotransmitters with which they communicate.

Ib. Neurons and neurotransmitters. Neurotransmitters are chemical messengers involved in cell-to-cell signaling. Neurotransmitters come in various classes in humans including, but not limited to, amino acids, monoamines, purines, and peptides (Valenzuela et al. 2011).

The general location of action of neurotransmitters involves a presynaptic , synaptic cleft between two cells, and a postsynaptic cell which may be the dendrite of another neuron. Neurotransmitters are stored in vesicles and then released from vesicles in the presynaptic cell to the synaptic cleft where they may bind to receptors and cause activation of a response. Neurons can have reuptake channels lining the presynaptic cell that act as carriers and reuptake leftover neurotransmitters, where they can be recycled or reused. Some neurotransmitters can be degraded by membrane-bound on the pre or postsynaptic cell or in the extracellular space.

Neurons can also form synapses onto muscles or other cells in both humans and C. elegans. Both organisms use the neurotransmitter to stimulate the contraction of some muscles.

Ic. Monoamines. Monoamines (MA) are a specific class of neurotransmitters that include an group connected to an aromatic ring via two hydrocarbons. MA are derived from the aromatic amino acids , tyrosine, or .

Examples of MA in humans include serotonin, dopamine, epinephrine, , and phenylethylamine (Sheffler and Pillarisetty 2020). C. elegans

10 primarily use the MA serotonin, dopamine, octopamine, and tyramine (Chase and

Koelle 2007; see figure 2). C. elegans can communicate via neurotransmitters that humans produce in small amounts such as octopamine and tyramine. On the other hand, C. elegans produce no epinephrine or norepinephrine neurotransmitters while humans use these neurotransmitters extensively (Bauknecht and Jékely. 2017).

In humans, MA are responsible for modulating many activities including learning, memory, , social behaviors, reproduction, and stress response

(Swallow et al. 2016). In C. elegans, MA affect metabolism and a number of behaviors including egg laying, feeding, movement, and habituation (Engleman et al.

2016).

Figure 2: Structures of the main MA in C. elegans

Id. Trafficking of monoamines in humans and C. elegans.

Idi: Synthesis. Synthesis of MA in C. elegans and humans starts with precursor molecules such as tyrosine and tryptophan (Chase and Koelle

2007; Sheffler and Pillarisetty 2020). In humans the synthesis of serotonin (5-HT) requires tryptophan absorbed from the diet (Lindseth et al. 2015). Tryptophan is then converted by (encoded by the TPH1 in humans and C. elegans) to 5-hydroxytryptophan (5-HTP). Finally, decarboxylase

11 encoded by bas-1 in C. elegans and DDC in humans, converts 5-HTP into serotonin

(5-HT) (see figures 3 and 4).

Figure 3: MA synthesis pathway in C. elegans (From WormBook 2005)

L-Tyrosine

Figure 4: MA synthesis pathway in humans (From Broadley 2010)

12 Tyrosine is the precursor for synthesis of dopamine, tyramine, and octopamine in both humans and C. elegans. Tyrosine is converted to the intermediate Levadopa

(L-DOPA) by CAT-2 in C. elegans and (TH) in humans; these are the rate-limiting enzymes for dopamine synthesis. L-DOPA is converted into dopamine (DA) by biogenic amine synthesis related protein (BAS-1) in C. elegans or by aromatic-L-amino acid decarboxylase protein (DDC) in humans. Tyrosine can also be converted to tyramine (TA) via tyrosine decarboxylase (TDC-1) encoded by the gene tdc-1 in C. elegans or DDC in humans. Tyramine can act as a neurotransmitter or be converted into octopamine via tyramine β-hydroxylase (TBH-1) encoded by the gene tbh-1 in C. elegans or by dopamine beta-hydroxylase encoded by DBH in humans (see figures 3 and 4). There are other routes and steps that may synthesize other MA and trace in neurons that are not shown above (Chase and Koelle

2007; Sheffler and Pillarisetty 2020). C. elegans do not use epinephrine or norepinephrine, which are major neurotransmitters in humans. C. elegans use tyramine and octopamine more frequently than humans do (Bauknecht and Jékely 2017).

Currently, tyramine and octopamine are the only known trace amines used as neurotransmitters in the (Pei et al. 2016).

Idii: Storage and release. MA are transported into dense core vesicles via the vesicular monoamine transporter (VMAT). VMAT uses the energy stored in a proton gradient generated by a vesicle-bound V-ATPase antiporter. Hydrogen ions are pumped out of the vesicles in exchange for MA import. There are two genes for

VMAT in the human body encoded by SLC18A1 (VMAT1) gene and SLC18A2

13 (VMAT2) (Lawal and Krantz 2013). There is only one gene found in C. elegans, cat-1, that encodes a VMAT (Duerr et al. 1999). In humans, VMAT1 is found predominantly in the peripheral nervous system in neuroendocrine cells such as chromaffin cells in the medulla of the , although there is some VMAT1 in the brain. VMAT2 is found primarily in the central nervous system.

MA are released from vesicles via calcium dependent exocytosis into the synaptic cleft. There are receptors on both the presynaptic neuron (autoreceptors) and the postsynaptic cell (Sarkar et al. 2012).

Idiii: Receptors and activation.

DAR Presynaptic cell DA DA Post- DAT synaptic tyrosine TH DOPA DA DA cell DA DA DA AADC DA DA DADA DA DA DA DAR DA DA DA DOPAC MAO DA DA DA DAR MAO? VMAT DA DOPAC Gene Protein amx-1,2,3 Possible MAOs (monoamine oxidases) bas-1 AADC (amino acid decarboxylase) cat-1 VMAT (vesicular monoamine transporter) cat-2 TH (tyrosine hydroxylase) dat-1 DAT (dopamine re-uptake transporter) dop-1,2,3,4 DARs (dopamine receptors)

Figure 5: MA signaling in neurons (from Janet Duerr, PhD)

In humans and C. elegans, monoamine receptors can be ionotropic, opening channels to allow the flow of ions into or out of the cell, or they can be metabotropic, using signaling proteins inside of the neurons. In humans, dopamine receptors are G

14 protein coupled receptors and are divided into two classes; D1-like and D2-like receptors. The D1-like family of receptors includes D1 and D5 and generally indirectly increase concentrations of the signaling molecule cAMP upon binding and increase excitability in the cell. The D2-like family of dopamine receptors includes D2, D3, and

D4 in humans; these generally decrease cAMP and therefore decrease excitability

(Beaulieu et al 2015). In C. elegans, there are four dopamine receptors (DOP 1-4).

DOP-1 and DOP-4 are D1-like receptors. DOP-2 and DOP-3 are D2 -like receptors

(Wang et al. 2014; see figure 5).

Idiv: Degradation. Monoamine oxidases (MAO) degrade

monoamines in the presynaptic monoaminergic cells. MAO are localized to the outer membrane of mitochondria in humans. There are two classes of monoamine oxidases in humans, MAO-A and MAO-B. MAO-A preferentially degrades serotonin, dopamine, epinephrine, norepinephrine, and tyramine while MAO-B preferentially degrades phenylethylamine and dopamine in the presynaptic neuron (Chen and Shih

1997). In C. elegans there appears to be only one type of MAO encoded by amx-2

(Schmid et al. 2015). MAO acts specifically by clipping off the amine group on neurotransmitters. In humans, MAO-A and MAO-B are largely localized in the brain but are also found in the cells of the kidney, heart, duodenum, blood vessels, and the liver (Rodríguez et al. 2001; Tong et al, 2013).

Ie. Monoamine oxidase inhibitors. Monoamine oxidase inhibitors (MAOI) are a class of drug that inhibits MAO. MAOIs were introduced in the 1950’s and were used to treat different types of depression, panic disorders and social phobias. People

15 with depression are commonly prescribed selective serotonin reuptake inhibitors

(SSRIs) for initial treatment. If these drugs do not work, patients may then be administered MAOIs, which have unwanted side effects and dietary interactions.

Parkinson’s disease patients have decreased dopamine signaling and are administered

L-DOPA to increase dopamine synthesis. They may also be prescribed the MAOI selegiline to reduce degradation of dopamine. Currently, there are four United States

Food and Drug administration (FDA) approved MAOIs; , phenelzine, selegiline, and tranylcypromine. Other MAOIs are approved for use outside of the

United States such as (Pinder 2007).

Specific MAOI prevent MAO from degrading MA such as dopamine and tyramine. MAOIs bind to MAOs and indirectly increase cell signaling by preventing the degradation of MA (Sheffler and Pillarisetty 2020). In our research, we are examining the genetic targets of the MAOI drugs tranylcypromine and phenelzine, which reversibly inhibit humans MAO-A and MAO-B (nonselective) in humans. The structure for phenelzine and tranylcypromine are shown in figure 6.

Figure 6: MAOI examples

16 If. Thrashing and mechanical sensation. Movement in humans and

C. elegans is modulated by the neurotransmitters dopamine and serotonin. In humans,

Parkinson’s disease (PD) is characterized by abnormalities in activation or inactivation of movements. These uncontrolled movements occur after damage or destruction of dopaminergic cells in the region of the brain. In C. elegans hermaphrodites there are eight mechanosensory dopaminergic neurons. In the head there are four CEPs (Cephalic sensilla: CEPDR, CEPDL, CEPVR, and CEPVL) and two ADEs (anterior deirids: ADER, and ADEL). In the body there are two PDEs

(posterior deirids: PDER, and PDEL) (Maulik et al. 2017; see figure 7).

Figure 7: Dopaminergic neurons in hermaphrodite C. elegans (From Rand and Nonet 1997)

Damage to or ablation of these neurons disrupts regulation of locomotion in C. elegans (Fang-Yen et al. 2012). For example, there are defects in changing locomotion speed in the presence of food. Normally, when a bacterial lawn (food) is present, C. elegans slow their movement as they enter the bacterial lawn in a process known as

17 the “basal slowing response”. When cat-2, the primary gene involved in dopamine synthesis, is knocked out, worms do not slow upon entering food (Sawin et al. 2000;

Maulik et al. 2017).

Tyramine and octopamine are used as neurotransmitters in C. elegans.

Tyramine is a precursor for octopamine. One physiological role of tyramine is to activate the flight/stress response (De Rosa et al. 2019). Tyraminergic cells include the

RIM-1 motor neurons and the uv1 neuroendocrine cells. Octopamine shares similar functions with norepinephrine in vertebrates (Alkema et al. 2005). Octopaminergic cells (cells that express both TDC-1 and TBH-1) are the RIC and gonadal sheath cells (Chase and Koelle 2007).

Ig. Pharyngeal pumping. Pharyngeal pumping is a process predominantly modulated by the MA serotonin and is how C. elegans eat. Mutant C. elegans lacking the gene tph-1 (lacking serotonin synthesis) show fewer contractions of the myogenic pharyngeal muscles. There are twenty pharyngeal neurons and eight muscles that make up the pharynx. Two cholinergic MC neurons are very important for rapid pumping; both are regulated by serotonin (Song and Avery 2012; Trojanowski et al.

2016).

There are eleven serotonergic neurons in C. elegans hermaphrodites. These include bilaterally symmetric NSMs, HSNs, ADFs, PHBs, AIMs, the single I5 and

RIH neurons (Sawin et al. 2000). NSML, NSMR, and I5 are the only three serotonergic neurons in the pharynx (Altun and Hall 2009; see figure 8).

18 Exogenous serotonin applied to C. elegans stimulates egg laying and pharyngeal pumping and inhibit locomotion and defecation. When C. elegans are deprived of food, they slow even more than usual upon entering a lawn of bacteria; this is known as the “enhanced slowing response” and it is dependent upon serotonin synthesis. When serotonin synthesis (tph-1) mutants are treated with exogenous serotonin, the worms regain their “enhanced slowing response”. tph-1 mutants show reduced egg laying activity as well as decreasing pharyngeal pumping activity (Chase and Koelle 2007).

Figure 8: Serotonergic neurons in hermaphrodite C. elegans (From Rand and Nonet 1997)

19 Ih. Research question. My question is “Do MAOIs act only by changing degradation of MA or do they also directly affect other MA binding proteins such as receptors?” My experiments are designed to examine the effects of gene knockouts on drug responses to identify possible sites of action of these drugs on the neurons in C. elegans and, perhaps, humans.

II. Experimental objective. Our research results can lead to more efficient changes in targeting in drug synthesis and a better understanding of different effects of

MAOIs on patients. This understanding can also help by ultimately giving physicians a better understanding of the molecular target(s) of MAOIs.

20 II Materials and methods

IIa. Strains and mutants. The wild type strain was N2. Four strains with mutations in single genes obtained from the Caenorhabditis elegans Stock Center

(CGC) were used to generate new strains with combinations of mutations. cat-2 encodes tyrosine hydroxylase in C. elegans (Omura et al. 2012). The genetic knockouts allele was cat-2 (tm346). tdc-1 encodes tyrosine decarboxylase in C. elegans (Alkema et al. 2005). The genetic knockouts allele was tdc-1 (ok914). dop-3

encodes a D2-like receptor in C. elegans (Ezak and Ferkey 2010). The genetic knockouts allele was dop-3 (vs106). lgc-55 (tm2913) is the knockout of a tyramine- gated chloride channel in C. elegans (Pirri et al. 2009).

IIb. PCR and gel electrophoresis. Polymerase chain reaction (PCR) is used to determine the genotype of the C. elegans generated from crosses. In our PCR protocol, “outside” and “inside” primers are used to determine the genotype (see figure 9). The deletion for cat-2 (tm346) has a deletion in a coding exon at the genomic position II:260360..260748. tdc-1 (ok914) has a deletion in a coding exon at the genomic position II:8271885..8272513. dop-3 (vs106) has a 247 (bp) deletion in a coding exon at the genomic position X:6569334..6569581. lgc-55

(tm2913) has a 297 bp deletion in a coding exon at the genomic position V:

20029029..20029325 (see table 1 and 2).

21

Gene name Primer sequence cat-2 (tm346) Outside: GGG TTA TCA GTT CTC GGC C & CTG CAC TTG ATT CGA TTG CC Inside: CAT CAA TTC TCC ATA CGC CG & GTC AAG TAG TTT AAA CGG TCG tdc-1 (ok914) Outside: ATG GTT GGC CAT GTT GAG AT& AAA TGG TTT ACG GGC TTG G Inside: ATG GTT GGC CAT GTT GAG AT & GAT GAT GAG CTC AAC CAA ACC dop-3 (vs106) Outside: ACCTGGCAATGTCTGGGTAG & GACAGGGTCCCAACAGAAAA Inside: GACAGGGTCCCAACAGAAAA& TCCAAAAACTGCCATGGTG lgc-55 (tm2913) Outside: GGGCTGAAACTAGCTGCAAA& GACTCTGTCCATCGGGAAAA Inside: GGGCTGAAACTAGCTGCAAA& CAACCATTCTATGGGACAGTGA Table 1: Location of knockout (KO) alleles

Gene name N2 size (base pairs) Mutant size (base pairs) cat-2 (tm346) Outer: 2500 Outer: 2100 Inner: 1500 Inner: None tdc-1 (ok914) Outer: ~2700 Outer: ~2000 Inner: 800 Inner: None dop-3 (vs106) Outer: 716 Outer: 468 Inner: 434 Inner: None lgc-55 (tm2913) Outer: 849 Outer: 553 Inner: 670 Inner: None

Table 2: Product sizes

22

Figure 9. PCR process

IIc. Genetic crosses. Crosses in C. elegans are done by mating males and hermaphrodites (which are non-obligate self-fertilizing). A small food spot is put onto a plate to help confine the nematode to a small area to increase mating success. One larvae in stage 4 (L4) hermaphrodite is placed on the plate with five males of a different genotype. In twenty-four hours, the adults are transferred to another plate.

This process is repeated one more time, and then a plate with a ratio of progeny closest to 1:1 hermaphrodites to males is chosen. This is because offspring that are cross progeny are 1:1 males to hermaphrodites but self-progeny from hermaphrodites are

~100% hermaphrodites. PCR is performed to verify the identity of cross progeny; hermaphrodite self-progeny will have the same genotype as their parent versus those who are cross-progeny will have alleles from both the hermaphrodite and the male.

Once appropriate hermaphrodite cross-progeny have been identified, they may be selfed to give rise to different combinations of offspring including, for example mutants that are double homozygous for dop-3 (vs106) and cat-2 (tm346).

23 IId. Growth plates. Nematode growth media is made following the standard recipe. Streptomycin and nystatin (an anti-fungal) were added. Four hundred ul of OP-

50 (streptomycin resistant E. coli) grown in tryptone broth was spread over the entire surface of the 60 mm plate (Stiernagle 2006).

IIe. Thrashing. C. elegans hermaphrodites in larval stage 4 (L4) were picked and were grown for 16-18 hours at 20°C until they were young adults. Ninety-six well

plates were treated with 10% BSA, rinsed with ddH2O, and then dried. One hundred ul of saline, 20 ul 0.75 mg/ml tranylcypromine in saline, or 1.0 mg/ml phenelzine in saline was placed in each well. Saline was used as a control with wild type and mutant worms. Saline is made up of 20 mM of KH2PO4, 40 mM of Na2HPO4, 50 mM of NaCl,

and 8 mM of MgSO4 in H2O. Testing was conducted only if the temperature was 20-

25°C, and the humidity was between 20-30% (Hart 2006). To count thrashing a single hermaphrodite was placed in a well and was allowed to recover for 2 minutes. Body bends were then counted for twenty seconds. Body bends consist of an inflection past straight of the middle of the body. Each hermaphrodite was counted once, new individuals were placed in new wells for testing.

IIf. Pharyngeal pumping. C. elegans hermaphrodites in larval stage 4

(L4) were picked and were grown for 16-18 hours at 20°C until they were young adults. Worms were transferred onto new spread plates, where they were left to acclimatize for at least five minutes. For controls (no drugs), contractions of the posterior pharynx were counted for one minute only if the temperature was between

20-25°C, and the humidity was between 20-30%.

24 For MAOI tests, 200 ul of drug was spread onto a 60 mm plate and left to dry for ten minutes. Then 100 ul of dead OP-50 (bacteria food) was spread on top. Dead bacteria were used to prevent any metabolism of the drugs by living bacteria.

IIg. Data collection and evaluation. Ten worms were tested per strain per data point. Between three to five sets were conducted on different days for each strain.

All tests were conducted blind to reduce any bias in testing. Results were compared using a one-way ANOVA with post hoc Tukey’s HSD using .

25 III. Results.

IIIa. Previous results. A single mutation in the only identified MAO gene

(amx-2) decreased responses to MAOIs but did not eliminate them (Basu 2014) (see figure 10). Since the amx-2 null mutant was still sensitive to MAOIs, we predicted that there are additional targets for MAOIs. If these targets are other enzymes that metabolize MAs, then eliminating synthesis of MAs should eliminate sensitivity to

MAOIs. More specifically, the MAOI sensitivity of a strain lacking synthesis of a specific MA should not be altered if the strain also lacks receptors for that specific

MA. We tested this hypothesis with an epistasis analysis of specific MA synthesis and receptor mutants.

Figure 10: amx-2 mutant results (From Nanda Filkin)

We are currently testing genetic interactions of four genes with homologs in humans. The gene cat-2 encodes tyrosine hydroxylase, an required for synthesis of dopamine. tdc-1 encodes tyrosine decarboxylase, an enzyme essential for

26 synthesis of octopamine and tyramine. The gene dop-3 encodes a D2-like receptor. lgc-

55 encodes a tyramine-gated chloride channel receptor. Previous work in the lab found that most other strains with deletions in specific receptors showed changes similar to those seen in the synthesis mutants, making epistasis analysis impractical.

Earlier work in our lab found that both cat-2 and tdc-1 mutants are hypersensitive to both tranylcypromine and phenelzine; this may be due to MAOIs actions of enzymes that metabolize the remaining monoamines, including serotonin.

Surprisingly, mutants lacking all of the known dopamine receptors or tyramine receptors were not hypersensitive to these two MAOIs. When we looked at specific dopamine receptor mutants, we found mutants that lack the dop-3 receptor were resistant to tranylcypromine, but not phenelzine. Mutants lacking lgc-55 were found to be resistant to phenelzine, but not tranylcypromine. These results suggest that different

MAOIs may act on both MAO and MA receptors.

IIIb. Genetic crosses. Mutant strains were crossed to create double, triple, and quadruple mutants. All of the mutants were viable and had deletions, so they could be analyzed using PCR. Mutants used in our lab include knockouts for MA synthesis, cat-2 (tm346), and tdc-1 (ok914), and MA receptors, lgc-55 (tm2913), and dop-3

(vs106).

The gel in figure 11 shows mutants screened for the presence of deletions in dop-3. The outside primer binds outside of the deletion and gives a larger product in the wild type than in the deletion mutant. One of the inside primers binds DNA that is within the deletion, so it gives a product in the wild type but the mutant has no

27 product. The results with inside (I) or outside (O) primers show all strains to be homozygous mutant except strains E, and H, which shows both a short band with outside primers and the presence of a band with the inner primers, indicating they are cross-progeny that are heterozygous for dop-3. When such heterozygotes are allowed to make self-progeny, one quarter of their progeny will be homozygous mutant.

Figure 11: dop-3 PCR gel

28 IIIc. Saline control. Movement of wild type and mutant strains were observed in saline as controls. Worms were placed in saline in 96 well plates and left for two minutes to acclimatize, and then body bends were counted for 20 seconds. Three blind trials, each with ten young adult hermaphrodites, were conducted for each strain.

There was no significant difference in movement in saline between any of these strains

(see figures 12-14).

Saline Control 80 70 N2=wild type 60 50 D=no dopamine 40 synthesis 30 DR= no dop-3 20 dopamine

Thrasher Thrasher per 20 seconds 10 receptor 0 N2 (D) (DR) (D and DR) Figure 12: Saline control for dopamine mutants. Mean ± standard error of the mean for n=3 trials (10 individuals per trial) Saline Control 70

60 N2=wild type 50 T=no tyramine nor 40 octopamine 30 synthesis

20 TR= no lgc-55 tyramine receptor

Thrasher Thrasher per 20 seconds 10

0 N2 (T) (TR) (T and TR) Figure 13: Saline control for tyramine-octopamine mutants. Mean ± standard error of the mean for n=3 trials (10 individuals per trial)

29 Saline Control N2=wild type 80 70 D=no dopamine synthesis 60 50 T=no tyramine nor octopamine 40 synthesis 30 DR= no dop-3 20 dopamine Thrasher Thrasher per 20 seconds 10 receptor

0 TR= no lgc-55 N2 (DR and TR) (D and T) (D & DR & T) (D & T & TR) tyramine receptor Figure 14: Saline control for combinations of dopamine and tyramine-octopamine mutants. Mean ± standard error of the mean for n=3 blinded trials (10 individuals per trial)

IIId. Tranylcypromine. Tranylcypromine is a non-selective irreversible inhibitor of both MAO-A and MAO-B. For tranylcypromine, 0.75 mg/ml was determined to decrease movement in wild type worms by approximately 50% after two minutes. Five blind trials were conducted for each strain; note that there was more individual variation in thrashing rate in tranylcypromine than in saline (see figure 15-

17).

30 Figure 15: Saline versus tranylcypromine for dopamine mutants. Mean ± standard error of the mean for n=5 trials in 0.75 mg/ml tranylcypromine and n=3 trials in saline (10 individual nematodes per trial for each set for both saline and tranylcypromine)

For this concentration of tranylcypromine, dopamine synthesis (D) cat-2 knockouts have approximately normal sensitivity to tranylcypromine, dopamine receptor knockouts (DR) dop-3 are slightly but not significantly resistant to tranylcypromine. When both genes are knocked out (D & DR), they display normal sensitivity. This suggests that tranylcypromine effects on strains with mutations in the dop-3 dopamine receptor occur due to changes in dopamine levels.

31

Figure 16: Saline versus tranylcypromine for tryamine-octopamine mutants. Mean ± standard error of the mean for n=5 trials in 0.75 mg/ml tranylcypromine and n=3 trials in saline (10 individual nematodes per trial for each set for both saline and tranylcypromine). * denotes a p-value of <0.05 and ** denotes a p-value of <0.01 using a one-way ANOVA and posthoc Tukey’s HSD

Mutants that lacks tyramine and octopamine synthesis (T) tdc-1 are significantly hypersensitive to tranylcypromine (p<0.05), while mutants that lack the tyramine receptor (TR) lgc-55 are resistant to tranylcypromine (p<0.01) compared to wild type. When both genes are knocked out, mutants show normal sensitivity. (T) and

(TR) and (T & TR) were all significantly different from one another. This suggests that tranylcypromine has effects on the tyramine receptor that do not depend on tyramine levels alone.

32

Figure 17: Saline versus tranylcypromine for combinations of dopamine and tyramine-octopamine mutants. Mean ± standard error of the mean for n=5 trials in 0.75 mg/ml tranylcypromine and n=3 trials in saline (10 individual nematodes per trial for each set for both saline and tranylcypromine).* denotes a p-value of <0.05 and ** denotes a p-value of <0.01 using a one-way ANOVA and post-hoc Tukey’s HSD

We next examined mutants with defects in dopamine, tyramine, and octopamine synthesis. Strains that lack the tyramine receptor show more resistance to the drug than those with the receptor. There was no significant difference between (D

& T) and (D & DR & T). (D & T) and (D & T & TR) were significantly different

(p<0.01); (D & DR & T) and (D & T & TR) were significantly different (p<0.05).

Thus, these results support the hypothesis that there are MA-independent effects on the tyramine receptor but not the DOP-3 receptor (the test on the quadruple mutant lacking synthesis of dopamine and tyramine and octopamine and both the DOP-3 and

LGC-55 receptors was not completed due to time lost to the pandemic).

33 IIIe. Phenelzine. Phenelzine is a non-selective and irreversible inhibitor of both MAO-A and MAO-B. Tests were conducted to determine the proper concentration of phenelzine to decrease movement in wild type worms by ~50%. I observed significantly more variability in the response to this drug compared with tranylcypromine. This variability included variability over time-some worms initially decreased then later increased their thrashing rates (see table 3).

Worm # 0 min. 2 min. 5 min. 10 min. 1 0 0 0 0 2 77 54 0 0 3 69 64 58 68 4 86 37 5 0 5 54 0 0 59 6 63 75 0 14 7 67 0 0 0 8 0 3 0 0 9 0 0 0 0 10 56 0 0 0 Table 3: One trial of 1 mg/ml phenelzine using tdc-1 mutants

I determined that 1 mg/ml over 5 minutes gave the most consistent results.

Three blind trials were conducted with 10 worms each for the same mutants tested above with phenelzine. Note that the standard error of the mean for wild type was still quite large since the number of individual worms in the no-thrashing or fast-thrashing states varied from test to test. The “paralyzed” worms were tested by touching them and they were found to be responsive to touch.

34 1 mg/ml phenelzine

80 Saline 70 Phenelzine 60 N2=wild type 50 D=no 40 dopamine synthesis 30 20 DR= no dop-3 dopamine Thrshes Thrshes per 20 seconds 10 receptor 0 N2 (D) (DR) (D & DR)

Figure 18: Phenelzine results for dopamine related mutants. Mean ± standard error of the mean for n=3 trials (10 individuals per trial)

For this concentration of phenelzine, dopamine synthesis (D) cat-2 knockouts and dopamine receptor knockouts (DR) dop-3 were slightly but not significantly resistant to phenelzine. When both genes are knocked out (D & DR), they display normal inhibition as compared to the wild type. However, the large standard errors precluded the identification of any significant differences (see figure 18).

1 mg/ml phenelzine 80 Saline 70 Phenelzine 60 N2=wild type 50 T=no tyramine nor 40 octopamine 30 synthesis

20 TR= no lgc-55 tyramine receptor Thrashes Thrashes per 20 seconds 10 0 N2 (T) (TR) (T & TR)

Figure 19: Phenelzine results for tyramine-octopamine related knockouts. Mean ± standard error of the mean for n=3 trials (10 individuals per trial)

35 Mutants that lack tyramine and octopamine synthesis (T) tdc-1 exhibit approximately normal (but quite variable) sensitivity to phenelzine, while mutants that lack the tyramine receptor (TR), lgc-55, are resistant to phenelzine. When both genes are knocked out, mutants show approximately normal sensitivity. (T) and (TR) and (T

& TR) were all insignificantly different from one another. This suggests that phenelzine has no effect on the tyramine receptor. However, the large SEM for phenelzine, which reflects true variability in individual behavior, makes it more difficult to analyze the results and to detemrine if there are true diffferences between groups (see figure 19).

1 mg/ml phenelzine 80 Saline 70 Phenelzine 60 N2=wild type

50 D=no dopamine synthesis

40 T=no tyramine nor 30 octopamine synthesis 20 DR= no dop-3 dopamine receptor Thrashes Thrashes per 20 seconds 10 TR= no lgc-55 tyramine 0 receptor N2 (DR & TR) (D & T) (D & DR & T) (D & T & TR)

Figure 20: Combination of dopamine and tyramine-octopamine mutants. Mean ± standard error of the mean for n=3 trials (10 individuals per trial)

The receptor knockout for dopamine and tyramine shows slight resistance to phenelzine. However, there was no significance between any of the groups.

Unfortunatley, the large indivdal variation in response and large SEM in phenelzine makes it difficult to analyze the results. (see figuere 20). The results suggest that this

36 behavioral assay is are not a reliable test to determine effects of phenelzine on MA receptors. One possible complication is that phenelzine might induce changes in a dopamine-dependent behavior called swimming induced paralysis, which normally occurs after 10 minutes or more in solution (Robinson et al. 2019). If phenelzine is accelerating swimming-induced paralysis, this would make quantification of partial inhibition of motion (such as that seen with tranylcypromine) difficult.

To further analyze the data, I determined the distribution of thrashing values in phenelzine. Individuals were puts in bins of 0-20 thrashes, 21-40 thrashes, 41-60 thrashes, or 61+ thrashes per 20 seconds (see figure 21).

3 blind sets of 10 worms in 1 mg/ml phenzline after 5 minutes 15

10

5

Number of worms 0 0-20 21-40 41-60 61+ Thrashes

N2 T TR T & TR

Figure 21: Binning of tyramine-octopamine related mutants from all 3 blind sets of 10 worms each after 5 minutes in 1 mg/ml phenelzine

Due to the significant variability within groups, I next collected data using a larger sample size of 20 worms per mean. However, this was insufficient to normalize the data. I hypothesized that some of the variability in behavior might be because the worms were growing on somewhat contaminated food and this might have increased

37 the variability in behavior. Microbes are known to influence health or behavior of C. elegans (Porta-de-la-Riva et al 2012). To test this hypothesis, I bleached embryos, regrew them on new OP-50 E. coli, and tested them.

Wild type and tyramine related knockout mutants were selected for the bleaching test due to their especially high variability (see figure 22 and 23).

Pre bleaching (20 worms per strain) in 1mg/ml phenelzine after 5 minutes 20

15

10

5 Number of worms

0 0-20 21-40 41-60 61+ Thrahses

N2 -T -TR -T & -TR

Figure 22: Pre bleaching of 20 worms per strain of tyramine-octopamine related mutants after 5 minutes in 1 mg/ml phenelzine

38

Post bleaching (20 worms per strain) in 1mg/ml phenelzine after 5 minutes

20

15

10

5

Number for worms

0 0-20 21-40 41-60 61+ Thrashes

N2 -T -TR -T & -TR

Figure 23: pre bleaching from of 20 worms per strain of tyramine-octopamine related mutants after 5 minutes in 1 mg/ml phenelzine

After decontaminating the worms, the number of quickly-thrashing worms seemed to increase for all strains. However, all strains continued to show high individual variability in response, with many individuals in all strains showing temporary paralysis.

Due to the high individual variability in thrashing in phenelzine. I decided to examine another behavior, pharyngeal pumping in response to phenelzine. Trials were started but then stopped due to the closure of labs during the pandemic. Further studies with pharyngeal pumping or other behavioral tests will need to be done to determine a consistent behavioral test.

39 IV. Discussion, conclusions and future directions. C. elegans are a wonderful species to use to determine the effects of MAOI on specific genetic targets. MAO enzymes come in two isoforms in humans; MAO-A and MAO-B. MAO-A preferentially degrades epinephrine, norepinephrine, dopamine, and serotonin. MAO-

B preferentially degrades phenylethylamine and dopamine. MAO act in presynaptic cells to degrade leftover neurotransmitters to terminate a signal in cells. It has been hypothesized that MAOIs may also bind to some MA receptors due to the structural similarity of MAOIs to MA. If this is true, understanding the additional targets of

MAOIs may give physicians a better understanding of unexpected effects of different

MAOIs on the brain and behavior.

From my research results it is now clearer that there may be MA-independent effects of MAOIs on specific MA receptors. Tranylcypromine is a non-selective, irreversible inhibitor of MAO-A and MAO-B. Movement assays were an appropriate test to conduct to determine MA-independent effects due to regulation of movement by many different neurotransmitters in C. elegans. We chose to study the effects of a concentration of tranylcypromine (0.75 mg/ml) that lowered thrashing by ~50%.

Effects of tranylcypromine on movement were consistent with tranylcypromine acting on MAO, and potentially other MA metabolizing enzymes to increase dopamine levels and indirectly change the response in dopamine receptor mutants. On the other hand, my results suggest tranylcypromine has effects on the tyramine receptor that are independent of tyramine levels. It is important to note that tranylcypromine induced

40 partial slowing of movement, unlike the bouts of paralysis seen with phenelzine,

(which may reflect activation of dopamine dependent swimming induced paralysis).

Phenelzine was the second MAOI studied, first using thrashing tests then with the intention of performing pharyngeal pumping tests (before the university closure of labs). Phenelzine is a non-selective and irreversible inhibitor of MAO. Conclusive results were limited since individual variation in thrashing was much higher in phenelzine than in tranylcypromine. After bleaching worms to remove possible microbe contaminants, there were higher average thrashing rates which was expected, but the variability was still too high and significance between groups could not be readily evaluated. This variability may arise from separate effects of phenelzine on average thrashing rates and induction of swimming induced paralysis. Analyzing data using larger batches of worms (n=20 vs. n=10 per data set), still gave highly variable results. Further studies will need to be performed for phenelzine.

Recently the quadruple deletion mutant cat-2 (tm346) tdc-1 (ok914); lgc-55

(tm2913); dop-3 (vs106) was generated in the lab. Testing of thrashing in this mutant was disrupted due to the current pandemic. We plan to start the testing of the quadruple deletion mutant as soon as the campus reopens.

In the future, we plan to continue testing mutants with defects in both MA synthesis and receptors. We also hope to test receptor mutants in strains with all MA synthesis disrupted, including that of serotonin. We will test the mutant worms in different concentrations of drugs for changes in thrashing and pharyngeal pumping.

We plan to extend these studies to more MAOIs to gain knowledge on the possible

41 targets of other MAOIs. We also hope to identify which specific receptors are being targeted by each of these MAOI.

I hope these results will allow for a better understanding of the effects MAOI have on a molecular level to better increase the understanding of these drugs in a clinical aspect.

There are also biochemical approaches to our research, including looking at crystallography structures of the receptor proteins and seeing if there are predicted drug interactions within the of the receptor. This is a topic I hope to work on next year as a side project for my Masters in Chemistry through Ohio University specifically in the field of biochemistry.

42 V. References.

1. Alkema, M. J., Hunter-Ensor, M., Ringstad, N., and Horvitz, H. R. (2005). Tyramine Functions Independently of Octopamine in the Caenorhabditis elegans Nervous System. Neuron, 46(2), 247–260. https://doi.org/10.1016/j.neuron.2005.02.024

2. Altun, Z. F., and Hall, D. H. (2009). Alimentary System, Pharynx. In WormAtlas. doi:10.3908/wormatlas.1.3

3. Basu, R. (2014). Investigating Domain Containing Genes - amx-1 and amx-2 - in Caenorhabditis elegans. (Electronic Dissertation). https://etd.ohiolink.edu/

4. Bauknecht, P., and Jékely, G. (2017). Ancient Coexistence of Norepinephrine, Tyramine, and Octopamine Signaling in Bilaterians. BMC biology, 15(1), 6. https://doi.org/10.1186/s12915-016-0341-7

5. Beaulieu, J. M., Espinoza, S., and Gainetdinov, R. R. (2015). Dopamine Receptors - IUPHAR Review 13. British Journal of Pharmacology, 172(1), 1– 23. https://doi.org/10.1111/bph.12906

6. Broadley, K. J. (2010). The Vascular Effects of Trace Amines and . Pharmacology and Therapeutics, 125 (3), 363-375. doi: 10.1016/j.pharmthera

7. Chase, D. L., and Koelle, M. R. (2007). Biogenic Amine Neurotransmitters in C. elegans. WormBook: the online review of C. elegans biology, 1–15. https://doi.org/10.1895/wormbook.1.132.1

8. Chen, K., Shih, J.C. (1997). and B: Structure, Function, and Behavior. Advanced Pharmacology, 42, 292–296. doi:10.1016/s1054-3589(08)60747-4

9. Corsi, A. K. (2006). A Biochemist's Guide to Caenorhabditis elegans Analytical Biochemistry, 359(1), 1–17. https://doi.org/10.1016/j.ab.2006.07.033

10. Corsi, A.K., Wightman, B., Chalfie, M. (2005). A Transparent Window into Biology: A Primer on Caenorhabditis elegans. In: WormBook: The Online Review of C. elegans Biology. Pasadena (CA): WormBook. Figure 3, [C. elegans anatomy. Major anatomical...]. Available from: https://www.ncbi.nlm.nih.gov/books/NBK299460/ figure/celegansintro_figure3/

43

11. De Rosa, M.J., Veuthey, T., Florman, J., Grant, J., Blanco, M.G., Andersen, N., Donnelly, J., Rayes, D., and Alkema, M.J. (2019). The Flight Response Impairs Cytoprotective Mechanisms by Activating the Insulin Pathway. Nature 573, 135–138. https://doi.org/10.1038/s41586-019-1524-5

12. Duerr, J. S., Frisby, D. L., Gaskin, J., Duke, A., Asermely, K., Huddleston, D., Eiden, L. E., and Rand, J. B. (1999). The cat-1 Gene of Caenorhabditis elegans Encodes a Vesicular Monoamine Transporter Required for Specific Monoamine-Dependent Behaviors. The Journal of Neuroscience: the official journal of the Society for Neuroscience, 19(1), 72–84. https://doi.org/10.1523/JNEUROSCI.19-01-00072.1999

13. Engleman, E. A., Katner, S. N., & Neal-Beliveau, B. S. (2016). Caenorhabditis elegans as a Model to Study the Molecular and Genetic Mechanisms of Drug Addiction. Progress in Molecular Biology and Translational Science, 137, 229–252. https://doi.org/10.1016/bs.pmbts.2015.10.019

14. Ezak, M. J., and Ferkey, D. M. (2010). The C. elegans D2-like Dopamine Receptor DOP-3 Decreases Behavioral Sensitivity to the Olfactory Stimulus 1- octanol. PloS one, 5(3), e9487. https://doi.org/10.1371/journal.pone.0009487

15. Fang-Yen, C., Gabel, C. V., Samuel, A. D., Bargmann, C. I., and Avery, L. (2012). Laser Microsurgery in Caenorhabditis elegans. Methods in Cell Biology, 107, 177–206. https://doi.org/10.1016/B978-0-12-394620-1.00006-0

16. Hart, A. C, ed. Behavior (2006). Wormbook, ed. The C. elegans Research Community, Wormbook, doi/10.1895/wormbook.1.87.1, http://www.wormbook.org

17. Lawal, H. O., and Krantz, D. E. (2013). SLC18: Vesicular Neurotransmitter Transporters for Monoamines and Acetylcholine. Molecular aspects of medicine, 34(2-3), 360–372. https://doi.org/10.1016/j.mam.2012.07.005

18. Lindseth, G., Helland, B., and Caspers, J. (2015). The Effects of Dietary Tryptophan on Affective Disorders. Archives of Psychiatric Nursing, 29(2), 102–107. https://doi.org/10.1016/j.apnu.2014.11.008

19. Maulik, M., Mitra, S., Bult-Ito, A., Taylor, B. E., and Vayndorf, E.M. (2017) Behavioral Phenotyping and Pathological Indicators of Parkinson's Disease in C. elegans Models. Frontiers in Genetics 8:77. doi:10.3389/fgene.2017.00077

44 20. Omura, D. T., Clark, D. A., Samuel, A. D., and Horvitz, H. R. (2012). Dopamine Signaling is Essential for Precise Rates of Locomotion by C. elegans. PloS one, 7(6), e38649. https://doi.org/10.1371/journal.pone.0038649

21. Pei, Y., Asif-Malik, A., and Canales, J. J. (2016). Trace Amines and the Trace Amine-Associated Receptor 1: Pharmacology, Neurochemistry, and Clinical Implications. Frontiers in Neuroscience, 10, 148. https://doi.org/10.3389/fnins.2016.00148

22. Pinder R.M. (2007). New or More of the Same?. Neuropsychiatric Disease and Treatment, 3(5), 519–520.

23. Pirri, J. K., McPherson, A. D., Donnelly, J. L., Francis, M. M., and Alkema, M. J. (2009). A Tyramine-Gated Chloride Channel Coordinates Distinct Motor Programs of a Caenorhabditis elegans Escape Response. Neuron, 62(4), 526– 538. https://doi.org/10.1016/j.neuron.2009.04.013

24. Porta-de-la-Riva, M., Fontrodona, L., Villanueva, A., and Cerón, J. (2012). Basic Caenorhabditis elegans Methods: Synchronization and Observation. Journal of Visualized Experiments: JoVE, (64), e4019. https://doi.org/10.3791/4019

25. Rand, J.B., and Nonet, M.L. (1997). Neurotransmitter Assignments for Specific Neurons. In: C. elegans II (Riddle, Blumenthal, Meyer & Priess, editors) pp 1049-1052. Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, NY.

26. Robinson, S.B., Refai, O., Hardaway, J.A., Sturgeon, S., Popay, T., Bermingham, D.P., Freeman, P., Wright, J., and Blakely, R.D. (2019). Dopamine-Dependent, Swimming-Induced Paralysis Arises as a Consequence of Loss of Function Mutations in the RUNX Factor RNT-1. PloS one, 14(5): e0216417. https://doi.org/10.1371/journal.pone.0216417

27. Rodríguez, M. Saura, J., Billett, E., Finch, C., and Mahy, N. (2001). Cellular Localization of Monoamine Oxidase A and B in Human Tissues Outside of the Central Nervous System. Cell Tissue Research 304, 215-220. https://doi.org/10.1007/s004410100361

28. Sarkar, B., Das, A.K., Arumugam, S., Kaushalya, S.K., Bandyopadhyay, A., Balaji, J., and Maiti, S. (2012) The Dynamics of Somatic Exocytosis in Monoaminergic Neurons. Frontiers in Physiology, 3:414. doi: 10.3389/fphys.2012.00414

45 29. Sawin, E. R., Ranganathan, R., and Horvitz, H. R. (2000). C. elegans Locomotory Rate is Modulated by the Environment Through a Dopaminergic Pathway and by Experience Through a Serotonergic Pathway. Neuron, 26(3), 619–631. https://doi.org/10.1016/s0896-6273(00)81199-x

30. Schmid, T., Snoek, L. B., Fröhli, E., Bent, M. L. V. D., Kammenga, J., and Hajnal, A. (2015). Systemic Regulation of RAS/MAPK Signaling by the Serotonin Metabolite 5-HIAA. PloS Genetics, 11(5). doi: 10.1371/journal.pgen.1005236

31. Sheffler, Z.M., Pillarisetty, L.S. Physiology, Neurotransmitters. [Updated 2019 Jun 4]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2020 Jan-. Available from: https://www.ncbi.nlm.nih.gov/books/NBK539894/

32. Song, B. M., and Avery, L. (2012). Serotonin Activates Overall Feeding by Activating Two Separate Neural Pathways in Caenorhabditis elegans. The Journal of Neuroscience: the official journal of the Society for Neuroscience, 32(6), 1920–1931. https://doi.org/10.1523/JNEUROSCI.2064- 11.2012

33. Stiernagle, T. (2006). Maintenance of C. elegans, WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.101.1, http://www.wormbook.org.

34. Swallow, J. G., Bubak, A. N., Grace, J. L., and Guest Editors (2016). The Role of Monoamines in Modulating Behavior. Current Zoology, 62(3), 253–255. https://doi.org/10.1093/cz/zow046

35. Toga, A. W., Clark, K. A., Thompson, P. M., Shattuck, D. W., and Van Horn, J. D. (2012). Mapping the Human Connectome. Neurosurgery, 71(1), 1–5. https://doi.org/10.1227/NEU.0b013e318258e9ff

36. Tong, J., Meyer, J. H., Furukawa, Y., Boileau, I., Chang, L. J., Wilson, A. A., Houle, S., & Kish, S. J. (2013). Distribution of Monoamine Oxidase Proteins in Human Brain: Implications for Brain Imaging Studies. Journal of Cerebral Blood Flow and Metabolism: official journal of the International Society of Cerebral Blood Flow and Metabolism, 33(6), 863–871. https://doi.org/10.1038/jcbfm.2013.19

37. Trojanowski, N. F., Raizen, D. M., and Fang-Yen, C. (2016). Pharyngeal Pumping in Caenorhabditis elegans Depends on Tonic and Phasic Signaling from the Nervous System. Scientific Reports, 6, 22940. https://doi.org/10.1038/srep22940

46 38. Valenzuela, C. F., Puglia, M. P., and Zucca, S. (2011). Focus on: Neurotransmitter Systems. Alcohol Research & Health: the journal of the National Institute on Alcohol Abuse and Alcoholism, 34(1), 106–120.

39. Wang, D., Yu, Y., Li, Y., Wang, Y., and Wang, D. (2014). Dopamine Receptors Antagonistically Regulate Behavioral Choice Between Conflicting Alternatives in C. elegans. PloS one, 9(12), e115985. https://doi.org/10.1371/journal.pone.0115985

47